Serveur d'exploration Chloroquine

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Lipoic Acid Synergizes with Antineoplastic Drugs in Colorectal Cancer by Targeting p53 for Proteasomal Degradation

Identifieur interne : 000635 ( Pmc/Checkpoint ); précédent : 000634; suivant : 000636

Lipoic Acid Synergizes with Antineoplastic Drugs in Colorectal Cancer by Targeting p53 for Proteasomal Degradation

Auteurs : Carina Neitzel [Allemagne] ; Nina Seiwert [Allemagne] ; Anja Göder [Allemagne] ; Erika Diehl [Allemagne] ; Carina Weber [Allemagne] ; Georg Nagel [Allemagne] ; Svenja Stroh [Allemagne] ; Birgit Rasenberger [Allemagne] ; Markus Christmann [Allemagne] ; Jörg Fahrer [Allemagne]

Source :

RBID : PMC:6721634

Abstract

Lipoic acid (LA) is a redox-active disulphide compound, which functions as a pivotal co-factor for mitochondrial oxidative decarboxylation. LA and chemical derivatives were shown to target mitochondria in cancer cells with altered energy metabolism, thereby inducing cell death. In this study, the impact of LA on the tumor suppressor protein p53 was analyzed in various colorectal cancer (CRC) cell lines, with a focus on the mechanisms driving p53 degradation. First, LA was demonstrated to trigger the depletion of both wildtype and mutant p53 protein in all CRC cells tested without influencing its gene expression and preceded LA-triggered cytotoxicity. Depletion of p53 coincided with a moderate, LA-dependent ROS production, but was not rescued by antioxidant treatment. LA induced the autophagy receptor p62 and differentially modulated autophagosome formation in CRC cells. However, p53 degradation was not mediated via autophagy as shown by chemical inhibition and genetic abrogation of autophagy. LA treatment also stabilized and activated the transcription factor Nrf2 in CRC cells, which was however dispensable for p53 degradation. Mechanistically, p53 was found to be readily ubiquitinylated and degraded by the proteasomal machinery following LA treatment, which did not involve the E3 ubiquitin ligase MDM2. Intriguingly, the combination of LA and anticancer drugs (doxorubicin, 5-fluorouracil) attenuated p53-mediated stabilization of p21 and resulted in synergistic killing in CRC cells in a p53-dependant manner.


Url:
DOI: 10.3390/cells8080794
PubMed: 31366086
PubMed Central: 6721634


Affiliations:


Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:6721634

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Lipoic Acid Synergizes with Antineoplastic Drugs in Colorectal Cancer by Targeting p53 for Proteasomal Degradation</title>
<author>
<name sortKey="Neitzel, Carina" sort="Neitzel, Carina" uniqKey="Neitzel C" first="Carina" last="Neitzel">Carina Neitzel</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-cells-08-00794">Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen</wicri:regionArea>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="af3-cells-08-00794">Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Kaiserslautern</settlement>
</placeName>
<orgName type="university">Université technique de Kaiserslautern</orgName>
</affiliation>
</author>
<author>
<name sortKey="Seiwert, Nina" sort="Seiwert, Nina" uniqKey="Seiwert N" first="Nina" last="Seiwert">Nina Seiwert</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-cells-08-00794">Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen</wicri:regionArea>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="af3-cells-08-00794">Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Kaiserslautern</settlement>
</placeName>
<orgName type="university">Université technique de Kaiserslautern</orgName>
</affiliation>
</author>
<author>
<name sortKey="Goder, Anja" sort="Goder, Anja" uniqKey="Goder A" first="Anja" last="Göder">Anja Göder</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Diehl, Erika" sort="Diehl, Erika" uniqKey="Diehl E" first="Erika" last="Diehl">Erika Diehl</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Weber, Carina" sort="Weber, Carina" uniqKey="Weber C" first="Carina" last="Weber">Carina Weber</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Nagel, Georg" sort="Nagel, Georg" uniqKey="Nagel G" first="Georg" last="Nagel">Georg Nagel</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Stroh, Svenja" sort="Stroh, Svenja" uniqKey="Stroh S" first="Svenja" last="Stroh">Svenja Stroh</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Rasenberger, Birgit" sort="Rasenberger, Birgit" uniqKey="Rasenberger B" first="Birgit" last="Rasenberger">Birgit Rasenberger</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Christmann, Markus" sort="Christmann, Markus" uniqKey="Christmann M" first="Markus" last="Christmann">Markus Christmann</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Fahrer, Jorg" sort="Fahrer, Jorg" uniqKey="Fahrer J" first="Jörg" last="Fahrer">Jörg Fahrer</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-cells-08-00794">Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen</wicri:regionArea>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="af3-cells-08-00794">Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Kaiserslautern</settlement>
</placeName>
<orgName type="university">Université technique de Kaiserslautern</orgName>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">31366086</idno>
<idno type="pmc">6721634</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6721634</idno>
<idno type="RBID">PMC:6721634</idno>
<idno type="doi">10.3390/cells8080794</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">000475</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000475</idno>
<idno type="wicri:Area/Pmc/Curation">000475</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000475</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000635</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000635</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Lipoic Acid Synergizes with Antineoplastic Drugs in Colorectal Cancer by Targeting p53 for Proteasomal Degradation</title>
<author>
<name sortKey="Neitzel, Carina" sort="Neitzel, Carina" uniqKey="Neitzel C" first="Carina" last="Neitzel">Carina Neitzel</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-cells-08-00794">Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen</wicri:regionArea>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="af3-cells-08-00794">Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Kaiserslautern</settlement>
</placeName>
<orgName type="university">Université technique de Kaiserslautern</orgName>
</affiliation>
</author>
<author>
<name sortKey="Seiwert, Nina" sort="Seiwert, Nina" uniqKey="Seiwert N" first="Nina" last="Seiwert">Nina Seiwert</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-cells-08-00794">Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen</wicri:regionArea>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="af3-cells-08-00794">Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Kaiserslautern</settlement>
</placeName>
<orgName type="university">Université technique de Kaiserslautern</orgName>
</affiliation>
</author>
<author>
<name sortKey="Goder, Anja" sort="Goder, Anja" uniqKey="Goder A" first="Anja" last="Göder">Anja Göder</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Diehl, Erika" sort="Diehl, Erika" uniqKey="Diehl E" first="Erika" last="Diehl">Erika Diehl</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Weber, Carina" sort="Weber, Carina" uniqKey="Weber C" first="Carina" last="Weber">Carina Weber</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Nagel, Georg" sort="Nagel, Georg" uniqKey="Nagel G" first="Georg" last="Nagel">Georg Nagel</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Stroh, Svenja" sort="Stroh, Svenja" uniqKey="Stroh S" first="Svenja" last="Stroh">Svenja Stroh</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Rasenberger, Birgit" sort="Rasenberger, Birgit" uniqKey="Rasenberger B" first="Birgit" last="Rasenberger">Birgit Rasenberger</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Christmann, Markus" sort="Christmann, Markus" uniqKey="Christmann M" first="Markus" last="Christmann">Markus Christmann</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Fahrer, Jorg" sort="Fahrer, Jorg" uniqKey="Fahrer J" first="Jörg" last="Fahrer">Jörg Fahrer</name>
<affiliation wicri:level="3">
<nlm:aff id="af1-cells-08-00794">Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Institute of Toxicology, University Medical Center Mainz, 55131 Mainz</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Mayence</settlement>
</placeName>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-cells-08-00794">Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen</wicri:regionArea>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
<wicri:noRegion>35392 Giessen</wicri:noRegion>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="af3-cells-08-00794">Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern</wicri:regionArea>
<placeName>
<region type="land" nuts="2">Rhénanie-Palatinat</region>
<settlement type="city">Kaiserslautern</settlement>
</placeName>
<orgName type="university">Université technique de Kaiserslautern</orgName>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Cells</title>
<idno type="eISSN">2073-4409</idno>
<imprint>
<date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Lipoic acid (LA) is a redox-active disulphide compound, which functions as a pivotal co-factor for mitochondrial oxidative decarboxylation. LA and chemical derivatives were shown to target mitochondria in cancer cells with altered energy metabolism, thereby inducing cell death. In this study, the impact of LA on the tumor suppressor protein p53 was analyzed in various colorectal cancer (CRC) cell lines, with a focus on the mechanisms driving p53 degradation. First, LA was demonstrated to trigger the depletion of both wildtype and mutant p53 protein in all CRC cells tested without influencing its gene expression and preceded LA-triggered cytotoxicity. Depletion of p53 coincided with a moderate, LA-dependent ROS production, but was not rescued by antioxidant treatment. LA induced the autophagy receptor p62 and differentially modulated autophagosome formation in CRC cells. However, p53 degradation was not mediated via autophagy as shown by chemical inhibition and genetic abrogation of autophagy. LA treatment also stabilized and activated the transcription factor Nrf2 in CRC cells, which was however dispensable for p53 degradation. Mechanistically, p53 was found to be readily ubiquitinylated and degraded by the proteasomal machinery following LA treatment, which did not involve the E3 ubiquitin ligase MDM2. Intriguingly, the combination of LA and anticancer drugs (doxorubicin, 5-fluorouracil) attenuated p53-mediated stabilization of p21 and resulted in synergistic killing in CRC cells in a p53-dependant manner.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Jones, W" uniqKey="Jones W">W. Jones</name>
</author>
<author>
<name sortKey="Li, X" uniqKey="Li X">X. Li</name>
</author>
<author>
<name sortKey="Qu, Z C" uniqKey="Qu Z">Z.-c. Qu</name>
</author>
<author>
<name sortKey="Perriott, L" uniqKey="Perriott L">L. Perriott</name>
</author>
<author>
<name sortKey="Whitesell, R R" uniqKey="Whitesell R">R.R. Whitesell</name>
</author>
<author>
<name sortKey="May, J M" uniqKey="May J">J.M. May</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sigel, H" uniqKey="Sigel H">H. Sigel</name>
</author>
<author>
<name sortKey="Prijs, B" uniqKey="Prijs B">B. Prijs</name>
</author>
<author>
<name sortKey="Mccormick, D B" uniqKey="Mccormick D">D.B. McCormick</name>
</author>
<author>
<name sortKey="Shih, J C" uniqKey="Shih J">J.C. Shih</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shay, K P" uniqKey="Shay K">K.P. Shay</name>
</author>
<author>
<name sortKey="Moreau, R F" uniqKey="Moreau R">R.F. Moreau</name>
</author>
<author>
<name sortKey="Smith, E J" uniqKey="Smith E">E.J. Smith</name>
</author>
<author>
<name sortKey="Smith, A R" uniqKey="Smith A">A.R. Smith</name>
</author>
<author>
<name sortKey="Hagen, T M" uniqKey="Hagen T">T.M. Hagen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rochette, L" uniqKey="Rochette L">L. Rochette</name>
</author>
<author>
<name sortKey="Ghibu, S" uniqKey="Ghibu S">S. Ghibu</name>
</author>
<author>
<name sortKey="Richard, C" uniqKey="Richard C">C. Richard</name>
</author>
<author>
<name sortKey="Zeller, M" uniqKey="Zeller M">M. Zeller</name>
</author>
<author>
<name sortKey="Cottin, Y" uniqKey="Cottin Y">Y. Cottin</name>
</author>
<author>
<name sortKey="Vergely, C" uniqKey="Vergely C">C. Vergely</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Satoh, S" uniqKey="Satoh S">S. Satoh</name>
</author>
<author>
<name sortKey="Shindoh, M" uniqKey="Shindoh M">M. Shindoh</name>
</author>
<author>
<name sortKey="Min, J Z" uniqKey="Min J">J.Z. Min</name>
</author>
<author>
<name sortKey="Toyo Ka, T" uniqKey="Toyo Ka T">T. Toyo’oka</name>
</author>
<author>
<name sortKey="Fukushima, T" uniqKey="Fukushima T">T. Fukushima</name>
</author>
<author>
<name sortKey="Inagaki, S" uniqKey="Inagaki S">S. Inagaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Akiba, S" uniqKey="Akiba S">S. Akiba</name>
</author>
<author>
<name sortKey="Matsugo, S" uniqKey="Matsugo S">S. Matsugo</name>
</author>
<author>
<name sortKey="Packer, L" uniqKey="Packer L">L. Packer</name>
</author>
<author>
<name sortKey="Konishi, T" uniqKey="Konishi T">T. Konishi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jarrett, J T" uniqKey="Jarrett J">J.T. Jarrett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Reljanovic, M" uniqKey="Reljanovic M">M. Reljanovic</name>
</author>
<author>
<name sortKey="Reichel, G" uniqKey="Reichel G">G. Reichel</name>
</author>
<author>
<name sortKey="Rett, K" uniqKey="Rett K">K. Rett</name>
</author>
<author>
<name sortKey="Lobisch, M" uniqKey="Lobisch M">M. Lobisch</name>
</author>
<author>
<name sortKey="Schuette, K" uniqKey="Schuette K">K. Schuette</name>
</author>
<author>
<name sortKey="Moller, W" uniqKey="Moller W">W. Möller</name>
</author>
<author>
<name sortKey="Tritschler, H J" uniqKey="Tritschler H">H.-J. Tritschler</name>
</author>
<author>
<name sortKey="Mehnert, H" uniqKey="Mehnert H">H. Mehnert</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dorsam, B" uniqKey="Dorsam B">B. Dörsam</name>
</author>
<author>
<name sortKey="Fahrer, J" uniqKey="Fahrer J">J. Fahrer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abolhassani, M" uniqKey="Abolhassani M">M. Abolhassani</name>
</author>
<author>
<name sortKey="Guais, A" uniqKey="Guais A">A. Guais</name>
</author>
<author>
<name sortKey="Sanders, E" uniqKey="Sanders E">E. Sanders</name>
</author>
<author>
<name sortKey="Campion, F" uniqKey="Campion F">F. Campion</name>
</author>
<author>
<name sortKey="Fichtner, I" uniqKey="Fichtner I">I. Fichtner</name>
</author>
<author>
<name sortKey="Bonte, J" uniqKey="Bonte J">J. Bonte</name>
</author>
<author>
<name sortKey="Baronzio, G" uniqKey="Baronzio G">G. Baronzio</name>
</author>
<author>
<name sortKey="Fiorentini, G" uniqKey="Fiorentini G">G. Fiorentini</name>
</author>
<author>
<name sortKey="Israel, M" uniqKey="Israel M">M. Israël</name>
</author>
<author>
<name sortKey="Schwartz, L" uniqKey="Schwartz L">L. Schwartz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Feuerecker, B" uniqKey="Feuerecker B">B. Feuerecker</name>
</author>
<author>
<name sortKey="Pirsig, S" uniqKey="Pirsig S">S. Pirsig</name>
</author>
<author>
<name sortKey="Seidl, C" uniqKey="Seidl C">C. Seidl</name>
</author>
<author>
<name sortKey="Aichler, M" uniqKey="Aichler M">M. Aichler</name>
</author>
<author>
<name sortKey="Feuchtinger, A" uniqKey="Feuchtinger A">A. Feuchtinger</name>
</author>
<author>
<name sortKey="Bruchelt, G" uniqKey="Bruchelt G">G. Bruchelt</name>
</author>
<author>
<name sortKey="Senekowitsch Schmidtke, R" uniqKey="Senekowitsch Schmidtke R">R. Senekowitsch-Schmidtke</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jeon, M J" uniqKey="Jeon M">M.J. Jeon</name>
</author>
<author>
<name sortKey="Kim, W G" uniqKey="Kim W">W.G. Kim</name>
</author>
<author>
<name sortKey="Lim, S" uniqKey="Lim S">S. Lim</name>
</author>
<author>
<name sortKey="Choi, H J" uniqKey="Choi H">H.-J. Choi</name>
</author>
<author>
<name sortKey="Sim, S" uniqKey="Sim S">S. Sim</name>
</author>
<author>
<name sortKey="Kim, T Y" uniqKey="Kim T">T.Y. Kim</name>
</author>
<author>
<name sortKey="Shong, Y K" uniqKey="Shong Y">Y.K. Shong</name>
</author>
<author>
<name sortKey="Kim, W B" uniqKey="Kim W">W.B. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Goder, A" uniqKey="Goder A">A. Göder</name>
</author>
<author>
<name sortKey="Nagel, G" uniqKey="Nagel G">G. Nagel</name>
</author>
<author>
<name sortKey="Kraus, A" uniqKey="Kraus A">A. Kraus</name>
</author>
<author>
<name sortKey="Dorsam, B" uniqKey="Dorsam B">B. Dörsam</name>
</author>
<author>
<name sortKey="Seiwert, N" uniqKey="Seiwert N">N. Seiwert</name>
</author>
<author>
<name sortKey="Kaina, B" uniqKey="Kaina B">B. Kaina</name>
</author>
<author>
<name sortKey="Fahrer, J" uniqKey="Fahrer J">J. Fahrer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zachar, Z" uniqKey="Zachar Z">Z. Zachar</name>
</author>
<author>
<name sortKey="Marecek, J" uniqKey="Marecek J">J. Marecek</name>
</author>
<author>
<name sortKey="Maturo, C" uniqKey="Maturo C">C. Maturo</name>
</author>
<author>
<name sortKey="Gupta, S" uniqKey="Gupta S">S. Gupta</name>
</author>
<author>
<name sortKey="Stuart, S D" uniqKey="Stuart S">S.D. Stuart</name>
</author>
<author>
<name sortKey="Howell, K" uniqKey="Howell K">K. Howell</name>
</author>
<author>
<name sortKey="Schauble, A" uniqKey="Schauble A">A. Schauble</name>
</author>
<author>
<name sortKey="Lem, J" uniqKey="Lem J">J. Lem</name>
</author>
<author>
<name sortKey="Piramzadian, A" uniqKey="Piramzadian A">A. Piramzadian</name>
</author>
<author>
<name sortKey="Karnik, S" uniqKey="Karnik S">S. Karnik</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dorsam, B" uniqKey="Dorsam B">B. Dörsam</name>
</author>
<author>
<name sortKey="Goder, A" uniqKey="Goder A">A. Göder</name>
</author>
<author>
<name sortKey="Seiwert, N" uniqKey="Seiwert N">N. Seiwert</name>
</author>
<author>
<name sortKey="Kaina, B" uniqKey="Kaina B">B. Kaina</name>
</author>
<author>
<name sortKey="Fahrer, J" uniqKey="Fahrer J">J. Fahrer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moungjaroen, J" uniqKey="Moungjaroen J">J. Moungjaroen</name>
</author>
<author>
<name sortKey="Nimmannit, U" uniqKey="Nimmannit U">U. Nimmannit</name>
</author>
<author>
<name sortKey="Callery, P S" uniqKey="Callery P">P.S. Callery</name>
</author>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L. Wang</name>
</author>
<author>
<name sortKey="Azad, N" uniqKey="Azad N">N. Azad</name>
</author>
<author>
<name sortKey="Lipipun, V" uniqKey="Lipipun V">V. Lipipun</name>
</author>
<author>
<name sortKey="Chanvorachote, P" uniqKey="Chanvorachote P">P. Chanvorachote</name>
</author>
<author>
<name sortKey="Rojanasakul, Y" uniqKey="Rojanasakul Y">Y. Rojanasakul</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wenzel, U" uniqKey="Wenzel U">U. Wenzel</name>
</author>
<author>
<name sortKey="Nickel, A" uniqKey="Nickel A">A. Nickel</name>
</author>
<author>
<name sortKey="Daniel, H" uniqKey="Daniel H">H. Daniel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sen, C K" uniqKey="Sen C">C.K. Sen</name>
</author>
<author>
<name sortKey="Sashwati, R" uniqKey="Sashwati R">R. Sashwati</name>
</author>
<author>
<name sortKey="Packer, L" uniqKey="Packer L">L. Packer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yoo, T H" uniqKey="Yoo T">T.-H. Yoo</name>
</author>
<author>
<name sortKey="Lee, J H" uniqKey="Lee J">J.-H. Lee</name>
</author>
<author>
<name sortKey="Chun, H S" uniqKey="Chun H">H.-S. Chun</name>
</author>
<author>
<name sortKey="Chi, S G" uniqKey="Chi S">S.-G. Chi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fahrer, J" uniqKey="Fahrer J">J. Fahrer</name>
</author>
<author>
<name sortKey="Kaina, B" uniqKey="Kaina B">B. Kaina</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brady, C A" uniqKey="Brady C">C.A. Brady</name>
</author>
<author>
<name sortKey="Attardi, L D" uniqKey="Attardi L">L.D. Attardi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Christmann, M" uniqKey="Christmann M">M. Christmann</name>
</author>
<author>
<name sortKey="Kaina, B" uniqKey="Kaina B">B. Kaina</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Williams, A B" uniqKey="Williams A">A.B. Williams</name>
</author>
<author>
<name sortKey="Schumacher, B" uniqKey="Schumacher B">B. Schumacher</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, J" uniqKey="Chen J">J. Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dai, C" uniqKey="Dai C">C. Dai</name>
</author>
<author>
<name sortKey="Gu, W" uniqKey="Gu W">W. Gu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, D H" uniqKey="Kim D">D.-H. Kim</name>
</author>
<author>
<name sortKey="Kundu, J K" uniqKey="Kundu J">J.K. Kundu</name>
</author>
<author>
<name sortKey="Surh, Y J" uniqKey="Surh Y">Y.-J. Surh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Muller, P A J" uniqKey="Muller P">P.A.J. Muller</name>
</author>
<author>
<name sortKey="Vousden, K H" uniqKey="Vousden K">K.H. Vousden</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Miller, M" uniqKey="Miller M">M. Miller</name>
</author>
<author>
<name sortKey="Shirole, N" uniqKey="Shirole N">N. Shirole</name>
</author>
<author>
<name sortKey="Tian, R" uniqKey="Tian R">R. Tian</name>
</author>
<author>
<name sortKey="Pal, D" uniqKey="Pal D">D. Pal</name>
</author>
<author>
<name sortKey="Sordella, R" uniqKey="Sordella R">R. Sordella</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Olivier, M" uniqKey="Olivier M">M. Olivier</name>
</author>
<author>
<name sortKey="Hollstein, M" uniqKey="Hollstein M">M. Hollstein</name>
</author>
<author>
<name sortKey="Hainaut, P" uniqKey="Hainaut P">P. Hainaut</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gatei, M" uniqKey="Gatei M">M. Gatei</name>
</author>
<author>
<name sortKey="Shkedy, D" uniqKey="Shkedy D">D. Shkedy</name>
</author>
<author>
<name sortKey="Khanna, K K" uniqKey="Khanna K">K.K. Khanna</name>
</author>
<author>
<name sortKey="Uziel, T" uniqKey="Uziel T">T. Uziel</name>
</author>
<author>
<name sortKey="Shiloh, Y" uniqKey="Shiloh Y">Y. Shiloh</name>
</author>
<author>
<name sortKey="Pandita, T K" uniqKey="Pandita T">T.K. Pandita</name>
</author>
<author>
<name sortKey="Lavin, M F" uniqKey="Lavin M">M.F. Lavin</name>
</author>
<author>
<name sortKey="Rotman, G" uniqKey="Rotman G">G. Rotman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Simbula, G" uniqKey="Simbula G">G. Simbula</name>
</author>
<author>
<name sortKey="Columbano, A" uniqKey="Columbano A">A. Columbano</name>
</author>
<author>
<name sortKey="Ledda Columbano, G M" uniqKey="Ledda Columbano G">G.M. Ledda-Columbano</name>
</author>
<author>
<name sortKey="Sanna, L" uniqKey="Sanna L">L. Sanna</name>
</author>
<author>
<name sortKey="Deidda, M" uniqKey="Deidda M">M. Deidda</name>
</author>
<author>
<name sortKey="Diana, A" uniqKey="Diana A">A. Diana</name>
</author>
<author>
<name sortKey="Pibiri, M" uniqKey="Pibiri M">M. Pibiri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Park, S" uniqKey="Park S">S. Park</name>
</author>
<author>
<name sortKey="Choi, S K" uniqKey="Choi S">S.K. Choi</name>
</author>
<author>
<name sortKey="Choi, Y" uniqKey="Choi Y">Y. Choi</name>
</author>
<author>
<name sortKey="Moon, H S" uniqKey="Moon H">H.-S. Moon</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seiwert, N" uniqKey="Seiwert N">N. Seiwert</name>
</author>
<author>
<name sortKey="Neitzel, C" uniqKey="Neitzel C">C. Neitzel</name>
</author>
<author>
<name sortKey="Stroh, S" uniqKey="Stroh S">S. Stroh</name>
</author>
<author>
<name sortKey="Frisan, T" uniqKey="Frisan T">T. Frisan</name>
</author>
<author>
<name sortKey="Audebert, M" uniqKey="Audebert M">M. Audebert</name>
</author>
<author>
<name sortKey="Toulany, M" uniqKey="Toulany M">M. Toulany</name>
</author>
<author>
<name sortKey="Kaina, B" uniqKey="Kaina B">B. Kaina</name>
</author>
<author>
<name sortKey="Fahrer, J" uniqKey="Fahrer J">J. Fahrer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mimmler, M" uniqKey="Mimmler M">M. Mimmler</name>
</author>
<author>
<name sortKey="Peter, S" uniqKey="Peter S">S. Peter</name>
</author>
<author>
<name sortKey="Kraus, A" uniqKey="Kraus A">A. Kraus</name>
</author>
<author>
<name sortKey="Stroh, S" uniqKey="Stroh S">S. Stroh</name>
</author>
<author>
<name sortKey="Nikolova, T" uniqKey="Nikolova T">T. Nikolova</name>
</author>
<author>
<name sortKey="Seiwert, N" uniqKey="Seiwert N">N. Seiwert</name>
</author>
<author>
<name sortKey="Hasselwander, S" uniqKey="Hasselwander S">S. Hasselwander</name>
</author>
<author>
<name sortKey="Neitzel, C" uniqKey="Neitzel C">C. Neitzel</name>
</author>
<author>
<name sortKey="Haub, J" uniqKey="Haub J">J. Haub</name>
</author>
<author>
<name sortKey="Monien, B H" uniqKey="Monien B">B.H. Monien</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Christmann, M" uniqKey="Christmann M">M. Christmann</name>
</author>
<author>
<name sortKey="Boisseau, C" uniqKey="Boisseau C">C. Boisseau</name>
</author>
<author>
<name sortKey="Kitzinger, R" uniqKey="Kitzinger R">R. Kitzinger</name>
</author>
<author>
<name sortKey="Berac, C" uniqKey="Berac C">C. Berac</name>
</author>
<author>
<name sortKey="Allmann, S" uniqKey="Allmann S">S. Allmann</name>
</author>
<author>
<name sortKey="Sommer, T" uniqKey="Sommer T">T. Sommer</name>
</author>
<author>
<name sortKey="Aasland, D" uniqKey="Aasland D">D. Aasland</name>
</author>
<author>
<name sortKey="Kaina, B" uniqKey="Kaina B">B. Kaina</name>
</author>
<author>
<name sortKey="Tomicic, M T" uniqKey="Tomicic M">M.T. Tomicic</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fahrer, J" uniqKey="Fahrer J">J. Fahrer</name>
</author>
<author>
<name sortKey="Huelsenbeck, J" uniqKey="Huelsenbeck J">J. Huelsenbeck</name>
</author>
<author>
<name sortKey="Jaurich, H" uniqKey="Jaurich H">H. Jaurich</name>
</author>
<author>
<name sortKey="Dorsam, B" uniqKey="Dorsam B">B. Dörsam</name>
</author>
<author>
<name sortKey="Frisan, T" uniqKey="Frisan T">T. Frisan</name>
</author>
<author>
<name sortKey="Eich, M" uniqKey="Eich M">M. Eich</name>
</author>
<author>
<name sortKey="Roos, W P" uniqKey="Roos W">W.P. Roos</name>
</author>
<author>
<name sortKey="Kaina, B" uniqKey="Kaina B">B. Kaina</name>
</author>
<author>
<name sortKey="Fritz, G" uniqKey="Fritz G">G. Fritz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vermes, I" uniqKey="Vermes I">I. Vermes</name>
</author>
<author>
<name sortKey="Haanen, C" uniqKey="Haanen C">C. Haanen</name>
</author>
<author>
<name sortKey="Steffens Nakken, H" uniqKey="Steffens Nakken H">H. Steffens-Nakken</name>
</author>
<author>
<name sortKey="Reutelingsperger, C" uniqKey="Reutelingsperger C">C. Reutelingsperger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rieger, A M" uniqKey="Rieger A">A.M. Rieger</name>
</author>
<author>
<name sortKey="Hall, B E" uniqKey="Hall B">B.E. Hall</name>
</author>
<author>
<name sortKey="Le Luong, T" uniqKey="Le Luong T">T. Le Luong</name>
</author>
<author>
<name sortKey="Schang, L M" uniqKey="Schang L">L.M. Schang</name>
</author>
<author>
<name sortKey="Barreda, D R" uniqKey="Barreda D">D.R. Barreda</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dorsam, B" uniqKey="Dorsam B">B. Dörsam</name>
</author>
<author>
<name sortKey="Wu, C F" uniqKey="Wu C">C.-F. Wu</name>
</author>
<author>
<name sortKey="Efferth, T" uniqKey="Efferth T">T. Efferth</name>
</author>
<author>
<name sortKey="Kaina, B" uniqKey="Kaina B">B. Kaina</name>
</author>
<author>
<name sortKey="Fahrer, J" uniqKey="Fahrer J">J. Fahrer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chou, T C" uniqKey="Chou T">T.-C. Chou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ahmed, D" uniqKey="Ahmed D">D. Ahmed</name>
</author>
<author>
<name sortKey="Eide, P W" uniqKey="Eide P">P.W. Eide</name>
</author>
<author>
<name sortKey="Eilertsen, I A" uniqKey="Eilertsen I">I.A. Eilertsen</name>
</author>
<author>
<name sortKey="Danielsen, S A" uniqKey="Danielsen S">S.A. Danielsen</name>
</author>
<author>
<name sortKey="Ekn S, M" uniqKey="Ekn S M">M. Eknæs</name>
</author>
<author>
<name sortKey="Hektoen, M" uniqKey="Hektoen M">M. Hektoen</name>
</author>
<author>
<name sortKey="Lind, G E" uniqKey="Lind G">G.E. Lind</name>
</author>
<author>
<name sortKey="Lothe, R A" uniqKey="Lothe R">R.A. Lothe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Subbarao Sreedhar, A" uniqKey="Subbarao Sreedhar A">A. Subbarao Sreedhar</name>
</author>
<author>
<name sortKey="Kalmar, E" uniqKey="Kalmar E">É. Kalmár</name>
</author>
<author>
<name sortKey="Csermely, P" uniqKey="Csermely P">P. Csermely</name>
</author>
<author>
<name sortKey="Shen, Y F" uniqKey="Shen Y">Y.-F. Shen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dorsam, B" uniqKey="Dorsam B">B. Dörsam</name>
</author>
<author>
<name sortKey="Seiwert, N" uniqKey="Seiwert N">N. Seiwert</name>
</author>
<author>
<name sortKey="Foersch, S" uniqKey="Foersch S">S. Foersch</name>
</author>
<author>
<name sortKey="Stroh, S" uniqKey="Stroh S">S. Stroh</name>
</author>
<author>
<name sortKey="Nagel, G" uniqKey="Nagel G">G. Nagel</name>
</author>
<author>
<name sortKey="Begaliew, D" uniqKey="Begaliew D">D. Begaliew</name>
</author>
<author>
<name sortKey="Diehl, E" uniqKey="Diehl E">E. Diehl</name>
</author>
<author>
<name sortKey="Kraus, A" uniqKey="Kraus A">A. Kraus</name>
</author>
<author>
<name sortKey="Mckeague, M" uniqKey="Mckeague M">M. McKeague</name>
</author>
<author>
<name sortKey="Minneker, V" uniqKey="Minneker V">V. Minneker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abrahams, S" uniqKey="Abrahams S">S. Abrahams</name>
</author>
<author>
<name sortKey="Haylett, W L" uniqKey="Haylett W">W.L. Haylett</name>
</author>
<author>
<name sortKey="Johnson, G" uniqKey="Johnson G">G. Johnson</name>
</author>
<author>
<name sortKey="Carr, J A" uniqKey="Carr J">J.A. Carr</name>
</author>
<author>
<name sortKey="Bardien, S" uniqKey="Bardien S">S. Bardien</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Glick, D" uniqKey="Glick D">D. Glick</name>
</author>
<author>
<name sortKey="Barth, S" uniqKey="Barth S">S. Barth</name>
</author>
<author>
<name sortKey="Macleod, K F" uniqKey="Macleod K">K.F. Macleod</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Meijer, A J" uniqKey="Meijer A">A.J. Meijer</name>
</author>
<author>
<name sortKey="Codogno, P" uniqKey="Codogno P">P. Codogno</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Klionsky, D J" uniqKey="Klionsky D">D.J. Klionsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mizushima, N" uniqKey="Mizushima N">N. Mizushima</name>
</author>
<author>
<name sortKey="Yoshimori, T" uniqKey="Yoshimori T">T. Yoshimori</name>
</author>
<author>
<name sortKey="Ohsumi, Y" uniqKey="Ohsumi Y">Y. Ohsumi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tebay, L E" uniqKey="Tebay L">L.E. Tebay</name>
</author>
<author>
<name sortKey="Robertson, H" uniqKey="Robertson H">H. Robertson</name>
</author>
<author>
<name sortKey="Durant, S T" uniqKey="Durant S">S.T. Durant</name>
</author>
<author>
<name sortKey="Vitale, S R" uniqKey="Vitale S">S.R. Vitale</name>
</author>
<author>
<name sortKey="Penning, T M" uniqKey="Penning T">T.M. Penning</name>
</author>
<author>
<name sortKey="Dinkova Kostova, A T" uniqKey="Dinkova Kostova A">A.T. Dinkova-Kostova</name>
</author>
<author>
<name sortKey="Hayes, J D" uniqKey="Hayes J">J.D. Hayes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lau, A" uniqKey="Lau A">A. Lau</name>
</author>
<author>
<name sortKey="Tian, W" uniqKey="Tian W">W. Tian</name>
</author>
<author>
<name sortKey="Whitman, S A" uniqKey="Whitman S">S.A. Whitman</name>
</author>
<author>
<name sortKey="Zhang, D D" uniqKey="Zhang D">D.D. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Singh, A" uniqKey="Singh A">A. Singh</name>
</author>
<author>
<name sortKey="Venkannagari, S" uniqKey="Venkannagari S">S. Venkannagari</name>
</author>
<author>
<name sortKey="Oh, K H" uniqKey="Oh K">K.H. Oh</name>
</author>
<author>
<name sortKey="Zhang, Y Q" uniqKey="Zhang Y">Y.-Q. Zhang</name>
</author>
<author>
<name sortKey="Rohde, J M" uniqKey="Rohde J">J.M. Rohde</name>
</author>
<author>
<name sortKey="Liu, L" uniqKey="Liu L">L. Liu</name>
</author>
<author>
<name sortKey="Nimmagadda, S" uniqKey="Nimmagadda S">S. Nimmagadda</name>
</author>
<author>
<name sortKey="Sudini, K" uniqKey="Sudini K">K. Sudini</name>
</author>
<author>
<name sortKey="Brimacombe, K R" uniqKey="Brimacombe K">K.R. Brimacombe</name>
</author>
<author>
<name sortKey="Gajghate, S" uniqKey="Gajghate S">S. Gajghate</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, Y" uniqKey="Yang Y">Y. Yang</name>
</author>
<author>
<name sortKey="Xi, Z" uniqKey="Xi Z">Z. Xi</name>
</author>
<author>
<name sortKey="Xue, Y" uniqKey="Xue Y">Y. Xue</name>
</author>
<author>
<name sortKey="Ren, J" uniqKey="Ren J">J. Ren</name>
</author>
<author>
<name sortKey="Sun, Y" uniqKey="Sun Y">Y. Sun</name>
</author>
<author>
<name sortKey="Wang, B" uniqKey="Wang B">B. Wang</name>
</author>
<author>
<name sortKey="Zhong, Z" uniqKey="Zhong Z">Z. Zhong</name>
</author>
<author>
<name sortKey="Yang, G Y" uniqKey="Yang G">G.-Y. Yang</name>
</author>
<author>
<name sortKey="Sun, Q" uniqKey="Sun Q">Q. Sun</name>
</author>
<author>
<name sortKey="Bian, L" uniqKey="Bian L">L. Bian</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bard, J A M" uniqKey="Bard J">J.A.M. Bard</name>
</author>
<author>
<name sortKey="Goodall, E A" uniqKey="Goodall E">E.A. Goodall</name>
</author>
<author>
<name sortKey="Greene, E R" uniqKey="Greene E">E.R. Greene</name>
</author>
<author>
<name sortKey="Jonsson, E" uniqKey="Jonsson E">E. Jonsson</name>
</author>
<author>
<name sortKey="Dong, K C" uniqKey="Dong K">K.C. Dong</name>
</author>
<author>
<name sortKey="Martin, A" uniqKey="Martin A">A. Martin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wade, M" uniqKey="Wade M">M. Wade</name>
</author>
<author>
<name sortKey="Li, Y C" uniqKey="Li Y">Y.-C. Li</name>
</author>
<author>
<name sortKey="Wahl, G M" uniqKey="Wahl G">G.M. Wahl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vassilev, L T" uniqKey="Vassilev L">L.T. Vassilev</name>
</author>
<author>
<name sortKey="Vu, B T" uniqKey="Vu B">B.T. Vu</name>
</author>
<author>
<name sortKey="Graves, B" uniqKey="Graves B">B. Graves</name>
</author>
<author>
<name sortKey="Carvajal, D" uniqKey="Carvajal D">D. Carvajal</name>
</author>
<author>
<name sortKey="Podlaski, F" uniqKey="Podlaski F">F. Podlaski</name>
</author>
<author>
<name sortKey="Filipovic, Z" uniqKey="Filipovic Z">Z. Filipovic</name>
</author>
<author>
<name sortKey="Kong, N" uniqKey="Kong N">N. Kong</name>
</author>
<author>
<name sortKey="Kammlott, U" uniqKey="Kammlott U">U. Kammlott</name>
</author>
<author>
<name sortKey="Lukacs, C" uniqKey="Lukacs C">C. Lukacs</name>
</author>
<author>
<name sortKey="Klein, C" uniqKey="Klein C">C. Klein</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cunningham, D" uniqKey="Cunningham D">D. Cunningham</name>
</author>
<author>
<name sortKey="Atkin, W" uniqKey="Atkin W">W. Atkin</name>
</author>
<author>
<name sortKey="Lenz, H J" uniqKey="Lenz H">H.-J. Lenz</name>
</author>
<author>
<name sortKey="Lynch, H T" uniqKey="Lynch H">H.T. Lynch</name>
</author>
<author>
<name sortKey="Minsky, B" uniqKey="Minsky B">B. Minsky</name>
</author>
<author>
<name sortKey="Nordlinger, B" uniqKey="Nordlinger B">B. Nordlinger</name>
</author>
<author>
<name sortKey="Starling, N" uniqKey="Starling N">N. Starling</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ju, J" uniqKey="Ju J">J. Ju</name>
</author>
<author>
<name sortKey="Schmitz, J C" uniqKey="Schmitz J">J.C. Schmitz</name>
</author>
<author>
<name sortKey="Song, B" uniqKey="Song B">B. Song</name>
</author>
<author>
<name sortKey="Kudo, K" uniqKey="Kudo K">K. Kudo</name>
</author>
<author>
<name sortKey="Chu, E" uniqKey="Chu E">E. Chu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rodrigues, N R" uniqKey="Rodrigues N">N.R. Rodrigues</name>
</author>
<author>
<name sortKey="Rowan, A" uniqKey="Rowan A">A. Rowan</name>
</author>
<author>
<name sortKey="Smith, M E" uniqKey="Smith M">M.E. Smith</name>
</author>
<author>
<name sortKey="Kerr, I B" uniqKey="Kerr I">I.B. Kerr</name>
</author>
<author>
<name sortKey="Bodmer, W F" uniqKey="Bodmer W">W.F. Bodmer</name>
</author>
<author>
<name sortKey="Gannon, J V" uniqKey="Gannon J">J.V. Gannon</name>
</author>
<author>
<name sortKey="Lane, D P" uniqKey="Lane D">D.P. Lane</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rivlin, N" uniqKey="Rivlin N">N. Rivlin</name>
</author>
<author>
<name sortKey="Brosh, R" uniqKey="Brosh R">R. Brosh</name>
</author>
<author>
<name sortKey="Oren, M" uniqKey="Oren M">M. Oren</name>
</author>
<author>
<name sortKey="Rotter, V" uniqKey="Rotter V">V. Rotter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kalo, E" uniqKey="Kalo E">E. Kalo</name>
</author>
<author>
<name sortKey="Kogan Sakin, I" uniqKey="Kogan Sakin I">I. Kogan-Sakin</name>
</author>
<author>
<name sortKey="Solomon, H" uniqKey="Solomon H">H. Solomon</name>
</author>
<author>
<name sortKey="Bar Nathan, E" uniqKey="Bar Nathan E">E. Bar-Nathan</name>
</author>
<author>
<name sortKey="Shay, M" uniqKey="Shay M">M. Shay</name>
</author>
<author>
<name sortKey="Shetzer, Y" uniqKey="Shetzer Y">Y. Shetzer</name>
</author>
<author>
<name sortKey="Dekel, E" uniqKey="Dekel E">E. Dekel</name>
</author>
<author>
<name sortKey="Goldfinger, N" uniqKey="Goldfinger N">N. Goldfinger</name>
</author>
<author>
<name sortKey="Buganim, Y" uniqKey="Buganim Y">Y. Buganim</name>
</author>
<author>
<name sortKey="Stambolsky, P" uniqKey="Stambolsky P">P. Stambolsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Muller, P A J" uniqKey="Muller P">P.A.J. Muller</name>
</author>
<author>
<name sortKey="Caswell, P T" uniqKey="Caswell P">P.T. Caswell</name>
</author>
<author>
<name sortKey="Doyle, B" uniqKey="Doyle B">B. Doyle</name>
</author>
<author>
<name sortKey="Iwanicki, M P" uniqKey="Iwanicki M">M.P. Iwanicki</name>
</author>
<author>
<name sortKey="Tan, E H" uniqKey="Tan E">E.H. Tan</name>
</author>
<author>
<name sortKey="Karim, S" uniqKey="Karim S">S. Karim</name>
</author>
<author>
<name sortKey="Lukashchuk, N" uniqKey="Lukashchuk N">N. Lukashchuk</name>
</author>
<author>
<name sortKey="Gillespie, D A" uniqKey="Gillespie D">D.A. Gillespie</name>
</author>
<author>
<name sortKey="Ludwig, R L" uniqKey="Ludwig R">R.L. Ludwig</name>
</author>
<author>
<name sortKey="Gosselin, P" uniqKey="Gosselin P">P. Gosselin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yeudall, W A" uniqKey="Yeudall W">W.A. Yeudall</name>
</author>
<author>
<name sortKey="Vaughan, C A" uniqKey="Vaughan C">C.A. Vaughan</name>
</author>
<author>
<name sortKey="Miyazaki, H" uniqKey="Miyazaki H">H. Miyazaki</name>
</author>
<author>
<name sortKey="Ramamoorthy, M" uniqKey="Ramamoorthy M">M. Ramamoorthy</name>
</author>
<author>
<name sortKey="Choi, M Y" uniqKey="Choi M">M.-Y. Choi</name>
</author>
<author>
<name sortKey="Chapman, C G" uniqKey="Chapman C">C.G. Chapman</name>
</author>
<author>
<name sortKey="Wang, H" uniqKey="Wang H">H. Wang</name>
</author>
<author>
<name sortKey="Black, E" uniqKey="Black E">E. Black</name>
</author>
<author>
<name sortKey="Bulysheva, A A" uniqKey="Bulysheva A">A.A. Bulysheva</name>
</author>
<author>
<name sortKey="Deb, S P" uniqKey="Deb S">S.P. Deb</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kruse, J P" uniqKey="Kruse J">J.-P. Kruse</name>
</author>
<author>
<name sortKey="Gu, W" uniqKey="Gu W">W. Gu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Watson, J L" uniqKey="Watson J">J.L. Watson</name>
</author>
<author>
<name sortKey="Hill, R" uniqKey="Hill R">R. Hill</name>
</author>
<author>
<name sortKey="Yaffe, P B" uniqKey="Yaffe P">P.B. Yaffe</name>
</author>
<author>
<name sortKey="Greenshields, A" uniqKey="Greenshields A">A. Greenshields</name>
</author>
<author>
<name sortKey="Walsh, M" uniqKey="Walsh M">M. Walsh</name>
</author>
<author>
<name sortKey="Lee, P W" uniqKey="Lee P">P.W. Lee</name>
</author>
<author>
<name sortKey="Giacomantonio, C A" uniqKey="Giacomantonio C">C.A. Giacomantonio</name>
</author>
<author>
<name sortKey="Hoskin, D W" uniqKey="Hoskin D">D.W. Hoskin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Danieli, A" uniqKey="Danieli A">A. Danieli</name>
</author>
<author>
<name sortKey="Martens, S" uniqKey="Martens S">S. Martens</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lamark, T" uniqKey="Lamark T">T. Lamark</name>
</author>
<author>
<name sortKey="Svenning, S" uniqKey="Svenning S">S. Svenning</name>
</author>
<author>
<name sortKey="Johansen, T" uniqKey="Johansen T">T. Johansen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jain, A" uniqKey="Jain A">A. Jain</name>
</author>
<author>
<name sortKey="Lamark, T" uniqKey="Lamark T">T. Lamark</name>
</author>
<author>
<name sortKey="Sj Ttem, E" uniqKey="Sj Ttem E">E. Sjøttem</name>
</author>
<author>
<name sortKey="Larsen, K B" uniqKey="Larsen K">K.B. Larsen</name>
</author>
<author>
<name sortKey="Awuh, J A" uniqKey="Awuh J">J.A. Awuh</name>
</author>
<author>
<name sortKey=" Vervatn, A" uniqKey=" Vervatn A">A. Øvervatn</name>
</author>
<author>
<name sortKey="Mcmahon, M" uniqKey="Mcmahon M">M. McMahon</name>
</author>
<author>
<name sortKey="Hayes, J D" uniqKey="Hayes J">J.D. Hayes</name>
</author>
<author>
<name sortKey="Johansen, T" uniqKey="Johansen T">T. Johansen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Komatsu, M" uniqKey="Komatsu M">M. Komatsu</name>
</author>
<author>
<name sortKey="Kurokawa, H" uniqKey="Kurokawa H">H. Kurokawa</name>
</author>
<author>
<name sortKey="Waguri, S" uniqKey="Waguri S">S. Waguri</name>
</author>
<author>
<name sortKey="Taguchi, K" uniqKey="Taguchi K">K. Taguchi</name>
</author>
<author>
<name sortKey="Kobayashi, A" uniqKey="Kobayashi A">A. Kobayashi</name>
</author>
<author>
<name sortKey="Ichimura, Y" uniqKey="Ichimura Y">Y. Ichimura</name>
</author>
<author>
<name sortKey="Sou, Y S" uniqKey="Sou Y">Y.-S. Sou</name>
</author>
<author>
<name sortKey="Ueno, I" uniqKey="Ueno I">I. Ueno</name>
</author>
<author>
<name sortKey="Sakamoto, A" uniqKey="Sakamoto A">A. Sakamoto</name>
</author>
<author>
<name sortKey="Tong, K I" uniqKey="Tong K">K.I. Tong</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shay, K P" uniqKey="Shay K">K.P. Shay</name>
</author>
<author>
<name sortKey="Michels, A J" uniqKey="Michels A">A.J. Michels</name>
</author>
<author>
<name sortKey="Li, W" uniqKey="Li W">W. Li</name>
</author>
<author>
<name sortKey="Kong, A N T" uniqKey="Kong A">A.-N.T. Kong</name>
</author>
<author>
<name sortKey="Hagen, T M" uniqKey="Hagen T">T.M. Hagen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lii, C K" uniqKey="Lii C">C.-K. Lii</name>
</author>
<author>
<name sortKey="Liu, K L" uniqKey="Liu K">K.-L. Liu</name>
</author>
<author>
<name sortKey="Cheng, Y P" uniqKey="Cheng Y">Y.-P. Cheng</name>
</author>
<author>
<name sortKey="Lin, A H" uniqKey="Lin A">A.-H. Lin</name>
</author>
<author>
<name sortKey="Chen, H W" uniqKey="Chen H">H.-W. Chen</name>
</author>
<author>
<name sortKey="Tsai, C W" uniqKey="Tsai C">C.-W. Tsai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pilar Valdecantos, M" uniqKey="Pilar Valdecantos M">M. Pilar Valdecantos</name>
</author>
<author>
<name sortKey="Prieto Hontoria, P L" uniqKey="Prieto Hontoria P">P.L. Prieto-Hontoria</name>
</author>
<author>
<name sortKey="Pardo, V" uniqKey="Pardo V">V. Pardo</name>
</author>
<author>
<name sortKey="M Dol, T" uniqKey="M Dol T">T. Módol</name>
</author>
<author>
<name sortKey="Santamaria, B" uniqKey="Santamaria B">B. Santamaría</name>
</author>
<author>
<name sortKey="Weber, M" uniqKey="Weber M">M. Weber</name>
</author>
<author>
<name sortKey="Herrero, L" uniqKey="Herrero L">L. Herrero</name>
</author>
<author>
<name sortKey="Serra, D" uniqKey="Serra D">D. Serra</name>
</author>
<author>
<name sortKey="Muntane, J" uniqKey="Muntane J">J. Muntané</name>
</author>
<author>
<name sortKey="Cuadrado, A" uniqKey="Cuadrado A">A. Cuadrado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pickering, A M" uniqKey="Pickering A">A.M. Pickering</name>
</author>
<author>
<name sortKey="Linder, R A" uniqKey="Linder R">R.A. Linder</name>
</author>
<author>
<name sortKey="Zhang, H" uniqKey="Zhang H">H. Zhang</name>
</author>
<author>
<name sortKey="Forman, H J" uniqKey="Forman H">H.J. Forman</name>
</author>
<author>
<name sortKey="Davies, K J A" uniqKey="Davies K">K.J.A. Davies</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ma, J" uniqKey="Ma J">J. Ma</name>
</author>
<author>
<name sortKey="Martin, J D" uniqKey="Martin J">J.D. Martin</name>
</author>
<author>
<name sortKey="Zhang, H" uniqKey="Zhang H">H. Zhang</name>
</author>
<author>
<name sortKey="Auger, K R" uniqKey="Auger K">K.R. Auger</name>
</author>
<author>
<name sortKey="Ho, T F" uniqKey="Ho T">T.F. Ho</name>
</author>
<author>
<name sortKey="Kirkpatrick, R B" uniqKey="Kirkpatrick R">R.B. Kirkpatrick</name>
</author>
<author>
<name sortKey="Grooms, M H" uniqKey="Grooms M">M.H. Grooms</name>
</author>
<author>
<name sortKey="Johanson, K O" uniqKey="Johanson K">K.O. Johanson</name>
</author>
<author>
<name sortKey="Tummino, P J" uniqKey="Tummino P">P.J. Tummino</name>
</author>
<author>
<name sortKey="Copeland, R A" uniqKey="Copeland R">R.A. Copeland</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chao, C C K" uniqKey="Chao C">C.C.-K. Chao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Scotcher, J" uniqKey="Scotcher J">J. Scotcher</name>
</author>
<author>
<name sortKey="Clarke, D J" uniqKey="Clarke D">D.J. Clarke</name>
</author>
<author>
<name sortKey="Mackay, C L" uniqKey="Mackay C">C.L. Mackay</name>
</author>
<author>
<name sortKey="Hupp, T" uniqKey="Hupp T">T. Hupp</name>
</author>
<author>
<name sortKey="Sadler, P J" uniqKey="Sadler P">P.J. Sadler</name>
</author>
<author>
<name sortKey="Langridge Smith, P R R" uniqKey="Langridge Smith P">P.R.R. Langridge-Smith</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hainaut, P" uniqKey="Hainaut P">P. Hainaut</name>
</author>
<author>
<name sortKey="Milner, J" uniqKey="Milner J">J. Milner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nomura, T" uniqKey="Nomura T">T. Nomura</name>
</author>
<author>
<name sortKey="Kamada, R" uniqKey="Kamada R">R. Kamada</name>
</author>
<author>
<name sortKey="Ito, I" uniqKey="Ito I">I. Ito</name>
</author>
<author>
<name sortKey="Sakamoto, K" uniqKey="Sakamoto K">K. Sakamoto</name>
</author>
<author>
<name sortKey="Chuman, Y" uniqKey="Chuman Y">Y. Chuman</name>
</author>
<author>
<name sortKey="Ishimori, K" uniqKey="Ishimori K">K. Ishimori</name>
</author>
<author>
<name sortKey="Shimohigashi, Y" uniqKey="Shimohigashi Y">Y. Shimohigashi</name>
</author>
<author>
<name sortKey="Sakaguchi, K" uniqKey="Sakaguchi K">K. Sakaguchi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Scotcher, J" uniqKey="Scotcher J">J. Scotcher</name>
</author>
<author>
<name sortKey="Clarke, D J" uniqKey="Clarke D">D.J. Clarke</name>
</author>
<author>
<name sortKey="Weidt, S K" uniqKey="Weidt S">S.K. Weidt</name>
</author>
<author>
<name sortKey="Mackay, C L" uniqKey="Mackay C">C.L. Mackay</name>
</author>
<author>
<name sortKey="Hupp, T R" uniqKey="Hupp T">T.R. Hupp</name>
</author>
<author>
<name sortKey="Sadler, P J" uniqKey="Sadler P">P.J. Sadler</name>
</author>
<author>
<name sortKey="Langridge Smith, P R R" uniqKey="Langridge Smith P">P.R.R. Langridge-Smith</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Velu, C S" uniqKey="Velu C">C.S. Velu</name>
</author>
<author>
<name sortKey="Niture, S K" uniqKey="Niture S">S.K. Niture</name>
</author>
<author>
<name sortKey="Doneanu, C E" uniqKey="Doneanu C">C.E. Doneanu</name>
</author>
<author>
<name sortKey="Pattabiraman, N" uniqKey="Pattabiraman N">N. Pattabiraman</name>
</author>
<author>
<name sortKey="Srivenugopal, K S" uniqKey="Srivenugopal K">K.S. Srivenugopal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Paranjpe, A" uniqKey="Paranjpe A">A. Paranjpe</name>
</author>
<author>
<name sortKey="Srivenugopal, K S" uniqKey="Srivenugopal K">K.S. Srivenugopal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Puchsaka, P" uniqKey="Puchsaka P">P. Puchsaka</name>
</author>
<author>
<name sortKey="Chaotham, C" uniqKey="Chaotham C">C. Chaotham</name>
</author>
<author>
<name sortKey="Chanvorachote, P" uniqKey="Chanvorachote P">P. Chanvorachote</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Cells</journal-id>
<journal-id journal-id-type="iso-abbrev">Cells</journal-id>
<journal-id journal-id-type="publisher-id">cells</journal-id>
<journal-title-group>
<journal-title>Cells</journal-title>
</journal-title-group>
<issn pub-type="epub">2073-4409</issn>
<publisher>
<publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">31366086</article-id>
<article-id pub-id-type="pmc">6721634</article-id>
<article-id pub-id-type="doi">10.3390/cells8080794</article-id>
<article-id pub-id-type="publisher-id">cells-08-00794</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Lipoic Acid Synergizes with Antineoplastic Drugs in Colorectal Cancer by Targeting p53 for Proteasomal Degradation</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Neitzel</surname>
<given-names>Carina</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
<xref ref-type="aff" rid="af2-cells-08-00794">2</xref>
<xref ref-type="aff" rid="af3-cells-08-00794">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Seiwert</surname>
<given-names>Nina</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
<xref ref-type="aff" rid="af2-cells-08-00794">2</xref>
<xref ref-type="aff" rid="af3-cells-08-00794">3</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0001-9743-1656</contrib-id>
<name>
<surname>Göder</surname>
<given-names>Anja</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Diehl</surname>
<given-names>Erika</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Weber</surname>
<given-names>Carina</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Nagel</surname>
<given-names>Georg</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Stroh</surname>
<given-names>Svenja</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Rasenberger</surname>
<given-names>Birgit</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Christmann</surname>
<given-names>Markus</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Fahrer</surname>
<given-names>Jörg</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-08-00794">1</xref>
<xref ref-type="aff" rid="af2-cells-08-00794">2</xref>
<xref ref-type="aff" rid="af3-cells-08-00794">3</xref>
<xref rid="c1-cells-08-00794" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<aff id="af1-cells-08-00794">
<label>1</label>
Institute of Toxicology, University Medical Center Mainz, 55131 Mainz, Germany</aff>
<aff id="af2-cells-08-00794">
<label>2</label>
Rudolf Buchheim Institute of Pharmacology, Justus Liebig University Giessen, 35392 Giessen, Germany</aff>
<aff id="af3-cells-08-00794">
<label>3</label>
Division of Food Chemistry and Toxicology, Department of Chemistry, Technical University of Kaiserslautern, 67663 Kaiserslautern, Germany</aff>
<author-notes>
<corresp id="c1-cells-08-00794">
<label>*</label>
Correspondence:
<email>fahrer@chemie.uni-kl.de</email>
; Tel.: +49-(0)631-2052974</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>30</day>
<month>7</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="collection">
<month>8</month>
<year>2019</year>
</pub-date>
<volume>8</volume>
<issue>8</issue>
<elocation-id>794</elocation-id>
<history>
<date date-type="received">
<day>30</day>
<month>6</month>
<year>2019</year>
</date>
<date date-type="accepted">
<day>20</day>
<month>7</month>
<year>2019</year>
</date>
</history>
<permissions>
<copyright-statement>© 2019 by the authors.</copyright-statement>
<copyright-year>2019</copyright-year>
<license license-type="open-access">
<license-p>Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<p>Lipoic acid (LA) is a redox-active disulphide compound, which functions as a pivotal co-factor for mitochondrial oxidative decarboxylation. LA and chemical derivatives were shown to target mitochondria in cancer cells with altered energy metabolism, thereby inducing cell death. In this study, the impact of LA on the tumor suppressor protein p53 was analyzed in various colorectal cancer (CRC) cell lines, with a focus on the mechanisms driving p53 degradation. First, LA was demonstrated to trigger the depletion of both wildtype and mutant p53 protein in all CRC cells tested without influencing its gene expression and preceded LA-triggered cytotoxicity. Depletion of p53 coincided with a moderate, LA-dependent ROS production, but was not rescued by antioxidant treatment. LA induced the autophagy receptor p62 and differentially modulated autophagosome formation in CRC cells. However, p53 degradation was not mediated via autophagy as shown by chemical inhibition and genetic abrogation of autophagy. LA treatment also stabilized and activated the transcription factor Nrf2 in CRC cells, which was however dispensable for p53 degradation. Mechanistically, p53 was found to be readily ubiquitinylated and degraded by the proteasomal machinery following LA treatment, which did not involve the E3 ubiquitin ligase MDM2. Intriguingly, the combination of LA and anticancer drugs (doxorubicin, 5-fluorouracil) attenuated p53-mediated stabilization of p21 and resulted in synergistic killing in CRC cells in a p53-dependant manner.</p>
</abstract>
<kwd-group>
<kwd>lipoic acid</kwd>
<kwd>p53</kwd>
<kwd>ubiquitin</kwd>
<kwd>proteasome</kwd>
<kwd>mitochondria</kwd>
<kwd>anticancer drugs</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="cells-08-00794-f001" orientation="portrait" position="float">
<label>Figure 1</label>
<caption>
<p>LA triggers depletion of p53 in CRC cells. (
<bold>A</bold>
) A panel of p53-wild type cells including HCT116, RKO, SW48, and LS174T were treated with increasing doses of LA for 48 h as indicated. EtOH was included as solvent control (0 µM). Depletion of p53 was monitored using western blot analysis. Hsp90 was visualized as loading control. (
<bold>B</bold>
) The p53-mutated cell line HT29 was exposed to LA and p53 protein expression was analyzed as described in A. (
<bold>C</bold>
) HCT116 cells treated with increasing doses of LA were collected after 48 h and subjected to cell fractionation. Cytoplasmic and nuclear fractions were separated by SDS-PAGE followed by immunoblot analysis for p53 levels. Hsp90 served as loading control for the cytoplasm, while PARP1 was used as loading control for the nucleus. (
<bold>D</bold>
) Confocal microscopy of p53 was performed in HCT116 cells upon 48 h of incubation with 0 mM LA (EtOH as solvent control) or 1 mM LA. Fixed cells were stained with a p53-antibody followed by an Alexa488-coupled secondary antibody (displayed in green) and nuclei were counterstained using TO-PRO3 (blue). Representative images are shown. (
<bold>E</bold>
) Quantification of nuclear p53 intensity as assessed in D. Data is expressed as mean + SEM (
<italic>n</italic>
= 3, at least 6 sections per group). ***
<italic>p</italic>
< 0.001. (
<bold>F</bold>
,
<bold>G</bold>
) Gene expression of
<italic>p53</italic>
in LA-treated HCT116 cells using qPCR after 24 h incubation. EtOH was included as solvent control (0 mM).
<italic>p53</italic>
expression levels are normalized to
<italic>ACTB</italic>
and
<italic>GAPDH</italic>
. Data is presented as mean + SEM (
<italic>n</italic>
= 3). Ns, not significant.</p>
</caption>
<graphic xlink:href="cells-08-00794-g001"></graphic>
</fig>
<fig id="cells-08-00794-f002" orientation="portrait" position="float">
<label>Figure 2</label>
<caption>
<p>Early p53 depletion in CRC cells and impact on p53-dependent gene expression. (
<bold>A</bold>
) CRC cells with wildtype p53 (HCT116 and RKO) and mutant p53 (HT29) were treated with increasing doses of LA for 24 h as indicated. EtOH was included as solvent control (0 µM). Depletion of p53 was monitored using western blot analysis. Hsp90 was visualized as loading control. (
<bold>B</bold>
) Densitometric analysis of data presented in A. p53 levels were normalized to Hsp90. Data is presented as mean + SEM (
<italic>n</italic>
= 3). *
<italic>p</italic>
< 0.05; **
<italic>p</italic>
< 0.01. (
<bold>C</bold>
) Gene expression of p53 targets genes (
<italic>MDM2</italic>
,
<italic>GADD45a</italic>
,
<italic>p21</italic>
,
<italic>FASR</italic>
,
<italic>NOXA</italic>
, and
<italic>PUMA</italic>
) in HCT116 cells treated with LA for 24 h determined by qPCR analysis. EtOH served as solvent control (0 µM LA), while 5-FU was used as positive control. Gene expression levels are normalized to
<italic>ACTB</italic>
and
<italic>GAPDH</italic>
. Data is presented as mean + SEM (
<italic>n</italic>
= 3), except for
<italic>FASR</italic>
analysis (
<italic>n</italic>
= 2).</p>
</caption>
<graphic xlink:href="cells-08-00794-g002"></graphic>
</fig>
<fig id="cells-08-00794-f003" orientation="portrait" position="float">
<label>Figure 3</label>
<caption>
<p>Induction of ROS upon LA treatment and impact of antioxidants on p53 depletion. (
<bold>A</bold>
) Flow cytometric determination of reactive oxygen species (ROS) in HCT116 and RKO cells upon LA treatment for 24 h using the CM-H
<sub>2</sub>
DCFDA dye. EtOH was used as solvent control (0 µM LA). H
<sub>2</sub>
O
<sub>2</sub>
(400 µM, 20 min) served as positive control. Data is presented as mean + SEM (
<italic>n</italic>
= 5). Ns:
<italic>p</italic>
> 0.05; *
<italic>p</italic>
< 0.05; **
<italic>p</italic>
< 0.01; ****
<italic>p</italic>
< 0.0001. (
<bold>B</bold>
) Representative histograms of A. (
<bold>C</bold>
) HCT116 cells were treated with 1 mM LA for 24 h either with or without co-incubation with the antioxidant NAC (5 mM). Cells were lyzed and subjected to SDS-PAGE, followed by western blot analysis of p53. Hsp90 was visualized as loading control. (
<bold>D</bold>
) Densitometric analysis of p53 signals obtained in C following normalization to Hsp90. Data are presented as mean + SEM (
<italic>n</italic>
= 3). Ns:
<italic>p</italic>
> 0.05. (
<bold>E</bold>
) HCT116 cells were treated with increasing doses of curcumin (1–10 µM) for 48 h and p53 levels were analyzed using western blot analysis. Hsp90 served as loading control. (
<bold>F</bold>
) Densitometric analysis of data presented in E. p53 signals were normalized to Hsp90. Data are presented as mean + SEM (
<italic>n</italic>
= 3).</p>
</caption>
<graphic xlink:href="cells-08-00794-g003"></graphic>
</fig>
<fig id="cells-08-00794-f004" orientation="portrait" position="float">
<label>Figure 4</label>
<caption>
<p>Autophagosome formation and p62 accumulation by LA in CRC cells and contribution of autophagy to p53 depletion. (
<bold>A</bold>
) Relative autophagosome levels in HCT116, RKO, LS174T, and SW48 cells after 48 h of LA treatment determined by the CytoID® Autophagy Detection Kit and flow cytometry. EtOH was used as solvent control (0 µM LA). Cytolethal distending toxin (CDT) served as positive control. Data are shown as mean + SEM (
<italic>n</italic>
= 4). ns
<italic>p</italic>
> 0.05; *
<italic>p</italic>
< 0.05; **
<italic>p</italic>
< 0.01; ***
<italic>p</italic>
< 0.001; ****
<italic>p</italic>
< 0.0001. (
<bold>B</bold>
) The autophagy marker LC3B and accumulation of the autophagy receptor p62 were visualized by western blot analysis of LS174T and SW48 cells treated with increasing doses of LA for 48 h. Hsp90 served as loading control. (
<bold>C</bold>
) Pharmacological inhibition of autophagy and impact of LA on p53 status. HCT116 cells were incubated with LA for 48 h as indicated. CQ was added 16 h prior to harvesting of the cells. Whole-cell extracts were separated by SDS-PAGE followed by western blot analysis of p53 and p62. Hsp90 served as loading control. (
<bold>D</bold>
) Genetic abrogation of autophagy and p53 depletion by LA. HCT116 cells were transiently transfected with ATG5 siRNA or scrambled (scr) siRNA. Cells were then incubated with 1 mM LA or the solvent control EtOH (0 mM LA). Samples were subjected to SDS-PAGE and western blot analysis of p53. Successful knockdown was confirmed by immunoblot detection of ATG5, while Hsp90 was used as loading control.</p>
</caption>
<graphic xlink:href="cells-08-00794-g004"></graphic>
</fig>
<fig id="cells-08-00794-f005" orientation="portrait" position="float">
<label>Figure 5</label>
<caption>
<p>LA induces Nrf2, which is likely dispensable for p53 degradation. (
<bold>A</bold>
) HCT116 cells were incubated with increasing doses of LA (125–1000 µM) for 48 h. Cells were thereafter subjected to SDS-PAGE and western blot analysis of p53, Nrf2 and its downstream target HO-1. EtOH (0 µM) served as solvent control. Hsp90 was visualized as loading control. (
<bold>B</bold>
) HCT116 cells were incubated for 48 h with LA in the presence or the absence of ML385, a pharmacological Nrf2 inhibitor. Hemin (200 µM, 24 h) was included as positive control for HO-1 induction. EtOH (0 µM) served as vehicle control. Cells were then lyzed and underwent western blot analysis of Nrf2, p53, HO-1, as well as p62. Hsp90 was used as loading control. (
<bold>C</bold>
<bold>F</bold>
) Densitometric quantification of NRF2 (C), p53 (D), HO-1 (E) and p62 (F) obtained from three independent experiments as described and shown in B. Data are given as mean + SEM (
<italic>n</italic>
= 3). ns
<italic>p</italic>
> 0.05; *
<italic>p</italic>
< 0.05; **
<italic>p</italic>
< 0.01; ***
<italic>p</italic>
< 0.001.</p>
</caption>
<graphic xlink:href="cells-08-00794-g005"></graphic>
</fig>
<fig id="cells-08-00794-f006" orientation="portrait" position="float">
<label>Figure 6</label>
<caption>
<p>LA causes enhanced ubiquitination of p53. (
<bold>A</bold>
) Enhanced ubiquitination as shown in HCT116 cells over a time period of 16 to 40 h using co-treatment with the proteasome inhibitor MG132 (10 µM), which was supplemented 16 h after treatment with 1 mM of LA. Cells were harvested at indicated time points and underwent western blot analysis. (
<bold>B</bold>
) Higher levels of p53 ubiquitination in HCT116 cells upon co-treatment of LA with MG132 after 24, 28, and 40 h with the corresponding MG132-control. Experiment was conducted as described in A. Samples were analyzed on the same blot membrane and cut for better visualization (dashed line). (
<bold>C</bold>
,
<bold>D</bold>
) Co-immunoprecipitation of p53 in HCT116 after 48 h of LA-treatment. EtOH served as solvent control (0 mM LA). The left panel describes input for co-immunoprecipitation with rabbit polyclonal p53-antibody. The right panel represents output for mouse monoclonal p53-antibody and mouse monoclonal ubiquitin-antibody.</p>
</caption>
<graphic xlink:href="cells-08-00794-g006"></graphic>
</fig>
<fig id="cells-08-00794-f007" orientation="portrait" position="float">
<label>Figure 7</label>
<caption>
<p>Role of MDM2 in LA-triggered p53-depletion in HCT116 cells. (
<bold>A</bold>
) Time course of
<italic>MDM2</italic>
gene expression. Cells were exposed to LA as indicated. EtOH was used as solvent control (0 µM LA), while 5-FU was used as positive control. (
<bold>B</bold>
,
<bold>C</bold>
) HCT116 were treated with increasing doses of LA for 24 h (B) or 48 h (C) either with or without the MDM2 inhibitor Nutlin-3a. In addition, 5-FU (5 µM) was used as positive control for p53 and p53-dependent MDM2 and p21 induction. Cells were analyzed by SDS-PAGE followed by western blot detection of MDM2, p53 and p21. Either Hsp90 or β-Actin served as loading control. (
<bold>D</bold>
<bold>F</bold>
) Densitometric quantification of MDM2 (D), p53 (E), and p21 (F) normalized to the respective loading controls obtained from three independent experiments as described and shown in (B). Data are displayed as mean + SEM of three independent experiments.</p>
</caption>
<graphic xlink:href="cells-08-00794-g007"></graphic>
</fig>
<fig id="cells-08-00794-f008" orientation="portrait" position="float">
<label>Figure 8</label>
<caption>
<p>LA attenuates p53 stabilization upon genotoxic stress and synergizes with Doxo and 5-FU. (
<bold>A</bold>
,
<bold>B</bold>
) Combination of LA with Doxo or 5-FU, respectively, in HCT116 cells and effects on p53 and its downstream target p21. Cells were treated as indicated in A and harvested after 48 h. Samples were then analyzed with respect to p53 and p21 by SDS-PAGE and western blot. Hsp90 served as loading control. (
<bold>C</bold>
) Treatment scheme of ATP assays in HCT116, HCT116-p53
<sup>−/−</sup>
, and RKO cells to determine the combination index. Cells were pre-treated with LA for 48 h and then supplemented with either Doxo or 5-FU. (
<bold>D</bold>
<bold>F</bold>
) Representative combination effects of LA and Doxo or 5-FU as measured using ATP assays according to the treatment scheme depicted in (
<bold>C</bold>
) in HCT116 ((
<bold>D</bold>
); 1 mM LA, 10 µM 5-FU, 2 µM Doxo), HCT116-p53
<sup>−/−</sup>
((
<bold>E</bold>
); 500 µM LA, 80 µM 5-FU; 62.5 nM Doxo), and RKO ((
<bold>F</bold>
); 400 µM LA, 5 µM 5-FU, 0.25 µM Doxo) cells.</p>
</caption>
<graphic xlink:href="cells-08-00794-g008"></graphic>
</fig>
<fig id="cells-08-00794-f009" orientation="portrait" position="float">
<label>Figure 9</label>
<caption>
<p>LA potentiates cell death induction in CRC upon treatment with the anticancer drugs Doxo and 5-FU. (
<bold>A</bold>
) Cells were pre-treated with LA for 48 h (250 µM for HCT116 and HCT116-p53
<sup>−/−</sup>
; 100 µM for RKO), then supplemented with either Doxo (1 µM for HCT116 and RKO; 5 µM for HCT116-p53
<sup>−/−</sup>
) or 5-FU (5 µM for HCT116; 20 µM for HCT116-p53
<sup>−/−</sup>
; 10 µM for RKO) and treated for another 72 h. After 120 h, cells were collected for cell death measurements and subjected to AnnexinV /PI staining followed by flow cytometry. Data is presented as mean + SEM (n≥3). Ns:
<italic>p</italic>
> 0.05; *
<italic>p</italic>
< 0.05; ***
<italic>p</italic>
< 0.001; ****
<italic>p</italic>
< 0.0001. (
<bold>B</bold>
) Representative dot plots for experiments shown in (A).</p>
</caption>
<graphic xlink:href="cells-08-00794-g009"></graphic>
</fig>
<table-wrap id="cells-08-00794-t001" orientation="portrait" position="float">
<object-id pub-id-type="pii">cells-08-00794-t001_Table 1</object-id>
<label>Table 1</label>
<caption>
<p>Primers used for qPCR</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">qPCR Primer</th>
<th align="left" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Sequence (5′–3′)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="bottom" rowspan="1" colspan="1">
<bold>
<italic>ACTB</italic>
</bold>
-real-up</td>
<td align="left" valign="middle" rowspan="1" colspan="1">TGGCATCCACGAAACTACC </td>
</tr>
<tr>
<td align="left" valign="bottom" rowspan="1" colspan="1">
<bold>
<italic>ACTB</italic>
</bold>
-real-low</td>
<td align="left" valign="middle" rowspan="1" colspan="1">GTGTTGGCGTACAGGTCTT</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>FASR</italic>
</bold>
-real-up</td>
<td align="left" valign="middle" rowspan="1" colspan="1">TTATCTGATGTTGACTTGAGTAA</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>FASR</italic>
</bold>
-real-low</td>
<td align="left" valign="middle" rowspan="1" colspan="1">GGCTTCATTGACACCATT</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>GADD45a</italic>
</bold>
-real-up</td>
<td align="left" valign="middle" rowspan="1" colspan="1">ATCTCCCTGAACGGTGAT</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>GADD45a</italic>
</bold>
-real-low</td>
<td align="left" valign="middle" rowspan="1" colspan="1">TGTAATCCTTGCATCAGTGT</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>GAPDH</italic>
</bold>
-real-up</td>
<td align="left" valign="middle" rowspan="1" colspan="1">CATGAGAAGTATGACAACAG</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>GAPDH</italic>
</bold>
-real-low </td>
<td align="left" valign="middle" rowspan="1" colspan="1">ATGAGTCCTTCCACGAT</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>MDM2</italic>
</bold>
-real-up</td>
<td align="left" valign="middle" rowspan="1" colspan="1">ATCTTGATGCTGGTGTAA</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>MDM2</italic>
</bold>
-real-low </td>
<td align="left" valign="middle" rowspan="1" colspan="1">AGGCTATAATCTTCTGAGTC</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>NOXA</italic>
</bold>
-real-up</td>
<td align="left" valign="middle" rowspan="1" colspan="1">TCTTCGGTCACTACACAAC</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>NOXA</italic>
</bold>
-real-low </td>
<td align="left" valign="middle" rowspan="1" colspan="1">CCAACAGGAACACATTGAAT</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>p21</italic>
</bold>
-real-up</td>
<td align="left" valign="middle" rowspan="1" colspan="1">ACCATGTCAGAACCGGCTGGG</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>p21</italic>
</bold>
-real-low</td>
<td align="left" valign="middle" rowspan="1" colspan="1">TGGGCGGATTAGGGCTTC</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>PUMA</italic>
</bold>
-real-up</td>
<td align="left" valign="middle" rowspan="1" colspan="1">TAAGGATGGAAAGTGTAG</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>PUMA</italic>
</bold>
-real-low </td>
<td align="left" valign="middle" rowspan="1" colspan="1">TTCAGTTTCTCATTGTTAC</td>
</tr>
<tr>
<td align="left" valign="middle" rowspan="1" colspan="1">
<bold>
<italic>p53</italic>
</bold>
-real-up</td>
<td align="left" valign="middle" rowspan="1" colspan="1">AGCACTAAGCGAGCACTG</td>
</tr>
<tr>
<td align="left" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<bold>
<italic>p53</italic>
</bold>
-real-low</td>
<td align="left" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">ACGGATCTGAAGGGTGAAA</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="cells-08-00794-t002" orientation="portrait" position="float">
<object-id pub-id-type="pii">cells-08-00794-t002_Table 2</object-id>
<label>Table 2</label>
<caption>
<p>Combination indexes (CI) determined by ATP assays and the Chou–Talalay-method</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Cell Line/CI</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">LA + 5-FU</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">LA + Doxo</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">HCT116</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.67</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.55</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">HCT116-p53
<sup>−/−</sup>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1.22</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1.29</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">RKO</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.84</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.59</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>Allemagne</li>
</country>
<region>
<li>Rhénanie-Palatinat</li>
</region>
<settlement>
<li>Kaiserslautern</li>
<li>Mayence</li>
</settlement>
<orgName>
<li>Université technique de Kaiserslautern</li>
</orgName>
</list>
<tree>
<country name="Allemagne">
<region name="Rhénanie-Palatinat">
<name sortKey="Neitzel, Carina" sort="Neitzel, Carina" uniqKey="Neitzel C" first="Carina" last="Neitzel">Carina Neitzel</name>
</region>
<name sortKey="Christmann, Markus" sort="Christmann, Markus" uniqKey="Christmann M" first="Markus" last="Christmann">Markus Christmann</name>
<name sortKey="Diehl, Erika" sort="Diehl, Erika" uniqKey="Diehl E" first="Erika" last="Diehl">Erika Diehl</name>
<name sortKey="Fahrer, Jorg" sort="Fahrer, Jorg" uniqKey="Fahrer J" first="Jörg" last="Fahrer">Jörg Fahrer</name>
<name sortKey="Fahrer, Jorg" sort="Fahrer, Jorg" uniqKey="Fahrer J" first="Jörg" last="Fahrer">Jörg Fahrer</name>
<name sortKey="Fahrer, Jorg" sort="Fahrer, Jorg" uniqKey="Fahrer J" first="Jörg" last="Fahrer">Jörg Fahrer</name>
<name sortKey="Goder, Anja" sort="Goder, Anja" uniqKey="Goder A" first="Anja" last="Göder">Anja Göder</name>
<name sortKey="Nagel, Georg" sort="Nagel, Georg" uniqKey="Nagel G" first="Georg" last="Nagel">Georg Nagel</name>
<name sortKey="Neitzel, Carina" sort="Neitzel, Carina" uniqKey="Neitzel C" first="Carina" last="Neitzel">Carina Neitzel</name>
<name sortKey="Neitzel, Carina" sort="Neitzel, Carina" uniqKey="Neitzel C" first="Carina" last="Neitzel">Carina Neitzel</name>
<name sortKey="Rasenberger, Birgit" sort="Rasenberger, Birgit" uniqKey="Rasenberger B" first="Birgit" last="Rasenberger">Birgit Rasenberger</name>
<name sortKey="Seiwert, Nina" sort="Seiwert, Nina" uniqKey="Seiwert N" first="Nina" last="Seiwert">Nina Seiwert</name>
<name sortKey="Seiwert, Nina" sort="Seiwert, Nina" uniqKey="Seiwert N" first="Nina" last="Seiwert">Nina Seiwert</name>
<name sortKey="Seiwert, Nina" sort="Seiwert, Nina" uniqKey="Seiwert N" first="Nina" last="Seiwert">Nina Seiwert</name>
<name sortKey="Stroh, Svenja" sort="Stroh, Svenja" uniqKey="Stroh S" first="Svenja" last="Stroh">Svenja Stroh</name>
<name sortKey="Weber, Carina" sort="Weber, Carina" uniqKey="Weber C" first="Carina" last="Weber">Carina Weber</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/ChloroquineV1/Data/Pmc/Checkpoint
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000635 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd -nk 000635 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    ChloroquineV1
   |flux=    Pmc
   |étape=   Checkpoint
   |type=    RBID
   |clé=     PMC:6721634
   |texte=   Lipoic Acid Synergizes with Antineoplastic Drugs in Colorectal Cancer by Targeting p53 for Proteasomal Degradation
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/RBID.i   -Sk "pubmed:31366086" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd   \
       | NlmPubMed2Wicri -a ChloroquineV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Wed Mar 25 22:43:59 2020. Site generation: Sun Jan 31 12:44:45 2021