MersV1, Main, Exploration, bibRecord, 004D05

An oligonucleotide probe for the detection of hepatitis B virus DNA in serum

Identifieur interne : 004D05 ( Main/Exploration ); précédent : 004D04; suivant : 004D06

An oligonucleotide probe for the detection of hepatitis B virus DNA in serum

Auteurs : Hsiang Ju Lin [République populaire de Chine] ; Pui-Chee Wu [République populaire de Chine] ; Ching-Lung Lai [République populaire de Chine]

Source :

Journal of Virological Methods [ 0166-0934 ] ; 1987.

RBID : ISTEX:E0363C795469185CFEA8E1AC7E1B7445F836D341

English descriptors

Teeft :
- Academic press, Assay, Dextran sulfate, Different carriers, Hbeag, Hbsag, Hepatitis, Hepatocellular carcinoma, Hong kong, Hybridization, Hybridization medium, Hybridization period, Nitrocellulose membranes, Nonspecific binding, Nucleic, Nucleic acids, Nucleotide sequence, Nylon membranes, Oligonucleotide, Oligonucleotide probe, Oligonucleotide probes, Polyethylene glycol, Probe, Serum hepatitis, Serum samples, Serum specimens, Specific activity, Testing serum, Tiollais, Viral.

Abstract

Abstract: A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d (CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays was comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.

Url:

https://api.istex.fr/ark:/67375/6H6-W6WD54TZ-T/fulltext.pdf

DOI: 10.1016/0166-0934(87)90057-7

Affiliations:

République populaire de Chine

Links toward previous steps (curation, corpus...)

to stream Istex, to step Corpus: 000366
to stream Istex, to step Curation: 000366
to stream Istex, to step Checkpoint: 002185
to stream Main, to step Merge: 004D85
to stream Main, to step Curation: 004D05

Le document en format XML

<record><TEI wicri:istexFullTextTei="biblStruct"><teiHeader><fileDesc><titleStmt><title>An oligonucleotide probe for the detection of hepatitis B virus DNA in serum</title>
<author><name sortKey="Hsiang Ju Lin" sort="Hsiang Ju Lin" uniqKey="Hsiang Ju Lin" first="" last="Hsiang Ju Lin">Hsiang Ju Lin</name>
</author>
<author><name sortKey="Pui Chee Wu" sort="Pui Chee Wu" uniqKey="Pui Chee Wu" first="" last="Pui-Chee Wu">Pui-Chee Wu</name>
</author>
<author><name sortKey="Ching Lung Lai" sort="Ching Lung Lai" uniqKey="Ching Lung Lai" first="" last="Ching-Lung Lai">Ching-Lung Lai</name>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">ISTEX</idno>
<idno type="RBID">ISTEX:E0363C795469185CFEA8E1AC7E1B7445F836D341</idno>
<date when="1987" year="1987">1987</date>
<idno type="doi">10.1016/0166-0934(87)90057-7</idno>
<idno type="url">https://api.istex.fr/ark:/67375/6H6-W6WD54TZ-T/fulltext.pdf</idno>
<idno type="wicri:Area/Istex/Corpus">000366</idno>
<idno type="wicri:explorRef" wicri:stream="Istex" wicri:step="Corpus" wicri:corpus="ISTEX">000366</idno>
<idno type="wicri:Area/Istex/Curation">000366</idno>
<idno type="wicri:Area/Istex/Checkpoint">002185</idno>
<idno type="wicri:explorRef" wicri:stream="Istex" wicri:step="Checkpoint">002185</idno>
<idno type="wicri:doubleKey">0166-0934:1987:Hsiang Ju Lin:an:oligonucleotide:probe</idno>
<idno type="wicri:Area/Main/Merge">004D85</idno>
<idno type="wicri:Area/Main/Curation">004D05</idno>
<idno type="wicri:Area/Main/Exploration">004D05</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title level="a">An oligonucleotide probe for the detection of hepatitis B virus DNA in serum</title>
<author><name sortKey="Hsiang Ju Lin" sort="Hsiang Ju Lin" uniqKey="Hsiang Ju Lin" first="" last="Hsiang Ju Lin">Hsiang Ju Lin</name>
<affiliation wicri:level="1"><country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Clinical Biochemistry Unit, University of Hong Kong, Hong Kong</wicri:regionArea>
<wicri:noRegion>Hong Kong</wicri:noRegion>
</affiliation>
</author>
<author><name sortKey="Pui Chee Wu" sort="Pui Chee Wu" uniqKey="Pui Chee Wu" first="" last="Pui-Chee Wu">Pui-Chee Wu</name>
<affiliation wicri:level="1"><country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Pathology, University of Hong Kong, Hong Kong</wicri:regionArea>
<wicri:noRegion>Hong Kong</wicri:noRegion>
</affiliation>
</author>
<author><name sortKey="Ching Lung Lai" sort="Ching Lung Lai" uniqKey="Ching Lung Lai" first="" last="Ching-Lung Lai">Ching-Lung Lai</name>
<affiliation wicri:level="1"><country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Medicine, University of Hong Kong, Hong Kong</wicri:regionArea>
<wicri:noRegion>Hong Kong</wicri:noRegion>
</affiliation>
</author>
</analytic>
<monogr></monogr>
<series><title level="j">Journal of Virological Methods</title>
<title level="j" type="abbrev">VIRMET</title>
<idno type="ISSN">0166-0934</idno>
<imprint><publisher>ELSEVIER</publisher>
<date type="published" when="1987">1987</date>
<biblScope unit="volume">15</biblScope>
<biblScope unit="issue">2</biblScope>
<biblScope unit="page" from="139">139</biblScope>
<biblScope unit="page" to="149">149</biblScope>
</imprint>
<idno type="ISSN">0166-0934</idno>
</series>
</biblStruct>
</sourceDesc>
<seriesStmt><idno type="ISSN">0166-0934</idno>
</seriesStmt>
</fileDesc>
<profileDesc><textClass><keywords scheme="Teeft" xml:lang="en"><term>Academic press</term>
<term>Assay</term>
<term>Dextran sulfate</term>
<term>Different carriers</term>
<term>Hbeag</term>
<term>Hbsag</term>
<term>Hepatitis</term>
<term>Hepatocellular carcinoma</term>
<term>Hong kong</term>
<term>Hybridization</term>
<term>Hybridization medium</term>
<term>Hybridization period</term>
<term>Nitrocellulose membranes</term>
<term>Nonspecific binding</term>
<term>Nucleic</term>
<term>Nucleic acids</term>
<term>Nucleotide sequence</term>
<term>Nylon membranes</term>
<term>Oligonucleotide</term>
<term>Oligonucleotide probe</term>
<term>Oligonucleotide probes</term>
<term>Polyethylene glycol</term>
<term>Probe</term>
<term>Serum hepatitis</term>
<term>Serum samples</term>
<term>Serum specimens</term>
<term>Specific activity</term>
<term>Testing serum</term>
<term>Tiollais</term>
<term>Viral</term>
</keywords>
</textClass>
<langUsage><language ident="en">en</language>
</langUsage>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en">Abstract: A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d (CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays was comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.</div>
</front>
</TEI>
<affiliations><list><country><li>République populaire de Chine</li>
</country>
</list>
<tree><country name="République populaire de Chine"><noRegion><name sortKey="Hsiang Ju Lin" sort="Hsiang Ju Lin" uniqKey="Hsiang Ju Lin" first="" last="Hsiang Ju Lin">Hsiang Ju Lin</name>
</noRegion>
<name sortKey="Ching Lung Lai" sort="Ching Lung Lai" uniqKey="Ching Lung Lai" first="" last="Ching-Lung Lai">Ching-Lung Lai</name>
<name sortKey="Pui Chee Wu" sort="Pui Chee Wu" uniqKey="Pui Chee Wu" first="" last="Pui-Chee Wu">Pui-Chee Wu</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/MersV1/Data/Main/Exploration

HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 004D05 | SxmlIndent | more

HfdSelect -h $EXPLOR_AREA/Data/Main/Exploration/biblio.hfd -nk 004D05 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    MersV1
   |flux=    Main
   |étape=   Exploration
   |type=    RBID
   |clé=     ISTEX:E0363C795469185CFEA8E1AC7E1B7445F836D341
   |texte=   An oligonucleotide probe for the detection of hepatitis B virus DNA in serum
}}

This area was generated with Dilib version V0.6.33.
Data generation: Mon Apr 20 23:26:43 2020. Site generation: Sat Mar 27 09:06:09 2021

	Serveur d'exploration MERS
	Attention, ce site est en cours de développement ! Attention, site généré par des moyens informatiques à partir de corpus bruts. Les informations ne sont donc pas validées.

Serveur d'exploration MERS

An oligonucleotide probe for the detection of hepatitis B virus DNA in serum

An oligonucleotide probe for the detection of hepatitis B virus DNA in serum

Source :

English descriptors

Abstract

Links toward previous steps (curation, corpus...)

Le document en format XML

Pour manipuler ce document sous Unix (Dilib)

Pour mettre un lien sur cette page dans le réseau Wicri