Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Secretory Phospholipases A2 in Durum Wheat (Triticum durum Desf.): Gene Expression, Enzymatic Activity, and Relation to Drought Stress Adaptation

Identifieur interne : 000F80 ( Pmc/Curation ); précédent : 000F79; suivant : 000F81

Secretory Phospholipases A2 in Durum Wheat (Triticum durum Desf.): Gene Expression, Enzymatic Activity, and Relation to Drought Stress Adaptation

Auteurs : Angelo Verlotta ; Maria T. Liberatore ; Luigi Cattivelli ; Daniela Trono

Source :

RBID : PMC:3634499

Abstract

Phospholipases A2 (PLA2s) are known to mediate signaling cascades during plant growth and development, as well as biotic and abiotic stress responses. In this context, the present study provides extensive characterization of specific PLA2s in durum wheat, and assesses their involvement in durum wheat response to drought stress. In durum wheat leaves, four full-length expressed sequences encoding putative PLA2s were isolated and characterized as belonging to the class of secretory PLA2s (sPLA2s): TdsPLA2I, TdsPLA2II, TdsPLA2III and TdsPLA2IV. PLA2 activity was also detected, the characteristics of which resemble those of previously characterized plant sPLA2s: strong preference for phospholipids; requirement for millimolar Ca2+ concentrations; optimal activity at basic pH; heat stability; and inhibition by the reducing agent dithiothreitol. With drought stress imposed at both the vegetative and reproductive stages, accumulation of TdsPLA2I and TdsPLA2III transcripts, and to a lesser extent of TdsPLA2IV transcript, paralleled increased PLA2 activity; both transcript levels and enzymatic activity decreased as a consequence of stress recovery. Consistently, free fatty acid analysis of drought-stressed leaves revealed increased linoleate, linolenate and palmitate contents, which were reversed by plant re-watering. Overall, these findings strongly suggest that there are inducible sPLA2 isoforms in durum wheat that have roles in orchestrating the plant response to drought stress.


Url:
DOI: 10.3390/ijms14035146
PubMed: 23455473
PubMed Central: 3634499

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:3634499

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Secretory Phospholipases A
<sub>2</sub>
in Durum Wheat (
<italic>Triticum durum</italic>
Desf.): Gene Expression, Enzymatic Activity, and Relation to Drought Stress Adaptation</title>
<author>
<name sortKey="Verlotta, Angelo" sort="Verlotta, Angelo" uniqKey="Verlotta A" first="Angelo" last="Verlotta">Angelo Verlotta</name>
</author>
<author>
<name sortKey="Liberatore, Maria T" sort="Liberatore, Maria T" uniqKey="Liberatore M" first="Maria T." last="Liberatore">Maria T. Liberatore</name>
</author>
<author>
<name sortKey="Cattivelli, Luigi" sort="Cattivelli, Luigi" uniqKey="Cattivelli L" first="Luigi" last="Cattivelli">Luigi Cattivelli</name>
</author>
<author>
<name sortKey="Trono, Daniela" sort="Trono, Daniela" uniqKey="Trono D" first="Daniela" last="Trono">Daniela Trono</name>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">23455473</idno>
<idno type="pmc">3634499</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3634499</idno>
<idno type="RBID">PMC:3634499</idno>
<idno type="doi">10.3390/ijms14035146</idno>
<date when="2013">2013</date>
<idno type="wicri:Area/Pmc/Corpus">000F81</idno>
<idno type="wicri:Area/Pmc/Curation">000F80</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Secretory Phospholipases A
<sub>2</sub>
in Durum Wheat (
<italic>Triticum durum</italic>
Desf.): Gene Expression, Enzymatic Activity, and Relation to Drought Stress Adaptation</title>
<author>
<name sortKey="Verlotta, Angelo" sort="Verlotta, Angelo" uniqKey="Verlotta A" first="Angelo" last="Verlotta">Angelo Verlotta</name>
</author>
<author>
<name sortKey="Liberatore, Maria T" sort="Liberatore, Maria T" uniqKey="Liberatore M" first="Maria T." last="Liberatore">Maria T. Liberatore</name>
</author>
<author>
<name sortKey="Cattivelli, Luigi" sort="Cattivelli, Luigi" uniqKey="Cattivelli L" first="Luigi" last="Cattivelli">Luigi Cattivelli</name>
</author>
<author>
<name sortKey="Trono, Daniela" sort="Trono, Daniela" uniqKey="Trono D" first="Daniela" last="Trono">Daniela Trono</name>
</author>
</analytic>
<series>
<title level="j">International Journal of Molecular Sciences</title>
<idno type="eISSN">1422-0067</idno>
<imprint>
<date when="2013">2013</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Phospholipases A
<sub>2</sub>
(PLA
<sub>2</sub>
s) are known to mediate signaling cascades during plant growth and development, as well as biotic and abiotic stress responses. In this context, the present study provides extensive characterization of specific PLA
<sub>2</sub>
s in durum wheat, and assesses their involvement in durum wheat response to drought stress. In durum wheat leaves, four full-length expressed sequences encoding putative PLA
<sub>2</sub>
s were isolated and characterized as belonging to the class of secretory PLA
<sub>2</sub>
s (sPLA
<sub>2</sub>
s):
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>I</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>II</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>III</italic>
and
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>IV</italic>
. PLA
<sub>2</sub>
activity was also detected, the characteristics of which resemble those of previously characterized plant sPLA
<sub>2</sub>
s: strong preference for phospholipids; requirement for millimolar Ca
<sup>2+</sup>
concentrations; optimal activity at basic pH; heat stability; and inhibition by the reducing agent dithiothreitol. With drought stress imposed at both the vegetative and reproductive stages, accumulation of
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>I</italic>
and
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>III</italic>
transcripts, and to a lesser extent of
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>IV</italic>
transcript, paralleled increased PLA
<sub>2</sub>
activity; both transcript levels and enzymatic activity decreased as a consequence of stress recovery. Consistently, free fatty acid analysis of drought-stressed leaves revealed increased linoleate, linolenate and palmitate contents, which were reversed by plant re-watering. Overall, these findings strongly suggest that there are inducible sPLA
<sub>2</sub>
isoforms in durum wheat that have roles in orchestrating the plant response to drought stress.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Munnik, T" uniqKey="Munnik T">T. Munnik</name>
</author>
<author>
<name sortKey="Testerink, C" uniqKey="Testerink C">C. Testerink</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, G" uniqKey="Wang G">G. Wang</name>
</author>
<author>
<name sortKey="Ryu, S" uniqKey="Ryu S">S. Ryu</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schaloske, R H" uniqKey="Schaloske R">R.H. Schaloske</name>
</author>
<author>
<name sortKey="Dennis, E A" uniqKey="Dennis E">E.A. Dennis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Scherer, G F E" uniqKey="Scherer G">G.F.E. Scherer</name>
</author>
<author>
<name sortKey="Ryu, S B" uniqKey="Ryu S">S.B. Ryu</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X. Wang</name>
</author>
<author>
<name sortKey="Matos, A R" uniqKey="Matos A">A.R. Matos</name>
</author>
<author>
<name sortKey="Heitz, T" uniqKey="Heitz T">T. Heitz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="St Hl, U" uniqKey="St Hl U">U. Ståhl</name>
</author>
<author>
<name sortKey="Ek, B" uniqKey="Ek B">B. Ek</name>
</author>
<author>
<name sortKey="Stymne, S" uniqKey="Stymne S">S. Stymne</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="St Hl, U" uniqKey="St Hl U">U. Ståhl</name>
</author>
<author>
<name sortKey="Lee, M" uniqKey="Lee M">M. Lee</name>
</author>
<author>
<name sortKey="Sjodahl, S" uniqKey="Sjodahl S">S. Sjodahl</name>
</author>
<author>
<name sortKey="Archer, D" uniqKey="Archer D">D. Archer</name>
</author>
<author>
<name sortKey="Cellini, F" uniqKey="Cellini F">F. Cellini</name>
</author>
<author>
<name sortKey="Ek, B" uniqKey="Ek B">B. Ek</name>
</author>
<author>
<name sortKey="Iannacone, N" uniqKey="Iannacone N">N. Iannacone</name>
</author>
<author>
<name sortKey="Mackenzie, D" uniqKey="Mackenzie D">D. MacKenzie</name>
</author>
<author>
<name sortKey="Semeraro, L" uniqKey="Semeraro L">L. Semeraro</name>
</author>
<author>
<name sortKey="Tramontano, E" uniqKey="Tramontano E">E. Tramontano</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Domingues, S J S" uniqKey="Domingues S">S.J.S. Domingues</name>
</author>
<author>
<name sortKey="Souza, T F" uniqKey="Souza T">T.F. Souza</name>
</author>
<author>
<name sortKey="Soares, A M S" uniqKey="Soares A">A.M.S. Soares</name>
</author>
<author>
<name sortKey="Jacinto, T" uniqKey="Jacinto T">T. Jacinto</name>
</author>
<author>
<name sortKey="Machado, O L T" uniqKey="Machado O">O.L.T. Machado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, J Y" uniqKey="Kim J">J.Y. Kim</name>
</author>
<author>
<name sortKey="Chung, Y S" uniqKey="Chung Y">Y.S. Chung</name>
</author>
<author>
<name sortKey="Ok, S H" uniqKey="Ok S">S.H. Ok</name>
</author>
<author>
<name sortKey="Lee, S G" uniqKey="Lee S">S.G. Lee</name>
</author>
<author>
<name sortKey="Chung, W I" uniqKey="Chung W">W.I. Chung</name>
</author>
<author>
<name sortKey="Kim, I Y" uniqKey="Kim I">I.Y. Kim</name>
</author>
<author>
<name sortKey="Shin, J S" uniqKey="Shin J">J.S. Shin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lee, H Y" uniqKey="Lee H">H.Y. Lee</name>
</author>
<author>
<name sortKey="Bahn, S C" uniqKey="Bahn S">S.C. Bahn</name>
</author>
<author>
<name sortKey="Shin, J S" uniqKey="Shin J">J.S. Shin</name>
</author>
<author>
<name sortKey="Hwang, I" uniqKey="Hwang I">I. Hwang</name>
</author>
<author>
<name sortKey="Back, K" uniqKey="Back K">K. Back</name>
</author>
<author>
<name sortKey="Doelling, J H" uniqKey="Doelling J">J.H. Doelling</name>
</author>
<author>
<name sortKey="Ryu, S B" uniqKey="Ryu S">S.B. Ryu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mariani, M E" uniqKey="Mariani M">M.E. Mariani</name>
</author>
<author>
<name sortKey="Villarreal, M A" uniqKey="Villarreal M">M.A. Villarreal</name>
</author>
<author>
<name sortKey="Cheung, F" uniqKey="Cheung F">F. Cheung</name>
</author>
<author>
<name sortKey="Leiva, E P" uniqKey="Leiva E">E.P. Leiva</name>
</author>
<author>
<name sortKey="Madoery, R R" uniqKey="Madoery R">R.R. Madoery</name>
</author>
<author>
<name sortKey="Fidelio, G D" uniqKey="Fidelio G">G.D. Fidelio</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Matos, A R" uniqKey="Matos A">A.R. Matos</name>
</author>
<author>
<name sortKey="Pham Thi, A T" uniqKey="Pham Thi A">A.-T. Pham-Thi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Reina Pinto, J J" uniqKey="Reina Pinto J">J.J. Reina-Pinto</name>
</author>
<author>
<name sortKey="Voisin, D" uniqKey="Voisin D">D. Voisin</name>
</author>
<author>
<name sortKey="Kurdyukov, S" uniqKey="Kurdyukov S">S. Kurdyukov</name>
</author>
<author>
<name sortKey="Faust, A" uniqKey="Faust A">A. Faust</name>
</author>
<author>
<name sortKey="Haslam, R P" uniqKey="Haslam R">R.P. Haslam</name>
</author>
<author>
<name sortKey="Michaelson, L V" uniqKey="Michaelson L">L.V. Michaelson</name>
</author>
<author>
<name sortKey="Efremova, N" uniqKey="Efremova N">N. Efremova</name>
</author>
<author>
<name sortKey="Franke, B" uniqKey="Franke B">B. Franke</name>
</author>
<author>
<name sortKey="Schreiber, L" uniqKey="Schreiber L">L. Schreiber</name>
</author>
<author>
<name sortKey="Napier, J A" uniqKey="Napier J">J.A. Napier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gustavsson, M H" uniqKey="Gustavsson M">M.H. Gustavsson</name>
</author>
<author>
<name sortKey="Sommarin, M" uniqKey="Sommarin M">M. Sommarin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Holk, A" uniqKey="Holk A">A. Holk</name>
</author>
<author>
<name sortKey="Rietz, S" uniqKey="Rietz S">S. Rietz</name>
</author>
<author>
<name sortKey="Zahn, M" uniqKey="Zahn M">M. Zahn</name>
</author>
<author>
<name sortKey="Quader, H" uniqKey="Quader H">H. Quader</name>
</author>
<author>
<name sortKey="Scherer, G F E" uniqKey="Scherer G">G.F.E. Scherer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rietz, S" uniqKey="Rietz S">S. Rietz</name>
</author>
<author>
<name sortKey="Dermendjiev, G" uniqKey="Dermendjiev G">G. Dermendjiev</name>
</author>
<author>
<name sortKey="Oppermann, E" uniqKey="Oppermann E">E. Oppermann</name>
</author>
<author>
<name sortKey="Tafesse, F G" uniqKey="Tafesse F">F.G. Tafesse</name>
</author>
<author>
<name sortKey="Effendi, Y" uniqKey="Effendi Y">Y. Effendi</name>
</author>
<author>
<name sortKey="Holk, A" uniqKey="Holk A">A. Holk</name>
</author>
<author>
<name sortKey="Parkera, J E" uniqKey="Parkera J">J.E. Parkera</name>
</author>
<author>
<name sortKey="Teige, M" uniqKey="Teige M">M. Teige</name>
</author>
<author>
<name sortKey="Scherer, G F E" uniqKey="Scherer G">G.F.E. Scherer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, M" uniqKey="Li M">M. Li</name>
</author>
<author>
<name sortKey="Bahn, S C" uniqKey="Bahn S">S.C. Bahn</name>
</author>
<author>
<name sortKey="Guo, L" uniqKey="Guo L">L. Guo</name>
</author>
<author>
<name sortKey="Musgrave, W" uniqKey="Musgrave W">W. Musgrave</name>
</author>
<author>
<name sortKey="Berg, H" uniqKey="Berg H">H. Berg</name>
</author>
<author>
<name sortKey="Welti, R" uniqKey="Welti R">R. Welti</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lee, H Y" uniqKey="Lee H">H.Y. Lee</name>
</author>
<author>
<name sortKey="Bahn, S C" uniqKey="Bahn S">S.C. Bahn</name>
</author>
<author>
<name sortKey="Kang, Y M" uniqKey="Kang Y">Y.-M. Kang</name>
</author>
<author>
<name sortKey="Lee, K H" uniqKey="Lee K">K.H. Lee</name>
</author>
<author>
<name sortKey="Kim, H J" uniqKey="Kim H">H.J. Kim</name>
</author>
<author>
<name sortKey="Noh, E K" uniqKey="Noh E">E.K. Noh</name>
</author>
<author>
<name sortKey="Palta, J P" uniqKey="Palta J">J.P. Palta</name>
</author>
<author>
<name sortKey="Shin, J S" uniqKey="Shin J">J.S. Shin</name>
</author>
<author>
<name sortKey="Ryu, S B" uniqKey="Ryu S">S.B. Ryu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seo, J" uniqKey="Seo J">J. Seo</name>
</author>
<author>
<name sortKey="Lee, H Y" uniqKey="Lee H">H.Y. Lee</name>
</author>
<author>
<name sortKey="Choi, H" uniqKey="Choi H">H. Choi</name>
</author>
<author>
<name sortKey="Choi, Y" uniqKey="Choi Y">Y. Choi</name>
</author>
<author>
<name sortKey="Lee, Y" uniqKey="Lee Y">Y. Lee</name>
</author>
<author>
<name sortKey="Kim, Y W" uniqKey="Kim Y">Y.-W. Kim</name>
</author>
<author>
<name sortKey="Ryu, S B" uniqKey="Ryu S">S.B. Ryu</name>
</author>
<author>
<name sortKey="Lee, Y" uniqKey="Lee Y">Y. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lee, O R" uniqKey="Lee O">O.R. Lee</name>
</author>
<author>
<name sortKey="Kim, S J" uniqKey="Kim S">S.J. Kim</name>
</author>
<author>
<name sortKey="Kim, H J" uniqKey="Kim H">H.J. Kim</name>
</author>
<author>
<name sortKey="Hong, J K" uniqKey="Hong J">J.K. Hong</name>
</author>
<author>
<name sortKey="Ryu, S B" uniqKey="Ryu S">S.B. Ryu</name>
</author>
<author>
<name sortKey="Lee, S H" uniqKey="Lee S">S.H. Lee</name>
</author>
<author>
<name sortKey="Ganguli, A" uniqKey="Ganguli A">A. Ganguli</name>
</author>
<author>
<name sortKey="Cho, H T" uniqKey="Cho H">H.-T. Cho</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, H J" uniqKey="Kim H">H.J. Kim</name>
</author>
<author>
<name sortKey="Ok, S H" uniqKey="Ok S">S.H. Ok</name>
</author>
<author>
<name sortKey="Bahn, S C" uniqKey="Bahn S">S.C. Bahn</name>
</author>
<author>
<name sortKey="Jang, J" uniqKey="Jang J">J. Jang</name>
</author>
<author>
<name sortKey="Oh, S A" uniqKey="Oh S">S.A. Oh</name>
</author>
<author>
<name sortKey="Park, S K" uniqKey="Park S">S.K. Park</name>
</author>
<author>
<name sortKey="Twell, D" uniqKey="Twell D">D. Twell</name>
</author>
<author>
<name sortKey="Ryu, S B" uniqKey="Ryu S">S.B. Ryu</name>
</author>
<author>
<name sortKey="Shin, J S" uniqKey="Shin J">J.S. Shin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jung, J" uniqKey="Jung J">J. Jung</name>
</author>
<author>
<name sortKey="Kumar, K" uniqKey="Kumar K">K. Kumar</name>
</author>
<author>
<name sortKey="Lee, H Y" uniqKey="Lee H">H.Y. Lee</name>
</author>
<author>
<name sortKey="Park, Y" uniqKey="Park Y">Y. Park</name>
</author>
<author>
<name sortKey="Cho, H T" uniqKey="Cho H">H.-T. Cho</name>
</author>
<author>
<name sortKey="Ryu, S B" uniqKey="Ryu S">S.B. Ryu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Heinze, M" uniqKey="Heinze M">M. Heinze</name>
</author>
<author>
<name sortKey="Herre, M" uniqKey="Herre M">M. Herre</name>
</author>
<author>
<name sortKey="Massalski, C" uniqKey="Massalski C">C. Massalski</name>
</author>
<author>
<name sortKey="Hermann, I" uniqKey="Hermann I">I. Hermann</name>
</author>
<author>
<name sortKey="Conrad, U" uniqKey="Conrad U">U. Conrad</name>
</author>
<author>
<name sortKey="Roos, W" uniqKey="Roos W">W Roos</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ryu, S B" uniqKey="Ryu S">S.B. Ryu</name>
</author>
<author>
<name sortKey="Lee, H Y" uniqKey="Lee H">H.Y. Lee</name>
</author>
<author>
<name sortKey="Hwang, I W" uniqKey="Hwang I">I.W. Hwang</name>
</author>
<author>
<name sortKey="Jiwan, P P" uniqKey="Jiwan P">P.P. Jiwan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Singh, A" uniqKey="Singh A">A. Singh</name>
</author>
<author>
<name sortKey="Baranwal, V" uniqKey="Baranwal V">V. Baranwal</name>
</author>
<author>
<name sortKey="Shankar, A" uniqKey="Shankar A">A. Shankar</name>
</author>
<author>
<name sortKey="Kanwar, P" uniqKey="Kanwar P">P. Kanwar</name>
</author>
<author>
<name sortKey="Ranjan, R" uniqKey="Ranjan R">R. Ranjan</name>
</author>
<author>
<name sortKey="Yadav, S" uniqKey="Yadav S">S. Yadav</name>
</author>
<author>
<name sortKey="Pandey, A" uniqKey="Pandey A">A. Pandey</name>
</author>
<author>
<name sortKey="Kapoor, S" uniqKey="Kapoor S">S. Kapoor</name>
</author>
<author>
<name sortKey="Pandey, G K" uniqKey="Pandey G">G.K. Pandey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Elias, E M" uniqKey="Elias E">E.M. Elias</name>
</author>
<author>
<name sortKey="Manthey, F A" uniqKey="Manthey F">F.A. Manthey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mansfeld, J" uniqKey="Mansfeld J">J. Mansfeld</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, H C" uniqKey="Yang H">H.-C. Yang</name>
</author>
<author>
<name sortKey="Mosior, M" uniqKey="Mosior M">M. Mosior</name>
</author>
<author>
<name sortKey="Johnson, C A" uniqKey="Johnson C">C.A. Johnson</name>
</author>
<author>
<name sortKey="Chen, Y" uniqKey="Chen Y">Y. Chen</name>
</author>
<author>
<name sortKey="Dennis, E A" uniqKey="Dennis E">E.A. Dennis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Winget, J M" uniqKey="Winget J">J.M. Winget</name>
</author>
<author>
<name sortKey="Pan, Y H" uniqKey="Pan Y">Y.H. Pan</name>
</author>
<author>
<name sortKey="Bahnson, B J" uniqKey="Bahnson B">B.J. Bahnson</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jezek, J" uniqKey="Jezek J">J. Ježek</name>
</author>
<author>
<name sortKey="Jaburek, M" uniqKey="Jaburek M">M. Jabůrek</name>
</author>
<author>
<name sortKey="Zelenka, J" uniqKey="Zelenka J">J. Zelenka</name>
</author>
<author>
<name sortKey="Jezek, P" uniqKey="Jezek P">P. Ježek</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Trono, D" uniqKey="Trono D">D. Trono</name>
</author>
<author>
<name sortKey="Soccio, M" uniqKey="Soccio M">M. Soccio</name>
</author>
<author>
<name sortKey="Laus, M N" uniqKey="Laus M">M.N. Laus</name>
</author>
<author>
<name sortKey="Pastore, D" uniqKey="Pastore D">D. Pastore</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fujikawa, Y" uniqKey="Fujikawa Y">Y. Fujikawa</name>
</author>
<author>
<name sortKey="Fujikawa, R" uniqKey="Fujikawa R">R. Fujikawa</name>
</author>
<author>
<name sortKey="Iijima, N" uniqKey="Iijima N">N. Iijima</name>
</author>
<author>
<name sortKey="Esaka, M" uniqKey="Esaka M">M Esaka</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mansfeld, J" uniqKey="Mansfeld J">J. Mansfeld</name>
</author>
<author>
<name sortKey="Ulbrich Hofmann, R" uniqKey="Ulbrich Hofmann R">R. Ulbrich-Hofmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fujikawa, R" uniqKey="Fujikawa R">R. Fujikawa</name>
</author>
<author>
<name sortKey="Fujikawa, Y" uniqKey="Fujikawa Y">Y. Fujikawa</name>
</author>
<author>
<name sortKey="Iijima, N" uniqKey="Iijima N">N. Iijima</name>
</author>
<author>
<name sortKey="Esaka, M" uniqKey="Esaka M">M. Esaka</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bahn, S C" uniqKey="Bahn S">S.C. Bahn</name>
</author>
<author>
<name sortKey="Lee, H Y" uniqKey="Lee H">H.Y. Lee</name>
</author>
<author>
<name sortKey="Kim, H J" uniqKey="Kim H">H.J. Kim</name>
</author>
<author>
<name sortKey="Ryu, S B" uniqKey="Ryu S">S.B. Ryu</name>
</author>
<author>
<name sortKey="Shin, J S" uniqKey="Shin J">J.S. Shin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jung, K M" uniqKey="Jung K">K.M. Jung</name>
</author>
<author>
<name sortKey="Kim, D K" uniqKey="Kim D">D.K. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rietz, S" uniqKey="Rietz S">S. Rietz</name>
</author>
<author>
<name sortKey="Holk, A" uniqKey="Holk A">A. Holk</name>
</author>
<author>
<name sortKey="Scherer, G F E" uniqKey="Scherer G">G.F.E. Scherer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Boyer, J S" uniqKey="Boyer J">J.S. Boyer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Passioura, J B" uniqKey="Passioura J">J.B. Passioura</name>
</author>
<author>
<name sortKey="Condon, A G" uniqKey="Condon A">A.G. Condon</name>
</author>
<author>
<name sortKey="Richards, R A" uniqKey="Richards R">R.A. Richards</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kader, M A" uniqKey="Kader M">M.A. Kader</name>
</author>
<author>
<name sortKey="Lindberg, S" uniqKey="Lindberg S">S. Lindberg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Reddy, A S N" uniqKey="Reddy A">A.S.N. Reddy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schachtman, D P" uniqKey="Schachtman D">D.P. Schachtman</name>
</author>
<author>
<name sortKey="Goodger, J Q D" uniqKey="Goodger J">J.Q.D. Goodger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Felle, H H" uniqKey="Felle H">H.H. Felle</name>
</author>
<author>
<name sortKey="Herrmann, A" uniqKey="Herrmann A">A. Herrmann</name>
</author>
<author>
<name sortKey="Huckelhoven, R" uniqKey="Huckelhoven R">R. Hückelhoven</name>
</author>
<author>
<name sortKey="Kogel, K H" uniqKey="Kogel K">K.-H. Kogel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sahsah, Y" uniqKey="Sahsah Y">Y. Sahsah</name>
</author>
<author>
<name sortKey="Campos, P" uniqKey="Campos P">P. Campos</name>
</author>
<author>
<name sortKey="Gareil, M" uniqKey="Gareil M">M. Gareil</name>
</author>
<author>
<name sortKey="Zuily Fodil, Y" uniqKey="Zuily Fodil Y">Y. Zuily-Fodil</name>
</author>
<author>
<name sortKey="Pham Thi, A T" uniqKey="Pham Thi A">A.T. Pham-Thi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Matos, A R" uniqKey="Matos A">A.R. Matos</name>
</author>
<author>
<name sortKey="D Rcy Lameta, A" uniqKey="D Rcy Lameta A">A. d’Arcy-Lameta</name>
</author>
<author>
<name sortKey="Franca, M" uniqKey="Franca M">M. França</name>
</author>
<author>
<name sortKey="Petres, S" uniqKey="Petres S">S. Pêtres</name>
</author>
<author>
<name sortKey="Edelman, L" uniqKey="Edelman L">L. Edelman</name>
</author>
<author>
<name sortKey="Kader, J" uniqKey="Kader J">J. Kader</name>
</author>
<author>
<name sortKey="Zuily Fodil, Y" uniqKey="Zuily Fodil Y">Y. Zuily-Fodil</name>
</author>
<author>
<name sortKey="Pham Thi, A T" uniqKey="Pham Thi A">A.T. Pham-Thi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Matos, A R" uniqKey="Matos A">A.R. Matos</name>
</author>
<author>
<name sortKey="Gigon, A" uniqKey="Gigon A">A. Gigon</name>
</author>
<author>
<name sortKey="Laffray, D" uniqKey="Laffray D">D. Laffray</name>
</author>
<author>
<name sortKey="Petres, S" uniqKey="Petres S">S. Petrês</name>
</author>
<author>
<name sortKey="Zuily Fodil, Y" uniqKey="Zuily Fodil Y">Y. Zuily-Fodil</name>
</author>
<author>
<name sortKey="Pham Thi, A T" uniqKey="Pham Thi A">A.T. Pham-Thi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Alferez, F" uniqKey="Alferez F">F. Alferez</name>
</author>
<author>
<name sortKey="Lluch, Y" uniqKey="Lluch Y">Y. Lluch</name>
</author>
<author>
<name sortKey="Burns, J K" uniqKey="Burns J">J.K. Burns</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liao, H L" uniqKey="Liao H">H.-L. Liao</name>
</author>
<author>
<name sortKey="Burns, J K" uniqKey="Burns J">J.K. Burns</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Navari Izzo, F" uniqKey="Navari Izzo F">F. Navari-Izzo</name>
</author>
<author>
<name sortKey="Milone, M T" uniqKey="Milone M">M.T. Milone</name>
</author>
<author>
<name sortKey="Quartacci, M F" uniqKey="Quartacci M">M.F. Quartacci</name>
</author>
<author>
<name sortKey="Pinzini, C" uniqKey="Pinzini C">C. Pinzini</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Quartacci, M F" uniqKey="Quartacci M">M.F. Quartacci</name>
</author>
<author>
<name sortKey="Pinzino, C" uniqKey="Pinzino C">C. Pinzino</name>
</author>
<author>
<name sortKey="Sgherri, C L M" uniqKey="Sgherri C">C.L.M. Sgherri</name>
</author>
<author>
<name sortKey="Navari Izzo, F" uniqKey="Navari Izzo F">F. Navari-Izzo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Weber, H" uniqKey="Weber H">H. Weber</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lehmann, J" uniqKey="Lehmann J">J. Lehmann</name>
</author>
<author>
<name sortKey="Atzorn, R" uniqKey="Atzorn R">R. Atzorn</name>
</author>
<author>
<name sortKey="Bruckner, C" uniqKey="Bruckner C">C. Brückner</name>
</author>
<author>
<name sortKey="Reinbothe, S" uniqKey="Reinbothe S">S. Reinbothe</name>
</author>
<author>
<name sortKey="Leopold, J" uniqKey="Leopold J">J. Leopold</name>
</author>
<author>
<name sortKey="Wasternack, C" uniqKey="Wasternack C">C. Wasternack</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Walia, H" uniqKey="Walia H">H. Walia</name>
</author>
<author>
<name sortKey="Wilson, C" uniqKey="Wilson C">C. Wilson</name>
</author>
<author>
<name sortKey="Condamine, P" uniqKey="Condamine P">P. Condamine</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X. Liu</name>
</author>
<author>
<name sortKey="Ismail, A M" uniqKey="Ismail A">A.M. Ismail</name>
</author>
<author>
<name sortKey="Closem, T J" uniqKey="Closem T">T.J. Closem</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Harris, D A" uniqKey="Harris D">D.A. Harris</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pastore, D" uniqKey="Pastore D">D. Pastore</name>
</author>
<author>
<name sortKey="Trono, D" uniqKey="Trono D">D. Trono</name>
</author>
<author>
<name sortKey="Padalino, L" uniqKey="Padalino L">L. Padalino</name>
</author>
<author>
<name sortKey="Simone, S" uniqKey="Simone S">S. Simone</name>
</author>
<author>
<name sortKey="Valenti, D" uniqKey="Valenti D">D. Valenti</name>
</author>
<author>
<name sortKey="Di Fonzo, N" uniqKey="Di Fonzo N">N. Di Fonzo</name>
</author>
<author>
<name sortKey="Passarella, S" uniqKey="Passarella S">S. Passarella</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gambacorta, G" uniqKey="Gambacorta G">G. Gambacorta</name>
</author>
<author>
<name sortKey="Sinigaglia, M" uniqKey="Sinigaglia M">M. Sinigaglia</name>
</author>
<author>
<name sortKey="Schena, A" uniqKey="Schena A">A. Schena</name>
</author>
<author>
<name sortKey="Baiano, A" uniqKey="Baiano A">A. Baiano</name>
</author>
<author>
<name sortKey="Lamacchia, C" uniqKey="Lamacchia C">C. Lamacchia</name>
</author>
<author>
<name sortKey="Pati, S" uniqKey="Pati S">S. Pati</name>
</author>
<author>
<name sortKey="La Notte, E" uniqKey="La Notte E">E. La Notte</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Int J Mol Sci</journal-id>
<journal-id journal-id-type="iso-abbrev">Int J Mol Sci</journal-id>
<journal-id journal-id-type="publisher-id">ijms</journal-id>
<journal-title-group>
<journal-title>International Journal of Molecular Sciences</journal-title>
</journal-title-group>
<issn pub-type="epub">1422-0067</issn>
<publisher>
<publisher-name>Molecular Diversity Preservation International (MDPI)</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">23455473</article-id>
<article-id pub-id-type="pmc">3634499</article-id>
<article-id pub-id-type="doi">10.3390/ijms14035146</article-id>
<article-id pub-id-type="publisher-id">ijms-14-05146</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Secretory Phospholipases A
<sub>2</sub>
in Durum Wheat (
<italic>Triticum durum</italic>
Desf.): Gene Expression, Enzymatic Activity, and Relation to Drought Stress Adaptation</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Verlotta</surname>
<given-names>Angelo</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liberatore</surname>
<given-names>Maria T.</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Cattivelli</surname>
<given-names>Luigi</given-names>
</name>
<xref ref-type="author-notes" rid="fn1-ijms-14-05146"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Trono</surname>
<given-names>Daniela</given-names>
</name>
<xref ref-type="corresp" rid="c1-ijms-14-05146">*</xref>
</contrib>
<aff id="af1-ijms-14-05146">Consiglio per la Ricerca e la sperimentazione in Agricoltura, Cereal Research Centre, S.S. 16, Km 675, 71122 Foggia, Italy; E-Mails:
<email>angeloverlotta@yahoo.it</email>
(A.V.);
<email>mt1981@libero.it</email>
(M.T.L.);
<email>luigi.cattivelli@entecra.it</email>
(L.C.)</aff>
</contrib-group>
<author-notes>
<fn id="fn1-ijms-14-05146">
<label></label>
<p>Current address: Consiglio per la Ricerca e la sperimentazione in Agricoltura, Genomics Research Centre, Via San Protaso 302, 29017 Fiorenzuola d’Arda, Italy.</p>
</fn>
<corresp id="c1-ijms-14-05146">
<label>*</label>
Author to whom correspondence should be addressed; E-Mail:
<email>daniela.trono@entecra.it</email>
; Tel.: +39-0-881-742-972; Fax: +39-0-881-713-150.</corresp>
</author-notes>
<pub-date pub-type="collection">
<month>3</month>
<year>2013</year>
</pub-date>
<pub-date pub-type="epub">
<day>01</day>
<month>3</month>
<year>2013</year>
</pub-date>
<volume>14</volume>
<issue>3</issue>
<fpage>5146</fpage>
<lpage>5169</lpage>
<history>
<date date-type="received">
<day>18</day>
<month>1</month>
<year>2013</year>
</date>
<date date-type="rev-recd">
<day>13</day>
<month>2</month>
<year>2013</year>
</date>
<date date-type="accepted">
<day>18</day>
<month>2</month>
<year>2013</year>
</date>
</history>
<permissions>
<copyright-statement>© 2013 by the authors; licensee MDPI, Basel, Switzerland.</copyright-statement>
<copyright-year>2013</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/3.0">
<license-p>
<pmc-comment>CREATIVE COMMONS</pmc-comment>
This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/3.0/">http://creativecommons.org/licenses/by/3.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<p>Phospholipases A
<sub>2</sub>
(PLA
<sub>2</sub>
s) are known to mediate signaling cascades during plant growth and development, as well as biotic and abiotic stress responses. In this context, the present study provides extensive characterization of specific PLA
<sub>2</sub>
s in durum wheat, and assesses their involvement in durum wheat response to drought stress. In durum wheat leaves, four full-length expressed sequences encoding putative PLA
<sub>2</sub>
s were isolated and characterized as belonging to the class of secretory PLA
<sub>2</sub>
s (sPLA
<sub>2</sub>
s):
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>I</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>II</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>III</italic>
and
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>IV</italic>
. PLA
<sub>2</sub>
activity was also detected, the characteristics of which resemble those of previously characterized plant sPLA
<sub>2</sub>
s: strong preference for phospholipids; requirement for millimolar Ca
<sup>2+</sup>
concentrations; optimal activity at basic pH; heat stability; and inhibition by the reducing agent dithiothreitol. With drought stress imposed at both the vegetative and reproductive stages, accumulation of
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>I</italic>
and
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>III</italic>
transcripts, and to a lesser extent of
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>IV</italic>
transcript, paralleled increased PLA
<sub>2</sub>
activity; both transcript levels and enzymatic activity decreased as a consequence of stress recovery. Consistently, free fatty acid analysis of drought-stressed leaves revealed increased linoleate, linolenate and palmitate contents, which were reversed by plant re-watering. Overall, these findings strongly suggest that there are inducible sPLA
<sub>2</sub>
isoforms in durum wheat that have roles in orchestrating the plant response to drought stress.</p>
</abstract>
<kwd-group>
<kwd>drought stress</kwd>
<kwd>durum wheat</kwd>
<kwd>phospholipase A
<sub>2</sub>
</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="f1-ijms-14-05146" position="float">
<label>Figure 1</label>
<caption>
<p>Analysis of the deduced amino acid sequences of sPLA
<sub>2</sub>
s from durum wheat leaves. (
<bold>A</bold>
) Phylogenetic tree of the deduced amino acid sequences of the four TdsPLA
<sub>2</sub>
s and some other plant sPLA
<sub>2</sub>
s. The GenBank accession numbers are as follows:
<italic>A. thaliana</italic>
isoform α (AtsPLA
<sub>2</sub>
α), β (AtsPLA
<sub>2</sub>
β), γ (AtsPLA
<sub>2</sub>
γ) and δ (AtsPLA
<sub>2</sub>
δ), At2g06925, At2g19690, At4g29460 and At4g29470, respectively; carnation (DcsPLA
<sub>2</sub>
), AF064732; durum wheat isoform I (TdsPLA
<sub>2</sub>
I), II (TdsPLA
<sub>2</sub>
II), III (TdsPLA
<sub>2</sub>
III) and IV (TdsPLA
<sub>2</sub>
IV), JX021445, JX021446, JX021447 and JX021448, respectively; orange isoform α (CssPLA
<sub>2</sub>
α) and β (CssPLA
<sub>2</sub>
β), GU075396 and GU075398, respectively; rice isoform I (OssPLA
<sub>2</sub>
I), II (OssPLA
<sub>2</sub>
II), III (OssPLA
<sub>2</sub>
III) and IV (OssPLA
<sub>2</sub>
IV), Os02g0831700, Os03g0261100, Os03g0708000 and Os11g0546600, respectively; tobacco isoform I (NtsPLA
<sub>2</sub>
I) and II (NtsPLA
<sub>2</sub>
II), AB190177 and AB190178, respectively; tomato (LesPLA
<sub>2</sub>
), AI487873. (
<bold>B</bold>
) Alignments between the deduced amino acid sequences of rice and durum wheat sPLA
<sub>2</sub>
s. The conserved domains with homology to the Ca
<sup>2+</sup>
-binding loop and the active site motifs of other known plant sPLA
<sub>2</sub>
s are indicated. Each of the twelve conserved Cys residues is marked with an asterisk. Triangles indicate the catalytic dyad. The signal peptides are highlighted in bold. The program used to produce phylogenetic tree and sequence alignment was the Vector NTI Suite software (version 9.0; Life Technology, Carlsbad, CA, USA). (
<bold>C</bold>
) Typical domains in TdsPLA
<sub>2</sub>
I as identified by the NCBI Conserved Domain Search Database [
<xref ref-type="bibr" rid="b27-ijms-14-05146">27</xref>
]. The same result was obtained by using as query the amino acid sequences deduced from the other three TdsPLA
<sub>2</sub>
isoforms.</p>
</caption>
<graphic xlink:href="ijms-14-05146f1a"></graphic>
<graphic xlink:href="ijms-14-05146f1b"></graphic>
</fig>
<fig id="f2-ijms-14-05146" position="float">
<label>Figure 2</label>
<caption>
<p>Tissue-specific expression of the
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
genes. Representative expression analysis of
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>I</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>II</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>III</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>IV</italic>
and
<italic>actin1</italic>
genes carried out by using the specific primer pairs reported in
<xref ref-type="table" rid="t1-ijms-14-05146">Table 1</xref>
. The figures of gel separation are presented in inverted colors. R, root; C, culm; L, leaf; G, glume; S, seed; A, awn.</p>
</caption>
<graphic xlink:href="ijms-14-05146f2"></graphic>
</fig>
<fig id="f3-ijms-14-05146" position="float">
<label>Figure 3</label>
<caption>
<p>Assay of PLA
<sub>2</sub>
activity in the crude extract from durum wheat leaves. (
<bold>A</bold>
) PLA
<sub>2</sub>
activity monitored as appearance of the typical hydroperoxide spectrum. The reaction mixture contained 2 mM CaCl
<sub>2</sub>
, 1.5 mM PC
<sub>LIN</sub>
and 4 E.U. LOX in 2 mL 50 mM Na borate buffer, pH 9.0; the reaction was started by the addition of 0.1 mg of crude leaf extract. The absorption spectra were recorded every 20 s; (
<bold>B</bold>
) PLA
<sub>2</sub>
activity monitored as time course at 234 nm. The reaction mixture contained 2 mM CaCl
<sub>2</sub>
and 1.5 mM PC
<sub>LIN</sub>
in 2 mL 50 mM Na borate buffer pH 9.0; 4 E.U. LOX and 0.1 mg of crude leaf extract were added at the time indicated. The number on the trace refers to E.U. per gram of dry weight.</p>
</caption>
<graphic xlink:href="ijms-14-05146f3"></graphic>
</fig>
<fig id="f4-ijms-14-05146" position="float">
<label>Figure 4</label>
<caption>
<p>Biochemical characterization of the PLA
<sub>2</sub>
activity detected in the crude extract from durum wheat leaves. (
<bold>A</bold>
) Effect of pH, Ca
<sup>2+</sup>
and heat inactivation. Measurements were carried out at 25 °C in the presence of 2 mM CaCl
<sub>2</sub>
(●), 10 mM EGTA (Δ) or denatured (15 min at 100 °C) crude leaf extract (□). (
<bold>B</bold>
) Substrate preference. PC, phosphatidylcholine; DGDG, digalactosyldiacylglycerol; MGDG, monogalactosyldiacylglycerol; TAG, triacylglycerol. (
<bold>C</bold>
) Sensitivity to inhibitors. Open symbols refer to the PLA
<sub>2</sub>
activity detected at pH 9.0, closed symbols refer to the PLA
<sub>2</sub>
activity detected at pH 5.0. (■,□) BEL, bromoenol lactone, iPLA
<sub>2</sub>
inhibitor; (●, ○) PACOCF
<sub>3</sub>
, palmityl trifluoromethyl ketone, cPLA
<sub>2</sub>
and iPLA
<sub>2</sub>
inhibitor; (▲, Δ) DTT, dithiothreitol, sPLA
<sub>2</sub>
inhibitor. Data are means ± SD (
<italic>n</italic>
= 3).</p>
</caption>
<graphic xlink:href="ijms-14-05146f4"></graphic>
</fig>
<fig id="f5-ijms-14-05146" position="float">
<label>Figure 5</label>
<caption>
<p>Substrate and Ca
<sup>2+</sup>
dependence of DWL-PLA
<sub>2</sub>
detected at pH 9.0 in the crude extract from durum wheat leaves. (
<bold>A</bold>
) Headgroup selectivity. PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI, phosphatidylinositol; PG, phosphatidylglycerol; PS, phosphatidylserine; (
<bold>B</bold>
) Dependence on substrate concentration. The assays were carried out at different PC
<sub>LIN</sub>
concentrations ranging between 150 and 2000 μM; (
<bold>C</bold>
) Dependence on Ca
<sup>2+</sup>
concentration. The assays were carried out at different CaCl
<sub>2</sub>
concentrations ranging between 50 and 2000 μM. The point at zero Ca
<sup>2+</sup>
concentration was obtained in the presence of 10 mM EGTA. Data are means ± SD (
<italic>n</italic>
= 3).</p>
</caption>
<graphic xlink:href="ijms-14-05146f5"></graphic>
</fig>
<fig id="f6-ijms-14-05146" position="float">
<label>Figure 6</label>
<caption>
<p>Effect of growth stage on
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
gene expression and DWL-PLA
<sub>2</sub>
activity in durum wheat leaves. (
<bold>A</bold>
) Representative expression analysis of
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>I</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>II</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>III</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>IV</italic>
and
<italic>actin 1</italic>
genes carried out by using the specific primer pairs reported in
<xref ref-type="table" rid="t1-ijms-14-05146">Table 1</xref>
. The figures of gel separation are presented in inverted colors; (
<bold>B</bold>
) DWL-PLA
<sub>2</sub>
activity. Data are means ± SD (
<italic>n</italic>
= 3). T: tillering, SE: stem elongation. B, booting; H, heading; F, flowering; WR, kernel watery ripening.</p>
</caption>
<graphic xlink:href="ijms-14-05146f6"></graphic>
</fig>
<fig id="f7-ijms-14-05146" position="float">
<label>Figure 7</label>
<caption>
<p>Effect of drought stress on
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
gene expression and DWL-PLA
<sub>2</sub>
activity in durum wheat leaves. (
<bold>A</bold>
) Representative expression analysis of
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>I</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>II</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>III</italic>
,
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>IV</italic>
,
<italic>cor410</italic>
and
<italic>actin 1</italic>
genes carried out by using the specific primer pairs reported in
<xref ref-type="table" rid="t1-ijms-14-05146">Table 1</xref>
. The figures of gel separation are presented in inverted colors; (
<bold>B</bold>
) DWL-PLA
<sub>2</sub>
activity. Data are means ± SD (
<italic>n</italic>
= 3). C
<sub>S</sub>
: control of the stress, S: stress, R: recovery, C
<sub>R</sub>
: control of the recovery.</p>
</caption>
<graphic xlink:href="ijms-14-05146f7a"></graphic>
<graphic xlink:href="ijms-14-05146f7b"></graphic>
</fig>
<fig id="f8-ijms-14-05146" position="float">
<label>Figure 8</label>
<caption>
<p>Effect of drought stress on FFA content in durum wheat leaves. Measurements were carried out at stem elongation (
<bold>A</bold>
) and watery ripening (
<bold>B</bold>
). C
<sub>S</sub>
: control of the stress; S: stress; R: recovery; C
<sub>R</sub>
: control of the recovery. Relative amounts of each FFA are expressed as percentage of the amount obtained for the C
<sub>S</sub>
taken as 100%. Data are means ± SD (
<italic>n</italic>
= 3).</p>
</caption>
<graphic xlink:href="ijms-14-05146f8"></graphic>
</fig>
<table-wrap id="t1-ijms-14-05146" position="float">
<label>Table 1</label>
<caption>
<p>Primer pairs used to amplify
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
,
<italic>actin1</italic>
and
<italic>cor410</italic>
transcripts, annealing temperature and PCR product sizes.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="middle" rowspan="1" colspan="1">Amplicon</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Forward primer (5′→3′)</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Reverse primer (5′→3′)</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Annealing temperature (°C)</th>
<th align="center" valign="middle" rowspan="1" colspan="1">Product size (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td colspan="5" align="left" valign="top" rowspan="1">
<bold>Full-length</bold>
</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>I</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">ATGGCGATGGCGATGGCGATG</td>
<td align="center" valign="top" rowspan="1" colspan="1">CTACAGTTCTAACTTCTGGCTGCCC</td>
<td align="center" valign="top" rowspan="1" colspan="1">60</td>
<td align="center" valign="top" rowspan="1" colspan="1">426</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>II</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">ATGAGATCGGTGCTCGGTC</td>
<td align="center" valign="top" rowspan="1" colspan="1">CTACTGCCCGATGTCGCG</td>
<td align="center" valign="top" rowspan="1" colspan="1">58</td>
<td align="center" valign="top" rowspan="1" colspan="1">474</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>III</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">ATGGCGCATGGCAGAGGC</td>
<td align="center" valign="top" rowspan="1" colspan="1">CTAGGGCTTGTGCAGGACCCG</td>
<td align="center" valign="top" rowspan="1" colspan="1">60</td>
<td align="center" valign="top" rowspan="1" colspan="1">489</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>IV</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">ATGCACACCGGCCGCCTCCTCCC</td>
<td align="center" valign="top" rowspan="1" colspan="1">CTACTTCGCCGGGGCCGGCGCC</td>
<td align="center" valign="top" rowspan="1" colspan="1">62</td>
<td align="center" valign="top" rowspan="1" colspan="1">513</td>
</tr>
<tr>
<td colspan="5" align="left" valign="top" rowspan="1">
<bold>Fragment</bold>
</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>I</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">GTCCTCCTCCTGGCCGGGGGC</td>
<td align="center" valign="top" rowspan="1" colspan="1">CAGGCATCGAGGTCGTCGCAGGG</td>
<td align="center" valign="top" rowspan="1" colspan="1">67</td>
<td align="center" valign="top" rowspan="1" colspan="1">170</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>II</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">TGCTTCTCCTCTCGCTGGTGACG</td>
<td align="center" valign="top" rowspan="1" colspan="1">TCGCCGGGGCAGCCGCTGTAG</td>
<td align="center" valign="top" rowspan="1" colspan="1">62</td>
<td align="center" valign="top" rowspan="1" colspan="1">184</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>III</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">ACGTCGGCCTCCAGACCCTCG</td>
<td align="center" valign="top" rowspan="1" colspan="1">TCCAGCAGGCCCTCGTTGCAC</td>
<td align="center" valign="top" rowspan="1" colspan="1">63</td>
<td align="center" valign="top" rowspan="1" colspan="1">253</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>TdsPLA</italic>
<italic>
<sub>2</sub>
</italic>
<italic>IV</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">GCGGTACGGCAAGTACTGCGGCG</td>
<td align="center" valign="top" rowspan="1" colspan="1">CCACGCAGTCCAGCAGGCTCTGG</td>
<td align="center" valign="top" rowspan="1" colspan="1">66</td>
<td align="center" valign="top" rowspan="1" colspan="1">157</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>actin1</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">CTTCGGACCCAAGAAAGAAAGCC</td>
<td align="center" valign="top" rowspan="1" colspan="1">CACCGCCCGTATTTCTCTAGTAGCC</td>
<td align="center" valign="top" rowspan="1" colspan="1">62</td>
<td align="center" valign="top" rowspan="1" colspan="1">280</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>cor410</italic>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">AGAAGAAGGAGGAGGAGGACAAGAAGAAGG</td>
<td align="center" valign="top" rowspan="1" colspan="1">AGAAGCCTTTCTTCTCCTCCTCGGG</td>
<td align="center" valign="top" rowspan="1" colspan="1">58</td>
<td align="center" valign="top" rowspan="1" colspan="1">432</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000F80 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd -nk 000F80 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Curation
   |type=    RBID
   |clé=     PMC:3634499
   |texte=   Secretory Phospholipases A2 in Durum Wheat (Triticum durum Desf.): Gene Expression, Enzymatic Activity, and Relation to Drought Stress Adaptation
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Curation/RBID.i   -Sk "pubmed:23455473" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd   \
       | NlmPubMed2Wicri -a OrangerV1 

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024