Serveur d'exploration MERS

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Isolation of Middle East Respiratory Syndrome Coronavirus from a Patient of the 2015 Korean Outbreak

Identifieur interne : 000B23 ( Pmc/Checkpoint ); précédent : 000B22; suivant : 000B24

Isolation of Middle East Respiratory Syndrome Coronavirus from a Patient of the 2015 Korean Outbreak

Auteurs : Wan Beom Park [Corée du Sud] ; Nak-Jung Kwon [Corée du Sud] ; Pyoeng Gyun Choe [Corée du Sud] ; Su-Jin Choi [Corée du Sud] ; Hong Sang Oh [Corée du Sud] ; Sang Min Lee [Corée du Sud] ; Hyonyong Chong [Corée du Sud] ; Jong-Il Kim [Corée du Sud] ; Kyoung-Ho Song [Corée du Sud] ; Ji Hwan Bang [Corée du Sud] ; Eu Suk Kim [Corée du Sud] ; Hong-Bin Kim [Corée du Sud] ; Sang Won Park [Corée du Sud] ; Nam Joong Kim [Corée du Sud] ; Myoung-Don Oh [Corée du Sud]

Source :

RBID : PMC:4729515

Abstract

During the 2015 outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) in Korea, 186 persons were infected, resulting in 38 fatalities. We isolated MERS-CoV from the oropharyngeal sample obtained from a patient of the outbreak. Cytopathic effects showing detachment and rounding of cells were observed in Vero cell cultures 3 days after inoculation of the sample. Spherical virus particles were observed by transmission electron microscopy. Full-length genome sequence of the virus isolate was obtained and phylogenetic analyses showed that it clustered with clade B of MERS-CoV.


Url:
DOI: 10.3346/jkms.2016.31.2.315
PubMed: 26839489
PubMed Central: 4729515


Affiliations:


Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:4729515

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Isolation of Middle East Respiratory Syndrome Coronavirus from a Patient of the 2015 Korean Outbreak</title>
<author>
<name sortKey="Park, Wan Beom" sort="Park, Wan Beom" uniqKey="Park W" first="Wan Beom" last="Park">Wan Beom Park</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
<affiliation wicri:level="3">
<nlm:aff id="A2">Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kwon, Nak Jung" sort="Kwon, Nak Jung" uniqKey="Kwon N" first="Nak-Jung" last="Kwon">Nak-Jung Kwon</name>
<affiliation wicri:level="3">
<nlm:aff id="A3">Macrogen, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Macrogen, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Choe, Pyoeng Gyun" sort="Choe, Pyoeng Gyun" uniqKey="Choe P" first="Pyoeng Gyun" last="Choe">Pyoeng Gyun Choe</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Choi, Su Jin" sort="Choi, Su Jin" uniqKey="Choi S" first="Su-Jin" last="Choi">Su-Jin Choi</name>
<affiliation wicri:level="3">
<nlm:aff id="A2">Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Oh, Hong Sang" sort="Oh, Hong Sang" uniqKey="Oh H" first="Hong Sang" last="Oh">Hong Sang Oh</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Lee, Sang Min" sort="Lee, Sang Min" uniqKey="Lee S" first="Sang Min" last="Lee">Sang Min Lee</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Chong, Hyonyong" sort="Chong, Hyonyong" uniqKey="Chong H" first="Hyonyong" last="Chong">Hyonyong Chong</name>
<affiliation wicri:level="3">
<nlm:aff id="A3">Macrogen, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Macrogen, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kim, Jong Il" sort="Kim, Jong Il" uniqKey="Kim J" first="Jong-Il" last="Kim">Jong-Il Kim</name>
<affiliation wicri:level="3">
<nlm:aff id="A4">Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Song, Kyoung Ho" sort="Song, Kyoung Ho" uniqKey="Song K" first="Kyoung-Ho" last="Song">Kyoung-Ho Song</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Bang, Ji Hwan" sort="Bang, Ji Hwan" uniqKey="Bang J" first="Ji Hwan" last="Bang">Ji Hwan Bang</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kim, Eu Suk" sort="Kim, Eu Suk" uniqKey="Kim E" first="Eu Suk" last="Kim">Eu Suk Kim</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kim, Hong Bin" sort="Kim, Hong Bin" uniqKey="Kim H" first="Hong-Bin" last="Kim">Hong-Bin Kim</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Park, Sang Won" sort="Park, Sang Won" uniqKey="Park S" first="Sang Won" last="Park">Sang Won Park</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kim, Nam Joong" sort="Kim, Nam Joong" uniqKey="Kim N" first="Nam Joong" last="Kim">Nam Joong Kim</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
<affiliation wicri:level="3">
<nlm:aff id="A2">Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Oh, Myoung Don" sort="Oh, Myoung Don" uniqKey="Oh M" first="Myoung-Don" last="Oh">Myoung-Don Oh</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
<affiliation wicri:level="3">
<nlm:aff id="A2">Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">26839489</idno>
<idno type="pmc">4729515</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4729515</idno>
<idno type="RBID">PMC:4729515</idno>
<idno type="doi">10.3346/jkms.2016.31.2.315</idno>
<date when="2016">2016</date>
<idno type="wicri:Area/Pmc/Corpus">000068</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000068</idno>
<idno type="wicri:Area/Pmc/Curation">000068</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000068</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000B23</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000B23</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Isolation of Middle East Respiratory Syndrome Coronavirus from a Patient of the 2015 Korean Outbreak</title>
<author>
<name sortKey="Park, Wan Beom" sort="Park, Wan Beom" uniqKey="Park W" first="Wan Beom" last="Park">Wan Beom Park</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
<affiliation wicri:level="3">
<nlm:aff id="A2">Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kwon, Nak Jung" sort="Kwon, Nak Jung" uniqKey="Kwon N" first="Nak-Jung" last="Kwon">Nak-Jung Kwon</name>
<affiliation wicri:level="3">
<nlm:aff id="A3">Macrogen, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Macrogen, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Choe, Pyoeng Gyun" sort="Choe, Pyoeng Gyun" uniqKey="Choe P" first="Pyoeng Gyun" last="Choe">Pyoeng Gyun Choe</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Choi, Su Jin" sort="Choi, Su Jin" uniqKey="Choi S" first="Su-Jin" last="Choi">Su-Jin Choi</name>
<affiliation wicri:level="3">
<nlm:aff id="A2">Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Oh, Hong Sang" sort="Oh, Hong Sang" uniqKey="Oh H" first="Hong Sang" last="Oh">Hong Sang Oh</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Lee, Sang Min" sort="Lee, Sang Min" uniqKey="Lee S" first="Sang Min" last="Lee">Sang Min Lee</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Chong, Hyonyong" sort="Chong, Hyonyong" uniqKey="Chong H" first="Hyonyong" last="Chong">Hyonyong Chong</name>
<affiliation wicri:level="3">
<nlm:aff id="A3">Macrogen, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Macrogen, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kim, Jong Il" sort="Kim, Jong Il" uniqKey="Kim J" first="Jong-Il" last="Kim">Jong-Il Kim</name>
<affiliation wicri:level="3">
<nlm:aff id="A4">Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Song, Kyoung Ho" sort="Song, Kyoung Ho" uniqKey="Song K" first="Kyoung-Ho" last="Song">Kyoung-Ho Song</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Bang, Ji Hwan" sort="Bang, Ji Hwan" uniqKey="Bang J" first="Ji Hwan" last="Bang">Ji Hwan Bang</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kim, Eu Suk" sort="Kim, Eu Suk" uniqKey="Kim E" first="Eu Suk" last="Kim">Eu Suk Kim</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kim, Hong Bin" sort="Kim, Hong Bin" uniqKey="Kim H" first="Hong-Bin" last="Kim">Hong-Bin Kim</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Park, Sang Won" sort="Park, Sang Won" uniqKey="Park S" first="Sang Won" last="Park">Sang Won Park</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kim, Nam Joong" sort="Kim, Nam Joong" uniqKey="Kim N" first="Nam Joong" last="Kim">Nam Joong Kim</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
<affiliation wicri:level="3">
<nlm:aff id="A2">Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Oh, Myoung Don" sort="Oh, Myoung Don" uniqKey="Oh M" first="Myoung-Don" last="Oh">Myoung-Don Oh</name>
<affiliation wicri:level="3">
<nlm:aff id="A1">Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Department of Internal Medicine, Seoul National University College of Medicine, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
<affiliation wicri:level="3">
<nlm:aff id="A2">Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul, Korea.</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">Corée du Sud</country>
<wicri:regionArea>Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul</wicri:regionArea>
<placeName>
<settlement type="city">Séoul</settlement>
<region type="capital">Région capitale de Séoul</region>
</placeName>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Journal of Korean Medical Science</title>
<idno type="ISSN">1011-8934</idno>
<idno type="eISSN">1598-6357</idno>
<imprint>
<date when="2016">2016</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>During the 2015 outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) in Korea, 186 persons were infected, resulting in 38 fatalities. We isolated MERS-CoV from the oropharyngeal sample obtained from a patient of the outbreak. Cytopathic effects showing detachment and rounding of cells were observed in Vero cell cultures 3 days after inoculation of the sample. Spherical virus particles were observed by transmission electron microscopy. Full-length genome sequence of the virus isolate was obtained and phylogenetic analyses showed that it clustered with clade B of MERS-CoV.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Chan, Jf" uniqKey="Chan J">JF Chan</name>
</author>
<author>
<name sortKey="Lau, Sk" uniqKey="Lau S">SK Lau</name>
</author>
<author>
<name sortKey="To, Kk" uniqKey="To K">KK To</name>
</author>
<author>
<name sortKey="Cheng, Vc" uniqKey="Cheng V">VC Cheng</name>
</author>
<author>
<name sortKey="Woo, Pc" uniqKey="Woo P">PC Woo</name>
</author>
<author>
<name sortKey="Yuen, Ky" uniqKey="Yuen K">KY Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zumla, A" uniqKey="Zumla A">A Zumla</name>
</author>
<author>
<name sortKey="Hui, Ds" uniqKey="Hui D">DS Hui</name>
</author>
<author>
<name sortKey="Perlman, S" uniqKey="Perlman S">S Perlman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zaki, Am" uniqKey="Zaki A">AM Zaki</name>
</author>
<author>
<name sortKey="Van Boheemen, S" uniqKey="Van Boheemen S">S van Boheemen</name>
</author>
<author>
<name sortKey="Bestebroer, Tm" uniqKey="Bestebroer T">TM Bestebroer</name>
</author>
<author>
<name sortKey="Osterhaus, Ad" uniqKey="Osterhaus A">AD Osterhaus</name>
</author>
<author>
<name sortKey="Fouchier, Ra" uniqKey="Fouchier R">RA Fouchier</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chowell, G" uniqKey="Chowell G">G Chowell</name>
</author>
<author>
<name sortKey="Abdirizak, F" uniqKey="Abdirizak F">F Abdirizak</name>
</author>
<author>
<name sortKey="Lee, S" uniqKey="Lee S">S Lee</name>
</author>
<author>
<name sortKey="Lee, J" uniqKey="Lee J">J Lee</name>
</author>
<author>
<name sortKey="Jung, E" uniqKey="Jung E">E Jung</name>
</author>
<author>
<name sortKey="Nishiura, H" uniqKey="Nishiura H">H Nishiura</name>
</author>
<author>
<name sortKey="Viboud, C" uniqKey="Viboud C">C Viboud</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Breban, R" uniqKey="Breban R">R Breban</name>
</author>
<author>
<name sortKey="Riou, J" uniqKey="Riou J">J Riou</name>
</author>
<author>
<name sortKey="Fontanet, A" uniqKey="Fontanet A">A Fontanet</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cotten, M" uniqKey="Cotten M">M Cotten</name>
</author>
<author>
<name sortKey="Watson, Sj" uniqKey="Watson S">SJ Watson</name>
</author>
<author>
<name sortKey="Kellam, P" uniqKey="Kellam P">P Kellam</name>
</author>
<author>
<name sortKey="Al Rabeeah, Aa" uniqKey="Al Rabeeah A">AA Al-Rabeeah</name>
</author>
<author>
<name sortKey="Makhdoom, Hq" uniqKey="Makhdoom H">HQ Makhdoom</name>
</author>
<author>
<name sortKey="Assiri, A" uniqKey="Assiri A">A Assiri</name>
</author>
<author>
<name sortKey="Al Tawfiq, Ja" uniqKey="Al Tawfiq J">JA Al-Tawfiq</name>
</author>
<author>
<name sortKey="Alhakeem, Rf" uniqKey="Alhakeem R">RF Alhakeem</name>
</author>
<author>
<name sortKey="Madani, H" uniqKey="Madani H">H Madani</name>
</author>
<author>
<name sortKey="Alrabiah, Fa" uniqKey="Alrabiah F">FA AlRabiah</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Edelstein, M" uniqKey="Edelstein M">M Edelstein</name>
</author>
<author>
<name sortKey="Heymann, Dl" uniqKey="Heymann D">DL Heymann</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Oh, Md" uniqKey="Oh M">MD Oh</name>
</author>
<author>
<name sortKey="Choe, Pg" uniqKey="Choe P">PG Choe</name>
</author>
<author>
<name sortKey="Oh, Hs" uniqKey="Oh H">HS Oh</name>
</author>
<author>
<name sortKey="Park, Wb" uniqKey="Park W">WB Park</name>
</author>
<author>
<name sortKey="Lee, Sm" uniqKey="Lee S">SM Lee</name>
</author>
<author>
<name sortKey="Park, J" uniqKey="Park J">J Park</name>
</author>
<author>
<name sortKey="Lee, Sk" uniqKey="Lee S">SK Lee</name>
</author>
<author>
<name sortKey="Song, Js" uniqKey="Song J">JS Song</name>
</author>
<author>
<name sortKey="Kim, Nj" uniqKey="Kim N">NJ Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Graham, L" uniqKey="Graham L">L Graham</name>
</author>
<author>
<name sortKey="Orenstein, Jm" uniqKey="Orenstein J">JM Orenstein</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cotten, M" uniqKey="Cotten M">M Cotten</name>
</author>
<author>
<name sortKey="Lam, Tt" uniqKey="Lam T">TT Lam</name>
</author>
<author>
<name sortKey="Watson, Sj" uniqKey="Watson S">SJ Watson</name>
</author>
<author>
<name sortKey="Palser, Al" uniqKey="Palser A">AL Palser</name>
</author>
<author>
<name sortKey="Petrova, V" uniqKey="Petrova V">V Petrova</name>
</author>
<author>
<name sortKey="Grant, P" uniqKey="Grant P">P Grant</name>
</author>
<author>
<name sortKey="Pybus, Og" uniqKey="Pybus O">OG Pybus</name>
</author>
<author>
<name sortKey="Rambaut, A" uniqKey="Rambaut A">A Rambaut</name>
</author>
<author>
<name sortKey="Guan, Y" uniqKey="Guan Y">Y Guan</name>
</author>
<author>
<name sortKey="Pillay, D" uniqKey="Pillay D">D Pillay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seong, Mw" uniqKey="Seong M">MW Seong</name>
</author>
<author>
<name sortKey="Kim, Sy" uniqKey="Kim S">SY Kim</name>
</author>
<author>
<name sortKey="Corman, Vm" uniqKey="Corman V">VM Corman</name>
</author>
<author>
<name sortKey="Kim, Ts" uniqKey="Kim T">TS Kim</name>
</author>
<author>
<name sortKey="Cho, Si" uniqKey="Cho S">SI Cho</name>
</author>
<author>
<name sortKey="Kim, Mj" uniqKey="Kim M">MJ Kim</name>
</author>
<author>
<name sortKey="Lee, Sj" uniqKey="Lee S">SJ Lee</name>
</author>
<author>
<name sortKey="Lee, Js" uniqKey="Lee J">JS Lee</name>
</author>
<author>
<name sortKey="Seo, Sh" uniqKey="Seo S">SH Seo</name>
</author>
<author>
<name sortKey="Ahn, Js" uniqKey="Ahn J">JS Ahn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, Dw" uniqKey="Kim D">DW Kim</name>
</author>
<author>
<name sortKey="Kim, Yj" uniqKey="Kim Y">YJ Kim</name>
</author>
<author>
<name sortKey="Park, Sh" uniqKey="Park S">SH Park</name>
</author>
<author>
<name sortKey="Yun, Mr" uniqKey="Yun M">MR Yun</name>
</author>
<author>
<name sortKey="Yang, Js" uniqKey="Yang J">JS Yang</name>
</author>
<author>
<name sortKey="Kang, Hj" uniqKey="Kang H">HJ Kang</name>
</author>
<author>
<name sortKey="Han, Yw" uniqKey="Han Y">YW Han</name>
</author>
<author>
<name sortKey="Lee, Hs" uniqKey="Lee H">HS Lee</name>
</author>
<author>
<name sortKey="Man Kim, H" uniqKey="Man Kim H">H Man Kim</name>
</author>
<author>
<name sortKey="Kim, H" uniqKey="Kim H">H Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author>
<name sortKey="Liu, D" uniqKey="Liu D">D Liu</name>
</author>
<author>
<name sortKey="Shi, W" uniqKey="Shi W">W Shi</name>
</author>
<author>
<name sortKey="Lu, R" uniqKey="Lu R">R Lu</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
<author>
<name sortKey="Zhao, Y" uniqKey="Zhao Y">Y Zhao</name>
</author>
<author>
<name sortKey="Deng, Y" uniqKey="Deng Y">Y Deng</name>
</author>
<author>
<name sortKey="Zhou, W" uniqKey="Zhou W">W Zhou</name>
</author>
<author>
<name sortKey="Ren, H" uniqKey="Ren H">H Ren</name>
</author>
<author>
<name sortKey="Wu, J" uniqKey="Wu J">J Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tamura, K" uniqKey="Tamura K">K Tamura</name>
</author>
<author>
<name sortKey="Nei, M" uniqKey="Nei M">M Nei</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tamura, K" uniqKey="Tamura K">K Tamura</name>
</author>
<author>
<name sortKey="Stecher, G" uniqKey="Stecher G">G Stecher</name>
</author>
<author>
<name sortKey="Peterson, D" uniqKey="Peterson D">D Peterson</name>
</author>
<author>
<name sortKey="Filipski, A" uniqKey="Filipski A">A Filipski</name>
</author>
<author>
<name sortKey="Kumar, S" uniqKey="Kumar S">S Kumar</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="brief-report">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">J Korean Med Sci</journal-id>
<journal-id journal-id-type="iso-abbrev">J. Korean Med. Sci</journal-id>
<journal-id journal-id-type="publisher-id">JKMS</journal-id>
<journal-title-group>
<journal-title>Journal of Korean Medical Science</journal-title>
</journal-title-group>
<issn pub-type="ppub">1011-8934</issn>
<issn pub-type="epub">1598-6357</issn>
<publisher>
<publisher-name>The Korean Academy of Medical Sciences</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">26839489</article-id>
<article-id pub-id-type="pmc">4729515</article-id>
<article-id pub-id-type="doi">10.3346/jkms.2016.31.2.315</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Brief Communication</subject>
<subj-group subj-group-type="subheading">
<subject>Infectious Diseases, Microbiology & Parasitology</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Isolation of Middle East Respiratory Syndrome Coronavirus from a Patient of the 2015 Korean Outbreak</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0003-0022-9625</contrib-id>
<name>
<surname>Park</surname>
<given-names>Wan Beom</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
<xref ref-type="aff" rid="A2">2</xref>
<xref ref-type="author-notes" rid="afn1">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0003-0874-4146</contrib-id>
<name>
<surname>Kwon</surname>
<given-names>Nak-Jung</given-names>
</name>
<xref ref-type="aff" rid="A3">3</xref>
<xref ref-type="author-notes" rid="afn1">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0001-6794-7918</contrib-id>
<name>
<surname>Choe</surname>
<given-names>Pyoeng Gyun</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0001-8732-3950</contrib-id>
<name>
<surname>Choi</surname>
<given-names>Su-Jin</given-names>
</name>
<xref ref-type="aff" rid="A2">2</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0002-4535-6305</contrib-id>
<name>
<surname>Oh</surname>
<given-names>Hong Sang</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0002-1388-9318</contrib-id>
<name>
<surname>Lee</surname>
<given-names>Sang Min</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0001-6928-8805</contrib-id>
<name>
<surname>Chong</surname>
<given-names>Hyonyong</given-names>
</name>
<xref ref-type="aff" rid="A3">3</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0002-7240-3744</contrib-id>
<name>
<surname>Kim</surname>
<given-names>Jong-Il</given-names>
</name>
<xref ref-type="aff" rid="A4">4</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0002-4517-3840</contrib-id>
<name>
<surname>Song</surname>
<given-names>Kyoung-Ho</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0002-7628-1182</contrib-id>
<name>
<surname>Bang</surname>
<given-names>Ji Hwan</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0001-7132-0157</contrib-id>
<name>
<surname>Kim</surname>
<given-names>Eu Suk</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0001-6262-372X</contrib-id>
<name>
<surname>Kim</surname>
<given-names>Hong-Bin</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0002-0550-1897</contrib-id>
<name>
<surname>Park</surname>
<given-names>Sang Won</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0001-6793-9467</contrib-id>
<name>
<surname>Kim</surname>
<given-names>Nam Joong</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
<xref ref-type="aff" rid="A2">2</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<contrib-id contrib-id-type="orcid" authenticated="true">http://orcid.org/0000-0002-2344-7695</contrib-id>
<name>
<surname>Oh</surname>
<given-names>Myoung-don</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
<xref ref-type="aff" rid="A2">2</xref>
</contrib>
</contrib-group>
<aff id="A1">
<label>1</label>
Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Korea.</aff>
<aff id="A2">
<label>2</label>
Laboratory of Infection & Immunity, Seoul National University Hospital Biomedical Research Institute, Seoul, Korea.</aff>
<aff id="A3">
<label>3</label>
Macrogen, Seoul, Korea.</aff>
<aff id="A4">
<label>4</label>
Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul, Korea.</aff>
<author-notes>
<corresp>Address for Correspondence: Myoung-don Oh, MD. Department of Internal Medicine, Seoul National University College of Medicine, 103, Daehak-ro, Jongno-gu, Seoul 03080, Korea. Tel: +82.2-2072-2945, Fax: +82.2-762-9662,
<email>mdohmd@snu.ac.kr</email>
</corresp>
<fn id="afn1" fn-type="equal">
<p>*Wan Beom Park and Nak-Jung Kwon equally contributed to the study.</p>
</fn>
</author-notes>
<pub-date pub-type="ppub">
<month>2</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="epub">
<day>14</day>
<month>1</month>
<year>2016</year>
</pub-date>
<volume>31</volume>
<issue>2</issue>
<fpage>315</fpage>
<lpage>320</lpage>
<history>
<date date-type="received">
<day>29</day>
<month>12</month>
<year>2015</year>
</date>
<date date-type="accepted">
<day>11</day>
<month>1</month>
<year>2016</year>
</date>
</history>
<permissions>
<copyright-statement>© 2016 The Korean Academy of Medical Sciences.</copyright-statement>
<copyright-year>2016</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc/4.0/">
<license-p>This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by-nc/4.0/">http://creativecommons.org/licenses/by-nc/4.0/</ext-link>
) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
</license>
</permissions>
<abstract>
<p>During the 2015 outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) in Korea, 186 persons were infected, resulting in 38 fatalities. We isolated MERS-CoV from the oropharyngeal sample obtained from a patient of the outbreak. Cytopathic effects showing detachment and rounding of cells were observed in Vero cell cultures 3 days after inoculation of the sample. Spherical virus particles were observed by transmission electron microscopy. Full-length genome sequence of the virus isolate was obtained and phylogenetic analyses showed that it clustered with clade B of MERS-CoV.</p>
</abstract>
<kwd-group kwd-group-type="author">
<kwd>Middle East Respiratory Syndrome</kwd>
<kwd>Middle East Respiratory Syndrome Coronavirus</kwd>
<kwd>Microscopy, Electron</kwd>
<kwd>Phylogeny</kwd>
<kwd>Korea</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="F1" fig-type="figure" orientation="portrait" position="float">
<label>Fig. 1</label>
<caption>
<title>Cytopathic effects of MERS-CoV in Vero cell cultures and Electron microscopy image of MERS-CoV. Vero cells were inoculated with oropharyngeal swab sample. (
<bold>A</bold>
) Vero cell cultures in negative control. (
<bold>B</bold>
) Cytopathic effects (rounding and detachment of cells) in Vero cell cultures 3 days after inoculation of the sample. (
<bold>C, D</bold>
) Transmission electron microscopy image of Vero cells infected with MERS-CoV. White arrow denotes nuclear membrane. Brown scale bar indicates 100 μm (A and B). Black scale bar indicates 500 nm (
<bold>C</bold>
) and white scale bar does 200 nm (
<bold>D</bold>
).</title>
</caption>
<graphic xlink:href="jkms-31-315-g001"></graphic>
</fig>
<fig id="F2" fig-type="figure" orientation="portrait" position="float">
<label>Fig. 2</label>
<caption>
<title>Molecular phylogenetic analysis. Phylogenetic tree on complete genome (
<bold>A</bold>
), S genes (
<bold>B</bold>
), and ORF1ab genes (
<bold>C</bold>
) for the 101 gene sequences of MERS-CoV. The evolutionary history was inferred by using the maximum likelihood method based on the Tamura-Nei model (
<xref rid="B16" ref-type="bibr">16</xref>
). Evolutionary analyses were conducted in MEGA6 (
<xref rid="B17" ref-type="bibr">17</xref>
). Red box indicates our virus isolate.</title>
</caption>
<graphic xlink:href="jkms-31-315-g002"></graphic>
</fig>
<table-wrap id="T1" orientation="portrait" position="float">
<label>Table 1</label>
<caption>
<title>PCR primer pairs used in this study</title>
</caption>
<alternatives>
<graphic xlink:href="jkms-31-315-i001"></graphic>
<table frame="hsides" rules="rows">
<thead>
<tr>
<th valign="top" align="left" rowspan="1" colspan="1">No.</th>
<th valign="top" align="center" rowspan="1" colspan="1">Forward</th>
<th valign="top" align="center" rowspan="1" colspan="1">sequence (5'-->3')</th>
<th valign="top" align="center" rowspan="1" colspan="1">Reverse</th>
<th valign="top" align="center" rowspan="1" colspan="1">sequence (5'-->3')</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="right" rowspan="1" colspan="1">1</td>
<td valign="top" align="left" rowspan="1" colspan="1">FEP_1_F</td>
<td valign="top" align="left" rowspan="1" colspan="1">GATTTAAGTGAATAGCTTGGCTATCTC</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_70342_1_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">GGAATATTAGAGACTCCCTGCCG</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="1" colspan="1">2</td>
<td valign="top" align="left" rowspan="1" colspan="1">2497F</td>
<td valign="top" align="left" rowspan="1" colspan="1">TCCCATCGGGAACCTATTACTGTG</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_68466_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGTAACCACCATTAGTGCGGAC</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="1" colspan="1">3</td>
<td valign="top" align="left" rowspan="1" colspan="1">4477F</td>
<td valign="top" align="left" rowspan="1" colspan="1">ACGTTAAGTTAAACCCTTCAGAAG</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_67825_1_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">AATGAAGCCCTAAATAGTAACTTCACT</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="2" colspan="1">4</td>
<td valign="top" align="left" rowspan="1" colspan="1">new2_15F_6427</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGCTTAGATTGCACACCGTT</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_68526_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">AGGTGGTTAACCGGAAAGCTAAA</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">6506F</td>
<td valign="top" align="left" rowspan="1" colspan="1">AGAATTTGCTACCCGCACTTTCACTG</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_68526_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">AGGTGGTTAACCGGAAAGCTAAA</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="2" colspan="1">5</td>
<td valign="top" align="left" rowspan="1" colspan="1">new2_19F_8393</td>
<td valign="top" align="left" rowspan="1" colspan="1">GGATGCACTTAAACGACAGA</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_33984_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">GTGTAACCAACACTACCACAAGAAC</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">8496F</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGGTGCTCCTACATGGTTTAATGCG</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_33984_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">GTGTAACCAACACTACCACAAGAAC</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="1" colspan="1">6</td>
<td valign="top" align="left" rowspan="1" colspan="1">10477F</td>
<td valign="top" align="left" rowspan="1" colspan="1">ACACCAAGGAGGGTAGTGTGATC</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_67887_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">GAATTACAACGCGAAGTTTATTTGAAG</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="2" colspan="1">7</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_2977_F</td>
<td valign="top" align="left" rowspan="1" colspan="1">AAGGCTTTGCAGAAGGCTGTTA</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_68115_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">GAATTACAACGCGAAGTTTATTTGAAG</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">12488F</td>
<td valign="top" align="left" rowspan="1" colspan="1">AGGTAGTCACATATCCCTCGCTTAAC</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_68115_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">TCATCAACTCCTTAAGAGAGAGCCTAT</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="1" colspan="1">8</td>
<td valign="top" align="left" rowspan="1" colspan="1">14481F</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGGATGTTAGTCTCCATAGACATAG</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_34102_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGTAATCACCACTTTCAGTCCAGT</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="1" colspan="1">9</td>
<td valign="top" align="left" rowspan="1" colspan="1">16476F</td>
<td valign="top" align="left" rowspan="1" colspan="1">TCGGCTTATACAAGAATATGTGCAC</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_981_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">CATGAGCCCAACAAACAAACGTA</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="1" colspan="1">10</td>
<td valign="top" align="left" rowspan="1" colspan="1">18490F</td>
<td valign="top" align="left" rowspan="1" colspan="1">ACGACGTATAGTGCAAATGTTGTC</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_69145_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">AGCTTTAAATCTATAACAGAACACACC</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="2" colspan="1">11</td>
<td valign="top" align="left" rowspan="1" colspan="1">new2_42F_20357</td>
<td valign="top" align="left" rowspan="1" colspan="1">AAGAAGCAACAGGAAGGTCA</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_34878_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">TAGAAGGCAGCCCAAGCTTTT</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">20490F</td>
<td valign="top" align="left" rowspan="1" colspan="1">AAGACCTTGGCGTAGTATCCAAGG</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_34878_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">TAGAAGGCAGCCCAAGCTTTT</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="2" colspan="1">12</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_67088_1_F</td>
<td valign="top" align="left" rowspan="1" colspan="1">CCACCTTGCCTGTTTATGATACTATTA</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_72579_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">CTGTTTGCATAGCTCCCAGAG</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">22481F</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGATTTGTCACAACTCCACTGC</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_72579_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">CTGTTTGCATAGCTCCCAGAG</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="2" colspan="1">13</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_66781_F</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGGACTGCTGGCTTATCCTC</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_66820_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">GCTTAAATCTATGTATGTTAGCACAGT</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">24512F</td>
<td valign="top" align="left" rowspan="1" colspan="1">TCAGAAGGTTCAGGATGCTGTGAAC</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_66820_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">GCTTAAATCTATGTATGTTAGCACAGT</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="1" colspan="1">14</td>
<td valign="top" align="left" rowspan="1" colspan="1">26470F</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGAGTTCGCCTTGCTGCGCAAAAC</td>
<td valign="top" align="left" rowspan="1" colspan="1">FCO_TM58_69858_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGTAATTACCTGCCTTATATCTATGGT</td>
</tr>
<tr>
<td valign="top" align="right" rowspan="2" colspan="1">15</td>
<td valign="top" align="left" rowspan="1" colspan="1">new2_59F_28427</td>
<td valign="top" align="left" rowspan="1" colspan="1">GGCAAAGCTACGGAACTAAT</td>
<td valign="top" align="left" rowspan="1" colspan="1">FEP_3_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">GCAAATCATCTAATTAGCCTAATCTAATTG</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">28490F</td>
<td valign="top" align="left" rowspan="1" colspan="1">AACTTGCATTGCTTCGAGCTTAGG</td>
<td valign="top" align="left" rowspan="1" colspan="1">FEP_3_R</td>
<td valign="top" align="left" rowspan="1" colspan="1">GCAAATCATCTAATTAGCCTAATCTAATTG</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>Corée du Sud</li>
</country>
<region>
<li>Région capitale de Séoul</li>
</region>
<settlement>
<li>Séoul</li>
</settlement>
</list>
<tree>
<country name="Corée du Sud">
<region name="Région capitale de Séoul">
<name sortKey="Park, Wan Beom" sort="Park, Wan Beom" uniqKey="Park W" first="Wan Beom" last="Park">Wan Beom Park</name>
</region>
<name sortKey="Bang, Ji Hwan" sort="Bang, Ji Hwan" uniqKey="Bang J" first="Ji Hwan" last="Bang">Ji Hwan Bang</name>
<name sortKey="Choe, Pyoeng Gyun" sort="Choe, Pyoeng Gyun" uniqKey="Choe P" first="Pyoeng Gyun" last="Choe">Pyoeng Gyun Choe</name>
<name sortKey="Choi, Su Jin" sort="Choi, Su Jin" uniqKey="Choi S" first="Su-Jin" last="Choi">Su-Jin Choi</name>
<name sortKey="Chong, Hyonyong" sort="Chong, Hyonyong" uniqKey="Chong H" first="Hyonyong" last="Chong">Hyonyong Chong</name>
<name sortKey="Kim, Eu Suk" sort="Kim, Eu Suk" uniqKey="Kim E" first="Eu Suk" last="Kim">Eu Suk Kim</name>
<name sortKey="Kim, Hong Bin" sort="Kim, Hong Bin" uniqKey="Kim H" first="Hong-Bin" last="Kim">Hong-Bin Kim</name>
<name sortKey="Kim, Jong Il" sort="Kim, Jong Il" uniqKey="Kim J" first="Jong-Il" last="Kim">Jong-Il Kim</name>
<name sortKey="Kim, Nam Joong" sort="Kim, Nam Joong" uniqKey="Kim N" first="Nam Joong" last="Kim">Nam Joong Kim</name>
<name sortKey="Kim, Nam Joong" sort="Kim, Nam Joong" uniqKey="Kim N" first="Nam Joong" last="Kim">Nam Joong Kim</name>
<name sortKey="Kwon, Nak Jung" sort="Kwon, Nak Jung" uniqKey="Kwon N" first="Nak-Jung" last="Kwon">Nak-Jung Kwon</name>
<name sortKey="Lee, Sang Min" sort="Lee, Sang Min" uniqKey="Lee S" first="Sang Min" last="Lee">Sang Min Lee</name>
<name sortKey="Oh, Hong Sang" sort="Oh, Hong Sang" uniqKey="Oh H" first="Hong Sang" last="Oh">Hong Sang Oh</name>
<name sortKey="Oh, Myoung Don" sort="Oh, Myoung Don" uniqKey="Oh M" first="Myoung-Don" last="Oh">Myoung-Don Oh</name>
<name sortKey="Oh, Myoung Don" sort="Oh, Myoung Don" uniqKey="Oh M" first="Myoung-Don" last="Oh">Myoung-Don Oh</name>
<name sortKey="Park, Sang Won" sort="Park, Sang Won" uniqKey="Park S" first="Sang Won" last="Park">Sang Won Park</name>
<name sortKey="Park, Wan Beom" sort="Park, Wan Beom" uniqKey="Park W" first="Wan Beom" last="Park">Wan Beom Park</name>
<name sortKey="Song, Kyoung Ho" sort="Song, Kyoung Ho" uniqKey="Song K" first="Kyoung-Ho" last="Song">Kyoung-Ho Song</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/MersV1/Data/Pmc/Checkpoint
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000B23 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd -nk 000B23 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    MersV1
   |flux=    Pmc
   |étape=   Checkpoint
   |type=    RBID
   |clé=     PMC:4729515
   |texte=   Isolation of Middle East Respiratory Syndrome Coronavirus from a Patient of the 2015 Korean Outbreak
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/RBID.i   -Sk "pubmed:26839489" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd   \
       | NlmPubMed2Wicri -a MersV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Mon Apr 20 23:26:43 2020. Site generation: Sat Mar 27 09:06:09 2021