Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Gelatinomyces siamensis gen. sp. nov. (Ascomycota, Leotiomycetes, incertae sedis) on bamboo in Thailand

Identifieur interne : 000F61 ( Pmc/Curation ); précédent : 000F60; suivant : 000F62

Gelatinomyces siamensis gen. sp. nov. (Ascomycota, Leotiomycetes, incertae sedis) on bamboo in Thailand

Auteurs : Niwat Sanoamuang [Thaïlande] ; Wuttiwat Jitjak [Thaïlande] ; Sureelak Rodtong [Thaïlande] ; Anthony J. S. Whalley [Thaïlande]

Source :

RBID : PMC:3719209

Abstract

Gelatinomyces siamensis gen. sp. nov., incertae sedis within Leotiomycetes, the Siamese jelly-ball, is described. The fungus was collected from bamboo culms and branches in Nam Nao National Park, Phetchabun, Thailand. It presents as a ping-pong ball-sized and golf ball-like gelatinous ascostroma. The asci have numerous ascospores, are thick-walled, and arise on discoid apothecia which are aggregated and clustered to form the spherical gelatinous structures. An hyphomycete asexual morph is morphologically somewhat phialophora-like, and produces red pigments. On the basis of phylogenetic analysis based on rRNA, SSU, and LSU gene sequences, the lineage is closest to Collophorarubra. However, ITS sequences place the fungus on a well-separated branch from that fungus, and the morphological and ecological differences exclude it from Collophora.


Url:
DOI: 10.5598/imafungus.2013.04.01.08
PubMed: 23898414
PubMed Central: 3719209

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:3719209

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">
<italic>Gelatinomyces siamensis</italic>
gen
<italic>.</italic>
sp. nov. (
<italic>Ascomycota</italic>
,
<italic>Leotiomycetes</italic>
,
<italic>incertae sedis</italic>
) on bamboo in Thailand</title>
<author>
<name sortKey="Sanoamuang, Niwat" sort="Sanoamuang, Niwat" uniqKey="Sanoamuang N" first="Niwat" last="Sanoamuang">Niwat Sanoamuang</name>
<affiliation wicri:level="1">
<nlm:aff id="A1">Applied Taxonomic Research Center, Khon Kaen University, Khon Kaen 40002, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>Applied Taxonomic Research Center, Khon Kaen University, Khon Kaen 40002</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="A2">Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Jitjak, Wuttiwat" sort="Jitjak, Wuttiwat" uniqKey="Jitjak W" first="Wuttiwat" last="Jitjak">Wuttiwat Jitjak</name>
<affiliation wicri:level="1">
<nlm:aff id="A2">Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Rodtong, Sureelak" sort="Rodtong, Sureelak" uniqKey="Rodtong S" first="Sureelak" last="Rodtong">Sureelak Rodtong</name>
<affiliation wicri:level="1">
<nlm:aff id="A3">School of Microbiology, Institute of Science, Suranaree University of Technology, Nakhon Ratchasima 30000, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>School of Microbiology, Institute of Science, Suranaree University of Technology, Nakhon Ratchasima 30000</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Whalley, Anthony J S" sort="Whalley, Anthony J S" uniqKey="Whalley A" first="Anthony J. S." last="Whalley">Anthony J. S. Whalley</name>
<affiliation wicri:level="1">
<nlm:aff id="A4">The Institute of Biotechnology and Genetic Engineering, Chulalongkorn University, Institute Bldg. 3, Phayathai Rd., Pathumwan, Bangkok 10330, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>The Institute of Biotechnology and Genetic Engineering, Chulalongkorn University, Institute Bldg. 3, Phayathai Rd., Pathumwan, Bangkok 10330</wicri:regionArea>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">23898414</idno>
<idno type="pmc">3719209</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3719209</idno>
<idno type="RBID">PMC:3719209</idno>
<idno type="doi">10.5598/imafungus.2013.04.01.08</idno>
<date when="2013">2013</date>
<idno type="wicri:Area/Pmc/Corpus">000F62</idno>
<idno type="wicri:Area/Pmc/Curation">000F61</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">
<italic>Gelatinomyces siamensis</italic>
gen
<italic>.</italic>
sp. nov. (
<italic>Ascomycota</italic>
,
<italic>Leotiomycetes</italic>
,
<italic>incertae sedis</italic>
) on bamboo in Thailand</title>
<author>
<name sortKey="Sanoamuang, Niwat" sort="Sanoamuang, Niwat" uniqKey="Sanoamuang N" first="Niwat" last="Sanoamuang">Niwat Sanoamuang</name>
<affiliation wicri:level="1">
<nlm:aff id="A1">Applied Taxonomic Research Center, Khon Kaen University, Khon Kaen 40002, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>Applied Taxonomic Research Center, Khon Kaen University, Khon Kaen 40002</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="A2">Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Jitjak, Wuttiwat" sort="Jitjak, Wuttiwat" uniqKey="Jitjak W" first="Wuttiwat" last="Jitjak">Wuttiwat Jitjak</name>
<affiliation wicri:level="1">
<nlm:aff id="A2">Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Rodtong, Sureelak" sort="Rodtong, Sureelak" uniqKey="Rodtong S" first="Sureelak" last="Rodtong">Sureelak Rodtong</name>
<affiliation wicri:level="1">
<nlm:aff id="A3">School of Microbiology, Institute of Science, Suranaree University of Technology, Nakhon Ratchasima 30000, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>School of Microbiology, Institute of Science, Suranaree University of Technology, Nakhon Ratchasima 30000</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Whalley, Anthony J S" sort="Whalley, Anthony J S" uniqKey="Whalley A" first="Anthony J. S." last="Whalley">Anthony J. S. Whalley</name>
<affiliation wicri:level="1">
<nlm:aff id="A4">The Institute of Biotechnology and Genetic Engineering, Chulalongkorn University, Institute Bldg. 3, Phayathai Rd., Pathumwan, Bangkok 10330, Thailand</nlm:aff>
<country xml:lang="fr">Thaïlande</country>
<wicri:regionArea>The Institute of Biotechnology and Genetic Engineering, Chulalongkorn University, Institute Bldg. 3, Phayathai Rd., Pathumwan, Bangkok 10330</wicri:regionArea>
</affiliation>
</author>
</analytic>
<series>
<title level="j">IMA Fungus</title>
<idno type="ISSN">2210-6340</idno>
<idno type="eISSN">2210-6359</idno>
<imprint>
<date when="2013">2013</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>
<italic>Gelatinomyces siamensis</italic>
gen. sp. nov.,
<italic>incertae sedis</italic>
within
<italic>Leotiomycetes</italic>
, the Siamese jelly-ball, is described. The fungus was collected from bamboo culms and branches in Nam Nao National Park, Phetchabun, Thailand. It presents as a ping-pong ball-sized and golf ball-like gelatinous ascostroma. The asci have numerous ascospores, are thick-walled, and arise on discoid apothecia which are aggregated and clustered to form the spherical gelatinous structures. An hyphomycete asexual morph is morphologically somewhat phialophora-like, and produces red pigments. On the basis of phylogenetic analysis based on rRNA, SSU, and LSU gene sequences, the lineage is closest to
<italic>Collophora</italic>
<italic>rubra</italic>
. However, ITS sequences place the fungus on a well-separated branch from that fungus, and the morphological and ecological differences exclude it from
<italic>Collophora</italic>
.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Bellemere, A" uniqKey="Bellemere A">A Bellemère</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Berbee, Ml" uniqKey="Berbee M">ML Berbee</name>
</author>
<author>
<name sortKey="Taylor, Jw" uniqKey="Taylor J">JW Taylor</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bischoff, Jf" uniqKey="Bischoff J">JF Bischoff</name>
</author>
<author>
<name sortKey="Chaverri, P" uniqKey="Chaverri P">P Chaverri</name>
</author>
<author>
<name sortKey="White, Jf" uniqKey="White J">JF White</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bischoff, Jfb" uniqKey="Bischoff J">JFB Bischoff</name>
</author>
<author>
<name sortKey="White, Jf" uniqKey="White J">JF White</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cai, L" uniqKey="Cai L">L Cai</name>
</author>
<author>
<name sortKey="Jeewon, R" uniqKey="Jeewon R">R Jeewon</name>
</author>
<author>
<name sortKey="Hyde, Kd" uniqKey="Hyde K">KD Hyde</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chaverri, P" uniqKey="Chaverri P">P Chaverri</name>
</author>
<author>
<name sortKey="Liu, M" uniqKey="Liu M">M Liu</name>
</author>
<author>
<name sortKey="Hodge, Kt" uniqKey="Hodge K">KT Hodge</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Damm, U" uniqKey="Damm U">U Damm</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Fourie, Ph" uniqKey="Fourie P">PH Fourie</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Damm, U" uniqKey="Damm U">U Damm</name>
</author>
<author>
<name sortKey="Fourie, Ph" uniqKey="Fourie P">PH Fourie</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="De Hoog, Gs" uniqKey="De Hoog G">GS de Hoog</name>
</author>
<author>
<name sortKey="Gottlich, E" uniqKey="Gottlich E">E Gottlich</name>
</author>
<author>
<name sortKey="Platas, G" uniqKey="Platas G">G Platas</name>
</author>
<author>
<name sortKey="Genilloud, O" uniqKey="Genilloud O">O Genilloud</name>
</author>
<author>
<name sortKey="Leotta, G" uniqKey="Leotta G">G Leotta</name>
</author>
<author>
<name sortKey="Van Brummelen, J" uniqKey="Van Brummelen J">J van Brummelen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eriksson, Oe" uniqKey="Eriksson O">OE Eriksson</name>
</author>
<author>
<name sortKey="Yue, J Z" uniqKey="Yue J">J-Z Yue</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Felsenstein, J" uniqKey="Felsenstein J">J Felsenstein</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fulton, Ce" uniqKey="Fulton C">CE Fulton</name>
</author>
<author>
<name sortKey="Brown, Ae" uniqKey="Brown A">AE Brown</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gramaje, D" uniqKey="Gramaje D">D Gramaje</name>
</author>
<author>
<name sortKey="Agusti Brisach, C" uniqKey="Agusti Brisach C">C Agusti-Brisach</name>
</author>
<author>
<name sortKey="Perez Sierra, A" uniqKey="Perez Sierra A">A Pérez-Sierra</name>
</author>
<author>
<name sortKey="Moralejo, E" uniqKey="Moralejo E">E Moralejo</name>
</author>
<author>
<name sortKey="Olmo, D" uniqKey="Olmo D">D Olmo</name>
</author>
<author>
<name sortKey="Mosrt, L" uniqKey="Mosrt L">L Mosrt</name>
</author>
<author>
<name sortKey="Damm, U" uniqKey="Damm U">U Damm</name>
</author>
<author>
<name sortKey="Armengol, J" uniqKey="Armengol J">J Armengol</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gramaje, D" uniqKey="Gramaje D">D Gramaje</name>
</author>
<author>
<name sortKey="Mostert, L" uniqKey="Mostert L">L Mostert</name>
</author>
<author>
<name sortKey="Armengol, J" uniqKey="Armengol J">J Armengol</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Greif, Md" uniqKey="Greif M">MD Greif</name>
</author>
<author>
<name sortKey="Gibas, Cfc" uniqKey="Gibas C">CFC Gibas</name>
</author>
<author>
<name sortKey="Tsuneda, A" uniqKey="Tsuneda A">A Tsuneda</name>
</author>
<author>
<name sortKey="Currah, Rs" uniqKey="Currah R">RS Currah</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hawksworth, Dl" uniqKey="Hawksworth D">DL Hawksworth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hirschhauser, S" uniqKey="Hirschhauser S">S Hirschhauser</name>
</author>
<author>
<name sortKey="Frohlich, J" uniqKey="Frohlich J">J Frohlich</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Huelsenbeck, Jp" uniqKey="Huelsenbeck J">JP Huelsenbeck</name>
</author>
<author>
<name sortKey="Ronquist, F" uniqKey="Ronquist F">F Ronquist</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Huelsenbeck, Jp" uniqKey="Huelsenbeck J">JP Huelsenbeck</name>
</author>
<author>
<name sortKey="Rannala, B" uniqKey="Rannala B">B Rannala</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hyde, Kd" uniqKey="Hyde K">KD Hyde</name>
</author>
<author>
<name sortKey="Zhou, D" uniqKey="Zhou D">D Zhou</name>
</author>
<author>
<name sortKey="Dalisay, T" uniqKey="Dalisay T">T Dalisay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="James, Ty" uniqKey="James T">TY James</name>
</author>
<author>
<name sortKey="Kauff, F" uniqKey="Kauff F">F Kauff</name>
</author>
<author>
<name sortKey="Schoch, Cl" uniqKey="Schoch C">CL Schoch</name>
</author>
<author>
<name sortKey="Matheny, Pb" uniqKey="Matheny P">PB Matheny</name>
</author>
<author>
<name sortKey="Hofstetter, V" uniqKey="Hofstetter V">V Hofstetter</name>
</author>
<author>
<name sortKey="Cox, Cj" uniqKey="Cox C">CJ Cox</name>
</author>
<author>
<name sortKey="Celio, G" uniqKey="Celio G">G Celio</name>
</author>
<author>
<name sortKey="Gueidan, C" uniqKey="Gueidan C">C Gueidan</name>
</author>
<author>
<name sortKey="Fraker, E" uniqKey="Fraker E">E Fraker</name>
</author>
<author>
<name sortKey="Miadlikowska, J" uniqKey="Miadlikowska J">J Miadlikowska</name>
</author>
<author>
<name sortKey="Lumbsch, Ht" uniqKey="Lumbsch H">HT Lumbsch</name>
</author>
<author>
<name sortKey="Rauhut, A" uniqKey="Rauhut A">A Rauhut</name>
</author>
<author>
<name sortKey="Reeb, V" uniqKey="Reeb V">V Reeb</name>
</author>
<author>
<name sortKey="Arnold, Ae" uniqKey="Arnold A">AE Arnold</name>
</author>
<author>
<name sortKey="Amtoft, A" uniqKey="Amtoft A">A Amtoft</name>
</author>
<author>
<name sortKey="Stajich, Je" uniqKey="Stajich J">JE Stajich</name>
</author>
<author>
<name sortKey="Hosaka, K" uniqKey="Hosaka K">K Hosaka</name>
</author>
<author>
<name sortKey="Sung, Gh" uniqKey="Sung G">GH Sung</name>
</author>
<author>
<name sortKey="Johnson, D" uniqKey="Johnson D">D Johnson</name>
</author>
<author>
<name sortKey="O Ourke, B" uniqKey="O Ourke B">B O’Rourke</name>
</author>
<author>
<name sortKey="Crockett, M" uniqKey="Crockett M">M Crockett</name>
</author>
<author>
<name sortKey="Binder, M" uniqKey="Binder M">M Binder</name>
</author>
<author>
<name sortKey="Curtis, Jm" uniqKey="Curtis J">JM Curtis</name>
</author>
<author>
<name sortKey="Slot, Jc" uniqKey="Slot J">JC Slot</name>
</author>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author>
<name sortKey="Wilson, Aw" uniqKey="Wilson A">AW Wilson</name>
</author>
<author>
<name sortKey="Schussler, A" uniqKey="Schussler A">A Schussler</name>
</author>
<author>
<name sortKey="Longcore, Je" uniqKey="Longcore J">JE Longcore</name>
</author>
<author>
<name sortKey="O Onnell, K" uniqKey="O Onnell K">K O’Donnell</name>
</author>
<author>
<name sortKey="Mozley Standridge, S" uniqKey="Mozley Standridge S">S Mozley-Standridge</name>
</author>
<author>
<name sortKey="Porter, D" uniqKey="Porter D">D Porter</name>
</author>
<author>
<name sortKey="Letcher, Pm" uniqKey="Letcher P">PM Letcher</name>
</author>
<author>
<name sortKey="Powell, Mj" uniqKey="Powell M">MJ Powell</name>
</author>
<author>
<name sortKey="Taylor, Jw" uniqKey="Taylor J">JW Taylor</name>
</author>
<author>
<name sortKey="White, Mm" uniqKey="White M">MM White</name>
</author>
<author>
<name sortKey="Griffith, Gw" uniqKey="Griffith G">GW Griffith</name>
</author>
<author>
<name sortKey="Davies, Dr" uniqKey="Davies D">DR Davies</name>
</author>
<author>
<name sortKey="Humber, Ra" uniqKey="Humber R">RA Humber</name>
</author>
<author>
<name sortKey="Morton, Jb" uniqKey="Morton J">JB Morton</name>
</author>
<author>
<name sortKey="Sugiyama, J" uniqKey="Sugiyama J">J Sugiyama</name>
</author>
<author>
<name sortKey="Rossman, Ay" uniqKey="Rossman A">AY Rossman</name>
</author>
<author>
<name sortKey="Rogers, Jd" uniqKey="Rogers J">JD Rogers</name>
</author>
<author>
<name sortKey="Pfister, Dh" uniqKey="Pfister D">DH Pfister</name>
</author>
<author>
<name sortKey="Hewitt, D" uniqKey="Hewitt D">D Hewitt</name>
</author>
<author>
<name sortKey="Hansen, K" uniqKey="Hansen K">K Hansen</name>
</author>
<author>
<name sortKey="Hambleton, S" uniqKey="Hambleton S">S Hambleton</name>
</author>
<author>
<name sortKey="Shoemaker, Ra" uniqKey="Shoemaker R">RA Shoemaker</name>
</author>
<author>
<name sortKey="Kohlmeyer, J" uniqKey="Kohlmeyer J">J Kohlmeyer</name>
</author>
<author>
<name sortKey="Volkmann Kohlmeyer, B" uniqKey="Volkmann Kohlmeyer B">B Volkmann-Kohlmeyer</name>
</author>
<author>
<name sortKey="Spotts, Ra" uniqKey="Spotts R">RA Spotts</name>
</author>
<author>
<name sortKey="Serdani, M" uniqKey="Serdani M">M Serdani</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Hughes, Kw" uniqKey="Hughes K">KW Hughes</name>
</author>
<author>
<name sortKey="Matsuura, K" uniqKey="Matsuura K">K Matsuura</name>
</author>
<author>
<name sortKey="Langer, E" uniqKey="Langer E">E Langer</name>
</author>
<author>
<name sortKey="Langer, G" uniqKey="Langer G">G Langer</name>
</author>
<author>
<name sortKey="Untereiner, Wa" uniqKey="Untereiner W">WA Untereiner</name>
</author>
<author>
<name sortKey="Lucking, R" uniqKey="Lucking R">R Lucking</name>
</author>
<author>
<name sortKey="Budel, B" uniqKey="Budel B">B Budel</name>
</author>
<author>
<name sortKey="Geiser, Dm" uniqKey="Geiser D">DM Geiser</name>
</author>
<author>
<name sortKey="Aptroot, A" uniqKey="Aptroot A">A Aptroot</name>
</author>
<author>
<name sortKey="Diederich, P" uniqKey="Diederich P">P Diederich</name>
</author>
<author>
<name sortKey="Schmitt, I" uniqKey="Schmitt I">I Schmitt</name>
</author>
<author>
<name sortKey="Schultz, M" uniqKey="Schultz M">M Schultz</name>
</author>
<author>
<name sortKey="Yahr, R" uniqKey="Yahr R">R Yahr</name>
</author>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett D">DS Hibbett</name>
</author>
<author>
<name sortKey="Lutzoni, F" uniqKey="Lutzoni F">F Lutzoni</name>
</author>
<author>
<name sortKey="Mclaughlin, Dj" uniqKey="Mclaughlin D">DJ McLaughlin</name>
</author>
<author>
<name sortKey="Spatafora, Jw" uniqKey="Spatafora J">JW Spatafora</name>
</author>
<author>
<name sortKey="Vilgalys, R" uniqKey="Vilgalys R">R Vilgalys</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jeewon, R" uniqKey="Jeewon R">R Jeewon</name>
</author>
<author>
<name sortKey="Liew, Ecy" uniqKey="Liew E">ECY Liew</name>
</author>
<author>
<name sortKey="Hyde, Kd" uniqKey="Hyde K">KD Hyde</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ju, Ym" uniqKey="Ju Y">YM Ju</name>
</author>
<author>
<name sortKey="Rogers, Jd" uniqKey="Rogers J">JD Rogers</name>
</author>
<author>
<name sortKey="San Martin, F" uniqKey="San Martin F">F San Martín</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kruys, A" uniqKey="Kruys A">A Kruys</name>
</author>
<author>
<name sortKey="Eriksson, Oe" uniqKey="Eriksson O">OE Eriksson</name>
</author>
<author>
<name sortKey="Wedin, M" uniqKey="Wedin M">M Wedin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lindemuth, R" uniqKey="Lindemuth R">R Lindemuth</name>
</author>
<author>
<name sortKey="Wirtz, N" uniqKey="Wirtz N">N Wirtz</name>
</author>
<author>
<name sortKey="Lumbsch, Ht" uniqKey="Lumbsch H">HT Lumbsch</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y Liu</name>
</author>
<author>
<name sortKey="Liu, Z" uniqKey="Liu Z">Z Liu</name>
</author>
<author>
<name sortKey="Wongkaew, S" uniqKey="Wongkaew S">S Wongkaew</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lumbsch, Ht" uniqKey="Lumbsch H">HT Lumbsch</name>
</author>
<author>
<name sortKey="Lindemuth, R" uniqKey="Lindemuth R">R Lindemuth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lumbsch, Ht" uniqKey="Lumbsch H">HT Lumbsch</name>
</author>
<author>
<name sortKey="Schmitt, I" uniqKey="Schmitt I">I Schmitt</name>
</author>
<author>
<name sortKey="Lindemuth, R" uniqKey="Lindemuth R">R Lindemuth</name>
</author>
<author>
<name sortKey="Miller, A" uniqKey="Miller A">A Miller</name>
</author>
<author>
<name sortKey="Mangold, A" uniqKey="Mangold A">A Mangold</name>
</author>
<author>
<name sortKey="Fernandez, F" uniqKey="Fernandez F">F Fernandez</name>
</author>
<author>
<name sortKey="Huhndorf, S" uniqKey="Huhndorf S">S Huhndorf</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lutzoni, F" uniqKey="Lutzoni F">F Lutzoni</name>
</author>
<author>
<name sortKey="Kauff, F" uniqKey="Kauff F">F Kauff</name>
</author>
<author>
<name sortKey="Cox, Cj" uniqKey="Cox C">CJ Cox</name>
</author>
<author>
<name sortKey="Mclaughlin, D" uniqKey="Mclaughlin D">D McLaughlin</name>
</author>
<author>
<name sortKey="Celio, G" uniqKey="Celio G">G Celio</name>
</author>
<author>
<name sortKey="Dentinger, B" uniqKey="Dentinger B">B Dentinger</name>
</author>
<author>
<name sortKey="Padamsee, M" uniqKey="Padamsee M">M Padamsee</name>
</author>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett D">DS Hibbett</name>
</author>
<author>
<name sortKey="James, Ty" uniqKey="James T">TY James</name>
</author>
<author>
<name sortKey="Baloch, E" uniqKey="Baloch E">E Baloch</name>
</author>
<author>
<name sortKey="Grube, M" uniqKey="Grube M">M Grube</name>
</author>
<author>
<name sortKey="Reeb, V" uniqKey="Reeb V">V Reeb</name>
</author>
<author>
<name sortKey="Hofstetter, V" uniqKey="Hofstetter V">V Hofstetter</name>
</author>
<author>
<name sortKey="Schoch, C" uniqKey="Schoch C">C Schoch</name>
</author>
<author>
<name sortKey="Arnold, Ae" uniqKey="Arnold A">AE Arnold</name>
</author>
<author>
<name sortKey="Miadlikowska, J" uniqKey="Miadlikowska J">J Miadlikowska</name>
</author>
<author>
<name sortKey="Spatafora, J" uniqKey="Spatafora J">J Spatafora</name>
</author>
<author>
<name sortKey="Johnson, D" uniqKey="Johnson D">D Johnson</name>
</author>
<author>
<name sortKey="Hambleton, S" uniqKey="Hambleton S">S Hambleton</name>
</author>
<author>
<name sortKey="Crockett, M" uniqKey="Crockett M">M Crockett</name>
</author>
<author>
<name sortKey="Shoemaker, R" uniqKey="Shoemaker R">R Shoemaker</name>
</author>
<author>
<name sortKey="Sung, Gh" uniqKey="Sung G">GH Sung</name>
</author>
<author>
<name sortKey="Lucking, R" uniqKey="Lucking R">R Lucking</name>
</author>
<author>
<name sortKey="Lumbsch, T" uniqKey="Lumbsch T">T Lumbsch</name>
</author>
<author>
<name sortKey="O Onnell, K" uniqKey="O Onnell K">K O’Donnell</name>
</author>
<author>
<name sortKey="Binder, M" uniqKey="Binder M">M Binder</name>
</author>
<author>
<name sortKey="Diederich, P" uniqKey="Diederich P">P Diederich</name>
</author>
<author>
<name sortKey="Ertz, D" uniqKey="Ertz D">D Ertz</name>
</author>
<author>
<name sortKey="Gueidan, C" uniqKey="Gueidan C">C Gueidan</name>
</author>
<author>
<name sortKey="Hansen, K" uniqKey="Hansen K">K Hansen</name>
</author>
<author>
<name sortKey="Harris, Rc" uniqKey="Harris R">RC Harris</name>
</author>
<author>
<name sortKey="Hosaka, K" uniqKey="Hosaka K">K Hosaka</name>
</author>
<author>
<name sortKey="Lim, Yw" uniqKey="Lim Y">YW Lim</name>
</author>
<author>
<name sortKey="Matheny, B" uniqKey="Matheny B">B Matheny</name>
</author>
<author>
<name sortKey="Nishida, H" uniqKey="Nishida H">H Nishida</name>
</author>
<author>
<name sortKey="Pfister, D" uniqKey="Pfister D">D Pfister</name>
</author>
<author>
<name sortKey="Rogers, J" uniqKey="Rogers J">J Rogers</name>
</author>
<author>
<name sortKey="Rossman, A" uniqKey="Rossman A">A Rossman</name>
</author>
<author>
<name sortKey="Schmitt, I" uniqKey="Schmitt I">I Schmitt</name>
</author>
<author>
<name sortKey="Sipman, H" uniqKey="Sipman H">H Sipman</name>
</author>
<author>
<name sortKey="Stone, J" uniqKey="Stone J">J Stone</name>
</author>
<author>
<name sortKey="Sugiyama, J" uniqKey="Sugiyama J">J Sugiyama</name>
</author>
<author>
<name sortKey="Yahr, R" uniqKey="Yahr R">R Yahr</name>
</author>
<author>
<name sortKey="Vilgalys, R" uniqKey="Vilgalys R">R Vilgalys</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Miadlikowska, J" uniqKey="Miadlikowska J">J Miadlikowska</name>
</author>
<author>
<name sortKey="Kauff, F" uniqKey="Kauff F">F Kauff</name>
</author>
<author>
<name sortKey="Hofstetter, V" uniqKey="Hofstetter V">V Hofstetter</name>
</author>
<author>
<name sortKey="Fraker, E" uniqKey="Fraker E">E Fraker</name>
</author>
<author>
<name sortKey="Grube, M" uniqKey="Grube M">M Grube</name>
</author>
<author>
<name sortKey="Hafellner, J" uniqKey="Hafellner J">J Hafellner</name>
</author>
<author>
<name sortKey="Reeb, V" uniqKey="Reeb V">V Reeb</name>
</author>
<author>
<name sortKey="Hodkinson, Bp" uniqKey="Hodkinson B">BP Hodkinson</name>
</author>
<author>
<name sortKey="Kukwa, M" uniqKey="Kukwa M">M Kukwa</name>
</author>
<author>
<name sortKey="Lucking, R" uniqKey="Lucking R">R Lucking</name>
</author>
<author>
<name sortKey="Hestmark, G" uniqKey="Hestmark G">G Hestmark</name>
</author>
<author>
<name sortKey="Otalora, Mg" uniqKey="Otalora M">MG Otalora</name>
</author>
<author>
<name sortKey="Rauhut, A" uniqKey="Rauhut A">A Rauhut</name>
</author>
<author>
<name sortKey="Budel, B" uniqKey="Budel B">B Budel</name>
</author>
<author>
<name sortKey="Scheidegger, C" uniqKey="Scheidegger C">C Scheidegger</name>
</author>
<author>
<name sortKey="Timdal, E" uniqKey="Timdal E">E Timdal</name>
</author>
<author>
<name sortKey="Stenroos, S" uniqKey="Stenroos S">S Stenroos</name>
</author>
<author>
<name sortKey="Brodo, I" uniqKey="Brodo I">I Brodo</name>
</author>
<author>
<name sortKey="Perlmutter, Gb" uniqKey="Perlmutter G">GB Perlmutter</name>
</author>
<author>
<name sortKey="Ertz, D" uniqKey="Ertz D">D Ertz</name>
</author>
<author>
<name sortKey="Diederich, P" uniqKey="Diederich P">P Diederich</name>
</author>
<author>
<name sortKey="Lendemer, Jc" uniqKey="Lendemer J">JC Lendemer</name>
</author>
<author>
<name sortKey="May, P" uniqKey="May P">P May</name>
</author>
<author>
<name sortKey="Schoch, Cl" uniqKey="Schoch C">CL Schoch</name>
</author>
<author>
<name sortKey="Arnold, Ae" uniqKey="Arnold A">AE Arnold</name>
</author>
<author>
<name sortKey="Gueidan, C" uniqKey="Gueidan C">C Gueidan</name>
</author>
<author>
<name sortKey="Tripp, E" uniqKey="Tripp E">E Tripp</name>
</author>
<author>
<name sortKey="Yahr, R" uniqKey="Yahr R">R Yahr</name>
</author>
<author>
<name sortKey="Robertson, C" uniqKey="Robertson C">C Robertson</name>
</author>
<author>
<name sortKey="Lutzoni, F" uniqKey="Lutzoni F">F Lutzoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Minter, Dw" uniqKey="Minter D">DW Minter</name>
</author>
<author>
<name sortKey="Peredo, Hl" uniqKey="Peredo H">HL Peredo</name>
</author>
<author>
<name sortKey="Watson, At" uniqKey="Watson A">AT Watson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="O Onnell, K" uniqKey="O Onnell K">K O’Donnell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Okane, I" uniqKey="Okane I">I Okane</name>
</author>
<author>
<name sortKey="Nakagiri, A" uniqKey="Nakagiri A">A Nakagiri</name>
</author>
<author>
<name sortKey="Ito, T" uniqKey="Ito T">T Ito</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Petersen, Jh" uniqKey="Petersen J">JH Petersen</name>
</author>
<author>
<name sortKey="L Ss E, T" uniqKey="L Ss E T">T Læssøe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Raju, Nb" uniqKey="Raju N">NB Raju</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rogers, Jd" uniqKey="Rogers J">JD Rogers</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schoch, Cl" uniqKey="Schoch C">CL Schoch</name>
</author>
<author>
<name sortKey="Shoemaker, Ra" uniqKey="Shoemaker R">RA Shoemaker</name>
</author>
<author>
<name sortKey="Seifert, Ka" uniqKey="Seifert K">KA Seifert</name>
</author>
<author>
<name sortKey="Hambleton, S" uniqKey="Hambleton S">S Hambleton</name>
</author>
<author>
<name sortKey="Spatafora, Jw" uniqKey="Spatafora J">JW Spatafora</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schoch, Cl" uniqKey="Schoch C">CL Schoch</name>
</author>
<author>
<name sortKey="Sung, Gh" uniqKey="Sung G">GH Sung</name>
</author>
<author>
<name sortKey="Giraldez, Fl" uniqKey="Giraldez F">FL Giráldez</name>
</author>
<author>
<name sortKey="Townsend, Jp" uniqKey="Townsend J">JP Townsend</name>
</author>
<author>
<name sortKey="Miadlikowska, J" uniqKey="Miadlikowska J">J Miadlikowska</name>
</author>
<author>
<name sortKey="Hofstetter, V" uniqKey="Hofstetter V">V Hofstetter</name>
</author>
<author>
<name sortKey="Robbertse, B" uniqKey="Robbertse B">B Robbertse</name>
</author>
<author>
<name sortKey="Matheny, Pb" uniqKey="Matheny P">PB Matheny</name>
</author>
<author>
<name sortKey="Kauff, F" uniqKey="Kauff F">F Kauff</name>
</author>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author>
<name sortKey="Gueidan, C" uniqKey="Gueidan C">C Gueidan</name>
</author>
<author>
<name sortKey="Andrie, Rm" uniqKey="Andrie R">RM Andrie</name>
</author>
<author>
<name sortKey="Trippe, K" uniqKey="Trippe K">K Trippe</name>
</author>
<author>
<name sortKey="Ciufetti, Lm" uniqKey="Ciufetti L">LM Ciufetti</name>
</author>
<author>
<name sortKey="Wynns, A" uniqKey="Wynns A">A Wynns</name>
</author>
<author>
<name sortKey="Fraker, E" uniqKey="Fraker E">E Fraker</name>
</author>
<author>
<name sortKey="Hodkinson, Bp" uniqKey="Hodkinson B">BP Hodkinson</name>
</author>
<author>
<name sortKey="Bonito, G" uniqKey="Bonito G">G Bonito</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Arzanlou, M" uniqKey="Arzanlou M">M Arzanlou</name>
</author>
<author>
<name sortKey="Sybren De Hoog, G" uniqKey="Sybren De Hoog G">G Sybren de Hoog</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Hewitt, D" uniqKey="Hewitt D">D Hewitt</name>
</author>
<author>
<name sortKey="Pfister, Dh" uniqKey="Pfister D">DH Pfister</name>
</author>
<author>
<name sortKey="Peterson, K" uniqKey="Peterson K">K Peterson</name>
</author>
<author>
<name sortKey="Gryzenhout, M" uniqKey="Gryzenhout M">M Gryzenhout</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
<author>
<name sortKey="Aptroot, A" uniqKey="Aptroot A">A Aptroot</name>
</author>
<author>
<name sortKey="Suh, So" uniqKey="Suh S">SO Suh</name>
</author>
<author>
<name sortKey="Blackwell, M" uniqKey="Blackwell M">M Blackwell</name>
</author>
<author>
<name sortKey="Hillis, Dm" uniqKey="Hillis D">DM Hillis</name>
</author>
<author>
<name sortKey="Griffith, Gw" uniqKey="Griffith G">GW Griffith</name>
</author>
<author>
<name sortKey="Castlebury, La" uniqKey="Castlebury L">LA Castlebury</name>
</author>
<author>
<name sortKey="Rossman, Ay" uniqKey="Rossman A">AY Rossman</name>
</author>
<author>
<name sortKey="Lumbsch, Ht" uniqKey="Lumbsch H">HT Lumbsch</name>
</author>
<author>
<name sortKey="Lucking, R" uniqKey="Lucking R">R Lücking</name>
</author>
<author>
<name sortKey="Budel, B" uniqKey="Budel B">B Büdel</name>
</author>
<author>
<name sortKey="Rauhut, A" uniqKey="Rauhut A">A Rauhut</name>
</author>
<author>
<name sortKey="Diederich, P" uniqKey="Diederich P">P Diederich</name>
</author>
<author>
<name sortKey="Ertz, D" uniqKey="Ertz D">D Ertz</name>
</author>
<author>
<name sortKey="Geiser, Dm" uniqKey="Geiser D">DM Geiser</name>
</author>
<author>
<name sortKey="Hosaka, K" uniqKey="Hosaka K">K Hosaka</name>
</author>
<author>
<name sortKey="Inderbitzin, P" uniqKey="Inderbitzin P">P Inderbitzin</name>
</author>
<author>
<name sortKey="Kohlmeyer, J" uniqKey="Kohlmeyer J">J Kohlmeyer</name>
</author>
<author>
<name sortKey="Volkmann Kohlmeyer, B" uniqKey="Volkmann Kohlmeyer B">B Volkmann-Kohlmeyer</name>
</author>
<author>
<name sortKey="Mostert, L" uniqKey="Mostert L">L Mostert</name>
</author>
<author>
<name sortKey=" Donnell, K" uniqKey=" Donnell K">K ÓDonnell</name>
</author>
<author>
<name sortKey="Sipman, H" uniqKey="Sipman H">H Sipman</name>
</author>
<author>
<name sortKey="Rogers, Jd" uniqKey="Rogers J">JD Rogers</name>
</author>
<author>
<name sortKey="Shoemaker, Ra" uniqKey="Shoemaker R">RA Shoemaker</name>
</author>
<author>
<name sortKey="Sugiyama, J" uniqKey="Sugiyama J">J Sugiyama</name>
</author>
<author>
<name sortKey="Summerbell, Rc" uniqKey="Summerbell R">RC Summerbell</name>
</author>
<author>
<name sortKey="Untereiner, W" uniqKey="Untereiner W">W Untereiner</name>
</author>
<author>
<name sortKey="Johnson, Pr" uniqKey="Johnson P">PR Johnson</name>
</author>
<author>
<name sortKey="Stenroos, S" uniqKey="Stenroos S">S Stenroos</name>
</author>
<author>
<name sortKey="Zuccaro, A" uniqKey="Zuccaro A">A Zuccaro</name>
</author>
<author>
<name sortKey="Dyer, Ps" uniqKey="Dyer P">PS Dyer</name>
</author>
<author>
<name sortKey="Crittenden, Pd" uniqKey="Crittenden P">PD Crittenden</name>
</author>
<author>
<name sortKey="Cole, Ms" uniqKey="Cole M">MS Cole</name>
</author>
<author>
<name sortKey="Hansen, K" uniqKey="Hansen K">K Hansen</name>
</author>
<author>
<name sortKey="Trappe, Jm" uniqKey="Trappe J">JM Trappe</name>
</author>
<author>
<name sortKey="Yahr, R" uniqKey="Yahr R">R Yahr</name>
</author>
<author>
<name sortKey="Lutzoni, F" uniqKey="Lutzoni F">F Lutzoni</name>
</author>
<author>
<name sortKey="Spatafora, Jw" uniqKey="Spatafora J">JW Spatafora</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seaver, Fj" uniqKey="Seaver F">FJ Seaver</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seifert, Ka" uniqKey="Seifert K">KA Seifert</name>
</author>
<author>
<name sortKey="Louis Seize, G" uniqKey="Louis Seize G">G Louis-Seize</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Skinner, Sj" uniqKey="Skinner S">SJ Skinner</name>
</author>
<author>
<name sortKey="Tsuneda, A" uniqKey="Tsuneda A">A Tsuneda</name>
</author>
<author>
<name sortKey="Currah, Rs" uniqKey="Currah R">RS Currah</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Spatafora, Jw" uniqKey="Spatafora J">JW Spatafora</name>
</author>
<author>
<name sortKey="Sung, Gh" uniqKey="Sung G">GH Sung</name>
</author>
<author>
<name sortKey="Johnson, D" uniqKey="Johnson D">D Johnson</name>
</author>
<author>
<name sortKey="Hesse, C" uniqKey="Hesse C">C Hesse</name>
</author>
<author>
<name sortKey="O Ourke, B" uniqKey="O Ourke B">B O’Rourke</name>
</author>
<author>
<name sortKey="Serdani, M" uniqKey="Serdani M">M Serdani</name>
</author>
<author>
<name sortKey="Spotts, R" uniqKey="Spotts R">R Spotts</name>
</author>
<author>
<name sortKey="Lutzoni, F" uniqKey="Lutzoni F">F Lutzoni</name>
</author>
<author>
<name sortKey="Hofstetter, V" uniqKey="Hofstetter V">V Hofstetter</name>
</author>
<author>
<name sortKey="Miadlikowska, J" uniqKey="Miadlikowska J">J Miadlikowska</name>
</author>
<author>
<name sortKey="Reeb, V" uniqKey="Reeb V">V Reeb</name>
</author>
<author>
<name sortKey="Gueidan, C" uniqKey="Gueidan C">C Gueidan</name>
</author>
<author>
<name sortKey="Fraker, E" uniqKey="Fraker E">E Fraker</name>
</author>
<author>
<name sortKey="Lumbsch, T" uniqKey="Lumbsch T">T Lumbsch</name>
</author>
<author>
<name sortKey="Lucking, R" uniqKey="Lucking R">R Lucking</name>
</author>
<author>
<name sortKey="Schmitt, I" uniqKey="Schmitt I">I Schmitt</name>
</author>
<author>
<name sortKey="Hosaka, K" uniqKey="Hosaka K">K Hosaka</name>
</author>
<author>
<name sortKey="Aptroot, A" uniqKey="Aptroot A">A Aptroot</name>
</author>
<author>
<name sortKey="Roux, C" uniqKey="Roux C">C Roux</name>
</author>
<author>
<name sortKey="Miller, An" uniqKey="Miller A">AN Miller</name>
</author>
<author>
<name sortKey="Geiser, M" uniqKey="Geiser M">M Geiser</name>
</author>
<author>
<name sortKey="Hafellner, J" uniqKey="Hafellner J">J Hafellner</name>
</author>
<author>
<name sortKey="Hestmark, G" uniqKey="Hestmark G">G Hestmark</name>
</author>
<author>
<name sortKey="Arnold, Ae" uniqKey="Arnold A">AE Arnold</name>
</author>
<author>
<name sortKey="Budel, B" uniqKey="Budel B">B Budel</name>
</author>
<author>
<name sortKey="Rauhut, A" uniqKey="Rauhut A">A Rauhut</name>
</author>
<author>
<name sortKey="Hewitt, D" uniqKey="Hewitt D">D Hewitt</name>
</author>
<author>
<name sortKey="Untereiner, Wa" uniqKey="Untereiner W">WA Untereiner</name>
</author>
<author>
<name sortKey="Cole, Ms" uniqKey="Cole M">MS Cole</name>
</author>
<author>
<name sortKey="Scheidegger, C" uniqKey="Scheidegger C">C Scheidegger</name>
</author>
<author>
<name sortKey="Schultz, M" uniqKey="Schultz M">M Schultz</name>
</author>
<author>
<name sortKey="Sipman, H" uniqKey="Sipman H">H Sipman</name>
</author>
<author>
<name sortKey="Schoch, Cl" uniqKey="Schoch C">CL Schoch</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Swofford, Dl" uniqKey="Swofford D">DL Swofford</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tsui, Ck" uniqKey="Tsui C">CK Tsui</name>
</author>
<author>
<name sortKey="Berbee, Ml" uniqKey="Berbee M">ML Berbee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vilgalys, R" uniqKey="Vilgalys R">R Vilgalys</name>
</author>
<author>
<name sortKey="Hester, M" uniqKey="Hester M">M Hester</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author>
<name sortKey="Binder, M" uniqKey="Binder M">M Binder</name>
</author>
<author>
<name sortKey="Schoch, Cl" uniqKey="Schoch C">CL Schoch</name>
</author>
<author>
<name sortKey="Johnston, Pr" uniqKey="Johnston P">PR Johnston</name>
</author>
<author>
<name sortKey="Spatafora, Jw" uniqKey="Spatafora J">JW Spatafora</name>
</author>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett "> DS Hibbett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author>
<name sortKey="Johnson, Pr" uniqKey="Johnson P">PR Johnson</name>
</author>
<author>
<name sortKey="Takamatsu, S" uniqKey="Takamatsu S">S Takamatsu</name>
</author>
<author>
<name sortKey="Spatafora, Jw" uniqKey="Spatafora J">JW Spatafora</name>
</author>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett "> DS Hibbett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Whalley, Ma" uniqKey="Whalley M">MA Whalley</name>
</author>
<author>
<name sortKey="Khalil, Ama" uniqKey="Khalil A">AMA Khalil</name>
</author>
<author>
<name sortKey="Wei, Tz" uniqKey="Wei T">TZ Wei</name>
</author>
<author>
<name sortKey="Yao, Yj" uniqKey="Yao Y">YJ Yao</name>
</author>
<author>
<name sortKey="Whalley, Ajs" uniqKey="Whalley A">AJS Whalley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="White, Tj" uniqKey="White T">TJ White</name>
</author>
<author>
<name sortKey="Bruns, T" uniqKey="Bruns T">T Bruns</name>
</author>
<author>
<name sortKey="Lee, S" uniqKey="Lee S">S Lee</name>
</author>
<author>
<name sortKey="Taylor, J" uniqKey="Taylor J">J Taylor</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">IMA Fungus</journal-id>
<journal-id journal-id-type="iso-abbrev">IMA Fungus</journal-id>
<journal-id journal-id-type="publisher-id">IMA Fungus</journal-id>
<journal-title-group>
<journal-title>IMA Fungus</journal-title>
</journal-title-group>
<issn pub-type="ppub">2210-6340</issn>
<issn pub-type="epub">2210-6359</issn>
<publisher>
<publisher-name>International Mycological Association</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">23898414</article-id>
<article-id pub-id-type="pmc">3719209</article-id>
<article-id pub-id-type="doi">10.5598/imafungus.2013.04.01.08</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>
<italic>Gelatinomyces siamensis</italic>
gen
<italic>.</italic>
sp. nov. (
<italic>Ascomycota</italic>
,
<italic>Leotiomycetes</italic>
,
<italic>incertae sedis</italic>
) on bamboo in Thailand</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Sanoamuang</surname>
<given-names>Niwat</given-names>
</name>
<xref ref-type="aff" rid="A1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="A2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="COR1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jitjak</surname>
<given-names>Wuttiwat</given-names>
</name>
<xref ref-type="aff" rid="A2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Rodtong</surname>
<given-names>Sureelak</given-names>
</name>
<xref ref-type="aff" rid="A3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Whalley</surname>
<given-names>Anthony J.S.</given-names>
</name>
<xref ref-type="aff" rid="A4">
<sup>4</sup>
</xref>
</contrib>
</contrib-group>
<aff id="A1">
<label>1</label>
Applied Taxonomic Research Center, Khon Kaen University, Khon Kaen 40002, Thailand</aff>
<aff id="A2">
<label>2</label>
Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002, Thailand</aff>
<aff id="A3">
<label>3</label>
School of Microbiology, Institute of Science, Suranaree University of Technology, Nakhon Ratchasima 30000, Thailand</aff>
<aff id="A4">
<label>4</label>
The Institute of Biotechnology and Genetic Engineering, Chulalongkorn University, Institute Bldg. 3, Phayathai Rd., Pathumwan, Bangkok 10330, Thailand</aff>
<author-notes>
<corresp id="COR1">corresponding author e-mail:
<email>niwatsanoa@gmail.com</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>14</day>
<month>5</month>
<year>2013</year>
</pub-date>
<pub-date pub-type="ppub">
<month>7</month>
<year>2013</year>
</pub-date>
<volume>4</volume>
<issue>1</issue>
<fpage>71</fpage>
<lpage>87</lpage>
<history>
<date date-type="received">
<day>25</day>
<month>6</month>
<year>2012</year>
</date>
<date date-type="accepted">
<day>8</day>
<month>4</month>
<year>2013</year>
</date>
</history>
<permissions>
<copyright-statement>© 2013 International Mycological Association</copyright-statement>
<copyright-year>2013</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode">
<license-p>You are free to share - to copy, distribute and transmit the work, under the following conditions:</license-p>
<license-p>
<bold>Attribution:</bold>
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).</license-p>
<license-p>
<bold>Non-commercial:</bold>
You may not use this work for commercial purposes.</license-p>
<license-p>
<bold>No derivative works:</bold>
You may not alter, transform, or build upon this work.</license-p>
<license-p>For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode">http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode</ext-link>
. Any of the above conditions can be waived if you get permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.</license-p>
</license>
</permissions>
<abstract abstract-type="executive-summary">
<p>
<italic>Gelatinomyces siamensis</italic>
gen. sp. nov.,
<italic>incertae sedis</italic>
within
<italic>Leotiomycetes</italic>
, the Siamese jelly-ball, is described. The fungus was collected from bamboo culms and branches in Nam Nao National Park, Phetchabun, Thailand. It presents as a ping-pong ball-sized and golf ball-like gelatinous ascostroma. The asci have numerous ascospores, are thick-walled, and arise on discoid apothecia which are aggregated and clustered to form the spherical gelatinous structures. An hyphomycete asexual morph is morphologically somewhat phialophora-like, and produces red pigments. On the basis of phylogenetic analysis based on rRNA, SSU, and LSU gene sequences, the lineage is closest to
<italic>Collophora</italic>
<italic>rubra</italic>
. However, ITS sequences place the fungus on a well-separated branch from that fungus, and the morphological and ecological differences exclude it from
<italic>Collophora</italic>
.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Bambusa</italic>
</kwd>
<kwd>Bambusicolous fungi</kwd>
<kwd>
<italic>Collophora</italic>
</kwd>
<kwd>Gelatinous ascostroma</kwd>
<kwd>Kao-niew ling</kwd>
<kwd>Siamese jelly-ball</kwd>
<kwd>Molecular phylogeny</kwd>
<kwd>Polyspored asci</kwd>
<kwd>Red pigments</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="F1" orientation="portrait" position="float">
<label>Fig. 1.</label>
<caption>
<p>Phylogenetic tree from maximum parsimony analysis based on SSU sequences showing the position of
<italic>Gelatinomyces siamensis</italic>
isolates KKUK1&2 (arrow), which is grouped closely in
<italic>Leotiomycetes</italic>
. Bootstrap support values > 50 % are shown above branches.</p>
</caption>
<graphic xlink:href="ima-4-1-71-g001"></graphic>
</fig>
<fig id="F2" orientation="portrait" position="float">
<label>Fig. 2.</label>
<caption>
<p>Phylogenetic tree obtained from Bayesian analysis inferred from SSU sequences showing phylogenetic relationship among fungal species selected from
<italic>Ascomycota</italic>
and
<italic>Gelatinomyces siamensis</italic>
isolates KKUK1&2. Posterior probability values ≥ 0.95 yielded from a Bayesian analysis shown at nodes.
<italic>Gelatinomyces siamensis</italic>
is grouped in
<italic>Leotiomycetes</italic>
(arrow).</p>
</caption>
<graphic xlink:href="ima-4-1-71-g002"></graphic>
</fig>
<fig id="F3" orientation="portrait" position="float">
<label>Fig. 3.</label>
<caption>
<p>Phylogenetic tree from maximum parsimony analysis based on LSU sequences showing the position of
<italic>Gelatinomyces siamensis</italic>
isolates KKUK1&2 (arrow), which clusters very close to
<italic>Leotiomycetes</italic>
. Bootstrap support values > 50 % are shown above branches.</p>
</caption>
<graphic xlink:href="ima-4-1-71-g003"></graphic>
</fig>
<fig id="F4" orientation="portrait" position="float">
<label>Fig. 4.</label>
<caption>
<p>Phylogenetic tree obtained from Bayesian analysis inferred from LSU sequences showing phylogenetic relationship among fungal species selected from Ascomycota and
<italic>Gelatinomyces siamensis</italic>
isolates KKUK1&2. Posterior probability values ≥ 0.95 shown at nodes.</p>
</caption>
<graphic xlink:href="ima-4-1-71-g004"></graphic>
</fig>
<fig id="F5" orientation="portrait" position="float">
<label>Fig. 5.</label>
<caption>
<p>Phylogenetic tree from maximum parsimony analysis based on ITS sequences showing the position of
<italic>Gelatinomyces siamensis</italic>
isolates KKUK1&2 (arrow) which clusters very close to
<italic>Collophora</italic>
spp. Bootstrap support values > 50 % are shown above the branches.</p>
</caption>
<graphic xlink:href="ima-4-1-71-g005"></graphic>
</fig>
<fig id="F6" orientation="portrait" position="float">
<label>Fig. 6.</label>
<caption>
<p>Sexual morph of
<italic>Gelatinomyces siamensis</italic>
(A–C, F, G holotype; D, E isotype).
<bold>A.</bold>
Ascostromata.
<bold>B.</bold>
Apothecia.
<bold>C.</bold>
Red pigments accumulated inside ascostroma.
<bold>D.</bold>
Ascal arrangement on gelatinous apothecium covered by dark matter.
<bold>E.</bold>
Asci and paraphyses.
<bold>F.</bold>
Single ascus.
<bold>G.</bold>
Ascospores under scanning electron microscope (arrow).</p>
</caption>
<graphic xlink:href="ima-4-1-71-g006"></graphic>
</fig>
<fig id="F7" orientation="portrait" position="float">
<label>Fig. 7.</label>
<caption>
<p>Microscopic characteristics of the asexual morph of
<italic>Gelatinomyces siamensis</italic>
(ex-holotype).
<bold>A, B.</bold>
Fungal colonies on PDA producing red pigments into the media.
<bold>C.</bold>
Red crystals generated by mycelia.
<bold>D.</bold>
Hyphal coil.
<bold>E.</bold>
Hyphal pairing, condia from short conidiogenous cells directly from mycelium.
<bold>F.</bold>
Conidia cluster at the apex of the tapered annellides and long, thick-walled, septate conidiophores.
<bold>G.</bold>
Conidia with internal inclusions.
<bold>H.</bold>
Swollen hypha.
<bold>I.</bold>
Dried conidia under scanning electron microscope (arrow).</p>
</caption>
<graphic xlink:href="ima-4-1-71-g007"></graphic>
</fig>
<table-wrap id="T1" orientation="portrait" position="float">
<caption>
<p>
<bold>Table 1.</bold>
PCR primers used for obtaining DNA sequences of the
<italic>Gelatinomyces siamensis.</italic>
</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" rowspan="1" colspan="1">
<bold>Name</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Sequence (5’-3’)</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Target region
<xref ref-type="table-fn" rid="tfn1">
<sup>a</sup>
</xref>
</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Reference</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">NS1</td>
<td align="left" rowspan="1" colspan="1">GTAGTCATATGCTTGTCTC</td>
<td align="left" rowspan="1" colspan="1">SSU 20-38</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R49">White
<italic>et al.</italic>
(1990)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NS4</td>
<td align="left" rowspan="1" colspan="1">CTTCCGTCAATTCCTTTAAG</td>
<td align="left" rowspan="1" colspan="1">SSU 1150-1131</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R49">White
<italic>et al</italic>
. (1990)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">SR8R</td>
<td align="left" rowspan="1" colspan="1">GAACCAGGACTTTTACCTT</td>
<td align="left" rowspan="1" colspan="1">SSU 732-749</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R45">Vilgalys & Hester (1990)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NS8</td>
<td align="left" rowspan="1" colspan="1">TCCGCAGGTTCACCTACGGA</td>
<td align="left" rowspan="1" colspan="1">SSU 1788-1768</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R49">White
<italic>et al.</italic>
(1990)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">ITS4</td>
<td align="left" rowspan="1" colspan="1">TCCTCCGCTTATTGATATGC</td>
<td align="left" rowspan="1" colspan="1">Internal transcribed spacer (ITS) regions LSU 60-41</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R49">White
<italic>et al.</italic>
(1990)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">ITS5</td>
<td align="left" rowspan="1" colspan="1">GGAAGTAAAAGTCGTAACAAGG</td>
<td align="left" rowspan="1" colspan="1">SSU 1744-1763</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R49">White
<italic>et al.</italic>
(1990)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NL1</td>
<td align="left" rowspan="1" colspan="1">GCATATCAATAAGCGGAGGAAAAG</td>
<td align="left" rowspan="1" colspan="1">Domain of large subunit (LSU) rDNA</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R32">O’Donnell (1993)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NL4</td>
<td align="left" rowspan="1" colspan="1">GGTCCGTGTTTCAAGACGG</td>
<td align="left" rowspan="1" colspan="1">D1/D2 domain of LSU rDNA</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R32">O’Donnell (1993)</xref>
</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn1">
<p>
<sup>a</sup>
<italic>Saccharomyces cerevisiae</italic>
numbering.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="T2" orientation="portrait" position="float">
<caption>
<p>
<bold>Table 2.</bold>
Fungal taxa used for phylogenetic analysis with GenBank accession numbers for small subunit (SSU) and large subunit (LSU) sequences, including their main characteristics.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" rowspan="1" colspan="1">
<bold>Ingroup</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>GenBank accession no. (SSU, LSU)</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Origin (substrate, country)</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Main characteristics</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Reference</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Class
<italic>Sordariomycetes</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Cainia graminis</italic>
</td>
<td align="left" rowspan="1" colspan="1">AF431948, AF431949</td>
<td align="left" rowspan="1" colspan="1">
<italic>Sesleria albicans</italic>
, France</td>
<td align="left" rowspan="1" colspan="1">Stromatic perithecial, unitunicate with pore, saprophytic, plant parasitic or endophytic</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Chaetomium globosum</italic>
</td>
<td align="left" rowspan="1" colspan="1">AB048285, AY346272</td>
<td align="left" rowspan="1" colspan="1">Indoor environment, Germany</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">Huhndorf
<italic>et al.</italic>
(2004),
<xref ref-type="bibr" rid="R33">Okane
<italic>et al.</italic>
(2001)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Diatrype disciformis</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ471012, DQ470964</td>
<td align="left" rowspan="1" colspan="1">Decayed wood, Netherlands</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R42">Spatafora
<italic>et al.</italic>
(2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Hypocrea americana</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY544693, AY544649</td>
<td align="left" rowspan="1" colspan="1">
<italic>Fomitopsis pinicola</italic>
, USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R29">Lutzoni
<italic>et al.</italic>
(2004)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Sordaria fimicola</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY545724, AY545728</td>
<td align="left" rowspan="1" colspan="1">Dung, Canada</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R5">Cai
<italic>et al.</italic>
(2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Xylaria acuta</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY544719, AY544676</td>
<td align="left" rowspan="1" colspan="1">Decayed wood, USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R36">Rogers (1984)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Xylaria hypoxylon</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY544692, AY544648</td>
<td align="left" rowspan="1" colspan="1">Downed rotting wood, USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R42">Spatafora
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Class
<italic>Leotiomycetes</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Botryotinia fuckeliana</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY544695, AY544651</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">Apothecial or cleistothecial, unitunicate and inoperculate, saprophytic, plant parasitic, some species known only anamorphic i.e.
<italic>Collophora</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R17">Hirschhauser & Frohlich (2007)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Bulgaria inquinans</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ471008, DQ470960</td>
<td align="left" rowspan="1" colspan="1">Germany</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R42">Spatafora
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Collophora rubra</italic>
</td>
<td align="left" rowspan="1" colspan="1">GQ154628, GQ154608</td>
<td align="left" rowspan="1" colspan="1">Wood necrosis close to pruning wound, South Africa</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R8">Damm
<italic>et al</italic>
. (2010)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Crinula calciiformis</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY544729, AY544680</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R29">Lutzoni
<italic>et al</italic>
. (2004)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Monilinia fructicola</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY544724, AY544683</td>
<td align="left" rowspan="1" colspan="1">Fruit, USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R12">Fulton & Brown (1997)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Neofabraea malicorticis</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY544706, AY544662</td>
<td align="left" rowspan="1" colspan="1">Apples, USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R29">Lutzoni
<italic>et al</italic>
. (2004)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Pezicula carpinea</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ471016, DQ470967</td>
<td align="left" rowspan="1" colspan="1">
<italic>Carpinus caroliniana</italic>
, Canada</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R42">Spatafora
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Potebniamyces pyri</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ470997, DQ470949</td>
<td align="left" rowspan="1" colspan="1">Cankered bark, USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R42">Spatafora
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Class
<italic>Lecanoromycetes</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Diploschistes thunbergianus</italic>
</td>
<td align="left" rowspan="1" colspan="1">AF274112, AF274095</td>
<td align="left" rowspan="1" colspan="1">Australia</td>
<td align="left" rowspan="1" colspan="1">Apothecial, unitunicate, rostrate asci, mostly lichenized</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Lobaria scrobiculata</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY584679, AY584655</td>
<td align="left" rowspan="1" colspan="1">USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R29">Lutzoni
<italic>et al</italic>
. (2004)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Trapella placodioides</italic>
</td>
<td align="left" rowspan="1" colspan="1">AF119500, AF274103</td>
<td align="left" rowspan="1" colspan="1">Wall, UK</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Class
<italic>Lichinomycetes</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Lempholemma polyanthes</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY548805, AF356691</td>
<td align="left" rowspan="1" colspan="1">USA</td>
<td align="left" rowspan="1" colspan="1">Apothecial, fissitunicate, lichenized</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R29">Lutzoni
<italic>et al</italic>
. (2004)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Peltula auriculata</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ832332, DQ832330</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R30">Miadlikowska
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Peltula umbilicata</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ782887, AF356689</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R30">Miadlikowska
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Class
<italic>Eurotiomycetes</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Eremascus albus</italic>
</td>
<td align="left" rowspan="1" colspan="1">M83258, AY004345</td>
<td align="left" rowspan="1" colspan="1">Dried fruit, UK</td>
<td align="left" rowspan="1" colspan="1">Cleistothecial, non-fissitunicate, saprophytic or plant parasitic</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R2">Berbee & Taylor (1992)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Eurotium rubrum</italic>
</td>
<td align="left" rowspan="1" colspan="1">U00970, AY004346</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005a)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Penicillium expansum</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ912698, AF003359</td>
<td align="left" rowspan="1" colspan="1">Fruit, USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R40">Seifert & Louis-Seize (2000)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Exophiala dermatitidis</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ823107, DQ823100</td>
<td align="left" rowspan="1" colspan="1">Human, USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R21">James
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Glyphium elatum</italic>
</td>
<td align="left" rowspan="1" colspan="1">AF346419, AF346420</td>
<td align="left" rowspan="1" colspan="1">Salix, USA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R25">Lindemuth
<italic>et al</italic>
. (2001)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Ramichloridium anceps</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ823109, DQ823102</td>
<td align="left" rowspan="1" colspan="1">Soil under
<italic>Thuja plicata,</italic>
Canada</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R21">James
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Class
<italic>Dothideomycetes</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Order
<italic>Botryosphaeriales</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Botryosphaeria ribis</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678000, DQ678053</td>
<td align="left" rowspan="1" colspan="1">
<italic>Ribes</italic>
, USA</td>
<td align="left" rowspan="1" colspan="1">Pseudothecial, fissitunicate asci, saprophytic or plant parasitic</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Botryosphaeria stevensii</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678012, DQ678064</td>
<td align="left" rowspan="1" colspan="1">
<italic>Fraxinus excelsior</italic>
, Netherlands</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Guignardia bidwellii</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678034, DQ678085</td>
<td align="left" rowspan="1" colspan="1">
<italic>Parthenocissus tricuspidata</italic>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Order
<italic>Capnodiales</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Catenulostroma abetis</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678040, DQ678092</td>
<td align="left" rowspan="1" colspan="1">
<italic>Abies</italic>
, Germany</td>
<td align="left" rowspan="1" colspan="1">Pseudothecial, fissitunicate asci, saprophytic or plant parasitic</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Cercospora beticola</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678039, DQ678091</td>
<td align="left" rowspan="1" colspan="1">
<italic>Beta vulgaris</italic>
, Italy</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Microxyphium citri</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY016340, AY004337</td>
<td align="left" rowspan="1" colspan="1">Fruit of
<italic>Citrus sinensis</italic>
, Spain</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Mycosphaerella punctiformis</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ471017, DQ470968</td>
<td align="left" rowspan="1" colspan="1">Dead fallen leaves of
<italic>Quercus robur</italic>
, Netherlands</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R42">Spatafora
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Scorias spongiosa</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678024, DQ678075</td>
<td align="left" rowspan="1" colspan="1">Aphid</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Order
<italic>Dothideales</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Aureobasidium pullulans</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ471004, DQ470956</td>
<td align="left" rowspan="1" colspan="1">Fruit of
<italic>Vitis vinifera,</italic>
France</td>
<td align="left" rowspan="1" colspan="1">Pseudothecial, fissitunicate asci, pseudoparaphyses absent, mainly saprophytic</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R42">Spatafora
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Delphinella strobiligena</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY016341, AY016358</td>
<td align="left" rowspan="1" colspan="1">Cone of
<italic>Pinus halepensis,</italic>
Greece</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R27">Lumbsch & Lindemuth (2001)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Discosphaerina fagi</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY016342, AY016359</td>
<td align="left" rowspan="1" colspan="1">Leaf of
<italic>Populus</italic>
, UK</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R27">Lumbsch & Lindemuth (2001)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Dothidea ribesia</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY016343, AY016360</td>
<td align="left" rowspan="1" colspan="1">Cult of
<italic>Ribes,</italic>
Switzerland</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Stylodothis puccinioides</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY016353, AY004342</td>
<td align="left" rowspan="1" colspan="1">
<italic>Viburnum lantana</italic>
, Switzerland</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Order
<italic>Myriangiales</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Cladosporium cladosporioides</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678004, DQ678057</td>
<td align="left" rowspan="1" colspan="1">Leaf of
<italic>Arundo</italic>
, England</td>
<td align="left" rowspan="1" colspan="1">Pseudothecial, fissitunicate globose asci, non-ostiolar, saprophytic or plant parasitic</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Davidiella tassiana</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678022, DQ678074</td>
<td align="left" rowspan="1" colspan="1">Human skin, Netherlands</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Elsinoe centrolobi</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678041, DQ678094</td>
<td align="left" rowspan="1" colspan="1">
<italic>Centrolobium robustum</italic>
, Brazil</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Myriangium duriaei</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY016347, DQ678059</td>
<td align="left" rowspan="1" colspan="1">
<italic>Chrysomphalus aonidium</italic>
, Argentina</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R27">Lumbsch & Lindemuth (2001)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Order
<italic>Pleosporales</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Arthopyrenia salicis</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY538333, AY538339</td>
<td align="left" rowspan="1" colspan="1">Bark of
<italic>Salix</italic>
, Netherlands</td>
<td align="left" rowspan="1" colspan="1">Perithecoid pseudothecial, ostiolar, non-lichenized or lichenized with fissitunicate asci and pseudoparaphyses present</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Cucurbitaria elongata</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678009, DQ678061</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cytisus sessilifolius</italic>
, France</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Dendrographa leucophaea</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY548803, AY548810</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R29">Lutzoni
<italic>et al</italic>
. (2004)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Lecanactis abietina</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY548805, AY548812</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R29">Lutzoni
<italic>et al</italic>
. (2004)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Neotestudina rosatii</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ384069, DQ384107</td>
<td align="left" rowspan="1" colspan="1">Seed of
<italic>Cuminum cyminum</italic>
imported from India, Japan</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R24">Kruys
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Pleospora herbarum</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ247812, DQ247804</td>
<td align="left" rowspan="1" colspan="1">Leaf of
<italic>Medicago sativa</italic>
, India</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Setosphaeria monoceras</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY016352, AY016368</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R27">Lumbsch & Lindemuth (2001)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Trematosphaeria heterospora</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY016354, AY016369</td>
<td align="left" rowspan="1" colspan="1">Iris, Switzerland</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Westerdykella cylindrica</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY016355, AY004343</td>
<td align="left" rowspan="1" colspan="1">Cow dung, Kenya</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Order
<italic>Incertae sedis</italic>
, Family
<italic>Tubeufiaceae</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Helicomyces lilliputeus</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY856942, AY856899</td>
<td align="left" rowspan="1" colspan="1">Rotten dicotyledonous wood, USA</td>
<td align="left" rowspan="1" colspan="1">Pseudothecial, fissitunicate</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R44">Tsui & Berbee (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Helicomyces roseus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ678032, DQ678083</td>
<td align="left" rowspan="1" colspan="1">Submerged bark, Switzerland</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R37">Schoch
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Tubeufia cerea</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY856947, AY856903</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R44">Tsui & Berbee (2006)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Class
<italic>Arthoniomycetes</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Arthonia dispersa</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY571379, AY571381</td>
<td align="left" rowspan="1" colspan="1">
<italic>Syringa vulgaris</italic>
, Sweden</td>
<td align="left" rowspan="1" colspan="1">Fissitunicate, mostly lichenized</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R28">Lumbsch
<italic>et al</italic>
. (2005)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Dendrographa leucophaea</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY548803, AY548810</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R29">Lutzoni
<italic>et al</italic>
. (2004)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Lecanactis abietina</italic>
</td>
<td align="left" rowspan="1" colspan="1">AY548805, AY548812</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R29">Lutzoni
<italic>et al</italic>
. (2004)</xref>
</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Unknown</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Gelatinomyces siamensis</italic>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<italic>Bambusa nutans,</italic>
Thailand</td>
<td align="left" rowspan="1" colspan="1">Apothecial, aggregated, embedded in gelatinous ball</td>
<td align="left" rowspan="1" colspan="1">This study</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Isolate KKUK1</td>
<td align="left" rowspan="1" colspan="1">JX219377, JX219381</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Isolate KKUK2</td>
<td align="left" rowspan="1" colspan="1">JX219378, JX219382</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Outgroup Class
<italic>Orbiliomycetes</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Orbilia auricolor</italic>
</td>
<td align="left" rowspan="1" colspan="1">DQ471001, DQ470953</td>
<td align="left" rowspan="1" colspan="1">Soil, UK</td>
<td align="left" rowspan="1" colspan="1">Apothecial, non-fissitunicate</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R42">Spatafora
<italic>et al</italic>
. (2006)</xref>
</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T3" orientation="portrait" position="float">
<caption>
<p>
<bold>Table 3.</bold>
Fungal taxa in the
<italic>Collophora</italic>
species,
<italic>Leotiomycetes</italic>
used for phylogenetic analysis with GenBank accession numbers for ITS sequences, including their main characteristics.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" rowspan="1" colspan="1">
<bold>Species</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>GenBank accession no. (ITS)</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Origin (substrate, country)</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Main characteristics</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Reference</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Order
<italic>Incertae sedis</italic>
, Family
<italic>Incertae sedis</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Collophora africana</italic>
</td>
<td align="left" rowspan="1" colspan="1">GQ154570</td>
<td align="left" rowspan="1" colspan="1">
<italic>Prunus salicina</italic>
, South Africa</td>
<td align="left" rowspan="1" colspan="1">Hyphae carry short necks or mere collarettes that release conidia; discrete conidiomata present</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R8">Damm
<italic>et al</italic>
. (2010)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. capensis</italic>
</td>
<td align="left" rowspan="1" colspan="1">GQ154571</td>
<td align="left" rowspan="1" colspan="1">
<italic>Prunus salicina</italic>
, South Africa</td>
<td align="left" rowspan="1" colspan="1">As above</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R8">Damm
<italic>et al</italic>
. (2010)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GQ154572</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GQ154573</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GQ154574</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. hispanica</italic>
</td>
<td align="left" rowspan="1" colspan="1">JN808840</td>
<td align="left" rowspan="1" colspan="1">
<italic>Prunus dulcis,</italic>
Spain</td>
<td align="left" rowspan="1" colspan="1">As above</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R13">Gramaje
<italic>et al</italic>
. (2012)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">JN808841</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">JN808842</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. paarla</italic>
</td>
<td align="left" rowspan="1" colspan="1">GQ154586</td>
<td align="left" rowspan="1" colspan="1">
<italic>Prunus salicina</italic>
, South Africa</td>
<td align="left" rowspan="1" colspan="1">As above</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R8">Damm
<italic>et al</italic>
. (2010)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. pallida</italic>
</td>
<td align="left" rowspan="1" colspan="1">GQ154578</td>
<td align="left" rowspan="1" colspan="1">
<italic>Prunus salicina</italic>
, South Africa</td>
<td align="left" rowspan="1" colspan="1">As above</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R8">Damm
<italic>et al</italic>
. (2010)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GQ154580</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GQ154582</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GQ154584</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. rubra</italic>
</td>
<td align="left" rowspan="1" colspan="1">GQ154562</td>
<td align="left" rowspan="1" colspan="1">
<italic>Prunus salicina</italic>
, South Africa</td>
<td align="left" rowspan="1" colspan="1">As above</td>
<td align="left" rowspan="1" colspan="1">
<xref ref-type="bibr" rid="R8">Damm
<italic>et al</italic>
. (2010)</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GQ154564</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GQ154566</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GQ154568</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Gelatinomyces siamensis</italic>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<italic>Bambusa nutans</italic>
</td>
<td align="left" rowspan="1" colspan="1">Sexual morph present, asexual conidia produced on short and long conidiogenous cells</td>
<td align="left" rowspan="1" colspan="1">This study</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Isolate KKUK1</td>
<td align="left" rowspan="1" colspan="1">JX219379</td>
<td align="left" rowspan="1" colspan="1">Thailand</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Isolate KKUK2</td>
<td align="left" rowspan="1" colspan="1">JX219380</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">
<bold>Outgroup
<italic>-Leotiales</italic>
</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Leotia lubrica</italic>
</td>
<td align="left" rowspan="1" colspan="1">GU222296</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Neobulgaria pura</italic>
</td>
<td align="left" rowspan="1" colspan="1">HM051080</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T4" orientation="portrait" position="float">
<caption>
<p>
<bold>Table 4.</bold>
Ecological and morphological characteristics of
<italic>Collophora</italic>
spp. in comparison to
<italic>Gelatinomyces siamensis.</italic>
</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" rowspan="1" colspan="1">
<bold>Characteristics</bold>
</th>
<th align="left" colspan="2" rowspan="1">
<bold>Species</bold>
<hr></hr>
</th>
</tr>
<tr>
<th align="left" rowspan="1" colspan="1"></th>
<th align="left" rowspan="1" colspan="1">
<bold>
<italic>Gelatinomyces</italic>
</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>
<italic>Collophora</italic>
</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">Associated plant</td>
<td align="left" rowspan="1" colspan="1">Bamboo species</td>
<td align="left" rowspan="1" colspan="1">
<italic>Prunus</italic>
spp. and almond</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Position</td>
<td align="left" rowspan="1" colspan="1">Attached to the point where bud breaks, culms or branches</td>
<td align="left" rowspan="1" colspan="1">Deep inside the heart of the wood, with heart rot symptom</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Teleomorph</td>
<td align="left" rowspan="1" colspan="1">Apothecia aggregate in a ball-like cluster</td>
<td align="left" rowspan="1" colspan="1">Unknown</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Red pigment crystalline in pure culture</td>
<td align="left" rowspan="1" colspan="1">Numerous, parallelogram or rhombus in shape</td>
<td align="left" rowspan="1" colspan="1">Absent, not mentioned</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Conidiogenous pegs, intercalary</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Present</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Conidiogenous cells at the septal point</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Absent</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Swollen hypha as conidial mother cells</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Absent</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Conidia</td>
<td align="left" rowspan="1" colspan="1">Various sizes and shapes but turn slightly ovoid in shape and minute in size when age</td>
<td align="left" rowspan="1" colspan="1">Consistency in shape and size</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T5" orientation="portrait" position="float">
<caption>
<p>
<bold>Table 5.</bold>
Characteristics of
<italic>Collophora</italic>
spp. in culture media in comparison to
<italic>Gelatinomyces siamensis.</italic>
</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" rowspan="1" colspan="1">
<bold>Species</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Spore size (μm)</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Discrete conidiomata</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Pigment</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Endo-conidia</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Sexual morph</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. africana</italic>
</td>
<td align="left" rowspan="1" colspan="1">(2.5−)3.5–5.5(−8) × 1–2(−2.5)
<break></break>
L/W = 3:1</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Red</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Unknown</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. capense</italic>
</td>
<td align="left" rowspan="1" colspan="1">(4−)4.5–6.5(−9) × 1–1.5(−2)
<break></break>
L/W = 3.7:1</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Red</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Unknown</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. hispanica</italic>
</td>
<td align="left" rowspan="1" colspan="1">(2.5−)3.5–5(−6.5) × (1−)1.5(−2)
<break></break>
L/W = 2.9:1</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Red</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Unknown</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. paarla</italic>
</td>
<td align="left" rowspan="1" colspan="1">(3−)4–7.5(−11) × (0.5−)1–2(−3)
<break></break>
L/W = 4.1:1</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Yellow, red</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Unknown</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. pallida</italic>
</td>
<td align="left" rowspan="1" colspan="1">(2.5−)3–5(−7) × 1–1.5(−2)
<break></break>
L/W = 3.5:1</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">None</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Unknown</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>C. rubra</italic>
</td>
<td align="left" rowspan="1" colspan="1">(3.5−)4–5.5(−8) × 1–2(−3.5)
<break></break>
L/W = 3.2:1</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Red</td>
<td align="left" rowspan="1" colspan="1">Present</td>
<td align="left" rowspan="1" colspan="1">Unknown</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>G. siamensis</italic>
</td>
<td align="left" rowspan="1" colspan="1">(2.0−)2.1–3.9(−4) × (2−)2–2.5(−2.5)
<break></break>
L/W=1.1:1</td>
<td align="left" rowspan="1" colspan="1">Absent</td>
<td align="left" rowspan="1" colspan="1">Red</td>
<td align="left" rowspan="1" colspan="1">Absent</td>
<td align="left" rowspan="1" colspan="1">Apothecia</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000F61 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd -nk 000F61 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Curation
   |type=    RBID
   |clé=     PMC:3719209
   |texte=   Gelatinomyces siamensis gen. sp. nov. (Ascomycota, Leotiomycetes, incertae sedis) on bamboo in Thailand
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Curation/RBID.i   -Sk "pubmed:23898414" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd   \
       | NlmPubMed2Wicri -a OrangerV1 

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024