An oligonucleotide probe for the detection of hepatitis B virus DNA in serum
Identifieur interne : 000366 ( Istex/Curation ); précédent : 000365; suivant : 000367An oligonucleotide probe for the detection of hepatitis B virus DNA in serum
Auteurs : Hsiang Ju Lin [République populaire de Chine] ; Pui-Chee Wu [République populaire de Chine] ; Ching-Lung Lai [République populaire de Chine]Source :
- Journal of Virological Methods [ 0166-0934 ] ; 1987.
English descriptors
- Teeft :
- Academic press, Assay, Dextran sulfate, Different carriers, Hbeag, Hbsag, Hepatitis, Hepatocellular carcinoma, Hong kong, Hybridization, Hybridization medium, Hybridization period, Nitrocellulose membranes, Nonspecific binding, Nucleic, Nucleic acids, Nucleotide sequence, Nylon membranes, Oligonucleotide, Oligonucleotide probe, Oligonucleotide probes, Polyethylene glycol, Probe, Serum hepatitis, Serum samples, Serum specimens, Specific activity, Testing serum, Tiollais, Viral.
Abstract
Abstract: A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d (CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays was comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.
Url:
DOI: 10.1016/0166-0934(87)90057-7
Links toward previous steps (curation, corpus...)
- to stream Istex, to step Corpus: Pour aller vers cette notice dans l'étape Curation :000366
Links to Exploration step
ISTEX:E0363C795469185CFEA8E1AC7E1B7445F836D341Le document en format XML
<record><TEI wicri:istexFullTextTei="biblStruct"><teiHeader><fileDesc><titleStmt><title>An oligonucleotide probe for the detection of hepatitis B virus DNA in serum</title>
<author><name sortKey="Hsiang Ju Lin" sort="Hsiang Ju Lin" uniqKey="Hsiang Ju Lin" first="" last="Hsiang Ju Lin">Hsiang Ju Lin</name>
<affiliation wicri:level="1"><mods:affiliation>Clinical Biochemistry Unit, University of Hong Kong, Hong Kong, China</mods:affiliation>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Clinical Biochemistry Unit, University of Hong Kong, Hong Kong</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Pui Chee Wu" sort="Pui Chee Wu" uniqKey="Pui Chee Wu" first="" last="Pui-Chee Wu">Pui-Chee Wu</name>
<affiliation wicri:level="1"><mods:affiliation>Department of Pathology, University of Hong Kong, Hong Kong, China</mods:affiliation>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Pathology, University of Hong Kong, Hong Kong</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Ching Lung Lai" sort="Ching Lung Lai" uniqKey="Ching Lung Lai" first="" last="Ching-Lung Lai">Ching-Lung Lai</name>
<affiliation wicri:level="1"><mods:affiliation>Department of Medicine, University of Hong Kong, Hong Kong, China</mods:affiliation>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Medicine, University of Hong Kong, Hong Kong</wicri:regionArea>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">ISTEX</idno>
<idno type="RBID">ISTEX:E0363C795469185CFEA8E1AC7E1B7445F836D341</idno>
<date when="1987" year="1987">1987</date>
<idno type="doi">10.1016/0166-0934(87)90057-7</idno>
<idno type="url">https://api.istex.fr/ark:/67375/6H6-W6WD54TZ-T/fulltext.pdf</idno>
<idno type="wicri:Area/Istex/Corpus">000366</idno>
<idno type="wicri:explorRef" wicri:stream="Istex" wicri:step="Corpus" wicri:corpus="ISTEX">000366</idno>
<idno type="wicri:Area/Istex/Curation">000366</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title level="a">An oligonucleotide probe for the detection of hepatitis B virus DNA in serum</title>
<author><name sortKey="Hsiang Ju Lin" sort="Hsiang Ju Lin" uniqKey="Hsiang Ju Lin" first="" last="Hsiang Ju Lin">Hsiang Ju Lin</name>
<affiliation wicri:level="1"><mods:affiliation>Clinical Biochemistry Unit, University of Hong Kong, Hong Kong, China</mods:affiliation>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Clinical Biochemistry Unit, University of Hong Kong, Hong Kong</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Pui Chee Wu" sort="Pui Chee Wu" uniqKey="Pui Chee Wu" first="" last="Pui-Chee Wu">Pui-Chee Wu</name>
<affiliation wicri:level="1"><mods:affiliation>Department of Pathology, University of Hong Kong, Hong Kong, China</mods:affiliation>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Pathology, University of Hong Kong, Hong Kong</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Ching Lung Lai" sort="Ching Lung Lai" uniqKey="Ching Lung Lai" first="" last="Ching-Lung Lai">Ching-Lung Lai</name>
<affiliation wicri:level="1"><mods:affiliation>Department of Medicine, University of Hong Kong, Hong Kong, China</mods:affiliation>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Medicine, University of Hong Kong, Hong Kong</wicri:regionArea>
</affiliation>
</author>
</analytic>
<monogr></monogr>
<series><title level="j">Journal of Virological Methods</title>
<title level="j" type="abbrev">VIRMET</title>
<idno type="ISSN">0166-0934</idno>
<imprint><publisher>ELSEVIER</publisher>
<date type="published" when="1987">1987</date>
<biblScope unit="volume">15</biblScope>
<biblScope unit="issue">2</biblScope>
<biblScope unit="page" from="139">139</biblScope>
<biblScope unit="page" to="149">149</biblScope>
</imprint>
<idno type="ISSN">0166-0934</idno>
</series>
</biblStruct>
</sourceDesc>
<seriesStmt><idno type="ISSN">0166-0934</idno>
</seriesStmt>
</fileDesc>
<profileDesc><textClass><keywords scheme="Teeft" xml:lang="en"><term>Academic press</term>
<term>Assay</term>
<term>Dextran sulfate</term>
<term>Different carriers</term>
<term>Hbeag</term>
<term>Hbsag</term>
<term>Hepatitis</term>
<term>Hepatocellular carcinoma</term>
<term>Hong kong</term>
<term>Hybridization</term>
<term>Hybridization medium</term>
<term>Hybridization period</term>
<term>Nitrocellulose membranes</term>
<term>Nonspecific binding</term>
<term>Nucleic</term>
<term>Nucleic acids</term>
<term>Nucleotide sequence</term>
<term>Nylon membranes</term>
<term>Oligonucleotide</term>
<term>Oligonucleotide probe</term>
<term>Oligonucleotide probes</term>
<term>Polyethylene glycol</term>
<term>Probe</term>
<term>Serum hepatitis</term>
<term>Serum samples</term>
<term>Serum specimens</term>
<term>Specific activity</term>
<term>Testing serum</term>
<term>Tiollais</term>
<term>Viral</term>
</keywords>
</textClass>
<langUsage><language ident="en">en</language>
</langUsage>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en">Abstract: A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d (CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays was comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.</div>
</front>
</TEI>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Sante/explor/MersV1/Data/Istex/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000366 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Istex/Curation/biblio.hfd -nk 000366 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Sante |area= MersV1 |flux= Istex |étape= Curation |type= RBID |clé= ISTEX:E0363C795469185CFEA8E1AC7E1B7445F836D341 |texte= An oligonucleotide probe for the detection of hepatitis B virus DNA in serum }}
This area was generated with Dilib version V0.6.33. |