Serveur d'exploration sur le patient édenté

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Concentration- and time-dependent response of human gingival fibroblasts to fibroblast growth factor 2 immobilized on titanium dental implants

Identifieur interne : 001F29 ( Pmc/Checkpoint ); précédent : 001F28; suivant : 001F30

Concentration- and time-dependent response of human gingival fibroblasts to fibroblast growth factor 2 immobilized on titanium dental implants

Auteurs : Qianli Ma [République populaire de Chine] ; Wei Wang [République populaire de Chine] ; Paul K. Chu [République populaire de Chine] ; Shenglin Mei [République populaire de Chine] ; Kun Ji [République populaire de Chine] ; Lei Jin [République populaire de Chine] ; Yumei Zhang [République populaire de Chine]

Source :

RBID : PMC:3356224

Abstract

Background

Titanium (Ti) implants are widely used clinically, but peri-implantitis remains one of the most common and serious complications. Healthy integration between gingival tissue and the implant surface is critical to long-term success in dental implant therapy. The objective of this study was to investigate how different concentrations of immobilized fibroblast growth factor 2 (FGF2) on the titania nanotubular surface influence the response of human gingival fibroblasts (HGFs).

Methods

Pure Ti metal was anodized at 20 V to form a vertically organized titanium dioxide nanotube array on which three concentrations of FGF2 (250 ng/mL, 500 ng/mL, or 1000 ng/mL) were immobilized by repeated lyophilization. Surface topography was observed and FGF2 elution was detected using enzyme-linked immunosorbent assay. The bioactivity changes of dissolvable immobilized FGF2 were measured by methyl-thiazolyl-tetrazolium assay. Behavior of HGFs was evaluated using adhesion and methyl-thiazolyl-tetrazolium bromide assays.

Results

The FGF2 remained for several days on the modified surface on which HGFs were cultured. Over 90% of the dissolvable immobilized FGF2 had been eluted by Day 9, whereas the FGF2 activity was found to diminish gradually from Day 1 to Day 9. The titania nanotubular surface with an optimal preparing concentration (500 ng/mL) of FGF2 immobilization exhibited improved HGF functions such as cellular attachment, proliferation, and extracellular matrix-related gene expression. Moreover, significant bidirectional as well as concentration- and time-dependent bioactivity was observed.

Conclusion

Synergism of the FGF2-impregnated titanium dioxide nanotubular surface revealed good gingival-implant integration, indicating that these materials might have promising applications in dentistry and other biomedical devices.


Url:
DOI: 10.2147/IJN.S29538
PubMed: 22619534
PubMed Central: 3356224


Affiliations:


Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:3356224

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Concentration- and time-dependent response of human gingival fibroblasts to fibroblast growth factor 2 immobilized on titanium dental implants</title>
<author>
<name sortKey="Ma, Qianli" sort="Ma, Qianli" uniqKey="Ma Q" first="Qianli" last="Ma">Qianli Ma</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-7-1965">Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Wang, Wei" sort="Wang, Wei" uniqKey="Wang W" first="Wei" last="Wang">Wei Wang</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-7-1965">Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Chu, Paul K" sort="Chu, Paul K" uniqKey="Chu P" first="Paul K" last="Chu">Paul K. Chu</name>
<affiliation wicri:level="1">
<nlm:aff id="af2-ijn-7-1965">Department of Physics and Materials Science, City University of Hong Kong, Kowloon, Hong Kong, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Physics and Materials Science, City University of Hong Kong, Kowloon, Hong Kong</wicri:regionArea>
<wicri:noRegion>Hong Kong</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Mei, Shenglin" sort="Mei, Shenglin" uniqKey="Mei S" first="Shenglin" last="Mei">Shenglin Mei</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-7-1965">Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-ijn-7-1965">Department of Physics and Materials Science, City University of Hong Kong, Kowloon, Hong Kong, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Physics and Materials Science, City University of Hong Kong, Kowloon, Hong Kong</wicri:regionArea>
<wicri:noRegion>Hong Kong</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Ji, Kun" sort="Ji, Kun" uniqKey="Ji K" first="Kun" last="Ji">Kun Ji</name>
<affiliation wicri:level="1">
<nlm:aff id="af3-ijn-7-1965">Department of Pediatric Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Pediatric Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Jin, Lei" sort="Jin, Lei" uniqKey="Jin L" first="Lei" last="Jin">Lei Jin</name>
<affiliation wicri:level="1">
<nlm:aff id="af4-ijn-7-1965">Stomatology Department, Jinling Hospital, School of Medicine, Southern Medical University, Nanjing, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Stomatology Department, Jinling Hospital, School of Medicine, Southern Medical University, Nanjing</wicri:regionArea>
<wicri:noRegion>Nanjing</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Yumei" sort="Zhang, Yumei" uniqKey="Zhang Y" first="Yumei" last="Zhang">Yumei Zhang</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-7-1965">Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">22619534</idno>
<idno type="pmc">3356224</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3356224</idno>
<idno type="RBID">PMC:3356224</idno>
<idno type="doi">10.2147/IJN.S29538</idno>
<date when="2012">2012</date>
<idno type="wicri:Area/Pmc/Corpus">002E49</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">002E49</idno>
<idno type="wicri:Area/Pmc/Curation">002E49</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">002E49</idno>
<idno type="wicri:Area/Pmc/Checkpoint">001F29</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">001F29</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Concentration- and time-dependent response of human gingival fibroblasts to fibroblast growth factor 2 immobilized on titanium dental implants</title>
<author>
<name sortKey="Ma, Qianli" sort="Ma, Qianli" uniqKey="Ma Q" first="Qianli" last="Ma">Qianli Ma</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-7-1965">Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Wang, Wei" sort="Wang, Wei" uniqKey="Wang W" first="Wei" last="Wang">Wei Wang</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-7-1965">Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Chu, Paul K" sort="Chu, Paul K" uniqKey="Chu P" first="Paul K" last="Chu">Paul K. Chu</name>
<affiliation wicri:level="1">
<nlm:aff id="af2-ijn-7-1965">Department of Physics and Materials Science, City University of Hong Kong, Kowloon, Hong Kong, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Physics and Materials Science, City University of Hong Kong, Kowloon, Hong Kong</wicri:regionArea>
<wicri:noRegion>Hong Kong</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Mei, Shenglin" sort="Mei, Shenglin" uniqKey="Mei S" first="Shenglin" last="Mei">Shenglin Mei</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-7-1965">Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-ijn-7-1965">Department of Physics and Materials Science, City University of Hong Kong, Kowloon, Hong Kong, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Physics and Materials Science, City University of Hong Kong, Kowloon, Hong Kong</wicri:regionArea>
<wicri:noRegion>Hong Kong</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Ji, Kun" sort="Ji, Kun" uniqKey="Ji K" first="Kun" last="Ji">Kun Ji</name>
<affiliation wicri:level="1">
<nlm:aff id="af3-ijn-7-1965">Department of Pediatric Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Pediatric Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Jin, Lei" sort="Jin, Lei" uniqKey="Jin L" first="Lei" last="Jin">Lei Jin</name>
<affiliation wicri:level="1">
<nlm:aff id="af4-ijn-7-1965">Stomatology Department, Jinling Hospital, School of Medicine, Southern Medical University, Nanjing, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Stomatology Department, Jinling Hospital, School of Medicine, Southern Medical University, Nanjing</wicri:regionArea>
<wicri:noRegion>Nanjing</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Yumei" sort="Zhang, Yumei" uniqKey="Zhang Y" first="Yumei" last="Zhang">Yumei Zhang</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-7-1965">Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
</analytic>
<series>
<title level="j">International Journal of Nanomedicine</title>
<idno type="ISSN">1176-9114</idno>
<idno type="eISSN">1178-2013</idno>
<imprint>
<date when="2012">2012</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>Titanium (Ti) implants are widely used clinically, but peri-implantitis remains one of the most common and serious complications. Healthy integration between gingival tissue and the implant surface is critical to long-term success in dental implant therapy. The objective of this study was to investigate how different concentrations of immobilized fibroblast growth factor 2 (FGF2) on the titania nanotubular surface influence the response of human gingival fibroblasts (HGFs).</p>
</sec>
<sec>
<title>Methods</title>
<p>Pure Ti metal was anodized at 20 V to form a vertically organized titanium dioxide nanotube array on which three concentrations of FGF2 (250 ng/mL, 500 ng/mL, or 1000 ng/mL) were immobilized by repeated lyophilization. Surface topography was observed and FGF2 elution was detected using enzyme-linked immunosorbent assay. The bioactivity changes of dissolvable immobilized FGF2 were measured by methyl-thiazolyl-tetrazolium assay. Behavior of HGFs was evaluated using adhesion and methyl-thiazolyl-tetrazolium bromide assays.</p>
</sec>
<sec>
<title>Results</title>
<p>The FGF2 remained for several days on the modified surface on which HGFs were cultured. Over 90% of the dissolvable immobilized FGF2 had been eluted by Day 9, whereas the FGF2 activity was found to diminish gradually from Day 1 to Day 9. The titania nanotubular surface with an optimal preparing concentration (500 ng/mL) of FGF2 immobilization exhibited improved HGF functions such as cellular attachment, proliferation, and extracellular matrix-related gene expression. Moreover, significant bidirectional as well as concentration- and time-dependent bioactivity was observed.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>Synergism of the FGF2-impregnated titanium dioxide nanotubular surface revealed good gingival-implant integration, indicating that these materials might have promising applications in dentistry and other biomedical devices.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Adell, R" uniqKey="Adell R">R Adell</name>
</author>
<author>
<name sortKey="Eriksson, B" uniqKey="Eriksson B">B Eriksson</name>
</author>
<author>
<name sortKey="Lekholm, U" uniqKey="Lekholm U">U Lekholm</name>
</author>
<author>
<name sortKey="Branemark, Pi" uniqKey="Branemark P">PI Branemark</name>
</author>
<author>
<name sortKey="Jemt, T" uniqKey="Jemt T">T Jemt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arvidson, K" uniqKey="Arvidson K">K Arvidson</name>
</author>
<author>
<name sortKey="Bystedt, H" uniqKey="Bystedt H">H Bystedt</name>
</author>
<author>
<name sortKey="Frykholm, A" uniqKey="Frykholm A">A Frykholm</name>
</author>
<author>
<name sortKey="Von Konow, L" uniqKey="Von Konow L">L von Konow</name>
</author>
<author>
<name sortKey="Lothigius, E" uniqKey="Lothigius E">E Lothigius</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Olsson, M" uniqKey="Olsson M">M Olsson</name>
</author>
<author>
<name sortKey="Gunne, J" uniqKey="Gunne J">J Gunne</name>
</author>
<author>
<name sortKey="Astrand, P" uniqKey="Astrand P">P Astrand</name>
</author>
<author>
<name sortKey="Borg, K" uniqKey="Borg K">K Borg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abrahamsson, I" uniqKey="Abrahamsson I">I Abrahamsson</name>
</author>
<author>
<name sortKey="Berglundh, T" uniqKey="Berglundh T">T Berglundh</name>
</author>
<author>
<name sortKey="Lindhe, J" uniqKey="Lindhe J">J Lindhe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lindhe, J" uniqKey="Lindhe J">J Lindhe</name>
</author>
<author>
<name sortKey="Berglundh, T" uniqKey="Berglundh T">T Berglundh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schwarz, F" uniqKey="Schwarz F">F Schwarz</name>
</author>
<author>
<name sortKey="Ferrari, D" uniqKey="Ferrari D">D Ferrari</name>
</author>
<author>
<name sortKey="Herten, M" uniqKey="Herten M">M Herten</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abrahamsson, I" uniqKey="Abrahamsson I">I Abrahamsson</name>
</author>
<author>
<name sortKey="Berglundh, T" uniqKey="Berglundh T">T Berglundh</name>
</author>
<author>
<name sortKey="Lindhe, J" uniqKey="Lindhe J">J Lindhe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abrahamsson, I" uniqKey="Abrahamsson I">I Abrahamsson</name>
</author>
<author>
<name sortKey="Cardaropoli, G" uniqKey="Cardaropoli G">G Cardaropoli</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Faveri, M" uniqKey="Faveri M">M Faveri</name>
</author>
<author>
<name sortKey="Goncalves, Lf" uniqKey="Goncalves L">LF Goncalves</name>
</author>
<author>
<name sortKey="Feres, M" uniqKey="Feres M">M Feres</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shibli, Ja" uniqKey="Shibli J">JA Shibli</name>
</author>
<author>
<name sortKey="Melo, L" uniqKey="Melo L">L Melo</name>
</author>
<author>
<name sortKey="Ferrari, Ds" uniqKey="Ferrari D">DS Ferrari</name>
</author>
<author>
<name sortKey="Figueiredo, Lc" uniqKey="Figueiredo L">LC Figueiredo</name>
</author>
<author>
<name sortKey="Faveri, M" uniqKey="Faveri M">M Faveri</name>
</author>
<author>
<name sortKey="Feres, M" uniqKey="Feres M">M Feres</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brunette, D" uniqKey="Brunette D">D Brunette</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhao, L" uniqKey="Zhao L">L Zhao</name>
</author>
<author>
<name sortKey="Mei, S" uniqKey="Mei S">S Mei</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
<author>
<name sortKey="Chu, Pk" uniqKey="Chu P">PK Chu</name>
</author>
<author>
<name sortKey="Wu, Z" uniqKey="Wu Z">Z Wu</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gong, D" uniqKey="Gong D">D Gong</name>
</author>
<author>
<name sortKey="Grimes, C" uniqKey="Grimes C">C Grimes</name>
</author>
<author>
<name sortKey="Varghese, Ok" uniqKey="Varghese O">OK Varghese</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Balasundaram, G" uniqKey="Balasundaram G">G Balasundaram</name>
</author>
<author>
<name sortKey="Yao, C" uniqKey="Yao C">C Yao</name>
</author>
<author>
<name sortKey="Webster, Tj" uniqKey="Webster T">TJ Webster</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Park, J" uniqKey="Park J">J Park</name>
</author>
<author>
<name sortKey="Bauer, S" uniqKey="Bauer S">S Bauer</name>
</author>
<author>
<name sortKey="Von Der Mark, K" uniqKey="Von Der Mark K">K von der Mark</name>
</author>
<author>
<name sortKey="Schmuki, P" uniqKey="Schmuki P">P Schmuki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brammer, Ks" uniqKey="Brammer K">KS Brammer</name>
</author>
<author>
<name sortKey="Oh, S" uniqKey="Oh S">S Oh</name>
</author>
<author>
<name sortKey="Cobb, Cj" uniqKey="Cobb C">CJ Cobb</name>
</author>
<author>
<name sortKey="Bjursten, Lm" uniqKey="Bjursten L">LM Bjursten</name>
</author>
<author>
<name sortKey="Heyde, H" uniqKey="Heyde H">H Heyde</name>
</author>
<author>
<name sortKey="Jin, S" uniqKey="Jin S">S Jin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Von Wilmowsky, C" uniqKey="Von Wilmowsky C">C von Wilmowsky</name>
</author>
<author>
<name sortKey="Bauer, S" uniqKey="Bauer S">S Bauer</name>
</author>
<author>
<name sortKey="Lutz, R" uniqKey="Lutz R">R Lutz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Demetrescu, I" uniqKey="Demetrescu I">I Demetrescu</name>
</author>
<author>
<name sortKey="Pirvu, C" uniqKey="Pirvu C">C Pirvu</name>
</author>
<author>
<name sortKey="Mitran, V" uniqKey="Mitran V">V Mitran</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ornitz, Dm" uniqKey="Ornitz D">DM Ornitz</name>
</author>
<author>
<name sortKey="Itoh, N" uniqKey="Itoh N">N Itoh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gerritsen, Me" uniqKey="Gerritsen M">ME Gerritsen</name>
</author>
<author>
<name sortKey="Soriano, R" uniqKey="Soriano R">R Soriano</name>
</author>
<author>
<name sortKey="Yang, S" uniqKey="Yang S">S Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Palmon, A" uniqKey="Palmon A">A Palmon</name>
</author>
<author>
<name sortKey="Roos, H" uniqKey="Roos H">H Roos</name>
</author>
<author>
<name sortKey="Edel, J" uniqKey="Edel J">J Edel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Takayama, S" uniqKey="Takayama S">S Takayama</name>
</author>
<author>
<name sortKey="Murakami, S" uniqKey="Murakami S">S Murakami</name>
</author>
<author>
<name sortKey="Miki, Y" uniqKey="Miki Y">Y Miki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pitaru, S" uniqKey="Pitaru S">S Pitaru</name>
</author>
<author>
<name sortKey="Kotev Emeth, S" uniqKey="Kotev Emeth S">S Kotev-Emeth</name>
</author>
<author>
<name sortKey="Noff, D" uniqKey="Noff D">D Noff</name>
</author>
<author>
<name sortKey="Kaffuler, S" uniqKey="Kaffuler S">S Kaffuler</name>
</author>
<author>
<name sortKey="Savion, N" uniqKey="Savion N">N Savion</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kokubu, E" uniqKey="Kokubu E">E Kokubu</name>
</author>
<author>
<name sortKey="Yoshinari, M" uniqKey="Yoshinari M">M Yoshinari</name>
</author>
<author>
<name sortKey="Matsuzaka, K" uniqKey="Matsuzaka K">K Matsuzaka</name>
</author>
<author>
<name sortKey="Inoue, T" uniqKey="Inoue T">T Inoue</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Peng, L" uniqKey="Peng L">L Peng</name>
</author>
<author>
<name sortKey="Mendelsohn, Ad" uniqKey="Mendelsohn A">AD Mendelsohn</name>
</author>
<author>
<name sortKey="Latempa, Tj" uniqKey="Latempa T">TJ LaTempa</name>
</author>
<author>
<name sortKey="Yoriya, S" uniqKey="Yoriya S">S Yoriya</name>
</author>
<author>
<name sortKey="Grimes, Ca" uniqKey="Grimes C">CA Grimes</name>
</author>
<author>
<name sortKey="Desai, Ta" uniqKey="Desai T">TA Desai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hankemeier, S" uniqKey="Hankemeier S">S Hankemeier</name>
</author>
<author>
<name sortKey="Keus, M" uniqKey="Keus M">M Keus</name>
</author>
<author>
<name sortKey="Zeichen, J" uniqKey="Zeichen J">J Zeichen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mustafa, K" uniqKey="Mustafa K">K Mustafa</name>
</author>
<author>
<name sortKey="Silva Lopez, B" uniqKey="Silva Lopez B">B Silva Lopez</name>
</author>
<author>
<name sortKey="Hultenby, K" uniqKey="Hultenby K">K Hultenby</name>
</author>
<author>
<name sortKey="Wennerberg, A" uniqKey="Wennerberg A">A Wennerberg</name>
</author>
<author>
<name sortKey="Arvidson, K" uniqKey="Arvidson K">K Arvidson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yoshinari, M" uniqKey="Yoshinari M">M Yoshinari</name>
</author>
<author>
<name sortKey="Matsuzaka, K" uniqKey="Matsuzaka K">K Matsuzaka</name>
</author>
<author>
<name sortKey="Inoue, T" uniqKey="Inoue T">T Inoue</name>
</author>
<author>
<name sortKey="Oda, Y" uniqKey="Oda Y">Y Oda</name>
</author>
<author>
<name sortKey="Shimono, M" uniqKey="Shimono M">M Shimono</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, S Y" uniqKey="Kim S">S-Y Kim</name>
</author>
<author>
<name sortKey="Oh, N" uniqKey="Oh N">N Oh</name>
</author>
<author>
<name sortKey="Lee, M H" uniqKey="Lee M">M-H Lee</name>
</author>
<author>
<name sortKey="Kim, S E" uniqKey="Kim S">S-E Kim</name>
</author>
<author>
<name sortKey="Leesungbok, R" uniqKey="Leesungbok R">R Leesungbok</name>
</author>
<author>
<name sortKey="Lee, Sw" uniqKey="Lee S">SW Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gelover, S" uniqKey="Gelover S">S Gelover</name>
</author>
<author>
<name sortKey="Gomez, La" uniqKey="Gomez L">LA Gomez</name>
</author>
<author>
<name sortKey="Reyes, K" uniqKey="Reyes K">K Reyes</name>
</author>
<author>
<name sortKey="Teresa Leal, M" uniqKey="Teresa Leal M">M Teresa Leal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Livak, Kj" uniqKey="Livak K">KJ Livak</name>
</author>
<author>
<name sortKey="Schmittgen, Td" uniqKey="Schmittgen T">TD Schmittgen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schultz, Gs" uniqKey="Schultz G">GS Schultz</name>
</author>
<author>
<name sortKey="Wysocki, A" uniqKey="Wysocki A">A Wysocki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sul, Yt" uniqKey="Sul Y">YT Sul</name>
</author>
<author>
<name sortKey="Johansson, Cb" uniqKey="Johansson C">CB Johansson</name>
</author>
<author>
<name sortKey="Petronis, S" uniqKey="Petronis S">S Petronis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shibli, Ja" uniqKey="Shibli J">JA Shibli</name>
</author>
<author>
<name sortKey="Grassi, S" uniqKey="Grassi S">S Grassi</name>
</author>
<author>
<name sortKey="De Figueiredo, Lc" uniqKey="De Figueiredo L">LC de Figueiredo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhao, L" uniqKey="Zhao L">L Zhao</name>
</author>
<author>
<name sortKey="Mei, S" uniqKey="Mei S">S Mei</name>
</author>
<author>
<name sortKey="Chu, Pk" uniqKey="Chu P">PK Chu</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author>
<name sortKey="Wu, Z" uniqKey="Wu Z">Z Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Murakami, S" uniqKey="Murakami S">S Murakami</name>
</author>
<author>
<name sortKey="Takayama, S" uniqKey="Takayama S">S Takayama</name>
</author>
<author>
<name sortKey="Ikezawa, K" uniqKey="Ikezawa K">K Ikezawa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nakahara, T" uniqKey="Nakahara T">T Nakahara</name>
</author>
<author>
<name sortKey="Nakamura, T" uniqKey="Nakamura T">T Nakamura</name>
</author>
<author>
<name sortKey="Kobayashi, E" uniqKey="Kobayashi E">E Kobayashi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Akman, Ac" uniqKey="Akman A">AC Akman</name>
</author>
<author>
<name sortKey="Tigli, Rs" uniqKey="Tigli R">RS Tigli</name>
</author>
<author>
<name sortKey="Gumusderelioglu, M" uniqKey="Gumusderelioglu M">M Gumusderelioglu</name>
</author>
<author>
<name sortKey="Nohutcu, Rm" uniqKey="Nohutcu R">RM Nohutcu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Filion, Rj" uniqKey="Filion R">RJ Filion</name>
</author>
<author>
<name sortKey="Popel, As" uniqKey="Popel A">AS Popel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Biggs, Mj" uniqKey="Biggs M">MJ Biggs</name>
</author>
<author>
<name sortKey="Richards, Rg" uniqKey="Richards R">RG Richards</name>
</author>
<author>
<name sortKey="Dalby, Mj" uniqKey="Dalby M">MJ Dalby</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gurtner, Gc" uniqKey="Gurtner G">GC Gurtner</name>
</author>
<author>
<name sortKey="Werner, S" uniqKey="Werner S">S Werner</name>
</author>
<author>
<name sortKey="Barrandon, Y" uniqKey="Barrandon Y">Y Barrandon</name>
</author>
<author>
<name sortKey="Longaker, Mt" uniqKey="Longaker M">MT Longaker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Johnson, Rb" uniqKey="Johnson R">RB Johnson</name>
</author>
<author>
<name sortKey="Serio, Fg" uniqKey="Serio F">FG Serio</name>
</author>
<author>
<name sortKey="Dai, X" uniqKey="Dai X">X Dai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Connolly, Dt" uniqKey="Connolly D">DT Connolly</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Diamond, Ms" uniqKey="Diamond M">MS Diamond</name>
</author>
<author>
<name sortKey="Springer, Ta" uniqKey="Springer T">TA Springer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Clark, Ea" uniqKey="Clark E">EA Clark</name>
</author>
<author>
<name sortKey="Brugge, Js" uniqKey="Brugge J">JS Brugge</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kramer, Pr" uniqKey="Kramer P">PR Kramer</name>
</author>
<author>
<name sortKey="Janikkeith, A" uniqKey="Janikkeith A">A Janikkeith</name>
</author>
<author>
<name sortKey="Cai, Z" uniqKey="Cai Z">Z Cai</name>
</author>
<author>
<name sortKey="Ma, S" uniqKey="Ma S">S Ma</name>
</author>
<author>
<name sortKey="Watanabe, I" uniqKey="Watanabe I">I Watanabe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Suzuki, Y" uniqKey="Suzuki Y">Y Suzuki</name>
</author>
<author>
<name sortKey="Yanagisawa, M" uniqKey="Yanagisawa M">M Yanagisawa</name>
</author>
<author>
<name sortKey="Yagi, H" uniqKey="Yagi H">H Yagi</name>
</author>
<author>
<name sortKey="Nakatani, Y" uniqKey="Nakatani Y">Y Nakatani</name>
</author>
<author>
<name sortKey="Yu, Rk" uniqKey="Yu R">RK Yu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crawford, Jm" uniqKey="Crawford J">JM Crawford</name>
</author>
<author>
<name sortKey="Hopp, B" uniqKey="Hopp B">B Hopp</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Norris, P" uniqKey="Norris P">P Norris</name>
</author>
<author>
<name sortKey="Poston, Rn" uniqKey="Poston R">RN Poston</name>
</author>
<author>
<name sortKey="Thomas, Ds" uniqKey="Thomas D">DS Thomas</name>
</author>
<author>
<name sortKey="Thornhill, M" uniqKey="Thornhill M">M Thornhill</name>
</author>
<author>
<name sortKey="Hawk, J" uniqKey="Hawk J">J Hawk</name>
</author>
<author>
<name sortKey="Haskard, Do" uniqKey="Haskard D">DO Haskard</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moughal, Na" uniqKey="Moughal N">NA Moughal</name>
</author>
<author>
<name sortKey="Adonogianaki, E" uniqKey="Adonogianaki E">E Adonogianaki</name>
</author>
<author>
<name sortKey="Thornhill, Mh" uniqKey="Thornhill M">MH Thornhill</name>
</author>
<author>
<name sortKey="Kinane, Df" uniqKey="Kinane D">DF Kinane</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zittermann, Si" uniqKey="Zittermann S">SI Zittermann</name>
</author>
<author>
<name sortKey="Issekutz, Ac" uniqKey="Issekutz A">AC Issekutz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Durbeej, M" uniqKey="Durbeej M">M Durbeej</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Int J Nanomedicine</journal-id>
<journal-id journal-id-type="iso-abbrev">Int J Nanomedicine</journal-id>
<journal-title-group>
<journal-title>International Journal of Nanomedicine</journal-title>
</journal-title-group>
<issn pub-type="ppub">1176-9114</issn>
<issn pub-type="epub">1178-2013</issn>
<publisher>
<publisher-name>Dove Medical Press</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">22619534</article-id>
<article-id pub-id-type="pmc">3356224</article-id>
<article-id pub-id-type="doi">10.2147/IJN.S29538</article-id>
<article-id pub-id-type="publisher-id">ijn-7-1965</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Concentration- and time-dependent response of human gingival fibroblasts to fibroblast growth factor 2 immobilized on titanium dental implants</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Ma</surname>
<given-names>Qianli</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-7-1965">1</xref>
<xref ref-type="author-notes" rid="fn1-ijn-7-1965">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Wei</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-7-1965">1</xref>
<xref ref-type="author-notes" rid="fn1-ijn-7-1965">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chu</surname>
<given-names>Paul K</given-names>
</name>
<xref ref-type="aff" rid="af2-ijn-7-1965">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Mei</surname>
<given-names>Shenglin</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-7-1965">1</xref>
<xref ref-type="aff" rid="af2-ijn-7-1965">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ji</surname>
<given-names>Kun</given-names>
</name>
<xref ref-type="aff" rid="af3-ijn-7-1965">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jin</surname>
<given-names>Lei</given-names>
</name>
<xref ref-type="aff" rid="af4-ijn-7-1965">4</xref>
<xref ref-type="corresp" rid="c1-ijn-7-1965"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Yumei</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-7-1965">1</xref>
<xref ref-type="corresp" rid="c1-ijn-7-1965"></xref>
</contrib>
</contrib-group>
<aff id="af1-ijn-7-1965">
<label>1</label>
Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</aff>
<aff id="af2-ijn-7-1965">
<label>2</label>
Department of Physics and Materials Science, City University of Hong Kong, Kowloon, Hong Kong, People’s Republic of China</aff>
<aff id="af3-ijn-7-1965">
<label>3</label>
Department of Pediatric Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</aff>
<aff id="af4-ijn-7-1965">
<label>4</label>
Stomatology Department, Jinling Hospital, School of Medicine, Southern Medical University, Nanjing, People’s Republic of China</aff>
<author-notes>
<corresp id="c1-ijn-7-1965">Correspondence: Yumei Zhang, Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, 17 West Chang Le Road, Xi’an 710032, People’s Republic of China, Tel +86 29 84776090, Fax +86 29 84776096, Email
<email>wqtzym@fmmu.edu.cn</email>
. Lei Jin, Stomatology Department, Jinling Hospital, School of Medicine, Southern Medical University, 305 East Zhongshan Road, Nanjing, 210002, People’s Republic of China, Tel +86 25 80861166, Fax +86 25 80861166, Email
<email>jindentist@gmail.com</email>
</corresp>
<fn id="fn1-ijn-7-1965">
<label>*</label>
<p>These authors contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="collection">
<year>2012</year>
</pub-date>
<pmc-comment>Dove Press titles changed from ppub to collections in 2009. Fake ppub written to satisfy Coll Date Type=ppub</pmc-comment>
<pub-date pub-type="ppub">
<year>2012</year>
</pub-date>
<pub-date pub-type="epub">
<day>17</day>
<month>4</month>
<year>2012</year>
</pub-date>
<volume>7</volume>
<fpage>1965</fpage>
<lpage>1976</lpage>
<permissions>
<copyright-statement>© 2012 Ma et al, publisher and licensee Dove Medical Press Ltd.</copyright-statement>
<copyright-year>2012</copyright-year>
<license>
<license-p>This is an Open Access article which permits unrestricted noncommercial use, provided the original work is properly cited.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Titanium (Ti) implants are widely used clinically, but peri-implantitis remains one of the most common and serious complications. Healthy integration between gingival tissue and the implant surface is critical to long-term success in dental implant therapy. The objective of this study was to investigate how different concentrations of immobilized fibroblast growth factor 2 (FGF2) on the titania nanotubular surface influence the response of human gingival fibroblasts (HGFs).</p>
</sec>
<sec>
<title>Methods</title>
<p>Pure Ti metal was anodized at 20 V to form a vertically organized titanium dioxide nanotube array on which three concentrations of FGF2 (250 ng/mL, 500 ng/mL, or 1000 ng/mL) were immobilized by repeated lyophilization. Surface topography was observed and FGF2 elution was detected using enzyme-linked immunosorbent assay. The bioactivity changes of dissolvable immobilized FGF2 were measured by methyl-thiazolyl-tetrazolium assay. Behavior of HGFs was evaluated using adhesion and methyl-thiazolyl-tetrazolium bromide assays.</p>
</sec>
<sec>
<title>Results</title>
<p>The FGF2 remained for several days on the modified surface on which HGFs were cultured. Over 90% of the dissolvable immobilized FGF2 had been eluted by Day 9, whereas the FGF2 activity was found to diminish gradually from Day 1 to Day 9. The titania nanotubular surface with an optimal preparing concentration (500 ng/mL) of FGF2 immobilization exhibited improved HGF functions such as cellular attachment, proliferation, and extracellular matrix-related gene expression. Moreover, significant bidirectional as well as concentration- and time-dependent bioactivity was observed.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>Synergism of the FGF2-impregnated titanium dioxide nanotubular surface revealed good gingival-implant integration, indicating that these materials might have promising applications in dentistry and other biomedical devices.</p>
</sec>
</abstract>
<kwd-group>
<kwd>dental implants</kwd>
<kwd>titanium dioxide nanotube</kwd>
<kwd>fibroblast growth factor 2</kwd>
<kwd>extracellular matrix</kwd>
<kwd>real-time polymerase chain reaction</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="f1-ijn-7-1965" position="float">
<label>Figure 1</label>
<caption>
<p>Immobilized FGF2 compared with FGF2-free samples initially and after 9 days.</p>
<p>
<bold>Abbreviations:</bold>
FGF2, fibroblast growth factor 2; NT, nanotube; PT, polished titanium.</p>
</caption>
<graphic xlink:href="ijn-7-1965f1"></graphic>
</fig>
<fig id="f2-ijn-7-1965" position="float">
<label>Figure 2</label>
<caption>
<p>Field emission scanning electron microscopy results. (
<bold>A</bold>
) NT surface showed an NT array structure; NT-F-H surface showed clumps of fibroblast growth factor 2 and that the typical NT surface was changed. (
<bold>B</bold>
) Profile of titania NT.</p>
<p>
<bold>Note:</bold>
The length of NT was 588.85 ± 31.92 nm (mean value ± standard deviation).</p>
<p>
<bold>Abbreviations:</bold>
NT, nanotube; PT, polished titanium.</p>
</caption>
<graphic xlink:href="ijn-7-1965f2"></graphic>
</fig>
<fig id="f3-ijn-7-1965" position="float">
<label>Figure 3</label>
<caption>
<p>Atomic force microscopy images of different surfaces: (
<bold>A</bold>
) PT, (
<bold>B</bold>
) NT, (
<bold>C</bold>
) NT-F-L, (
<bold>D</bold>
) NT-F-M, and (
<bold>E</bold>
) NT-F-H. PT showed a microgroove structure, and porous-like structures were observed in other groups.</p>
<p>
<bold>Abbreviations:</bold>
NT, nanotube; PT, polished titanium.</p>
</caption>
<graphic xlink:href="ijn-7-1965f3"></graphic>
</fig>
<fig id="f4-ijn-7-1965" position="float">
<label>Figure 4</label>
<caption>
<p>Elution kinetics of various FGF2 immobilizations. FGF2 eluted rapidly within first 3 days and the elution velocity reduced with time. Approximately all dissolvable FGF2 eluted within 30 days.</p>
<p>
<bold>Abbreviations:</bold>
FGF2, fibroblast growth factor 2; NT, nanotube.</p>
</caption>
<graphic xlink:href="ijn-7-1965f4"></graphic>
</fig>
<fig id="f5-ijn-7-1965" position="float">
<label>Figure 5</label>
<caption>
<p>HGF adhesion. (
<bold>A</bold>
) HGFs attached to the substrates with 4′,6′-diamidino-2-phenylindole stain and (
<bold>B</bold>
) relative cell adhesion rate of attached HGFs. The NT and NT-F-H surfaces inhibited cell adhesion, whereas the NT-F-L and NT-F-M improved cell attachment.</p>
<p>
<bold>Notes:</bold>
<sup>#</sup>
Higher than PT (
<italic>P</italic>
< 0.01), *lower than PT (
<italic>P</italic>
< 0.01), difference also exists between 1*, 2*, 1
<sup>#</sup>
, and 2
<sup>#</sup>
(
<italic>P</italic>
< 0.01).</p>
<p>
<bold>Abbreviations:</bold>
HGF, human gingival fibroblast; NT, nanotube; PT, polished titanium.</p>
</caption>
<graphic xlink:href="ijn-7-1965f5"></graphic>
</fig>
<fig id="f6-ijn-7-1965" position="float">
<label>Figure 6</label>
<caption>
<p>Cell proliferation measured by the methyl-thiazolyl-tetrazolium assay. NT-F-L and NT-F-M showed the higher cell proliferation at each interval, whereas NT-F-H with overimmobilized FGF2 showed the lowest at the early stage (Days 1 and 3).</p>
<p>
<bold>Notes:</bold>
<sup>#</sup>
Higher than PT (
<italic>P</italic>
< 0.01), *lower than PT (
<italic>P</italic>
< 0.01), significant difference exists between 1
<sup>#</sup>
and 2
<sup>#</sup>
(
<italic>P</italic>
< 0.01).</p>
<p>
<bold>Abbreviations:</bold>
FGF2, fibroblast growth factor 2; NT, nanotube; OD, optical density; PT, polished titanium.</p>
</caption>
<graphic xlink:href="ijn-7-1965f6"></graphic>
</fig>
<fig id="f7-ijn-7-1965" position="float">
<label>Figure 7</label>
<caption>
<p>Morphology of HGFs: (
<bold>A</bold>
) PT, (
<bold>B</bold>
) NT, (
<bold>C</bold>
) NT-F-L, (
<bold>D</bold>
) NT-F-M, and (
<bold>E</bold>
) NT-F-H lacking sufficient prominences/pseudopods and not fusing together.</p>
<p>
<bold>Abbreviations:</bold>
HGF, human gingival fibroblast; NT, nanotube; PT, polished titanium.</p>
</caption>
<graphic xlink:href="ijn-7-1965f7"></graphic>
</fig>
<fig id="f8-ijn-7-1965" position="float">
<label>Figure 8</label>
<caption>
<p>Extracellular matrix-related gene expressions by HGFs cultured on four different titanium surfaces at Days 3, 6, and 9: (
<bold>A</bold>
)
<italic>VEGFA</italic>
, (
<bold>B</bold>
)
<italic>ITGB</italic>
, (
<bold>C</bold>
)
<italic>ICAM1</italic>
, and (
<bold>D</bold>
)
<italic>LAMA1</italic>
. Inverse concentration-dependent effects of NT-F-H were observed at Day 3 on (
<bold>C</bold>
) and (
<bold>D</bold>
).</p>
<p>
<bold>Notes:</bold>
<sup>#</sup>
Upregulated compared with PT (
<italic>P</italic>
< 0.01), *downregulated (
<italic>P</italic>
< 0.01), significant difference exists between 1*, 2*, 1
<sup>#</sup>
, and 2
<sup>#</sup>
(
<italic>P</italic>
< 0.01).</p>
<p>
<bold>Abbreviations:</bold>
HGF, human gingival fibroblast;
<italic>ICAM1</italic>
, intercellular adhesion molecule 1;
<italic>ITGB</italic>
, β-integrin;
<italic>LAMA1</italic>
, laminin-1; NT, nanotube; PT, polished titanium;
<italic>VEGFA,</italic>
vascular endothelial growth factor A.</p>
</caption>
<graphic xlink:href="ijn-7-1965f8"></graphic>
</fig>
<fig id="f9-ijn-7-1965" position="float">
<label>Figure 9</label>
<caption>
<p>Activity changes of dissolvable FGF2 (10 ng/mL): control (FGF2-free); newly prepared Dulbecco’s modified Eagle’s medium; and S1, S3, S6, and S9 (FGF2 in Dulbecco’s modified Eagle’s medium stored for 1 day, 3 days, 6 days, or 9 days, respectively). The activity of FGF2 reduced gradually in culture medium with time and dropped to less than 50% after 9 days (S9) compared with NP.</p>
<p>
<bold>Note:</bold>
<sup>#</sup>
Higher than PT (
<italic>P</italic>
< 0.01), significant difference exists between 1
<sup>#</sup>
, 2
<sup>#</sup>
, and 3
<sup>#</sup>
(
<italic>P</italic>
< 0.01).</p>
<p>
<bold>Abbreviations:</bold>
FGF2, fibroblast growth factor 2; NT, nanotube; OD, optical density; PT, polished titanium.</p>
</caption>
<graphic xlink:href="ijn-7-1965f9"></graphic>
</fig>
<fig id="f10-ijn-7-1965" position="float">
<label>Figure 10</label>
<caption>
<p>Pattern of nanotube-based FGF2 control release system: (
<bold>A</bold>
) initial stage, (
<bold>B</bold>
) in culture medium, FGF2 is gradually released from the nanotubes.</p>
<p>
<bold>Abbreviation:</bold>
FGF2, fibroblast growth factor 2.</p>
</caption>
<graphic xlink:href="ijn-7-1965f10"></graphic>
</fig>
<table-wrap id="t1-ijn-7-1965" position="float">
<label>Table 1</label>
<caption>
<p>Target cDNA primer sequences used in quantitative polymerase chain reaction</p>
</caption>
<table frame="hsides" rules="groups">
<tbody>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>VEGFA</italic>
</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Forward: 5′-GAGCCTTGCCTTGCTGCTCTAC-3′</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Reverse: 5′-CACCAGGTCTCGATTGGATG-3′</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> PCR product size: 148 bp</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>ITGB</italic>
</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Forward: 5′-TGTGTCAGACCTGCCTTGGTG-3′</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Reverse: 5′-AGGAACATTCCTGTGTGCATGTG-3′</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> PCR product size: 105 bp</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>ICAM1</italic>
</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Forward: TGAGCAATGTGCAAGAAGATAGC</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Reverse: CCCGTTCTGGAGTCCAGTACA</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> PCR product size: 105 bp</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>LAMA1</italic>
</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Forward: TGGTAACATTTGCCACCACGA</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Reverse: TTGCCTCCGATCAGCATGAC</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> PCR product size: 127 bp</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>GAPDH</italic>
(housekeeping gene)</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Forward: 5′-GCACCGTCAAGGCTGAGAAC-3′</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> Reverse: 5′-TGGTGAAGACGCCAGTGGA-3′</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1"> PCR product size: 138 bp</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn1-ijn-7-1965">
<p>
<bold>Abbreviations:</bold>
<italic>GAPDH</italic>
, glyceraldehyde 3-phosphate dehydrogenase;
<italic>ICAM1</italic>
, intercellular adhesion molecule 1;
<italic>ITGB</italic>
, β-integrin;
<italic>LAMA1</italic>
, laminin-1;
<italic>VEGFA,</italic>
vascular endothelial growth factor A.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="t2-ijn-7-1965" position="float">
<label>Table 2</label>
<caption>
<p>Measurement of surface roughness by atomic force microscopy</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1">Group</th>
<th align="left" valign="top" rowspan="1" colspan="1">R
<sub>a</sub>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">RMS</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">PT</td>
<td align="center" valign="top" rowspan="1" colspan="1">32.60 ± 3.45 nm</td>
<td align="center" valign="top" rowspan="1" colspan="1">41.70 ± 3.96 nm</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">NT</td>
<td align="center" valign="top" rowspan="1" colspan="1">4.96 ± 0.50 nm
<xref ref-type="table-fn" rid="tfn3-ijn-7-1965">*</xref>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">6.23 ± 0.80 nm
<xref ref-type="table-fn" rid="tfn3-ijn-7-1965">*</xref>
</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">NT-F-L</td>
<td align="center" valign="top" rowspan="1" colspan="1">7.25 ± 0.97 nm
<xref ref-type="table-fn" rid="tfn3-ijn-7-1965">*</xref>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">9.14 ± 1.25 nm
<xref ref-type="table-fn" rid="tfn3-ijn-7-1965">*</xref>
</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">NT-F-M</td>
<td align="center" valign="top" rowspan="1" colspan="1">9.70 ± 1.85 nm
<xref ref-type="table-fn" rid="tfn3-ijn-7-1965">*</xref>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">11.80 ± 2.21 nm
<xref ref-type="table-fn" rid="tfn3-ijn-7-1965">*</xref>
</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">NT-F-H</td>
<td align="center" valign="top" rowspan="1" colspan="1">9.42 ± 1.99 nm
<xref ref-type="table-fn" rid="tfn3-ijn-7-1965">*</xref>
</td>
<td align="center" valign="top" rowspan="1" colspan="1">11.79 ± 2.35 nm
<xref ref-type="table-fn" rid="tfn3-ijn-7-1965">*</xref>
</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn2-ijn-7-1965">
<p>
<bold>Notes:</bold>
</p>
</fn>
<fn id="tfn3-ijn-7-1965">
<label>*</label>
<p>Lower R
<sub>a</sub>
and RMS compared with PT (
<italic>P</italic>
< 0.01). Anodization significantly smoothed titanium surface, whereas surface roughness was barely affected by FGF2 immobilization.</p>
</fn>
<fn id="tfn4-ijn-7-1965">
<p>
<bold>Abbreviations:</bold>
FGF2, fibroblast growth factor 2; NT, nanotube; PT, polished titanium; R
<sub>a</sub>
, average roughness, RMS, root mean square roughness.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="t3-ijn-7-1965" position="float">
<label>Table 3</label>
<caption>
<p>Elution of dissolvable FGF2 at different time intervals
<xref ref-type="table-fn" rid="tfn6-ijn-7-1965">*</xref>
</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1">Time interval</th>
<th colspan="2" align="left" valign="top" rowspan="1">NT-F-L</th>
<th colspan="2" align="left" valign="top" rowspan="1">NT-F-M</th>
<th colspan="2" align="left" valign="top" rowspan="1">NT-F-H</th>
</tr>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1"></th>
<th colspan="2" align="left" valign="top" rowspan="1">
<hr></hr>
</th>
<th colspan="2" align="left" valign="top" rowspan="1">
<hr></hr>
</th>
<th colspan="2" align="left" valign="top" rowspan="1">
<hr></hr>
</th>
</tr>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1"></th>
<th align="left" valign="top" rowspan="1" colspan="1">Mass (ng)</th>
<th align="left" valign="top" rowspan="1" colspan="1">Percent (accumulative)</th>
<th align="left" valign="top" rowspan="1" colspan="1">Mass (ng)</th>
<th align="left" valign="top" rowspan="1" colspan="1">Percent (accumulative)</th>
<th align="left" valign="top" rowspan="1" colspan="1">Mass (ng)</th>
<th align="left" valign="top" rowspan="1" colspan="1">Percent (accumulative)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">D0~D1</td>
<td align="left" valign="top" rowspan="1" colspan="1">10</td>
<td align="left" valign="top" rowspan="1" colspan="1">36.76</td>
<td align="left" valign="top" rowspan="1" colspan="1">24</td>
<td align="left" valign="top" rowspan="1" colspan="1">36.70</td>
<td align="left" valign="top" rowspan="1" colspan="1">35.6</td>
<td align="left" valign="top" rowspan="1" colspan="1">41.59</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">D1~D2</td>
<td align="left" valign="top" rowspan="1" colspan="1">6</td>
<td align="left" valign="top" rowspan="1" colspan="1">58.82</td>
<td align="left" valign="top" rowspan="1" colspan="1">14.1</td>
<td align="left" valign="top" rowspan="1" colspan="1">58.26</td>
<td align="left" valign="top" rowspan="1" colspan="1">16.5</td>
<td align="left" valign="top" rowspan="1" colspan="1">60.86</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">D2~D3</td>
<td align="left" valign="top" rowspan="1" colspan="1">3</td>
<td align="left" valign="top" rowspan="1" colspan="1">69.85</td>
<td align="left" valign="top" rowspan="1" colspan="1">7.9</td>
<td align="left" valign="top" rowspan="1" colspan="1">70.34</td>
<td align="left" valign="top" rowspan="1" colspan="1">8.9</td>
<td align="left" valign="top" rowspan="1" colspan="1">71.26</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">D3~D6</td>
<td align="left" valign="top" rowspan="1" colspan="1">4.5</td>
<td align="left" valign="top" rowspan="1" colspan="1">86.40</td>
<td align="left" valign="top" rowspan="1" colspan="1">11.5</td>
<td align="left" valign="top" rowspan="1" colspan="1">87.92</td>
<td align="left" valign="top" rowspan="1" colspan="1">15.5</td>
<td align="left" valign="top" rowspan="1" colspan="1">89.37</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">D6~D9</td>
<td align="left" valign="top" rowspan="1" colspan="1">1.5</td>
<td align="left" valign="top" rowspan="1" colspan="1">91.91</td>
<td align="left" valign="top" rowspan="1" colspan="1">4.5</td>
<td align="left" valign="top" rowspan="1" colspan="1">94.80</td>
<td align="left" valign="top" rowspan="1" colspan="1">5.7</td>
<td align="left" valign="top" rowspan="1" colspan="1">96.03</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">D9~D15</td>
<td align="left" valign="top" rowspan="1" colspan="1">1.4</td>
<td align="left" valign="top" rowspan="1" colspan="1">97.06</td>
<td align="left" valign="top" rowspan="1" colspan="1">2.3</td>
<td align="left" valign="top" rowspan="1" colspan="1">98.32</td>
<td align="left" valign="top" rowspan="1" colspan="1">2.1</td>
<td align="left" valign="top" rowspan="1" colspan="1">98.48</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">D15~D21</td>
<td align="left" valign="top" rowspan="1" colspan="1">0.6</td>
<td align="left" valign="top" rowspan="1" colspan="1">99.26</td>
<td align="left" valign="top" rowspan="1" colspan="1">0.7</td>
<td align="left" valign="top" rowspan="1" colspan="1">99.39</td>
<td align="left" valign="top" rowspan="1" colspan="1">0.8</td>
<td align="left" valign="top" rowspan="1" colspan="1">99.42</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">D21~D30</td>
<td align="left" valign="top" rowspan="1" colspan="1">0.2</td>
<td align="left" valign="top" rowspan="1" colspan="1">100.00</td>
<td align="left" valign="top" rowspan="1" colspan="1">0.4</td>
<td align="left" valign="top" rowspan="1" colspan="1">100.00</td>
<td align="left" valign="top" rowspan="1" colspan="1">0.5</td>
<td align="left" valign="top" rowspan="1" colspan="1">100.00</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn5-ijn-7-1965">
<p>
<bold>Notes:</bold>
</p>
</fn>
<fn id="tfn6-ijn-7-1965">
<label>*</label>
<p>Average amounts and accumulative percent of eluted FGF2 at each time interval. FGF2 rapidly eluted within the first 3 days, followed by a gradual reduction in elution. Over 90% of the dissolvable immobilized FGF2 eluted within 9 days. After 21 days, additional elution was negligible.</p>
</fn>
<fn id="tfn7-ijn-7-1965">
<p>
<bold>Abbreviations:</bold>
FGF2, fibroblast growth factor 2; NT, nanotube; PT, polished titanium.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="t4-ijn-7-1965" position="float">
<label>Table 4</label>
<caption>
<p>Summary of extracellular matrix-related gene expressions on Days 3, 6, and 9</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1"></th>
<th colspan="3" align="left" valign="top" rowspan="1">
<italic>VEGFA</italic>
</th>
<th colspan="3" align="left" valign="top" rowspan="1">
<italic>ITGB</italic>
</th>
<th colspan="3" align="left" valign="top" rowspan="1">
<italic>ICAM1</italic>
</th>
<th colspan="3" align="left" valign="top" rowspan="1">
<italic>LAMA1</italic>
</th>
</tr>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1"></th>
<th colspan="3" align="left" valign="top" rowspan="1">
<hr></hr>
</th>
<th colspan="3" align="left" valign="top" rowspan="1">
<hr></hr>
</th>
<th colspan="3" align="left" valign="top" rowspan="1">
<hr></hr>
</th>
<th colspan="3" align="left" valign="top" rowspan="1">
<hr></hr>
</th>
</tr>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1"></th>
<th align="left" valign="top" rowspan="1" colspan="1">D3</th>
<th align="left" valign="top" rowspan="1" colspan="1">D6</th>
<th align="left" valign="top" rowspan="1" colspan="1">D9</th>
<th align="left" valign="top" rowspan="1" colspan="1">D3</th>
<th align="left" valign="top" rowspan="1" colspan="1">D6</th>
<th align="left" valign="top" rowspan="1" colspan="1">D9</th>
<th align="left" valign="top" rowspan="1" colspan="1">D3</th>
<th align="left" valign="top" rowspan="1" colspan="1">D6</th>
<th align="left" valign="top" rowspan="1" colspan="1">D9</th>
<th align="left" valign="top" rowspan="1" colspan="1">D3</th>
<th align="left" valign="top" rowspan="1" colspan="1">D6</th>
<th align="left" valign="top" rowspan="1" colspan="1">D9</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">NT</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">/</td>
<td align="left" valign="top" rowspan="1" colspan="1">/</td>
<td align="left" valign="top" rowspan="1" colspan="1">/</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">/</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">NT-F-L</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+3</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">/</td>
<td align="left" valign="top" rowspan="1" colspan="1">/</td>
<td align="left" valign="top" rowspan="1" colspan="1">/</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+3</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">NT-F-M</td>
<td align="left" valign="top" rowspan="1" colspan="1">+3</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+4</td>
<td align="left" valign="top" rowspan="1" colspan="1">+4</td>
<td align="left" valign="top" rowspan="1" colspan="1">+4</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+3</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">NT-F-H</td>
<td align="left" valign="top" rowspan="1" colspan="1">+4</td>
<td align="left" valign="top" rowspan="1" colspan="1">+3</td>
<td align="left" valign="top" rowspan="1" colspan="1">+3</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+3</td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1"></td>
<td align="left" valign="top" rowspan="1" colspan="1">+2</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1"></td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
<td align="left" valign="top" rowspan="1" colspan="1">+</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn8-ijn-7-1965">
<p>
<bold>Notes: +</bold>
, Upregulated compared with PT (
<italic>P</italic>
< 0.01); −, downregulated (
<italic>P</italic>
< 0.01);
<bold>/</bold>
, no significant difference compared with PT.</p>
</fn>
<fn id="tfn9-ijn-7-1965">
<p>
<bold>Abbreviations:</bold>
<italic>ICAM1</italic>
, intercellular adhesion molecule 1;
<italic>ITGB</italic>
, β-integrin;
<italic>LAMA1</italic>
, laminin-1; NT, nanotube; PT, polished titanium;
<italic>VEGFA,</italic>
vascular endothelial growth factor A.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>République populaire de Chine</li>
</country>
</list>
<tree>
<country name="République populaire de Chine">
<noRegion>
<name sortKey="Ma, Qianli" sort="Ma, Qianli" uniqKey="Ma Q" first="Qianli" last="Ma">Qianli Ma</name>
</noRegion>
<name sortKey="Chu, Paul K" sort="Chu, Paul K" uniqKey="Chu P" first="Paul K" last="Chu">Paul K. Chu</name>
<name sortKey="Ji, Kun" sort="Ji, Kun" uniqKey="Ji K" first="Kun" last="Ji">Kun Ji</name>
<name sortKey="Jin, Lei" sort="Jin, Lei" uniqKey="Jin L" first="Lei" last="Jin">Lei Jin</name>
<name sortKey="Mei, Shenglin" sort="Mei, Shenglin" uniqKey="Mei S" first="Shenglin" last="Mei">Shenglin Mei</name>
<name sortKey="Mei, Shenglin" sort="Mei, Shenglin" uniqKey="Mei S" first="Shenglin" last="Mei">Shenglin Mei</name>
<name sortKey="Wang, Wei" sort="Wang, Wei" uniqKey="Wang W" first="Wei" last="Wang">Wei Wang</name>
<name sortKey="Zhang, Yumei" sort="Zhang, Yumei" uniqKey="Zhang Y" first="Yumei" last="Zhang">Yumei Zhang</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Santé/explor/EdenteV2/Data/Pmc/Checkpoint
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 001F29 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd -nk 001F29 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Santé
   |area=    EdenteV2
   |flux=    Pmc
   |étape=   Checkpoint
   |type=    RBID
   |clé=     PMC:3356224
   |texte=   Concentration- and time-dependent response of human gingival fibroblasts to fibroblast growth factor 2 immobilized on titanium dental implants
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/RBID.i   -Sk "pubmed:22619534" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd   \
       | NlmPubMed2Wicri -a EdenteV2 

Wicri

This area was generated with Dilib version V0.6.32.
Data generation: Thu Nov 30 15:26:48 2017. Site generation: Tue Mar 8 16:36:20 2022