Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23
Identifieur interne : 000B24 ( Pmc/Checkpoint ); précédent : 000B23; suivant : 000B25Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23
Auteurs : Patrick C. Y. Woo [Hong Kong, République populaire de Chine] ; Susanna K. P. Lau [Hong Kong, République populaire de Chine] ; Rachel Y. Y. Fan ; Candy C. Y. Lau ; Emily Y. M. Wong ; Sunitha Joseph ; Alan K. L. Tsang ; Renate Wernery ; Cyril C. Y. Yip ; Chi-Ching Tsang ; Ulrich Wernery ; Kwok-Yung Yuen [Hong Kong, République populaire de Chine]Source :
- International Journal of Molecular Sciences [ 1422-0067 ] ; 2016.
Abstract
Recently, we reported the discovery of a dromedary camel coronavirus UAE-HKU23 (DcCoV UAE-HKU23) from dromedaries in the Middle East. In this study, DcCoV UAE-HKU23 was successfully isolated in two of the 14 dromedary fecal samples using HRT-18G cells, with cytopathic effects observed five days after inoculation. Northern blot analysis revealed at least seven distinct RNA species, corresponding to predicted subgenomic mRNAs and confirming the core sequence of transcription regulatory sequence motifs as 5′-UCUAAAC-3′ as we predicted previously. Antibodies against DcCoV UAE-HKU23 were detected in 58 (98.3%) and 59 (100%) of the 59 dromedary sera by immunofluorescence and neutralization antibody tests, respectively. There was significant correlation between the antibody titers determined by immunofluorescence and neutralization assays (Pearson coefficient = 0.525,
Url:
DOI: 10.3390/ijms17050691
PubMed: 27164099
PubMed Central: 4881517
Affiliations:
Links toward previous steps (curation, corpus...)
Links to Exploration step
PMC:4881517Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23</title>
<author><name sortKey="Woo, Patrick C Y" sort="Woo, Patrick C Y" uniqKey="Woo P" first="Patrick C. Y." last="Woo">Patrick C. Y. Woo</name>
<affiliation><nlm:aff id="af1-ijms-17-00691">State Key Laboratory of Emerging Infectious Diseases, the University of Hong Kong, Pokfulam, Hong Kong;<email>skplau@hku.hk</email>
(S.K.P.L.);<email>kyyuen@hku.hk</email>
(K.-Y.Y.)</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af3-ijms-17-00691">Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af4-ijms-17-00691">Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4"><nlm:aff id="af5-ijms-17-00691">Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006</wicri:regionArea>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
<orgName type="university">Université de Zhejiang</orgName>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
</affiliation>
</author>
<author><name sortKey="Lau, Susanna K P" sort="Lau, Susanna K P" uniqKey="Lau S" first="Susanna K. P." last="Lau">Susanna K. P. Lau</name>
<affiliation><nlm:aff id="af1-ijms-17-00691">State Key Laboratory of Emerging Infectious Diseases, the University of Hong Kong, Pokfulam, Hong Kong;<email>skplau@hku.hk</email>
(S.K.P.L.);<email>kyyuen@hku.hk</email>
(K.-Y.Y.)</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af3-ijms-17-00691">Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af4-ijms-17-00691">Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4"><nlm:aff id="af5-ijms-17-00691">Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006</wicri:regionArea>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
<orgName type="university">Université de Zhejiang</orgName>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
</affiliation>
</author>
<author><name sortKey="Fan, Rachel Y Y" sort="Fan, Rachel Y Y" uniqKey="Fan R" first="Rachel Y. Y." last="Fan">Rachel Y. Y. Fan</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lau, Candy C Y" sort="Lau, Candy C Y" uniqKey="Lau C" first="Candy C. Y." last="Lau">Candy C. Y. Lau</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wong, Emily Y M" sort="Wong, Emily Y M" uniqKey="Wong E" first="Emily Y. M." last="Wong">Emily Y. M. Wong</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Joseph, Sunitha" sort="Joseph, Sunitha" uniqKey="Joseph S" first="Sunitha" last="Joseph">Sunitha Joseph</name>
<affiliation><nlm:aff id="af6-ijms-17-00691">Central Veterinary Research Laboratory, Dubai, UAE;<email>sjoseph@cvrl.ae</email>
(S.J.);<email>wernery@cvrl.ae</email>
(R.W.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Tsang, Alan K L" sort="Tsang, Alan K L" uniqKey="Tsang A" first="Alan K. L." last="Tsang">Alan K. L. Tsang</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wernery, Renate" sort="Wernery, Renate" uniqKey="Wernery R" first="Renate" last="Wernery">Renate Wernery</name>
<affiliation><nlm:aff id="af6-ijms-17-00691">Central Veterinary Research Laboratory, Dubai, UAE;<email>sjoseph@cvrl.ae</email>
(S.J.);<email>wernery@cvrl.ae</email>
(R.W.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yip, Cyril C Y" sort="Yip, Cyril C Y" uniqKey="Yip C" first="Cyril C. Y." last="Yip">Cyril C. Y. Yip</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Tsang, Chi Ching" sort="Tsang, Chi Ching" uniqKey="Tsang C" first="Chi-Ching" last="Tsang">Chi-Ching Tsang</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wernery, Ulrich" sort="Wernery, Ulrich" uniqKey="Wernery U" first="Ulrich" last="Wernery">Ulrich Wernery</name>
<affiliation><nlm:aff id="af6-ijms-17-00691">Central Veterinary Research Laboratory, Dubai, UAE;<email>sjoseph@cvrl.ae</email>
(S.J.);<email>wernery@cvrl.ae</email>
(R.W.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yuen, Kwok Yung" sort="Yuen, Kwok Yung" uniqKey="Yuen K" first="Kwok-Yung" last="Yuen">Kwok-Yung Yuen</name>
<affiliation><nlm:aff id="af1-ijms-17-00691">State Key Laboratory of Emerging Infectious Diseases, the University of Hong Kong, Pokfulam, Hong Kong;<email>skplau@hku.hk</email>
(S.K.P.L.);<email>kyyuen@hku.hk</email>
(K.-Y.Y.)</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af3-ijms-17-00691">Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af4-ijms-17-00691">Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4"><nlm:aff id="af5-ijms-17-00691">Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006</wicri:regionArea>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
<orgName type="university">Université de Zhejiang</orgName>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">27164099</idno>
<idno type="pmc">4881517</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4881517</idno>
<idno type="RBID">PMC:4881517</idno>
<idno type="doi">10.3390/ijms17050691</idno>
<date when="2016">2016</date>
<idno type="wicri:Area/Pmc/Corpus">000098</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000098</idno>
<idno type="wicri:Area/Pmc/Curation">000098</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000098</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000B24</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000B24</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23</title>
<author><name sortKey="Woo, Patrick C Y" sort="Woo, Patrick C Y" uniqKey="Woo P" first="Patrick C. Y." last="Woo">Patrick C. Y. Woo</name>
<affiliation><nlm:aff id="af1-ijms-17-00691">State Key Laboratory of Emerging Infectious Diseases, the University of Hong Kong, Pokfulam, Hong Kong;<email>skplau@hku.hk</email>
(S.K.P.L.);<email>kyyuen@hku.hk</email>
(K.-Y.Y.)</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af3-ijms-17-00691">Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af4-ijms-17-00691">Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4"><nlm:aff id="af5-ijms-17-00691">Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006</wicri:regionArea>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
<orgName type="university">Université de Zhejiang</orgName>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
</affiliation>
</author>
<author><name sortKey="Lau, Susanna K P" sort="Lau, Susanna K P" uniqKey="Lau S" first="Susanna K. P." last="Lau">Susanna K. P. Lau</name>
<affiliation><nlm:aff id="af1-ijms-17-00691">State Key Laboratory of Emerging Infectious Diseases, the University of Hong Kong, Pokfulam, Hong Kong;<email>skplau@hku.hk</email>
(S.K.P.L.);<email>kyyuen@hku.hk</email>
(K.-Y.Y.)</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af3-ijms-17-00691">Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af4-ijms-17-00691">Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4"><nlm:aff id="af5-ijms-17-00691">Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006</wicri:regionArea>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
<orgName type="university">Université de Zhejiang</orgName>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
</affiliation>
</author>
<author><name sortKey="Fan, Rachel Y Y" sort="Fan, Rachel Y Y" uniqKey="Fan R" first="Rachel Y. Y." last="Fan">Rachel Y. Y. Fan</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lau, Candy C Y" sort="Lau, Candy C Y" uniqKey="Lau C" first="Candy C. Y." last="Lau">Candy C. Y. Lau</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wong, Emily Y M" sort="Wong, Emily Y M" uniqKey="Wong E" first="Emily Y. M." last="Wong">Emily Y. M. Wong</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Joseph, Sunitha" sort="Joseph, Sunitha" uniqKey="Joseph S" first="Sunitha" last="Joseph">Sunitha Joseph</name>
<affiliation><nlm:aff id="af6-ijms-17-00691">Central Veterinary Research Laboratory, Dubai, UAE;<email>sjoseph@cvrl.ae</email>
(S.J.);<email>wernery@cvrl.ae</email>
(R.W.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Tsang, Alan K L" sort="Tsang, Alan K L" uniqKey="Tsang A" first="Alan K. L." last="Tsang">Alan K. L. Tsang</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wernery, Renate" sort="Wernery, Renate" uniqKey="Wernery R" first="Renate" last="Wernery">Renate Wernery</name>
<affiliation><nlm:aff id="af6-ijms-17-00691">Central Veterinary Research Laboratory, Dubai, UAE;<email>sjoseph@cvrl.ae</email>
(S.J.);<email>wernery@cvrl.ae</email>
(R.W.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yip, Cyril C Y" sort="Yip, Cyril C Y" uniqKey="Yip C" first="Cyril C. Y." last="Yip">Cyril C. Y. Yip</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Tsang, Chi Ching" sort="Tsang, Chi Ching" uniqKey="Tsang C" first="Chi-Ching" last="Tsang">Chi-Ching Tsang</name>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wernery, Ulrich" sort="Wernery, Ulrich" uniqKey="Wernery U" first="Ulrich" last="Wernery">Ulrich Wernery</name>
<affiliation><nlm:aff id="af6-ijms-17-00691">Central Veterinary Research Laboratory, Dubai, UAE;<email>sjoseph@cvrl.ae</email>
(S.J.);<email>wernery@cvrl.ae</email>
(R.W.)</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yuen, Kwok Yung" sort="Yuen, Kwok Yung" uniqKey="Yuen K" first="Kwok-Yung" last="Yuen">Kwok-Yung Yuen</name>
<affiliation><nlm:aff id="af1-ijms-17-00691">State Key Laboratory of Emerging Infectious Diseases, the University of Hong Kong, Pokfulam, Hong Kong;<email>skplau@hku.hk</email>
(S.K.P.L.);<email>kyyuen@hku.hk</email>
(K.-Y.Y.)</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="af2-ijms-17-00691">Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af3-ijms-17-00691">Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="af4-ijms-17-00691">Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam, Hong Kong</nlm:aff>
<country xml:lang="fr">Hong Kong</country>
<wicri:regionArea>Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam</wicri:regionArea>
<wicri:noRegion>Pokfulam</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4"><nlm:aff id="af5-ijms-17-00691">Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006</wicri:regionArea>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
<orgName type="university">Université de Zhejiang</orgName>
<placeName><settlement type="city">Hangzhou</settlement>
<region type="province">Zhejiang</region>
</placeName>
</affiliation>
</author>
</analytic>
<series><title level="j">International Journal of Molecular Sciences</title>
<idno type="eISSN">1422-0067</idno>
<imprint><date when="2016">2016</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>Recently, we reported the discovery of a dromedary camel coronavirus UAE-HKU23 (DcCoV UAE-HKU23) from dromedaries in the Middle East. In this study, DcCoV UAE-HKU23 was successfully isolated in two of the 14 dromedary fecal samples using HRT-18G cells, with cytopathic effects observed five days after inoculation. Northern blot analysis revealed at least seven distinct RNA species, corresponding to predicted subgenomic mRNAs and confirming the core sequence of transcription regulatory sequence motifs as 5′-UCUAAAC-3′ as we predicted previously. Antibodies against DcCoV UAE-HKU23 were detected in 58 (98.3%) and 59 (100%) of the 59 dromedary sera by immunofluorescence and neutralization antibody tests, respectively. There was significant correlation between the antibody titers determined by immunofluorescence and neutralization assays (Pearson coefficient = 0.525, <italic>p</italic>
< 0.0001). Immunization of mice using recombinant N proteins of DcCoV UAE-HKU23 and Middle East respiratory syndrome coronavirus (MERS-CoV), respectively, and heat-inactivated DcCoV UAE-HKU23 showed minimal cross-antigenicity between DcCoV UAE-HKU23 and MERS-CoV by Western blot and neutralization antibody assays. Codon usage and genetic distance analysis of RdRp, S and N genes showed that the 14 strains of DcCoV UAE-HKU23 formed a distinct cluster, separated from those of other closely related members of <italic>Betacoronavirus 1</italic>
, including alpaca CoV, confirming that DcCoV UAE-HKU23 is a novel member of <italic>Betacoronavirus 1</italic>
.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Peck, K M" uniqKey="Peck K">K.M. Peck</name>
</author>
<author><name sortKey="Burch, C L" uniqKey="Burch C">C.L. Burch</name>
</author>
<author><name sortKey="Heise, M T" uniqKey="Heise M">M.T. Heise</name>
</author>
<author><name sortKey="Baric, R S" uniqKey="Baric R">R.S. Baric</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lai, M M" uniqKey="Lai M">M.M. Lai</name>
</author>
<author><name sortKey="Cavanagh, D" uniqKey="Cavanagh D">D. Cavanagh</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ziebuhr, J" uniqKey="Ziebuhr J">J. Ziebuhr</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Brian, D A" uniqKey="Brian D">D.A. Brian</name>
</author>
<author><name sortKey="Baric, R S" uniqKey="Baric R">R.S. Baric</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="De Groot, R J" uniqKey="De Groot R">R.J. De Groot</name>
</author>
<author><name sortKey="Baker, S C" uniqKey="Baker S">S.C. Baker</name>
</author>
<author><name sortKey="Baric, R" uniqKey="Baric R">R. Baric</name>
</author>
<author><name sortKey="Enjuanes, L" uniqKey="Enjuanes L">L. Enjuanes</name>
</author>
<author><name sortKey="Gorbalenya, A E" uniqKey="Gorbalenya A">A.E. Gorbalenya</name>
</author>
<author><name sortKey="Holmes, K V" uniqKey="Holmes K">K.V. Holmes</name>
</author>
<author><name sortKey="Perlman, S" uniqKey="Perlman S">S. Perlman</name>
</author>
<author><name sortKey="Poon, L" uniqKey="Poon L">L. Poon</name>
</author>
<author><name sortKey="Rottier, P J M" uniqKey="Rottier P">P.J.M. Rottier</name>
</author>
<author><name sortKey="Talbot, P J" uniqKey="Talbot P">P.J. Talbot</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wu, H Y" uniqKey="Wu H">H.Y. Wu</name>
</author>
<author><name sortKey="Brian, D A" uniqKey="Brian D">D.A. Brian</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Herrewegh, A A" uniqKey="Herrewegh A">A.A. Herrewegh</name>
</author>
<author><name sortKey="Smeenk, I" uniqKey="Smeenk I">I. Smeenk</name>
</author>
<author><name sortKey="Horzinek, M C" uniqKey="Horzinek M">M.C. Horzinek</name>
</author>
<author><name sortKey="Rottier, P J" uniqKey="Rottier P">P.J. Rottier</name>
</author>
<author><name sortKey="De Groot, R J" uniqKey="De Groot R">R.J. de Groot</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Yip, C C" uniqKey="Yip C">C.C. Yip</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Yuen, K Y" uniqKey="Yuen K">K.Y. Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bidokhti, M R" uniqKey="Bidokhti M">M.R. Bidokhti</name>
</author>
<author><name sortKey="Traven, M" uniqKey="Traven M">M. Traven</name>
</author>
<author><name sortKey="Ohlson, A" uniqKey="Ohlson A">A. Ohlson</name>
</author>
<author><name sortKey="Baule, C" uniqKey="Baule C">C. Baule</name>
</author>
<author><name sortKey="Hakhverdyan, M" uniqKey="Hakhverdyan M">M. Hakhverdyan</name>
</author>
<author><name sortKey="Belak, S" uniqKey="Belak S">S. Belak</name>
</author>
<author><name sortKey="Liu, L" uniqKey="Liu L">L. Liu</name>
</author>
<author><name sortKey="Alenius, S" uniqKey="Alenius S">S. Alenius</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Decaro, N" uniqKey="Decaro N">N. Decaro</name>
</author>
<author><name sortKey="Martella, V" uniqKey="Martella V">V. Martella</name>
</author>
<author><name sortKey="Elia, G" uniqKey="Elia G">G. Elia</name>
</author>
<author><name sortKey="Campolo, M" uniqKey="Campolo M">M. Campolo</name>
</author>
<author><name sortKey="Mari, V" uniqKey="Mari V">V. Mari</name>
</author>
<author><name sortKey="Desario, C" uniqKey="Desario C">C. Desario</name>
</author>
<author><name sortKey="Lucente, M S" uniqKey="Lucente M">M.S. Lucente</name>
</author>
<author><name sortKey="Lorusso, A" uniqKey="Lorusso A">A. Lorusso</name>
</author>
<author><name sortKey="Greco, G" uniqKey="Greco G">G. Greco</name>
</author>
<author><name sortKey="Corrente, M" uniqKey="Corrente M">M. Corrente</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Guan, Y" uniqKey="Guan Y">Y. Guan</name>
</author>
<author><name sortKey="Zheng, B J" uniqKey="Zheng B">B.J. Zheng</name>
</author>
<author><name sortKey="He, Y Q" uniqKey="He Y">Y.Q. He</name>
</author>
<author><name sortKey="Liu, X L" uniqKey="Liu X">X.L. Liu</name>
</author>
<author><name sortKey="Zhuang, Z X" uniqKey="Zhuang Z">Z.X. Zhuang</name>
</author>
<author><name sortKey="Cheung, C L" uniqKey="Cheung C">C.L. Cheung</name>
</author>
<author><name sortKey="Luo, S W" uniqKey="Luo S">S.W. Luo</name>
</author>
<author><name sortKey="Li, P H" uniqKey="Li P">P.H. Li</name>
</author>
<author><name sortKey="Zhang, L J" uniqKey="Zhang L">L.J. Zhang</name>
</author>
<author><name sortKey="Guan, Y J" uniqKey="Guan Y">Y.J. Guan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Marra, M A" uniqKey="Marra M">M.A. Marra</name>
</author>
<author><name sortKey="Jones, S J" uniqKey="Jones S">S.J. Jones</name>
</author>
<author><name sortKey="Astell, C R" uniqKey="Astell C">C.R. Astell</name>
</author>
<author><name sortKey="Holt, R A" uniqKey="Holt R">R.A. Holt</name>
</author>
<author><name sortKey="Brooks Wilson, A" uniqKey="Brooks Wilson A">A. Brooks-Wilson</name>
</author>
<author><name sortKey="Butterfield, Y S" uniqKey="Butterfield Y">Y.S. Butterfield</name>
</author>
<author><name sortKey="Khattra, J" uniqKey="Khattra J">J. Khattra</name>
</author>
<author><name sortKey="Asano, J K" uniqKey="Asano J">J.K. Asano</name>
</author>
<author><name sortKey="Barber, S A" uniqKey="Barber S">S.A. Barber</name>
</author>
<author><name sortKey="Chan, S Y" uniqKey="Chan S">S.Y. Chan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rota, P A" uniqKey="Rota P">P.A. Rota</name>
</author>
<author><name sortKey="Oberste, M S" uniqKey="Oberste M">M.S. Oberste</name>
</author>
<author><name sortKey="Monroe, S S" uniqKey="Monroe S">S.S. Monroe</name>
</author>
<author><name sortKey="Nix, W A" uniqKey="Nix W">W.A. Nix</name>
</author>
<author><name sortKey="Campagnoli, R" uniqKey="Campagnoli R">R. Campagnoli</name>
</author>
<author><name sortKey="Icenogle, J P" uniqKey="Icenogle J">J.P. Icenogle</name>
</author>
<author><name sortKey="Penaranda, S" uniqKey="Penaranda S">S. Penaranda</name>
</author>
<author><name sortKey="Bankamp, B" uniqKey="Bankamp B">B. Bankamp</name>
</author>
<author><name sortKey="Maher, K" uniqKey="Maher K">K. Maher</name>
</author>
<author><name sortKey="Chen, M H" uniqKey="Chen M">M.H. Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Snijder, E J" uniqKey="Snijder E">E.J. Snijder</name>
</author>
<author><name sortKey="Bredenbeek, P J" uniqKey="Bredenbeek P">P.J. Bredenbeek</name>
</author>
<author><name sortKey="Dobbe, J C" uniqKey="Dobbe J">J.C. Dobbe</name>
</author>
<author><name sortKey="Thiel, V" uniqKey="Thiel V">V. Thiel</name>
</author>
<author><name sortKey="Ziebuhr, J" uniqKey="Ziebuhr J">J. Ziebuhr</name>
</author>
<author><name sortKey="Poon, L L" uniqKey="Poon L">L.L. Poon</name>
</author>
<author><name sortKey="Guan, Y" uniqKey="Guan Y">Y. Guan</name>
</author>
<author><name sortKey="Rozanov, M" uniqKey="Rozanov M">M. Rozanov</name>
</author>
<author><name sortKey="Spaan, W J" uniqKey="Spaan W">W.J. Spaan</name>
</author>
<author><name sortKey="Gorbalenya, A E" uniqKey="Gorbalenya A">A.E. Gorbalenya</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
<author><name sortKey="Che, X Y" uniqKey="Che X">X.Y. Che</name>
</author>
<author><name sortKey="Tam, V K" uniqKey="Tam V">V.K. Tam</name>
</author>
<author><name sortKey="Tam, S C" uniqKey="Tam S">S.C. Tam</name>
</author>
<author><name sortKey="Cheng, V C" uniqKey="Cheng V">V.C. Cheng</name>
</author>
<author><name sortKey="Hung, I F" uniqKey="Hung I">I.F. Hung</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Cheng, V C" uniqKey="Cheng V">V.C. Cheng</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Yuen, K Y" uniqKey="Yuen K">K.Y. Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fouchier, R A" uniqKey="Fouchier R">R.A. Fouchier</name>
</author>
<author><name sortKey="Hartwig, N G" uniqKey="Hartwig N">N.G. Hartwig</name>
</author>
<author><name sortKey="Bestebroer, T M" uniqKey="Bestebroer T">T.M. Bestebroer</name>
</author>
<author><name sortKey="Niemeyer, B" uniqKey="Niemeyer B">B. Niemeyer</name>
</author>
<author><name sortKey="De Jong, J C" uniqKey="De Jong J">J.C. de Jong</name>
</author>
<author><name sortKey="Simon, J H" uniqKey="Simon J">J.H. Simon</name>
</author>
<author><name sortKey="Osterhaus, A D" uniqKey="Osterhaus A">A.D. Osterhaus</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L. Van der Hoek</name>
</author>
<author><name sortKey="Pyrc, K" uniqKey="Pyrc K">K. Pyrc</name>
</author>
<author><name sortKey="Jebbink, M F" uniqKey="Jebbink M">M.F. Jebbink</name>
</author>
<author><name sortKey="Vermeulen Oost, W" uniqKey="Vermeulen Oost W">W. Vermeulen-Oost</name>
</author>
<author><name sortKey="Berkhout, R J" uniqKey="Berkhout R">R.J. Berkhout</name>
</author>
<author><name sortKey="Wolthers, K C" uniqKey="Wolthers K">K.C. Wolthers</name>
</author>
<author><name sortKey="Wertheim Van Dillen, P M" uniqKey="Wertheim Van Dillen P">P.M. Wertheim-van Dillen</name>
</author>
<author><name sortKey="Kaandorp, J" uniqKey="Kaandorp J">J. Kaandorp</name>
</author>
<author><name sortKey="Spaargaren, J" uniqKey="Spaargaren J">J. Spaargaren</name>
</author>
<author><name sortKey="Berkhout, B" uniqKey="Berkhout B">B. Berkhout</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Vabret, A" uniqKey="Vabret A">A. Vabret</name>
</author>
<author><name sortKey="Mourez, T" uniqKey="Mourez T">T. Mourez</name>
</author>
<author><name sortKey="Dina, J" uniqKey="Dina J">J. Dina</name>
</author>
<author><name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L. van der Hoek</name>
</author>
<author><name sortKey="Gouarin, S" uniqKey="Gouarin S">S. Gouarin</name>
</author>
<author><name sortKey="Petitjean, J" uniqKey="Petitjean J">J. Petitjean</name>
</author>
<author><name sortKey="Brouard, J" uniqKey="Brouard J">J. Brouard</name>
</author>
<author><name sortKey="Freymuth, F" uniqKey="Freymuth F">F. Freymuth</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Chu, C M" uniqKey="Chu C">C.M. Chu</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
<author><name sortKey="Poon, R W" uniqKey="Poon R">R.W. Poon</name>
</author>
<author><name sortKey="Cai, J J" uniqKey="Cai J">J.J. Cai</name>
</author>
<author><name sortKey="Luk, W K" uniqKey="Luk W">W.K. Luk</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Poon, R W" uniqKey="Poon R">R.W. Poon</name>
</author>
<author><name sortKey="Chu, C M" uniqKey="Chu C">C.M. Chu</name>
</author>
<author><name sortKey="Lee, R A" uniqKey="Lee R">R.A. Lee</name>
</author>
<author><name sortKey="Luk, W K" uniqKey="Luk W">W.K. Luk</name>
</author>
<author><name sortKey="Wong, G K" uniqKey="Wong G">G.K. Wong</name>
</author>
<author><name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Yip, C C" uniqKey="Yip C">C.C. Yip</name>
</author>
<author><name sortKey="Tse, H" uniqKey="Tse H">H. Tse</name>
</author>
<author><name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author><name sortKey="Cheng, V C" uniqKey="Cheng V">V.C. Cheng</name>
</author>
<author><name sortKey="Lee, P" uniqKey="Lee P">P. Lee</name>
</author>
<author><name sortKey="Tang, B S" uniqKey="Tang B">B.S. Tang</name>
</author>
<author><name sortKey="Cheung, C H" uniqKey="Cheung C">C.H. Cheung</name>
</author>
<author><name sortKey="Lee, R A" uniqKey="Lee R">R.A. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Li, K S" uniqKey="Li K">K.S. Li</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author><name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
<author><name sortKey="Wong, S S" uniqKey="Wong S">S.S. Wong</name>
</author>
<author><name sortKey="Leung, S Y" uniqKey="Leung S">S.Y. Leung</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Yuen, K Y" uniqKey="Yuen K">K.Y. Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, W" uniqKey="Li W">W. Li</name>
</author>
<author><name sortKey="Shi, Z" uniqKey="Shi Z">Z. Shi</name>
</author>
<author><name sortKey="Yu, M" uniqKey="Yu M">M. Yu</name>
</author>
<author><name sortKey="Ren, W" uniqKey="Ren W">W. Ren</name>
</author>
<author><name sortKey="Smith, C" uniqKey="Smith C">C. Smith</name>
</author>
<author><name sortKey="Epstein, J H" uniqKey="Epstein J">J.H. Epstein</name>
</author>
<author><name sortKey="Wang, H" uniqKey="Wang H">H. Wang</name>
</author>
<author><name sortKey="Crameri, G" uniqKey="Crameri G">G. Crameri</name>
</author>
<author><name sortKey="Hu, Z" uniqKey="Hu Z">Z. Hu</name>
</author>
<author><name sortKey="Zhang, H" uniqKey="Zhang H">H. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ge, X Y" uniqKey="Ge X">X.Y. Ge</name>
</author>
<author><name sortKey="Li, J L" uniqKey="Li J">J.L. Li</name>
</author>
<author><name sortKey="Yang, X L" uniqKey="Yang X">X.L. Yang</name>
</author>
<author><name sortKey="Chmura, A A" uniqKey="Chmura A">A.A. Chmura</name>
</author>
<author><name sortKey="Zhu, G" uniqKey="Zhu G">G. Zhu</name>
</author>
<author><name sortKey="Epstein, J H" uniqKey="Epstein J">J.H. Epstein</name>
</author>
<author><name sortKey="Mazet, J K" uniqKey="Mazet J">J.K. Mazet</name>
</author>
<author><name sortKey="Hu, B" uniqKey="Hu B">B. Hu</name>
</author>
<author><name sortKey="Zhang, W" uniqKey="Zhang W">W. Zhang</name>
</author>
<author><name sortKey="Peng, C" uniqKey="Peng C">C. Peng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Li, K S" uniqKey="Li K">K.S. Li</name>
</author>
<author><name sortKey="Poon, R W" uniqKey="Poon R">R.W. Poon</name>
</author>
<author><name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
<author><name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author><name sortKey="Yip, B C" uniqKey="Yip B">B.C. Yip</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Yuen, K Y" uniqKey="Yuen K">K.Y. Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Wang, M" uniqKey="Wang M">M. Wang</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Xu, H" uniqKey="Xu H">H. Xu</name>
</author>
<author><name sortKey="Poon, R W" uniqKey="Poon R">R.W. Poon</name>
</author>
<author><name sortKey="Guo, R" uniqKey="Guo R">R. Guo</name>
</author>
<author><name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
<author><name sortKey="Gao, K" uniqKey="Gao K">K. Gao</name>
</author>
<author><name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Li, K S" uniqKey="Li K">K.S. Li</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Wang, M" uniqKey="Wang M">M. Wang</name>
</author>
<author><name sortKey="Lam, C S" uniqKey="Lam C">C.S. Lam</name>
</author>
<author><name sortKey="Xu, H" uniqKey="Xu H">H. Xu</name>
</author>
<author><name sortKey="Guo, R" uniqKey="Guo R">R. Guo</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Zheng, B J" uniqKey="Zheng B">B.J. Zheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Lam, C S" uniqKey="Lam C">C.S. Lam</name>
</author>
<author><name sortKey="Lai, K K" uniqKey="Lai K">K.K. Lai</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Lee, P" uniqKey="Lee P">P. Lee</name>
</author>
<author><name sortKey="Luk, G S" uniqKey="Luk G">G.S. Luk</name>
</author>
<author><name sortKey="Dyrting, K C" uniqKey="Dyrting K">K.C. Dyrting</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Yuen, K Y" uniqKey="Yuen K">K.Y. Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Li, K S" uniqKey="Li K">K.S. Li</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Shek, C T" uniqKey="Shek C">C.T. Shek</name>
</author>
<author><name sortKey="Tse, H" uniqKey="Tse H">H. Tse</name>
</author>
<author><name sortKey="Wang, M" uniqKey="Wang M">M. Wang</name>
</author>
<author><name sortKey="Choi, G K" uniqKey="Choi G">G.K. Choi</name>
</author>
<author><name sortKey="Xu, H" uniqKey="Xu H">H. Xu</name>
</author>
<author><name sortKey="Lam, C S" uniqKey="Lam C">C.S. Lam</name>
</author>
<author><name sortKey="Guo, R" uniqKey="Guo R">R. Guo</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Poon, R W" uniqKey="Poon R">R.W. Poon</name>
</author>
<author><name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
<author><name sortKey="Wang, M" uniqKey="Wang M">M. Wang</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Xu, H" uniqKey="Xu H">H. Xu</name>
</author>
<author><name sortKey="Guo, R" uniqKey="Guo R">R. Guo</name>
</author>
<author><name sortKey="Li, K S" uniqKey="Li K">K.S. Li</name>
</author>
<author><name sortKey="Gao, K" uniqKey="Gao K">K. Gao</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Li, K S" uniqKey="Li K">K.S. Li</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Shek, C T" uniqKey="Shek C">C.T. Shek</name>
</author>
<author><name sortKey="Wang, M" uniqKey="Wang M">M. Wang</name>
</author>
<author><name sortKey="Choi, G K" uniqKey="Choi G">G.K. Choi</name>
</author>
<author><name sortKey="Guo, R" uniqKey="Guo R">R. Guo</name>
</author>
<author><name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
<author><name sortKey="Poon, R W" uniqKey="Poon R">R.W. Poon</name>
</author>
<author><name sortKey="Lam, C S" uniqKey="Lam C">C.S. Lam</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Lam, C S" uniqKey="Lam C">C.S. Lam</name>
</author>
<author><name sortKey="Lau, C C" uniqKey="Lau C">C.C. Lau</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Lau, J H" uniqKey="Lau J">J.H. Lau</name>
</author>
<author><name sortKey="Bai, R" uniqKey="Bai R">R. Bai</name>
</author>
<author><name sortKey="Teng, J L" uniqKey="Teng J">J.L. Teng</name>
</author>
<author><name sortKey="Tsang, C C" uniqKey="Tsang C">C.C. Tsang</name>
</author>
<author><name sortKey="Wang, M" uniqKey="Wang M">M. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Yip, C C" uniqKey="Yip C">C.C. Yip</name>
</author>
<author><name sortKey="Fan, R Y" uniqKey="Fan R">R.Y. Fan</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author><name sortKey="Wang, M" uniqKey="Wang M">M. Wang</name>
</author>
<author><name sortKey="Guo, R" uniqKey="Guo R">R. Guo</name>
</author>
<author><name sortKey="Lam, C S" uniqKey="Lam C">C.S. Lam</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Lai, K K" uniqKey="Lai K">K.K. Lai</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Lam, C S" uniqKey="Lam C">C.S. Lam</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Hui, S W" uniqKey="Hui S">S.W. Hui</name>
</author>
<author><name sortKey="Fan, R Y" uniqKey="Fan R">R.Y. Fan</name>
</author>
<author><name sortKey="Martelli, P" uniqKey="Martelli P">P. Martelli</name>
</author>
<author><name sortKey="Yuen, K Y" uniqKey="Yuen K">K.Y. Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Li, K S" uniqKey="Li K">K.S. Li</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Fan, R Y" uniqKey="Fan R">R.Y. Fan</name>
</author>
<author><name sortKey="Luk, H K" uniqKey="Luk H">H.K. Luk</name>
</author>
<author><name sortKey="Cai, J P" uniqKey="Cai J">J.P. Cai</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Zheng, B J" uniqKey="Zheng B">B.J. Zheng</name>
</author>
<author><name sortKey="Wang, M" uniqKey="Wang M">M. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zaki, A M" uniqKey="Zaki A">A.M. Zaki</name>
</author>
<author><name sortKey="Van Boheemen, S" uniqKey="Van Boheemen S">S. van Boheemen</name>
</author>
<author><name sortKey="Bestebroer, T M" uniqKey="Bestebroer T">T.M. Bestebroer</name>
</author>
<author><name sortKey="Osterhaus, A D" uniqKey="Osterhaus A">A.D. Osterhaus</name>
</author>
<author><name sortKey="Fouchier, R A" uniqKey="Fouchier R">R.A. Fouchier</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="De Groot, R J" uniqKey="De Groot R">R.J. De Groot</name>
</author>
<author><name sortKey="Baker, S C" uniqKey="Baker S">S.C. Baker</name>
</author>
<author><name sortKey="Baric, R S" uniqKey="Baric R">R.S. Baric</name>
</author>
<author><name sortKey="Brown, C S" uniqKey="Brown C">C.S. Brown</name>
</author>
<author><name sortKey="Drosten, C" uniqKey="Drosten C">C. Drosten</name>
</author>
<author><name sortKey="Enjuanes, L" uniqKey="Enjuanes L">L. Enjuanes</name>
</author>
<author><name sortKey="Fouchier, R A" uniqKey="Fouchier R">R.A. Fouchier</name>
</author>
<author><name sortKey="Galiano, M" uniqKey="Galiano M">M. Galiano</name>
</author>
<author><name sortKey="Gorbalenya, A E" uniqKey="Gorbalenya A">A.E. Gorbalenya</name>
</author>
<author><name sortKey="Memish, Z A" uniqKey="Memish Z">Z.A. Memish</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Li, K S" uniqKey="Li K">K.S. Li</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Lam, C S" uniqKey="Lam C">C.S. Lam</name>
</author>
<author><name sortKey="Ahmed, S" uniqKey="Ahmed S">S. Ahmed</name>
</author>
<author><name sortKey="Chen, H" uniqKey="Chen H">H. Chen</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Yuen, K Y" uniqKey="Yuen K">K.Y. Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Abd, E W A" uniqKey="Abd E">E.W.A. Abd</name>
</author>
<author><name sortKey="Patel, P" uniqKey="Patel P">P. Patel</name>
</author>
<author><name sortKey="Heidenreich, D" uniqKey="Heidenreich D">D. Heidenreich</name>
</author>
<author><name sortKey="Hufert, F T" uniqKey="Hufert F">F.T. Hufert</name>
</author>
<author><name sortKey="Weidmann, M" uniqKey="Weidmann M">M. Weidmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Reusken, C B" uniqKey="Reusken C">C.B. Reusken</name>
</author>
<author><name sortKey="Haagmans, B L" uniqKey="Haagmans B">B.L. Haagmans</name>
</author>
<author><name sortKey="Muller, M A" uniqKey="Muller M">M.A. Muller</name>
</author>
<author><name sortKey="Gutierrez, C" uniqKey="Gutierrez C">C. Gutierrez</name>
</author>
<author><name sortKey="Godeke, G J" uniqKey="Godeke G">G.J. Godeke</name>
</author>
<author><name sortKey="Meyer, B" uniqKey="Meyer B">B. Meyer</name>
</author>
<author><name sortKey="Muth, D" uniqKey="Muth D">D. Muth</name>
</author>
<author><name sortKey="Raj, V S" uniqKey="Raj V">V.S. Raj</name>
</author>
<author><name sortKey="Vries, L S" uniqKey="Vries L">L.S. Vries</name>
</author>
<author><name sortKey="Corman, V M" uniqKey="Corman V">V.M. Corman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Perera, R A" uniqKey="Perera R">R.A. Perera</name>
</author>
<author><name sortKey="Wang, P" uniqKey="Wang P">P. Wang</name>
</author>
<author><name sortKey="Gomaa, M R" uniqKey="Gomaa M">M.R. Gomaa</name>
</author>
<author><name sortKey="El Shesheny, R" uniqKey="El Shesheny R">R. El-Shesheny</name>
</author>
<author><name sortKey="Kandeil, A" uniqKey="Kandeil A">A. Kandeil</name>
</author>
<author><name sortKey="Bagato, O" uniqKey="Bagato O">O. Bagato</name>
</author>
<author><name sortKey="Siu, L Y" uniqKey="Siu L">L.Y. Siu</name>
</author>
<author><name sortKey="Shehata, M M" uniqKey="Shehata M">M.M. Shehata</name>
</author>
<author><name sortKey="Kayed, A S" uniqKey="Kayed A">A.S. Kayed</name>
</author>
<author><name sortKey="Moatasim, Y" uniqKey="Moatasim Y">Y. Moatasim</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Raj, V S" uniqKey="Raj V">V.S. Raj</name>
</author>
<author><name sortKey="Farag, E A" uniqKey="Farag E">E.A. Farag</name>
</author>
<author><name sortKey="Reusken, C B" uniqKey="Reusken C">C.B. Reusken</name>
</author>
<author><name sortKey="Lamers, M M" uniqKey="Lamers M">M.M. Lamers</name>
</author>
<author><name sortKey="Pas, S D" uniqKey="Pas S">S.D. Pas</name>
</author>
<author><name sortKey="Voermans, J" uniqKey="Voermans J">J. Voermans</name>
</author>
<author><name sortKey="Smits, S L" uniqKey="Smits S">S.L. Smits</name>
</author>
<author><name sortKey="Osterhaus, A D" uniqKey="Osterhaus A">A.D. Osterhaus</name>
</author>
<author><name sortKey="Al Mawlawi, N" uniqKey="Al Mawlawi N">N. Al-Mawlawi</name>
</author>
<author><name sortKey="Al Romaihi, H E" uniqKey="Al Romaihi H">H.E. Al-Romaihi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chu, D K" uniqKey="Chu D">D.K. Chu</name>
</author>
<author><name sortKey="Poon, L L" uniqKey="Poon L">L.L. Poon</name>
</author>
<author><name sortKey="Gomaa, M M" uniqKey="Gomaa M">M.M. Gomaa</name>
</author>
<author><name sortKey="Shehata, M M" uniqKey="Shehata M">M.M. Shehata</name>
</author>
<author><name sortKey="Perera, R A" uniqKey="Perera R">R.A. Perera</name>
</author>
<author><name sortKey="Abu Zeid, D" uniqKey="Abu Zeid D">D. Abu Zeid</name>
</author>
<author><name sortKey="El Rifay, A S" uniqKey="El Rifay A">A.S. El Rifay</name>
</author>
<author><name sortKey="Siu, L Y" uniqKey="Siu L">L.Y. Siu</name>
</author>
<author><name sortKey="Guan, Y" uniqKey="Guan Y">Y. Guan</name>
</author>
<author><name sortKey="Webby, R J" uniqKey="Webby R">R.J. Webby</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hemida, M G" uniqKey="Hemida M">M.G. Hemida</name>
</author>
<author><name sortKey="Chu, D K" uniqKey="Chu D">D.K. Chu</name>
</author>
<author><name sortKey="Poon, L L" uniqKey="Poon L">L.L. Poon</name>
</author>
<author><name sortKey="Perera, R A" uniqKey="Perera R">R.A. Perera</name>
</author>
<author><name sortKey="Alhammadi, M A" uniqKey="Alhammadi M">M.A. Alhammadi</name>
</author>
<author><name sortKey="Ng, H Y" uniqKey="Ng H">H.Y. Ng</name>
</author>
<author><name sortKey="Siu, L Y" uniqKey="Siu L">L.Y. Siu</name>
</author>
<author><name sortKey="Guan, Y" uniqKey="Guan Y">Y. Guan</name>
</author>
<author><name sortKey="Alnaeem, A" uniqKey="Alnaeem A">A. Alnaeem</name>
</author>
<author><name sortKey="Peiris, M" uniqKey="Peiris M">M. Peiris</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Alagaili, A N" uniqKey="Alagaili A">A.N. Alagaili</name>
</author>
<author><name sortKey="Briese, T" uniqKey="Briese T">T. Briese</name>
</author>
<author><name sortKey="Mishra, N" uniqKey="Mishra N">N. Mishra</name>
</author>
<author><name sortKey="Kapoor, V" uniqKey="Kapoor V">V. Kapoor</name>
</author>
<author><name sortKey="Sameroff, S C" uniqKey="Sameroff S">S.C. Sameroff</name>
</author>
<author><name sortKey="Burbelo, P D" uniqKey="Burbelo P">P.D. Burbelo</name>
</author>
<author><name sortKey="De Wit, E" uniqKey="De Wit E">E. de Wit</name>
</author>
<author><name sortKey="Munster, V J" uniqKey="Munster V">V.J. Munster</name>
</author>
<author><name sortKey="Hensley, L E" uniqKey="Hensley L">L.E. Hensley</name>
</author>
<author><name sortKey="Zalmout, I S" uniqKey="Zalmout I">I.S. Zalmout</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wernery, U" uniqKey="Wernery U">U. Wernery</name>
</author>
<author><name sortKey="Corman, V M" uniqKey="Corman V">V.M. Corman</name>
</author>
<author><name sortKey="Wong, E Y" uniqKey="Wong E">E.Y. Wong</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Muth, D" uniqKey="Muth D">D. Muth</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Khazanehdari, K" uniqKey="Khazanehdari K">K. Khazanehdari</name>
</author>
<author><name sortKey="Zirkel, F" uniqKey="Zirkel F">F. Zirkel</name>
</author>
<author><name sortKey="Ali, M" uniqKey="Ali M">M. Ali</name>
</author>
<author><name sortKey="Nagy, P" uniqKey="Nagy P">P. Nagy</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Teng, J L" uniqKey="Teng J">J.L. Teng</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Joseph, M" uniqKey="Joseph M">M. Joseph</name>
</author>
<author><name sortKey="Wong, E Y" uniqKey="Wong E">E.Y. Wong</name>
</author>
<author><name sortKey="Tang, Y" uniqKey="Tang Y">Y. Tang</name>
</author>
<author><name sortKey="Sivakumar, S" uniqKey="Sivakumar S">S. Sivakumar</name>
</author>
<author><name sortKey="Xie, J" uniqKey="Xie J">J. Xie</name>
</author>
<author><name sortKey="Bai, R" uniqKey="Bai R">R. Bai</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Teng, J L" uniqKey="Teng J">J.L. Teng</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Joseph, M" uniqKey="Joseph M">M. Joseph</name>
</author>
<author><name sortKey="Wong, E Y" uniqKey="Wong E">E.Y. Wong</name>
</author>
<author><name sortKey="Tang, Y" uniqKey="Tang Y">Y. Tang</name>
</author>
<author><name sortKey="Sivakumar, S" uniqKey="Sivakumar S">S. Sivakumar</name>
</author>
<author><name sortKey="Bai, R" uniqKey="Bai R">R. Bai</name>
</author>
<author><name sortKey="Wernery, R" uniqKey="Wernery R">R. Wernery</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Wernery, U" uniqKey="Wernery U">U. Wernery</name>
</author>
<author><name sortKey="Wong, E Y" uniqKey="Wong E">E.Y. Wong</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Johnson, B" uniqKey="Johnson B">B. Johnson</name>
</author>
<author><name sortKey="Yip, C C" uniqKey="Yip C">C.C. Yip</name>
</author>
<author><name sortKey="Lau, C C" uniqKey="Lau C">C.C. Lau</name>
</author>
<author><name sortKey="Sivakumar, S" uniqKey="Sivakumar S">S. Sivakumar</name>
</author>
<author><name sortKey="Cai, J P" uniqKey="Cai J">J.P. Cai</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sawicki, S G" uniqKey="Sawicki S">S.G. Sawicki</name>
</author>
<author><name sortKey="Sawicki, D L" uniqKey="Sawicki D">D.L. Sawicki</name>
</author>
<author><name sortKey="Siddell, S G" uniqKey="Siddell S">S.G. Siddell</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Schaad, M C" uniqKey="Schaad M">M.C. Schaad</name>
</author>
<author><name sortKey="Chen, W" uniqKey="Chen W">W. Chen</name>
</author>
<author><name sortKey="Peel, S A" uniqKey="Peel S">S.A. Peel</name>
</author>
<author><name sortKey="Baric, R S" uniqKey="Baric R">R.S. Baric</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jeong, Y S" uniqKey="Jeong Y">Y.S. Jeong</name>
</author>
<author><name sortKey="Repass, J F" uniqKey="Repass J">J.F. Repass</name>
</author>
<author><name sortKey="Kim, Y N" uniqKey="Kim Y">Y.N. Kim</name>
</author>
<author><name sortKey="Hwang, S M" uniqKey="Hwang S">S.M. Hwang</name>
</author>
<author><name sortKey="Makino, S" uniqKey="Makino S">S. Makino</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Lee, P" uniqKey="Lee P">P. Lee</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Yip, C C" uniqKey="Yip C">C.C. Yip</name>
</author>
<author><name sortKey="Tse, H" uniqKey="Tse H">H. Tse</name>
</author>
<author><name sortKey="Lee, R A" uniqKey="Lee R">R.A. Lee</name>
</author>
<author><name sortKey="So, L Y" uniqKey="So L">L.Y. So</name>
</author>
<author><name sortKey="Lau, Y L" uniqKey="Lau Y">Y.L. Lau</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wu, H Y" uniqKey="Wu H">H.Y. Wu</name>
</author>
<author><name sortKey="Ozdarendeli, A" uniqKey="Ozdarendeli A">A. Ozdarendeli</name>
</author>
<author><name sortKey="Brian, D A" uniqKey="Brian D">D.A. Brian</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
<author><name sortKey="Guy, J S" uniqKey="Guy J">J.S. Guy</name>
</author>
<author><name sortKey="Snijder, E J" uniqKey="Snijder E">E.J. Snijder</name>
</author>
<author><name sortKey="Denniston, D A" uniqKey="Denniston D">D.A. Denniston</name>
</author>
<author><name sortKey="Timoney, P J" uniqKey="Timoney P">P.J. Timoney</name>
</author>
<author><name sortKey="Balasuriya, U B" uniqKey="Balasuriya U">U.B. Balasuriya</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jin, L" uniqKey="Jin L">L. Jin</name>
</author>
<author><name sortKey="Cebra, C K" uniqKey="Cebra C">C.K. Cebra</name>
</author>
<author><name sortKey="Baker, R J" uniqKey="Baker R">R.J. Baker</name>
</author>
<author><name sortKey="Mattson, D E" uniqKey="Mattson D">D.E. Mattson</name>
</author>
<author><name sortKey="Cohen, S A" uniqKey="Cohen S">S.A. Cohen</name>
</author>
<author><name sortKey="Alvarado, D E" uniqKey="Alvarado D">D.E. Alvarado</name>
</author>
<author><name sortKey="Rohrmann, G F" uniqKey="Rohrmann G">G.F. Rohrmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Amer, H M" uniqKey="Amer H">H.M. Amer</name>
</author>
<author><name sortKey="Abd El Wahed, A" uniqKey="Abd El Wahed A">A. Abd El Wahed</name>
</author>
<author><name sortKey="Shalaby, M A" uniqKey="Shalaby M">M.A. Shalaby</name>
</author>
<author><name sortKey="Almajhdi, F N" uniqKey="Almajhdi F">F.N. Almajhdi</name>
</author>
<author><name sortKey="Hufert, F T" uniqKey="Hufert F">F.T. Hufert</name>
</author>
<author><name sortKey="Weidmann, M" uniqKey="Weidmann M">M. Weidmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Miszczak, F" uniqKey="Miszczak F">F. Miszczak</name>
</author>
<author><name sortKey="Tesson, V" uniqKey="Tesson V">V. Tesson</name>
</author>
<author><name sortKey="Kin, N" uniqKey="Kin N">N. Kin</name>
</author>
<author><name sortKey="Dina, J" uniqKey="Dina J">J. Dina</name>
</author>
<author><name sortKey="Balasuriya, U B" uniqKey="Balasuriya U">U.B. Balasuriya</name>
</author>
<author><name sortKey="Pronost, S" uniqKey="Pronost S">S. Pronost</name>
</author>
<author><name sortKey="Vabret, A" uniqKey="Vabret A">A. Vabret</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Vabret, A" uniqKey="Vabret A">A. Vabret</name>
</author>
<author><name sortKey="Dina, J" uniqKey="Dina J">J. Dina</name>
</author>
<author><name sortKey="Mourez, T" uniqKey="Mourez T">T. Mourez</name>
</author>
<author><name sortKey="Gouarin, S" uniqKey="Gouarin S">S. Gouarin</name>
</author>
<author><name sortKey="Petitjean, J" uniqKey="Petitjean J">J. Petitjean</name>
</author>
<author><name sortKey="Van Der Werf, S" uniqKey="Van Der Werf S">S. van der Werf</name>
</author>
<author><name sortKey="Freymuth, F" uniqKey="Freymuth F">F. Freymuth</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Alekseev, K P" uniqKey="Alekseev K">K.P. Alekseev</name>
</author>
<author><name sortKey="Vlasova, A N" uniqKey="Vlasova A">A.N. Vlasova</name>
</author>
<author><name sortKey="Jung, K" uniqKey="Jung K">K. Jung</name>
</author>
<author><name sortKey="Hasoksuz, M" uniqKey="Hasoksuz M">M. Hasoksuz</name>
</author>
<author><name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author><name sortKey="Halpin, R" uniqKey="Halpin R">R. Halpin</name>
</author>
<author><name sortKey="Wang, S" uniqKey="Wang S">S. Wang</name>
</author>
<author><name sortKey="Ghedin, E" uniqKey="Ghedin E">E. Ghedin</name>
</author>
<author><name sortKey="Spiro, D" uniqKey="Spiro D">D. Spiro</name>
</author>
<author><name sortKey="Saif, L J" uniqKey="Saif L">L.J. Saif</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chung, J Y" uniqKey="Chung J">J.Y. Chung</name>
</author>
<author><name sortKey="Kim, H R" uniqKey="Kim H">H.R. Kim</name>
</author>
<author><name sortKey="Bae, Y C" uniqKey="Bae Y">Y.C. Bae</name>
</author>
<author><name sortKey="Lee, O S" uniqKey="Lee O">O.S. Lee</name>
</author>
<author><name sortKey="Oem, J K" uniqKey="Oem J">J.K. Oem</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hasoksuz, M" uniqKey="Hasoksuz M">M. Hasoksuz</name>
</author>
<author><name sortKey="Alekseev, K" uniqKey="Alekseev K">K. Alekseev</name>
</author>
<author><name sortKey="Vlasova, A" uniqKey="Vlasova A">A. Vlasova</name>
</author>
<author><name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author><name sortKey="Spiro, D" uniqKey="Spiro D">D. Spiro</name>
</author>
<author><name sortKey="Halpin, R" uniqKey="Halpin R">R. Halpin</name>
</author>
<author><name sortKey="Wang, S" uniqKey="Wang S">S. Wang</name>
</author>
<author><name sortKey="Ghedin, E" uniqKey="Ghedin E">E. Ghedin</name>
</author>
<author><name sortKey="Saif, L J" uniqKey="Saif L">L.J. Saif</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Decaro, N" uniqKey="Decaro N">N. Decaro</name>
</author>
<author><name sortKey="Cirone, F" uniqKey="Cirone F">F. Cirone</name>
</author>
<author><name sortKey="Mari, V" uniqKey="Mari V">V. Mari</name>
</author>
<author><name sortKey="Nava, D" uniqKey="Nava D">D. Nava</name>
</author>
<author><name sortKey="Tinelli, A" uniqKey="Tinelli A">A. Tinelli</name>
</author>
<author><name sortKey="Elia, G" uniqKey="Elia G">G. Elia</name>
</author>
<author><name sortKey="Di Sarno, A" uniqKey="Di Sarno A">A. Di Sarno</name>
</author>
<author><name sortKey="Martella, V" uniqKey="Martella V">V. Martella</name>
</author>
<author><name sortKey="Colaianni, M L" uniqKey="Colaianni M">M.L. Colaianni</name>
</author>
<author><name sortKey="Aprea, G" uniqKey="Aprea G">G. Aprea</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, I W" uniqKey="Li I">I.W. Li</name>
</author>
<author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="To, K W" uniqKey="To K">K.W. To</name>
</author>
<author><name sortKey="Wong, S S" uniqKey="Wong S">S.S. Wong</name>
</author>
<author><name sortKey="Ho, P L" uniqKey="Ho P">P.L. Ho</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author><name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author><name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author><name sortKey="Chan, J F" uniqKey="Chan J">J.F. Chan</name>
</author>
<author><name sortKey="Cheng, V C" uniqKey="Cheng V">V.C. Cheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kuiken, T" uniqKey="Kuiken T">T. Kuiken</name>
</author>
<author><name sortKey="Fouchier, R A" uniqKey="Fouchier R">R.A. Fouchier</name>
</author>
<author><name sortKey="Schutten, M" uniqKey="Schutten M">M. Schutten</name>
</author>
<author><name sortKey="Rimmelzwaan, G F" uniqKey="Rimmelzwaan G">G.F. Rimmelzwaan</name>
</author>
<author><name sortKey="Van Amerongen, G" uniqKey="Van Amerongen G">G. van Amerongen</name>
</author>
<author><name sortKey="Van Riel, D" uniqKey="Van Riel D">D. van Riel</name>
</author>
<author><name sortKey="Laman, J D" uniqKey="Laman J">J.D. Laman</name>
</author>
<author><name sortKey="De Jong, T" uniqKey="De Jong T">T. de Jong</name>
</author>
<author><name sortKey="Van Doornum, G" uniqKey="Van Doornum G">G. van Doornum</name>
</author>
<author><name sortKey="Lim, W" uniqKey="Lim W">W. Lim</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Peiris, J S" uniqKey="Peiris J">J.S. Peiris</name>
</author>
<author><name sortKey="Lai, S T" uniqKey="Lai S">S.T. Lai</name>
</author>
<author><name sortKey="Poon, L L" uniqKey="Poon L">L.L. Poon</name>
</author>
<author><name sortKey="Guan, Y" uniqKey="Guan Y">Y. Guan</name>
</author>
<author><name sortKey="Yam, L Y" uniqKey="Yam L">L.Y. Yam</name>
</author>
<author><name sortKey="Lim, W" uniqKey="Lim W">W. Lim</name>
</author>
<author><name sortKey="Nicholls, J" uniqKey="Nicholls J">J. Nicholls</name>
</author>
<author><name sortKey="Yee, W K" uniqKey="Yee W">W.K. Yee</name>
</author>
<author><name sortKey="Yan, W W" uniqKey="Yan W">W.W. Yan</name>
</author>
<author><name sortKey="Cheung, M T" uniqKey="Cheung M">M.T. Cheung</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pyrc, K" uniqKey="Pyrc K">K. Pyrc</name>
</author>
<author><name sortKey="Jebbink, M F" uniqKey="Jebbink M">M.F. Jebbink</name>
</author>
<author><name sortKey="Berkhout, B" uniqKey="Berkhout B">B. Berkhout</name>
</author>
<author><name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L. van der Hoek</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author><name sortKey="Chan, J F" uniqKey="Chan J">J.F. Chan</name>
</author>
<author><name sortKey="Tse, H" uniqKey="Tse H">H. Tse</name>
</author>
<author><name sortKey="Chen, H" uniqKey="Chen H">H. Chen</name>
</author>
<author><name sortKey="Lau, C C" uniqKey="Lau C">C.C. Lau</name>
</author>
<author><name sortKey="Cai, J P" uniqKey="Cai J">J.P. Cai</name>
</author>
<author><name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author><name sortKey="Xiao, X" uniqKey="Xiao X">X. Xiao</name>
</author>
<author><name sortKey="To, K K" uniqKey="To K">K.K. To</name>
</author>
<author><name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Simmonds, P" uniqKey="Simmonds P">P. Simmonds</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">Int J Mol Sci</journal-id>
<journal-id journal-id-type="iso-abbrev">Int J Mol Sci</journal-id>
<journal-id journal-id-type="publisher-id">ijms</journal-id>
<journal-title-group><journal-title>International Journal of Molecular Sciences</journal-title>
</journal-title-group>
<issn pub-type="epub">1422-0067</issn>
<publisher><publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">27164099</article-id>
<article-id pub-id-type="pmc">4881517</article-id>
<article-id pub-id-type="doi">10.3390/ijms17050691</article-id>
<article-id pub-id-type="publisher-id">ijms-17-00691</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Article</subject>
</subj-group>
</article-categories>
<title-group><article-title>Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23</article-title>
</title-group>
<contrib-group><contrib contrib-type="author"><name><surname>Woo</surname>
<given-names>Patrick C. Y.</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-00691">1</xref>
<xref ref-type="aff" rid="af2-ijms-17-00691">2</xref>
<xref ref-type="aff" rid="af3-ijms-17-00691">3</xref>
<xref ref-type="aff" rid="af4-ijms-17-00691">4</xref>
<xref ref-type="aff" rid="af5-ijms-17-00691">5</xref>
<xref rid="c1-ijms-17-00691" ref-type="corresp">*</xref>
<xref ref-type="author-notes" rid="fn1-ijms-17-00691">†</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Lau</surname>
<given-names>Susanna K. P.</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-00691">1</xref>
<xref ref-type="aff" rid="af2-ijms-17-00691">2</xref>
<xref ref-type="aff" rid="af3-ijms-17-00691">3</xref>
<xref ref-type="aff" rid="af4-ijms-17-00691">4</xref>
<xref ref-type="aff" rid="af5-ijms-17-00691">5</xref>
<xref ref-type="author-notes" rid="fn1-ijms-17-00691">†</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Fan</surname>
<given-names>Rachel Y. Y.</given-names>
</name>
<xref ref-type="aff" rid="af2-ijms-17-00691">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Lau</surname>
<given-names>Candy C. Y.</given-names>
</name>
<xref ref-type="aff" rid="af2-ijms-17-00691">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Wong</surname>
<given-names>Emily Y. M.</given-names>
</name>
<xref ref-type="aff" rid="af2-ijms-17-00691">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Joseph</surname>
<given-names>Sunitha</given-names>
</name>
<xref ref-type="aff" rid="af6-ijms-17-00691">6</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Tsang</surname>
<given-names>Alan K. L.</given-names>
</name>
<xref ref-type="aff" rid="af2-ijms-17-00691">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Wernery</surname>
<given-names>Renate</given-names>
</name>
<xref ref-type="aff" rid="af6-ijms-17-00691">6</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Yip</surname>
<given-names>Cyril C. Y.</given-names>
</name>
<xref ref-type="aff" rid="af2-ijms-17-00691">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Tsang</surname>
<given-names>Chi-Ching</given-names>
</name>
<xref ref-type="aff" rid="af2-ijms-17-00691">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Wernery</surname>
<given-names>Ulrich</given-names>
</name>
<xref ref-type="aff" rid="af6-ijms-17-00691">6</xref>
<xref rid="c1-ijms-17-00691" ref-type="corresp">*</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Yuen</surname>
<given-names>Kwok-Yung</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-00691">1</xref>
<xref ref-type="aff" rid="af2-ijms-17-00691">2</xref>
<xref ref-type="aff" rid="af3-ijms-17-00691">3</xref>
<xref ref-type="aff" rid="af4-ijms-17-00691">4</xref>
<xref ref-type="aff" rid="af5-ijms-17-00691">5</xref>
</contrib>
</contrib-group>
<contrib-group><contrib contrib-type="editor"><name><surname>Collyer</surname>
<given-names>Charles A.</given-names>
</name>
<role>Academic Editor</role>
</contrib>
</contrib-group>
<aff id="af1-ijms-17-00691"><label>1</label>
State Key Laboratory of Emerging Infectious Diseases, the University of Hong Kong, Pokfulam, Hong Kong;<email>skplau@hku.hk</email>
(S.K.P.L.);<email>kyyuen@hku.hk</email>
(K.-Y.Y.)</aff>
<aff id="af2-ijms-17-00691"><label>2</label>
Department of Microbiology, the University of Hong Kong, Pokfulam, Hong Kong;<email>rachelfyy2004@yahoo.com.hk</email>
(R.Y.Y.F.);<email>candylaucy@gmail.com</email>
(C.C.Y.L.);<email>emilyhk2811@gmail.com</email>
(E.Y.M.W.);<email>alantsangmb@gmail.com</email>
(A.K.L.T.);<email>cyrilyip@gmail.com</email>
(C.C.Y.Y.);<email>microbioct@connect.hku.hk</email>
(C.-C.T.)</aff>
<aff id="af3-ijms-17-00691"><label>3</label>
Research Centre of Infection and Immunology, the University of Hong Kong, Pokfulam, Hong Kong</aff>
<aff id="af4-ijms-17-00691"><label>4</label>
Carol Yu Centre for Infection, the University of Hong Kong, Pokfulam, Hong Kong</aff>
<aff id="af5-ijms-17-00691"><label>5</label>
Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou 310006, China</aff>
<aff id="af6-ijms-17-00691"><label>6</label>
Central Veterinary Research Laboratory, Dubai, UAE;<email>sjoseph@cvrl.ae</email>
(S.J.);<email>wernery@cvrl.ae</email>
(R.W.)</aff>
<author-notes><corresp id="c1-ijms-17-00691"><label>*</label>
Correspondence: <email>pcywoo@hku.hk</email>
(P.C.Y.W.); <email>cvrl@cvrl.ae</email>
(U.W.); Tel.: +852-2255-4892 (P.C.Y.W.); +971-4-337-5165 (U.W.); Fax: +852-2855-1241 (P.C.Y.W); +971-4-336-8638 (U.W.)</corresp>
<fn id="fn1-ijms-17-00691"><label>†</label>
<p>These authors contributed equally to this work.</p>
</fn>
</author-notes>
<pub-date pub-type="epub"><day>07</day>
<month>5</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="collection"><month>5</month>
<year>2016</year>
</pub-date>
<volume>17</volume>
<issue>5</issue>
<elocation-id>691</elocation-id>
<history><date date-type="received"><day>17</day>
<month>3</month>
<year>2016</year>
</date>
<date date-type="accepted"><day>25</day>
<month>4</month>
<year>2016</year>
</date>
</history>
<permissions><copyright-statement>© 2016 by the authors; licensee MDPI, Basel, Switzerland.</copyright-statement>
<copyright-year>2016</copyright-year>
<license><license-p><pmc-comment>CREATIVE COMMONS</pmc-comment>
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract><p>Recently, we reported the discovery of a dromedary camel coronavirus UAE-HKU23 (DcCoV UAE-HKU23) from dromedaries in the Middle East. In this study, DcCoV UAE-HKU23 was successfully isolated in two of the 14 dromedary fecal samples using HRT-18G cells, with cytopathic effects observed five days after inoculation. Northern blot analysis revealed at least seven distinct RNA species, corresponding to predicted subgenomic mRNAs and confirming the core sequence of transcription regulatory sequence motifs as 5′-UCUAAAC-3′ as we predicted previously. Antibodies against DcCoV UAE-HKU23 were detected in 58 (98.3%) and 59 (100%) of the 59 dromedary sera by immunofluorescence and neutralization antibody tests, respectively. There was significant correlation between the antibody titers determined by immunofluorescence and neutralization assays (Pearson coefficient = 0.525, <italic>p</italic>
< 0.0001). Immunization of mice using recombinant N proteins of DcCoV UAE-HKU23 and Middle East respiratory syndrome coronavirus (MERS-CoV), respectively, and heat-inactivated DcCoV UAE-HKU23 showed minimal cross-antigenicity between DcCoV UAE-HKU23 and MERS-CoV by Western blot and neutralization antibody assays. Codon usage and genetic distance analysis of RdRp, S and N genes showed that the 14 strains of DcCoV UAE-HKU23 formed a distinct cluster, separated from those of other closely related members of <italic>Betacoronavirus 1</italic>
, including alpaca CoV, confirming that DcCoV UAE-HKU23 is a novel member of <italic>Betacoronavirus 1</italic>
.</p>
</abstract>
<kwd-group><kwd>coronavirus</kwd>
<kwd>dromedary camel</kwd>
<kwd>isolation</kwd>
<kwd>characterization</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group><fig id="ijms-17-00691-f001" position="float"><label>Figure 1</label>
<caption><p>(<bold>a</bold>
) HRT-18G cells infected with dromedary camel coronavirus (DcCoV) UAE-HKU23 showing cytopathic effects with rounded, aggregated, fused, and granulated giant cells rapidly detaching from the monolayer at day 5 after incubation (arrows) (original magnification 40×); (<bold>b</bold>
) Negative contrast electron microscopy of ultracentrifuged deposit of HRT-18G cell culture-grown DcCoV UAE-HKU23, showing typical club-shaped surface projections (arrow) of coronavirus particles, with rabbit coronavirus HKU14 as the control (bottom <bold>left</bold>
corner). Bar = 50 nm; Indirect immunofluorescent antigen detection in (<bold>c</bold>
) uninfected and (<bold>d</bold>
) infected HRT-18G cells using serum from dromedary showing apple green fluorescence in (arrows) DcCoV UAE-HKU23 infected HRT-18G cells (original magnification 100× for both).</p>
</caption>
<graphic xlink:href="ijms-17-00691-g001"></graphic>
</fig>
<fig id="ijms-17-00691-f002" position="float"><label>Figure 2</label>
<caption><p>(<bold>a</bold>
) Northern blot analysis for total RNA isolated from dromedary camel coronavirus (DcCoV) UAE-HKU23–infected HRT-18G cells. RNA species are indicated by arrows. NS2, non-structural NS2; HE, hemagglutinin; S, spike; NS5, non-structural NS5; E, envelope; M, membrane; N, nucleocapsid. Lane 1, 1 μg total RNA from uninfected cells; Lane 2, 1 μg total RNA from infected cells; (<bold>b</bold>
) DcCoV UAE-HKU23 subgenomic mRNA (sg mRNA) leader-body junction and flanking sequences. The subgenomic mRNA sequences are shown in alignment with the leader and the genomic sequences. The start codon AUG in each subgenomic mRNA is depicted in bold. The putative transcription regulatory sequences (TRS) was underlined and base mismatch between the body TRS and the leader TRS or the corresponding genomic region was indicated by asterisk. The 43N and 115N in the parentheses indicate that 43 and 115 nucleotides at that region are not shown.</p>
</caption>
<graphic xlink:href="ijms-17-00691-g002a"></graphic>
<graphic xlink:href="ijms-17-00691-g002b"></graphic>
</fig>
<fig id="ijms-17-00691-f003" position="float"><label>Figure 3</label>
<caption><p>Comparison of neutralization antibody titer and immunofluorescence antibody titer of dromedary serum samples for dromedary camel coronavirus UAE-HKU23. Numbers of serum samples with that particular neutralization antibody and immunofluorescence antibody titers are indicated by points with different colors.</p>
</caption>
<graphic xlink:href="ijms-17-00691-g003"></graphic>
</fig>
<fig id="ijms-17-00691-f004" position="float"><label>Figure 4</label>
<caption><p>Western blotting analysis of dromedary camel coronavirus (DcCoV) UAE-HKU23 and Middle East respiratory syndrome coronavirus (MERS-CoV) N proteins expressed in <italic>E. coli</italic>
. Lane 1: MERS-CoV N protein reacted with 1:16,000 dilution of serum from mouse immunized with MERS-CoV N protein; Lane 2: MERS-CoV N protein reacted with 1:16,000 dilution of serum from mouse immunized with DcCoV UAE-HKU23 N protein; Lane 3: DcCoV UAE-HKU23 N protein reacted with 1:16,000 dilution of serum from mouse immunized with MERS-CoV N protein, Lane 4: DcCoV UAE-HKU23 N protein reacted with 1:16,000 dilution of serum from mouse immunized with DcCoV UAE-HKU23 N protein.</p>
</caption>
<graphic xlink:href="ijms-17-00691-g004"></graphic>
</fig>
<fig id="ijms-17-00691-f005" position="float"><label>Figure 5</label>
<caption><p>Phylogenetic analyses of RNA-dependent RNA polymerase (RdRp), S, and N genes of dromedary camel coronavirus (DcCoV) UAE-HKU23. Included in the analysis were 2784, 4101, and 1347 nucleotide positions in RdRp, S and N, respectively. For RdRp, the scale bar indicates the estimated number of substitutions per 200 nucleotides. For S, the scale bars indicate the estimated number of substitutions per 50 nucleotides. For N, the scale bars indicate the estimated number of substitutions per 100 nucleotides. Bootstrap values were calculated from 1000 trees and those below 70% are not shown. The 14 strains of DcCoV UAE-HKU23 characterized in this and our previous studies are shown in bold. BCoV, bovine coronavirus; CRCoV, canine respiratory coronavirus; SDCoV, sambar deer coronavirus; WbCoV, waterbuck coronavirus; WtDCoV, white-tailed deer coronavirus; BRCoV, bovine respiratory coronavirus; GiCoV, giraffe coronavirus; SACoV, sable antelope coronavirus.</p>
</caption>
<graphic xlink:href="ijms-17-00691-g005a"></graphic>
<graphic xlink:href="ijms-17-00691-g005b"></graphic>
</fig>
<fig id="ijms-17-00691-f006" position="float"><label>Figure 6</label>
<caption><p>(<bold>a</bold>
) Scatter plot of the corresponding analysis (CA) using relative synonymous codon usage (RSCU) of the RdRp, S, and N genes of members of <italic>Betacoronavirus 1</italic>
and RbCoV HKU14. Different coronaviruses are indicated in different colored markers. The group of bovine coronavirus-like viruses is circled; (<bold>b</bold>
) SimPlot analysis of complete RdRp, S, and N genes of DcCoV UAE-HKU23, alpaca CoV, BCoV and other wild ruminant CoVs. Each point plotted is the percent genetic distance within a sliding window of 200 nt wide, centered on the position plotted, with a step size of 20 nt. Each curve represents a comparison of the sequence data of DcCoV UAE-HKU23, BCoV, and other wild ruminant CoV strains to the reference sequence data of alpaca CoV. Alpaca CoV, alpaca coronavirus; BCoV, bovine coronavirus; BuCoV, <italic>Bubalus bubalis</italic>
coronavirus; CRCoV, canine respiratory coronavirus; DcCoV, dromedary camel coronavirus, ECoV, equine coronavirus; GiCoV, giraffe coronavirus; HCoV-OC43, human coronavirus OC43; HTCoV, Himalayan tahr coronavirus; NyCoV, nyala coronavirus; PHEV, porcine hemagglutinating encephalomyelitis virus; RbCoV, rabbit coronavirus; SACoV, sable antelope coronavirus; SDCoV, sambar deer coronavirus; SiCoV, sitatunga coronavirus; WbCoV, waterbuck coronavirus; WiCoV, wisent coronavirus; WtDCoV, white-tailed deer coronavirus.</p>
</caption>
<graphic xlink:href="ijms-17-00691-g006a"></graphic>
<graphic xlink:href="ijms-17-00691-g006b"></graphic>
</fig>
<table-wrap id="ijms-17-00691-t001" position="float"><object-id pub-id-type="pii">ijms-17-00691-t001_Table 1</object-id>
<label>Table 1</label>
<caption><p>Dromedary camel coronavirus UAE-HKU23 antibody detection by immunofluorescence and neutralization antibody tests.</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Antibody Titer</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Number (%) of Samples</th>
</tr>
<tr><th colspan="2" align="center" valign="middle" style="border-bottom:solid thin" rowspan="1">Immunofluorescence Antibody Test</th>
</tr>
</thead>
<tbody><tr><td align="center" valign="middle" rowspan="1" colspan="1"><20</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1 (1.7)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">80</td>
<td align="center" valign="middle" rowspan="1" colspan="1">21 (35.6)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">320</td>
<td align="center" valign="middle" rowspan="1" colspan="1">23 (39.0)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">1280</td>
<td align="center" valign="middle" rowspan="1" colspan="1">13 (22.0)</td>
</tr>
<tr><td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">5120</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">1 (1.7)</td>
</tr>
<tr><td colspan="2" align="center" valign="middle" style="border-bottom:solid thin" rowspan="1"><bold>Neutralization Antibody Test</bold>
</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">10</td>
<td align="center" valign="middle" rowspan="1" colspan="1">2 (3.4)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">20</td>
<td align="center" valign="middle" rowspan="1" colspan="1">4 (6.8)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">40</td>
<td align="center" valign="middle" rowspan="1" colspan="1">6 (10.2)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">80</td>
<td align="center" valign="middle" rowspan="1" colspan="1">18 (30.5)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">160</td>
<td align="center" valign="middle" rowspan="1" colspan="1">11 (18.6)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">320</td>
<td align="center" valign="middle" rowspan="1" colspan="1">9 (15.3)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">640</td>
<td align="center" valign="middle" rowspan="1" colspan="1">5 (8.5)</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">1280</td>
<td align="center" valign="middle" rowspan="1" colspan="1">2 (3.4)</td>
</tr>
<tr><td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2560</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2 (3.4)</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="ijms-17-00691-t002" position="float"><object-id pub-id-type="pii">ijms-17-00691-t002_Table 2</object-id>
<label>Table 2</label>
<caption><p>Primers used for RT-PCR amplification of the leader-body junction of subgenomic mRNAs (sg mRNAs) of dromedary camel coronavirus UAE-HKU23.</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Primer</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Sequence (5′-3′)</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Use</th>
</tr>
</thead>
<tbody><tr><td align="center" valign="middle" rowspan="1" colspan="1">LPW25800</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GATTGTGAGCGATTTGCGTGC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward primer for all sg mRNAs PCR</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">LPW18463</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GTAAACCTTTATAATTTAACACA</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse primer for mRNA (NS2) PCR</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">LPW25801</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AATCGGTAAAGTGAAAACTCC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse primer for mRNA (HE) PCR</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">LPW25802</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CCACAATGTACTCAACAATAAAG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse primer for mRNA (S) PCR</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">LPW25803</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TAGCGAATGCTGTAAAACCAG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse primer for mRNA (NS5) PCR</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">LPW25804</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CTCATAAAACTGCCTACCTCT</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse primer for mRNA (E) PCR</td>
</tr>
<tr><td align="center" valign="middle" rowspan="1" colspan="1">LPW18468</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CCAAGATACACATTATTCAACG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse primer for mRNA (M) PCR</td>
</tr>
<tr><td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">LPW18469</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">GAGTAATTCCAGAGAACCAAGA</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">Reverse primer for mRNA (N) PCR</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
<affiliations><list><country><li>Hong Kong</li>
<li>République populaire de Chine</li>
</country>
<region><li>Zhejiang</li>
</region>
<settlement><li>Hangzhou</li>
</settlement>
<orgName><li>Université de Zhejiang</li>
</orgName>
</list>
<tree><noCountry><name sortKey="Fan, Rachel Y Y" sort="Fan, Rachel Y Y" uniqKey="Fan R" first="Rachel Y. Y." last="Fan">Rachel Y. Y. Fan</name>
<name sortKey="Joseph, Sunitha" sort="Joseph, Sunitha" uniqKey="Joseph S" first="Sunitha" last="Joseph">Sunitha Joseph</name>
<name sortKey="Lau, Candy C Y" sort="Lau, Candy C Y" uniqKey="Lau C" first="Candy C. Y." last="Lau">Candy C. Y. Lau</name>
<name sortKey="Tsang, Alan K L" sort="Tsang, Alan K L" uniqKey="Tsang A" first="Alan K. L." last="Tsang">Alan K. L. Tsang</name>
<name sortKey="Tsang, Chi Ching" sort="Tsang, Chi Ching" uniqKey="Tsang C" first="Chi-Ching" last="Tsang">Chi-Ching Tsang</name>
<name sortKey="Wernery, Renate" sort="Wernery, Renate" uniqKey="Wernery R" first="Renate" last="Wernery">Renate Wernery</name>
<name sortKey="Wernery, Ulrich" sort="Wernery, Ulrich" uniqKey="Wernery U" first="Ulrich" last="Wernery">Ulrich Wernery</name>
<name sortKey="Wong, Emily Y M" sort="Wong, Emily Y M" uniqKey="Wong E" first="Emily Y. M." last="Wong">Emily Y. M. Wong</name>
<name sortKey="Yip, Cyril C Y" sort="Yip, Cyril C Y" uniqKey="Yip C" first="Cyril C. Y." last="Yip">Cyril C. Y. Yip</name>
</noCountry>
<country name="Hong Kong"><noRegion><name sortKey="Woo, Patrick C Y" sort="Woo, Patrick C Y" uniqKey="Woo P" first="Patrick C. Y." last="Woo">Patrick C. Y. Woo</name>
</noRegion>
<name sortKey="Lau, Susanna K P" sort="Lau, Susanna K P" uniqKey="Lau S" first="Susanna K. P." last="Lau">Susanna K. P. Lau</name>
<name sortKey="Lau, Susanna K P" sort="Lau, Susanna K P" uniqKey="Lau S" first="Susanna K. P." last="Lau">Susanna K. P. Lau</name>
<name sortKey="Woo, Patrick C Y" sort="Woo, Patrick C Y" uniqKey="Woo P" first="Patrick C. Y." last="Woo">Patrick C. Y. Woo</name>
<name sortKey="Yuen, Kwok Yung" sort="Yuen, Kwok Yung" uniqKey="Yuen K" first="Kwok-Yung" last="Yuen">Kwok-Yung Yuen</name>
<name sortKey="Yuen, Kwok Yung" sort="Yuen, Kwok Yung" uniqKey="Yuen K" first="Kwok-Yung" last="Yuen">Kwok-Yung Yuen</name>
</country>
<country name="République populaire de Chine"><region name="Zhejiang"><name sortKey="Woo, Patrick C Y" sort="Woo, Patrick C Y" uniqKey="Woo P" first="Patrick C. Y." last="Woo">Patrick C. Y. Woo</name>
</region>
<name sortKey="Lau, Susanna K P" sort="Lau, Susanna K P" uniqKey="Lau S" first="Susanna K. P." last="Lau">Susanna K. P. Lau</name>
<name sortKey="Yuen, Kwok Yung" sort="Yuen, Kwok Yung" uniqKey="Yuen K" first="Kwok-Yung" last="Yuen">Kwok-Yung Yuen</name>
</country>
</tree>
</affiliations>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Sante/explor/MersV1/Data/Pmc/Checkpoint
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000B24 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd -nk 000B24 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Sante |area= MersV1 |flux= Pmc |étape= Checkpoint |type= RBID |clé= PMC:4881517 |texte= Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23 }}
Pour générer des pages wiki
HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/RBID.i -Sk "pubmed:27164099" \ | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd \ | NlmPubMed2Wicri -a MersV1
![]() | This area was generated with Dilib version V0.6.33. | ![]() |