Serveur d'exploration Cyberinfrastructure

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Assessing the global phylum level diversity within the bacterial domain: A review

Identifieur interne : 000707 ( Pmc/Curation ); précédent : 000706; suivant : 000708

Assessing the global phylum level diversity within the bacterial domain: A review

Auteurs : Noha H. Youssef ; M. B. Couger ; Alexandra L. Mccully ; Andrés Eduardo Guerrero Criado ; Mostafa S. Elshahed

Source :

RBID : PMC:4522544

Abstract

Graphical abstract

Url:
DOI: 10.1016/j.jare.2014.10.005
PubMed: 26257925
PubMed Central: 4522544

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:4522544

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Assessing the global phylum level diversity within the bacterial domain: A review</title>
<author>
<name sortKey="Youssef, Noha H" sort="Youssef, Noha H" uniqKey="Youssef N" first="Noha H." last="Youssef">Noha H. Youssef</name>
</author>
<author>
<name sortKey="Couger, M B" sort="Couger, M B" uniqKey="Couger M" first="M. B." last="Couger">M. B. Couger</name>
</author>
<author>
<name sortKey="Mccully, Alexandra L" sort="Mccully, Alexandra L" uniqKey="Mccully A" first="Alexandra L." last="Mccully">Alexandra L. Mccully</name>
</author>
<author>
<name sortKey="Criado, Andres Eduardo Guerrero" sort="Criado, Andres Eduardo Guerrero" uniqKey="Criado A" first="Andrés Eduardo Guerrero" last="Criado">Andrés Eduardo Guerrero Criado</name>
</author>
<author>
<name sortKey="Elshahed, Mostafa S" sort="Elshahed, Mostafa S" uniqKey="Elshahed M" first="Mostafa S." last="Elshahed">Mostafa S. Elshahed</name>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">26257925</idno>
<idno type="pmc">4522544</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4522544</idno>
<idno type="RBID">PMC:4522544</idno>
<idno type="doi">10.1016/j.jare.2014.10.005</idno>
<date when="2014">2014</date>
<idno type="wicri:Area/Pmc/Corpus">000707</idno>
<idno type="wicri:Area/Pmc/Curation">000707</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Assessing the global phylum level diversity within the bacterial domain: A review</title>
<author>
<name sortKey="Youssef, Noha H" sort="Youssef, Noha H" uniqKey="Youssef N" first="Noha H." last="Youssef">Noha H. Youssef</name>
</author>
<author>
<name sortKey="Couger, M B" sort="Couger, M B" uniqKey="Couger M" first="M. B." last="Couger">M. B. Couger</name>
</author>
<author>
<name sortKey="Mccully, Alexandra L" sort="Mccully, Alexandra L" uniqKey="Mccully A" first="Alexandra L." last="Mccully">Alexandra L. Mccully</name>
</author>
<author>
<name sortKey="Criado, Andres Eduardo Guerrero" sort="Criado, Andres Eduardo Guerrero" uniqKey="Criado A" first="Andrés Eduardo Guerrero" last="Criado">Andrés Eduardo Guerrero Criado</name>
</author>
<author>
<name sortKey="Elshahed, Mostafa S" sort="Elshahed, Mostafa S" uniqKey="Elshahed M" first="Mostafa S." last="Elshahed">Mostafa S. Elshahed</name>
</author>
</analytic>
<series>
<title level="j">Journal of Advanced Research</title>
<idno type="ISSN">2090-1232</idno>
<idno type="eISSN">2090-1224</idno>
<imprint>
<date when="2014">2014</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<title>Graphical abstract</title>
<fig id="f0035" position="anchor">
<graphic xlink:href="fx2"></graphic>
</fig>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Bibel, D J" uniqKey="Bibel D">D.J. Bibel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Blevins, S M" uniqKey="Blevins S">S.M. Blevins</name>
</author>
<author>
<name sortKey="Bronze, M S" uniqKey="Bronze M">M.S. Bronze</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gilbert, J A" uniqKey="Gilbert J">J.A. Gilbert</name>
</author>
<author>
<name sortKey="Meyer, F" uniqKey="Meyer F">F. Meyer</name>
</author>
<author>
<name sortKey="Antonopoulos, D" uniqKey="Antonopoulos D">D. Antonopoulos</name>
</author>
<author>
<name sortKey="Balaji, P" uniqKey="Balaji P">P. Balaji</name>
</author>
<author>
<name sortKey="Brown, T" uniqKey="Brown T">T. Brown</name>
</author>
<author>
<name sortKey="Brown, C T" uniqKey="Brown C">C.T. Brown</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schloss, P D" uniqKey="Schloss P">P.D. Schloss</name>
</author>
<author>
<name sortKey="Handelsman, J" uniqKey="Handelsman J">J. Handelsman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baveye, P C" uniqKey="Baveye P">P.C. Baveye</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vogel, T M" uniqKey="Vogel T">T.M. Vogel</name>
</author>
<author>
<name sortKey="Simonet, P" uniqKey="Simonet P">P. Simonet</name>
</author>
<author>
<name sortKey="Jansson, J K" uniqKey="Jansson J">J.K. Jansson</name>
</author>
<author>
<name sortKey="Hirsch, P R" uniqKey="Hirsch P">P.R. Hirsch</name>
</author>
<author>
<name sortKey="Tiedje, J M" uniqKey="Tiedje J">J.M. Tiedje</name>
</author>
<author>
<name sortKey="Elsas, Jdv" uniqKey="Elsas J">JDv Elsas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Razumov, A S" uniqKey="Razumov A">A.S. Razumov</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Staley, J T" uniqKey="Staley J">J.T. Staley</name>
</author>
<author>
<name sortKey="Konopka, A" uniqKey="Konopka A">A. Konopka</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Joseph, S J" uniqKey="Joseph S">S.J. Joseph</name>
</author>
<author>
<name sortKey="Hugenholtz, P" uniqKey="Hugenholtz P">P. Hugenholtz</name>
</author>
<author>
<name sortKey="Sangwan, P" uniqKey="Sangwan P">P. Sangwan</name>
</author>
<author>
<name sortKey="Osborne, C A" uniqKey="Osborne C">C.A. Osborne</name>
</author>
<author>
<name sortKey="Janssen, P H" uniqKey="Janssen P">P.H. Janssen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kaeberlein, T" uniqKey="Kaeberlein T">T. Kaeberlein</name>
</author>
<author>
<name sortKey="Lewis, K" uniqKey="Lewis K">K. Lewis</name>
</author>
<author>
<name sortKey="Epstein, S S" uniqKey="Epstein S">S.S. Epstein</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zengler, K" uniqKey="Zengler K">K. Zengler</name>
</author>
<author>
<name sortKey="Toledo, G" uniqKey="Toledo G">G. Toledo</name>
</author>
<author>
<name sortKey="Rappe, M" uniqKey="Rappe M">M. Rappe</name>
</author>
<author>
<name sortKey="Elkins, J" uniqKey="Elkins J">J. Elkins</name>
</author>
<author>
<name sortKey="Mathur, E J" uniqKey="Mathur E">E.J. Mathur</name>
</author>
<author>
<name sortKey="Short, J M" uniqKey="Short J">J.M. Short</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Connon, S A" uniqKey="Connon S">S.A. Connon</name>
</author>
<author>
<name sortKey="Giovannoni, S J" uniqKey="Giovannoni S">S.J. Giovannoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rappe, M" uniqKey="Rappe M">M. Rappe</name>
</author>
<author>
<name sortKey="Connon, S A" uniqKey="Connon S">S.A. Connon</name>
</author>
<author>
<name sortKey="Vergin, K L" uniqKey="Vergin K">K.L. Vergin</name>
</author>
<author>
<name sortKey="Giovannoni, S J" uniqKey="Giovannoni S">S.J. Giovannoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Walsby, A E" uniqKey="Walsby A">A.E. Walsby</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lane, D J" uniqKey="Lane D">D.J. Lane</name>
</author>
<author>
<name sortKey="Pace, B" uniqKey="Pace B">B. Pace</name>
</author>
<author>
<name sortKey="Olsen, G J" uniqKey="Olsen G">G.J. Olsen</name>
</author>
<author>
<name sortKey="Stahl, D A" uniqKey="Stahl D">D.A. Stahl</name>
</author>
<author>
<name sortKey="Sogin, M L" uniqKey="Sogin M">M.L. Sogin</name>
</author>
<author>
<name sortKey="Pace, N R" uniqKey="Pace N">N.R. Pace</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Woese, C R" uniqKey="Woese C">C.R. Woese</name>
</author>
<author>
<name sortKey="Fox, G E" uniqKey="Fox G">G.E. Fox</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Woese, C R" uniqKey="Woese C">C.R. Woese</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lane, D J" uniqKey="Lane D">D.J. Lane</name>
</author>
<author>
<name sortKey="Pace, B" uniqKey="Pace B">B. Pace</name>
</author>
<author>
<name sortKey="Olsen, G J" uniqKey="Olsen G">G.J. Olsen</name>
</author>
<author>
<name sortKey="Stahl, D A" uniqKey="Stahl D">D.A. Stahl</name>
</author>
<author>
<name sortKey="Sogin, M L" uniqKey="Sogin M">M.L. Sogin</name>
</author>
<author>
<name sortKey="Pace, N R" uniqKey="Pace N">N.R. Pace</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sogin, M L" uniqKey="Sogin M">M.L. Sogin</name>
</author>
<author>
<name sortKey="Morrison, H G" uniqKey="Morrison H">H.G. Morrison</name>
</author>
<author>
<name sortKey="Huber, J A" uniqKey="Huber J">J.A. Huber</name>
</author>
<author>
<name sortKey="Welch, D M" uniqKey="Welch D">D.M. Welch</name>
</author>
<author>
<name sortKey="Huse, S M" uniqKey="Huse S">S.M. Huse</name>
</author>
<author>
<name sortKey="Neal, P R" uniqKey="Neal P">P.R. Neal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sogin, M L" uniqKey="Sogin M">M.L. Sogin</name>
</author>
<author>
<name sortKey="Morrison, H G" uniqKey="Morrison H">H.G. Morrison</name>
</author>
<author>
<name sortKey="Huber, J A" uniqKey="Huber J">J.A. Huber</name>
</author>
<author>
<name sortKey="Mark Welch, D" uniqKey="Mark Welch D">D. Mark Welch</name>
</author>
<author>
<name sortKey="Huse, S M" uniqKey="Huse S">S.M. Huse</name>
</author>
<author>
<name sortKey="Neal, P R" uniqKey="Neal P">P.R. Neal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Delong, E F" uniqKey="Delong E">E.F. DeLong</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Field, K G" uniqKey="Field K">K.G. Field</name>
</author>
<author>
<name sortKey="Gordon, D" uniqKey="Gordon D">D. Gordon</name>
</author>
<author>
<name sortKey="Wright, T" uniqKey="Wright T">T. Wright</name>
</author>
<author>
<name sortKey="Rappe, M" uniqKey="Rappe M">M. Rappe</name>
</author>
<author>
<name sortKey="Urback, E" uniqKey="Urback E">E. Urback</name>
</author>
<author>
<name sortKey="Vergin, K" uniqKey="Vergin K">K. Vergin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fuhrman, J A" uniqKey="Fuhrman J">J.A. Fuhrman</name>
</author>
<author>
<name sortKey="Mccallum, K" uniqKey="Mccallum K">K. McCallum</name>
</author>
<author>
<name sortKey="Davis, A A" uniqKey="Davis A">A.A. Davis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Giovannoni, S J" uniqKey="Giovannoni S">S.J. Giovannoni</name>
</author>
<author>
<name sortKey="Rappe, M S" uniqKey="Rappe M">M.S. Rappe</name>
</author>
<author>
<name sortKey="Vergin, K L" uniqKey="Vergin K">K.L. Vergin</name>
</author>
<author>
<name sortKey="Adair, N L" uniqKey="Adair N">N.L. Adair</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schmidt, T M" uniqKey="Schmidt T">T.M. Schmidt</name>
</author>
<author>
<name sortKey="Delong, E F" uniqKey="Delong E">E.F. DeLong</name>
</author>
<author>
<name sortKey="Pace, N R" uniqKey="Pace N">N.R. Pace</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kirchman, D L" uniqKey="Kirchman D">D.L. Kirchman</name>
</author>
<author>
<name sortKey="Cottrell, M T" uniqKey="Cottrell M">M.T. Cottrell</name>
</author>
<author>
<name sortKey="Lovejoy, C" uniqKey="Lovejoy C">C. Lovejoy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Malmstrom, R R" uniqKey="Malmstrom R">R.R. Malmstrom</name>
</author>
<author>
<name sortKey="Straza, T R" uniqKey="Straza T">T.R. Straza</name>
</author>
<author>
<name sortKey="Cottrell, M T" uniqKey="Cottrell M">M.T. Cottrell</name>
</author>
<author>
<name sortKey="Kirchman, D L" uniqKey="Kirchman D">D.L. Kirchman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Inagaki, F" uniqKey="Inagaki F">F. Inagaki</name>
</author>
<author>
<name sortKey="Nunoura, T" uniqKey="Nunoura T">T. Nunoura</name>
</author>
<author>
<name sortKey="Nakagawa, S" uniqKey="Nakagawa S">S. Nakagawa</name>
</author>
<author>
<name sortKey="Teske, A" uniqKey="Teske A">A. Teske</name>
</author>
<author>
<name sortKey="Lever, M" uniqKey="Lever M">M. Lever</name>
</author>
<author>
<name sortKey="Lauer, A" uniqKey="Lauer A">A. Lauer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lauro, F M" uniqKey="Lauro F">F.M. Lauro</name>
</author>
<author>
<name sortKey="Chastain, R A" uniqKey="Chastain R">R.A. Chastain</name>
</author>
<author>
<name sortKey="Blankenship, L E" uniqKey="Blankenship L">L.E. Blankenship</name>
</author>
<author>
<name sortKey="Yayanos, A A" uniqKey="Yayanos A">A.A. Yayanos</name>
</author>
<author>
<name sortKey="Bartlett, D H" uniqKey="Bartlett D">D.H. Bartlett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Santelli, C M" uniqKey="Santelli C">C.M. Santelli</name>
</author>
<author>
<name sortKey="Orcutt, B N" uniqKey="Orcutt B">B.N. Orcutt</name>
</author>
<author>
<name sortKey="Banning, E" uniqKey="Banning E">E. Banning</name>
</author>
<author>
<name sortKey="Bach, W" uniqKey="Bach W">W. Bach</name>
</author>
<author>
<name sortKey="Moyer, C L" uniqKey="Moyer C">C.L. Moyer</name>
</author>
<author>
<name sortKey="Sogin, M L" uniqKey="Sogin M">M.L. Sogin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Campbell, B J" uniqKey="Campbell B">B.J. Campbell</name>
</author>
<author>
<name sortKey="Yu, L" uniqKey="Yu L">L. Yu</name>
</author>
<author>
<name sortKey="Heidelberg, J F" uniqKey="Heidelberg J">J.F. Heidelberg</name>
</author>
<author>
<name sortKey="Kirchman, D L" uniqKey="Kirchman D">D.L. Kirchman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tian, F" uniqKey="Tian F">F. Tian</name>
</author>
<author>
<name sortKey="Yu, Y" uniqKey="Yu Y">Y. Yu</name>
</author>
<author>
<name sortKey="Chen, B" uniqKey="Chen B">B. Chen</name>
</author>
<author>
<name sortKey="Li, H" uniqKey="Li H">H. Li</name>
</author>
<author>
<name sortKey="Yao, Y F" uniqKey="Yao Y">Y.-F. Yao</name>
</author>
<author>
<name sortKey="Guo, X K" uniqKey="Guo X">X.-K. Guo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Quast, C" uniqKey="Quast C">C. Quast</name>
</author>
<author>
<name sortKey="Pruesse, E" uniqKey="Pruesse E">E. Pruesse</name>
</author>
<author>
<name sortKey="Yilmaz, P" uniqKey="Yilmaz P">P. Yilmaz</name>
</author>
<author>
<name sortKey="Gerken, J" uniqKey="Gerken J">J. Gerken</name>
</author>
<author>
<name sortKey="Schweer, T" uniqKey="Schweer T">T. Schweer</name>
</author>
<author>
<name sortKey="Yarza, P" uniqKey="Yarza P">P. Yarza</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Biers, E J" uniqKey="Biers E">E.J. Biers</name>
</author>
<author>
<name sortKey="Sun, S" uniqKey="Sun S">S. Sun</name>
</author>
<author>
<name sortKey="Howard, E C" uniqKey="Howard E">E.C. Howard</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Galand, P E" uniqKey="Galand P">P.E. Galand</name>
</author>
<author>
<name sortKey="Casamayor, E O" uniqKey="Casamayor E">E.O. Casamayor</name>
</author>
<author>
<name sortKey="Kirchman, D L" uniqKey="Kirchman D">D.L. Kirchman</name>
</author>
<author>
<name sortKey="Lovejoy, C" uniqKey="Lovejoy C">C. Lovejoy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hongxiang, X" uniqKey="Hongxiang X">X. Hongxiang</name>
</author>
<author>
<name sortKey="Min, W" uniqKey="Min W">W. Min</name>
</author>
<author>
<name sortKey="Xiaogu, W" uniqKey="Xiaogu W">W. Xiaogu</name>
</author>
<author>
<name sortKey="Junyi, Y" uniqKey="Junyi Y">Y. Junyi</name>
</author>
<author>
<name sortKey="Chunsheng, W" uniqKey="Chunsheng W">W. Chunsheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gibbons, S M" uniqKey="Gibbons S">S.M. Gibbons</name>
</author>
<author>
<name sortKey="Caporaso, J G" uniqKey="Caporaso J">J.G. Caporaso</name>
</author>
<author>
<name sortKey="Pirrung, M" uniqKey="Pirrung M">M. Pirrung</name>
</author>
<author>
<name sortKey="Field, D" uniqKey="Field D">D. Field</name>
</author>
<author>
<name sortKey="Knight, R" uniqKey="Knight R">R. Knight</name>
</author>
<author>
<name sortKey="Gilbert, J A" uniqKey="Gilbert J">J.A. Gilbert</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hunt, D E" uniqKey="Hunt D">D.E. Hunt</name>
</author>
<author>
<name sortKey="Lin, Y" uniqKey="Lin Y">Y. Lin</name>
</author>
<author>
<name sortKey="Church, M J" uniqKey="Church M">M.J. Church</name>
</author>
<author>
<name sortKey="Karl, D M" uniqKey="Karl D">D.M. Karl</name>
</author>
<author>
<name sortKey="Tringe, S G" uniqKey="Tringe S">S.G. Tringe</name>
</author>
<author>
<name sortKey="Izzo, L K" uniqKey="Izzo L">L.K. Izzo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Whalan, S" uniqKey="Whalan S">S. Whalan</name>
</author>
<author>
<name sortKey="Webster, N S" uniqKey="Webster N">N.S. Webster</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mohit, V" uniqKey="Mohit V">V. Mohit</name>
</author>
<author>
<name sortKey="Archambault, P" uniqKey="Archambault P">P. Archambault</name>
</author>
<author>
<name sortKey="Toupoint, N" uniqKey="Toupoint N">N. Toupoint</name>
</author>
<author>
<name sortKey="Lovejoy, C" uniqKey="Lovejoy C">C. Lovejoy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kuffner, M" uniqKey="Kuffner M">M. Kuffner</name>
</author>
<author>
<name sortKey="Hai, B" uniqKey="Hai B">B. Hai</name>
</author>
<author>
<name sortKey="Rattei, T" uniqKey="Rattei T">T. Rattei</name>
</author>
<author>
<name sortKey="Melodelima, C" uniqKey="Melodelima C">C. Melodelima</name>
</author>
<author>
<name sortKey="Schloter, M" uniqKey="Schloter M">M. Schloter</name>
</author>
<author>
<name sortKey="Zechmeister Boltenstern, S" uniqKey="Zechmeister Boltenstern S">S. Zechmeister-Boltenstern</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Will, C" uniqKey="Will C">C. Will</name>
</author>
<author>
<name sortKey="Thurmer, A" uniqKey="Thurmer A">A. Thürmer</name>
</author>
<author>
<name sortKey="Wollherr, A" uniqKey="Wollherr A">A. Wollherr</name>
</author>
<author>
<name sortKey="Nacke, H" uniqKey="Nacke H">H. Nacke</name>
</author>
<author>
<name sortKey="Herold, N" uniqKey="Herold N">N. Herold</name>
</author>
<author>
<name sortKey="Schrumpf, M" uniqKey="Schrumpf M">M. Schrumpf</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vasileiadis, S" uniqKey="Vasileiadis S">S. Vasileiadis</name>
</author>
<author>
<name sortKey="Puglisi, E" uniqKey="Puglisi E">E. Puglisi</name>
</author>
<author>
<name sortKey="Arena, M" uniqKey="Arena M">M. Arena</name>
</author>
<author>
<name sortKey="Cappa, F" uniqKey="Cappa F">F. Cappa</name>
</author>
<author>
<name sortKey="Cocconcelli, P S" uniqKey="Cocconcelli P">P.S. Cocconcelli</name>
</author>
<author>
<name sortKey="Trevisan, M" uniqKey="Trevisan M">M. Trevisan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Luo, C" uniqKey="Luo C">C. Luo</name>
</author>
<author>
<name sortKey="Rodriguez R, L M" uniqKey="Rodriguez R L">L.M. Rodriguez-R</name>
</author>
<author>
<name sortKey="Johnston, E R" uniqKey="Johnston E">E.R. Johnston</name>
</author>
<author>
<name sortKey="Wu, L" uniqKey="Wu L">L. Wu</name>
</author>
<author>
<name sortKey="Cheng, L" uniqKey="Cheng L">L. Cheng</name>
</author>
<author>
<name sortKey="Xue, K" uniqKey="Xue K">K. Xue</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Peiffer, J A" uniqKey="Peiffer J">J.A. Peiffer</name>
</author>
<author>
<name sortKey="Spor, A" uniqKey="Spor A">A. Spor</name>
</author>
<author>
<name sortKey="Koren, O" uniqKey="Koren O">O. Koren</name>
</author>
<author>
<name sortKey="Jin, Z" uniqKey="Jin Z">Z. Jin</name>
</author>
<author>
<name sortKey="Tringe, S G" uniqKey="Tringe S">S.G. Tringe</name>
</author>
<author>
<name sortKey="Dangl, J L" uniqKey="Dangl J">J.L. Dangl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ferrenberg, S" uniqKey="Ferrenberg S">S. Ferrenberg</name>
</author>
<author>
<name sortKey="O Eill, S P" uniqKey="O Eill S">S.P. O’Neill</name>
</author>
<author>
<name sortKey="Knelman, J E" uniqKey="Knelman J">J.E. Knelman</name>
</author>
<author>
<name sortKey="Todd, B" uniqKey="Todd B">B. Todd</name>
</author>
<author>
<name sortKey="Duggan, S" uniqKey="Duggan S">S. Duggan</name>
</author>
<author>
<name sortKey="Bradley, D" uniqKey="Bradley D">D. Bradley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J. Wang</name>
</author>
<author>
<name sortKey="Gu, J D" uniqKey="Gu J">J.-D. Gu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Desai, C" uniqKey="Desai C">C. Desai</name>
</author>
<author>
<name sortKey="Parikh, R Y" uniqKey="Parikh R">R.Y. Parikh</name>
</author>
<author>
<name sortKey="Vaishnav, T" uniqKey="Vaishnav T">T. Vaishnav</name>
</author>
<author>
<name sortKey="Shouche, Y S" uniqKey="Shouche Y">Y.S. Shouche</name>
</author>
<author>
<name sortKey="Madamwar, D" uniqKey="Madamwar D">D. Madamwar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jechalke, S" uniqKey="Jechalke S">S. Jechalke</name>
</author>
<author>
<name sortKey="Focks, A" uniqKey="Focks A">A. Focks</name>
</author>
<author>
<name sortKey="Rosendahl, I" uniqKey="Rosendahl I">I. Rosendahl</name>
</author>
<author>
<name sortKey="Groeneweg, J" uniqKey="Groeneweg J">J. Groeneweg</name>
</author>
<author>
<name sortKey="Siemens, J" uniqKey="Siemens J">J. Siemens</name>
</author>
<author>
<name sortKey="Heuer, H" uniqKey="Heuer H">H. Heuer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sprocati, A" uniqKey="Sprocati A">A. Sprocati</name>
</author>
<author>
<name sortKey="Alisi, C" uniqKey="Alisi C">C. Alisi</name>
</author>
<author>
<name sortKey="Tasso, F" uniqKey="Tasso F">F. Tasso</name>
</author>
<author>
<name sortKey="Fiore, A" uniqKey="Fiore A">A. Fiore</name>
</author>
<author>
<name sortKey="Marconi, P" uniqKey="Marconi P">P. Marconi</name>
</author>
<author>
<name sortKey="Langella, F" uniqKey="Langella F">F. Langella</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rahman, M M" uniqKey="Rahman M">M.M. Rahman</name>
</author>
<author>
<name sortKey="Basaglia, M" uniqKey="Basaglia M">M. Basaglia</name>
</author>
<author>
<name sortKey="Vendramin, E" uniqKey="Vendramin E">E. Vendramin</name>
</author>
<author>
<name sortKey="Boz, B" uniqKey="Boz B">B. Boz</name>
</author>
<author>
<name sortKey="Fontana, F" uniqKey="Fontana F">F. Fontana</name>
</author>
<author>
<name sortKey="Gumiero, B" uniqKey="Gumiero B">B. Gumiero</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roesch, L F" uniqKey="Roesch L">L.F. Roesch</name>
</author>
<author>
<name sortKey="Fulthorpe, R R" uniqKey="Fulthorpe R">R.R. Fulthorpe</name>
</author>
<author>
<name sortKey="Riva, A" uniqKey="Riva A">A. Riva</name>
</author>
<author>
<name sortKey="Casella, G" uniqKey="Casella G">G. Casella</name>
</author>
<author>
<name sortKey="Hadwin, A K" uniqKey="Hadwin A">A.K. Hadwin</name>
</author>
<author>
<name sortKey="Kent, A D" uniqKey="Kent A">A.D. Kent</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bintrim, S B" uniqKey="Bintrim S">S.B. Bintrim</name>
</author>
<author>
<name sortKey="Donohue, T J" uniqKey="Donohue T">T.J. Donohue</name>
</author>
<author>
<name sortKey="Handelsman, J" uniqKey="Handelsman J">J. Handelsman</name>
</author>
<author>
<name sortKey="Roberts, G P" uniqKey="Roberts G">G.P. Roberts</name>
</author>
<author>
<name sortKey="Goodman, R M" uniqKey="Goodman R">R.M. Goodman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kuske, C R" uniqKey="Kuske C">C.R. Kuske</name>
</author>
<author>
<name sortKey="Barns, S M" uniqKey="Barns S">S.M. Barns</name>
</author>
<author>
<name sortKey="Busch, J D" uniqKey="Busch J">J.D. Busch</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dunbar, J" uniqKey="Dunbar J">J. Dunbar</name>
</author>
<author>
<name sortKey="Barns, S M" uniqKey="Barns S">S.M. Barns</name>
</author>
<author>
<name sortKey="Ticknor, L O" uniqKey="Ticknor L">L.O. Ticknor</name>
</author>
<author>
<name sortKey="Kuske, C R" uniqKey="Kuske C">C.R. Kuske</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schloss, P D" uniqKey="Schloss P">P.D. Schloss</name>
</author>
<author>
<name sortKey="Handelsman, J" uniqKey="Handelsman J">J. Handelsman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Youssef, N" uniqKey="Youssef N">N. Youssef</name>
</author>
<author>
<name sortKey="Sheik, C S" uniqKey="Sheik C">C.S. Sheik</name>
</author>
<author>
<name sortKey="Krumholz, L R" uniqKey="Krumholz L">L.R. Krumholz</name>
</author>
<author>
<name sortKey="Najar, F Z" uniqKey="Najar F">F.Z. Najar</name>
</author>
<author>
<name sortKey="Roe, B A" uniqKey="Roe B">B.A. Roe</name>
</author>
<author>
<name sortKey="Elshahed, M S" uniqKey="Elshahed M">M.S. Elshahed</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Youssef, N H" uniqKey="Youssef N">N.H. Youssef</name>
</author>
<author>
<name sortKey="Elshahed, M S" uniqKey="Elshahed M">M.S. Elshahed</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Youssef, N H" uniqKey="Youssef N">N.H. Youssef</name>
</author>
<author>
<name sortKey="Elshahed, M S" uniqKey="Elshahed M">M.S. Elshahed</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Janssen, P H" uniqKey="Janssen P">P.H. Janssen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kimura, H" uniqKey="Kimura H">H. Kimura</name>
</author>
<author>
<name sortKey="Higashide, Y" uniqKey="Higashide Y">Y. Higashide</name>
</author>
<author>
<name sortKey="Naganuma, T" uniqKey="Naganuma T">T. Naganuma</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Teske, A" uniqKey="Teske A">A. Teske</name>
</author>
<author>
<name sortKey="Hinrichs, K U" uniqKey="Hinrichs K">K.U. Hinrichs</name>
</author>
<author>
<name sortKey="Edgcomb, V" uniqKey="Edgcomb V">V. Edgcomb</name>
</author>
<author>
<name sortKey="De Vera Gomez, A" uniqKey="De Vera Gomez A">A. de Vera Gomez</name>
</author>
<author>
<name sortKey="Kysela, D" uniqKey="Kysela D">D. Kysela</name>
</author>
<author>
<name sortKey="Sylva, S P" uniqKey="Sylva S">S.P. Sylva</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Amarouche Yala, S" uniqKey="Amarouche Yala S">S. Amarouche-Yala</name>
</author>
<author>
<name sortKey="Benouadah, A" uniqKey="Benouadah A">A. Benouadah</name>
</author>
<author>
<name sortKey="El Ouahab Bentabet, A" uniqKey="El Ouahab Bentabet A">A. El Ouahab Bentabet</name>
</author>
<author>
<name sortKey="L Pez Garcia, P" uniqKey="L Pez Garcia P">P. López-García</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Anderson, R E" uniqKey="Anderson R">R.E. Anderson</name>
</author>
<author>
<name sortKey="Beltran, M T" uniqKey="Beltran M">M.T. Beltrán</name>
</author>
<author>
<name sortKey="Hallam, S J" uniqKey="Hallam S">S.J. Hallam</name>
</author>
<author>
<name sortKey="Baross, J A" uniqKey="Baross J">J.A. Baross</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brazelton, W J" uniqKey="Brazelton W">W.J. Brazelton</name>
</author>
<author>
<name sortKey="Ludwig, K A" uniqKey="Ludwig K">K.A. Ludwig</name>
</author>
<author>
<name sortKey="Sogin, M L" uniqKey="Sogin M">M.L. Sogin</name>
</author>
<author>
<name sortKey="Andreishcheva, E N" uniqKey="Andreishcheva E">E.N. Andreishcheva</name>
</author>
<author>
<name sortKey="Kelley, D S" uniqKey="Kelley D">D.S. Kelley</name>
</author>
<author>
<name sortKey="Shen, C C" uniqKey="Shen C">C.-C. Shen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Byrne, N" uniqKey="Byrne N">N. Byrne</name>
</author>
<author>
<name sortKey="Strous, M" uniqKey="Strous M">M. Strous</name>
</author>
<author>
<name sortKey="Crepeau, V" uniqKey="Crepeau V">V. Crepeau</name>
</author>
<author>
<name sortKey="Kartal, B" uniqKey="Kartal B">B. Kartal</name>
</author>
<author>
<name sortKey="Birrien, J L" uniqKey="Birrien J">J.-L. Birrien</name>
</author>
<author>
<name sortKey="Schmid, M" uniqKey="Schmid M">M. Schmid</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dick, G J" uniqKey="Dick G">G.J. Dick</name>
</author>
<author>
<name sortKey="Tebo, B M" uniqKey="Tebo B">B.M. Tebo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Flores, G E" uniqKey="Flores G">G.E. Flores</name>
</author>
<author>
<name sortKey="Campbell, J H" uniqKey="Campbell J">J.H. Campbell</name>
</author>
<author>
<name sortKey="Kirshtein, J D" uniqKey="Kirshtein J">J.D. Kirshtein</name>
</author>
<author>
<name sortKey="Meneghin, J" uniqKey="Meneghin J">J. Meneghin</name>
</author>
<author>
<name sortKey="Podar, M" uniqKey="Podar M">M. Podar</name>
</author>
<author>
<name sortKey="Steinberg, J I" uniqKey="Steinberg J">J.I. Steinberg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hou, W" uniqKey="Hou W">W. Hou</name>
</author>
<author>
<name sortKey="Wang, S" uniqKey="Wang S">S. Wang</name>
</author>
<author>
<name sortKey="Dong, H" uniqKey="Dong H">H. Dong</name>
</author>
<author>
<name sortKey="Jiang, H" uniqKey="Jiang H">H. Jiang</name>
</author>
<author>
<name sortKey="Briggs, B R" uniqKey="Briggs B">B.R. Briggs</name>
</author>
<author>
<name sortKey="Peacock, J P" uniqKey="Peacock J">J.P. Peacock</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lanzen, A" uniqKey="Lanzen A">A. Lanzén</name>
</author>
<author>
<name sortKey="J Rgensen, S L" uniqKey="J Rgensen S">S.L. Jørgensen</name>
</author>
<author>
<name sortKey="Bengtsson, M M" uniqKey="Bengtsson M">M.M. Bengtsson</name>
</author>
<author>
<name sortKey="Jonassen, I" uniqKey="Jonassen I">I. Jonassen</name>
</author>
<author>
<name sortKey=" Vre S, L" uniqKey=" Vre S L">L. Øvreås</name>
</author>
<author>
<name sortKey="Urich, T" uniqKey="Urich T">T. Urich</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rogers, A D" uniqKey="Rogers A">A.D. Rogers</name>
</author>
<author>
<name sortKey="Tyler, P A" uniqKey="Tyler P">P.A. Tyler</name>
</author>
<author>
<name sortKey="Connelly, D P" uniqKey="Connelly D">D.P. Connelly</name>
</author>
<author>
<name sortKey="Copley, J T" uniqKey="Copley J">J.T. Copley</name>
</author>
<author>
<name sortKey="James, R" uniqKey="James R">R. James</name>
</author>
<author>
<name sortKey="Larter, R D" uniqKey="Larter R">R.D. Larter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sylvan, J B" uniqKey="Sylvan J">J.B. Sylvan</name>
</author>
<author>
<name sortKey="Toner, B M" uniqKey="Toner B">B.M. Toner</name>
</author>
<author>
<name sortKey="Edwards, K J" uniqKey="Edwards K">K.J. Edwards</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Voordeckers, J" uniqKey="Voordeckers J">J. Voordeckers</name>
</author>
<author>
<name sortKey="Do, M" uniqKey="Do M">M. Do</name>
</author>
<author>
<name sortKey="Hugler, M" uniqKey="Hugler M">M. Hügler</name>
</author>
<author>
<name sortKey="Ko, V" uniqKey="Ko V">V. Ko</name>
</author>
<author>
<name sortKey="Sievert, S" uniqKey="Sievert S">S. Sievert</name>
</author>
<author>
<name sortKey="Vetriani, C" uniqKey="Vetriani C">C. Vetriani</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, S" uniqKey="Wang S">S. Wang</name>
</author>
<author>
<name sortKey="Xiao, X" uniqKey="Xiao X">X. Xiao</name>
</author>
<author>
<name sortKey="Jiang, L" uniqKey="Jiang L">L. Jiang</name>
</author>
<author>
<name sortKey="Peng, X" uniqKey="Peng X">X. Peng</name>
</author>
<author>
<name sortKey="Zhou, H" uniqKey="Zhou H">H. Zhou</name>
</author>
<author>
<name sortKey="Meng, J" uniqKey="Meng J">J. Meng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yanagawa, K" uniqKey="Yanagawa K">K. Yanagawa</name>
</author>
<author>
<name sortKey="Kouduka, M" uniqKey="Kouduka M">M. Kouduka</name>
</author>
<author>
<name sortKey="Nakamura, Y" uniqKey="Nakamura Y">Y. Nakamura</name>
</author>
<author>
<name sortKey="Hachikubo, A" uniqKey="Hachikubo A">A. Hachikubo</name>
</author>
<author>
<name sortKey="Tomaru, H" uniqKey="Tomaru H">H. Tomaru</name>
</author>
<author>
<name sortKey="Suzuki, Y" uniqKey="Suzuki Y">Y. Suzuki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhou, H" uniqKey="Zhou H">H. Zhou</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J. Li</name>
</author>
<author>
<name sortKey="Peng, X" uniqKey="Peng X">X. Peng</name>
</author>
<author>
<name sortKey="Meng, J" uniqKey="Meng J">J. Meng</name>
</author>
<author>
<name sortKey="Wang, F" uniqKey="Wang F">F. Wang</name>
</author>
<author>
<name sortKey="Ai, Y" uniqKey="Ai Y">Y. Ai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shivaji, S" uniqKey="Shivaji S">S. Shivaji</name>
</author>
<author>
<name sortKey="Kumari, K" uniqKey="Kumari K">K. Kumari</name>
</author>
<author>
<name sortKey="Kishore, K H" uniqKey="Kishore K">K.H. Kishore</name>
</author>
<author>
<name sortKey="Pindi, P K" uniqKey="Pindi P">P.K. Pindi</name>
</author>
<author>
<name sortKey="Rao, P S" uniqKey="Rao P">P.S. Rao</name>
</author>
<author>
<name sortKey="Radha Srinivas, T N" uniqKey="Radha Srinivas T">T.N. Radha Srinivas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mikucki, J A" uniqKey="Mikucki J">J.A. Mikucki</name>
</author>
<author>
<name sortKey="Priscu, J C" uniqKey="Priscu J">J.C. Priscu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tang, C" uniqKey="Tang C">C. Tang</name>
</author>
<author>
<name sortKey="Madigan, M T" uniqKey="Madigan M">M.T. Madigan</name>
</author>
<author>
<name sortKey="Lanoil, B" uniqKey="Lanoil B">B. Lanoil</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="M Ller, A K" uniqKey="M Ller A">A.K. Møller</name>
</author>
<author>
<name sortKey="S Borg, D A" uniqKey="S Borg D">D.A. Søborg</name>
</author>
<author>
<name sortKey="Al Soud, W A" uniqKey="Al Soud W">W.A. Al-Soud</name>
</author>
<author>
<name sortKey="S Rensen, S J" uniqKey="S Rensen S">S.J. Sørensen</name>
</author>
<author>
<name sortKey="Kroer, N" uniqKey="Kroer N">N. Kroer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Murray, A E" uniqKey="Murray A">A.E. Murray</name>
</author>
<author>
<name sortKey="Kenig, F" uniqKey="Kenig F">F. Kenig</name>
</author>
<author>
<name sortKey="Fritsen, C H" uniqKey="Fritsen C">C.H. Fritsen</name>
</author>
<author>
<name sortKey="Mckay, C P" uniqKey="Mckay C">C.P. McKay</name>
</author>
<author>
<name sortKey="Cawley, K M" uniqKey="Cawley K">K.M. Cawley</name>
</author>
<author>
<name sortKey="Edwards, R" uniqKey="Edwards R">R. Edwards</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nakai, R" uniqKey="Nakai R">R. Nakai</name>
</author>
<author>
<name sortKey="Abe, T" uniqKey="Abe T">T. Abe</name>
</author>
<author>
<name sortKey="Baba, T" uniqKey="Baba T">T. Baba</name>
</author>
<author>
<name sortKey="Imura, S" uniqKey="Imura S">S. Imura</name>
</author>
<author>
<name sortKey="Kagoshima, H" uniqKey="Kagoshima H">H. Kagoshima</name>
</author>
<author>
<name sortKey="Kanda, H" uniqKey="Kanda H">H. Kanda</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Frank Fahle, B A" uniqKey="Frank Fahle B">B.A. Frank-Fahle</name>
</author>
<author>
<name sortKey="Yergeau, E" uniqKey="Yergeau E">É. Yergeau</name>
</author>
<author>
<name sortKey="Greer, C W" uniqKey="Greer C">C.W. Greer</name>
</author>
<author>
<name sortKey="Lantuit, H" uniqKey="Lantuit H">H. Lantuit</name>
</author>
<author>
<name sortKey="Wagner, D" uniqKey="Wagner D">D. Wagner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ganzert, L" uniqKey="Ganzert L">L. Ganzert</name>
</author>
<author>
<name sortKey="Lipski, A" uniqKey="Lipski A">A. Lipski</name>
</author>
<author>
<name sortKey="Hubberten, H W" uniqKey="Hubberten H">H.-W. Hubberten</name>
</author>
<author>
<name sortKey="Wagner, D" uniqKey="Wagner D">D. Wagner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Niederberger, T D" uniqKey="Niederberger T">T.D. Niederberger</name>
</author>
<author>
<name sortKey="Mcdonald, I R" uniqKey="Mcdonald I">I.R. McDonald</name>
</author>
<author>
<name sortKey="Hacker, A L" uniqKey="Hacker A">A.L. Hacker</name>
</author>
<author>
<name sortKey="Soo, R M" uniqKey="Soo R">R.M. Soo</name>
</author>
<author>
<name sortKey="Barrett, J E" uniqKey="Barrett J">J.E. Barrett</name>
</author>
<author>
<name sortKey="Wall, D H" uniqKey="Wall D">D.H. Wall</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cary, S C" uniqKey="Cary S">S.C. Cary</name>
</author>
<author>
<name sortKey="Mcdonald, I R" uniqKey="Mcdonald I">I.R. McDonald</name>
</author>
<author>
<name sortKey="Barrett, J E" uniqKey="Barrett J">J.E. Barrett</name>
</author>
<author>
<name sortKey="Cowan, D A" uniqKey="Cowan D">D.A. Cowan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Aislabie, J M" uniqKey="Aislabie J">J.M. Aislabie</name>
</author>
<author>
<name sortKey="Jordan, S" uniqKey="Jordan S">S. Jordan</name>
</author>
<author>
<name sortKey="Barker, G M" uniqKey="Barker G">G.M. Barker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="De La Torre, J R" uniqKey="De La Torre J">J.R. de la Torre</name>
</author>
<author>
<name sortKey="Goebel, B M" uniqKey="Goebel B">B.M. Goebel</name>
</author>
<author>
<name sortKey="Friedmann, E I" uniqKey="Friedmann E">E.I. Friedmann</name>
</author>
<author>
<name sortKey="Pace, N R" uniqKey="Pace N">N.R. Pace</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bajerski, F" uniqKey="Bajerski F">F. Bajerski</name>
</author>
<author>
<name sortKey="Wagner, D" uniqKey="Wagner D">D. Wagner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yergeau, E" uniqKey="Yergeau E">E. Yergeau</name>
</author>
<author>
<name sortKey="Newsham, K K" uniqKey="Newsham K">K.K. Newsham</name>
</author>
<author>
<name sortKey="Pearce, D A" uniqKey="Pearce D">D.A. Pearce</name>
</author>
<author>
<name sortKey="Kowalchuk, G A" uniqKey="Kowalchuk G">G.A. Kowalchuk</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mcdonald, D" uniqKey="Mcdonald D">D. McDonald</name>
</author>
<author>
<name sortKey="Price, M N" uniqKey="Price M">M.N. Price</name>
</author>
<author>
<name sortKey="Goodrich, J" uniqKey="Goodrich J">J. Goodrich</name>
</author>
<author>
<name sortKey="Nawrocki, E P" uniqKey="Nawrocki E">E.P. Nawrocki</name>
</author>
<author>
<name sortKey="Desantis, T Z" uniqKey="Desantis T">T.Z. DeSantis</name>
</author>
<author>
<name sortKey="Probst, A" uniqKey="Probst A">A. Probst</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Leinonen, R" uniqKey="Leinonen R">R. Leinonen</name>
</author>
<author>
<name sortKey="Akhtar, R" uniqKey="Akhtar R">R. Akhtar</name>
</author>
<author>
<name sortKey="Birney, E" uniqKey="Birney E">E. Birney</name>
</author>
<author>
<name sortKey="Bower, L" uniqKey="Bower L">L. Bower</name>
</author>
<author>
<name sortKey="Cerdeno Tarraga, A" uniqKey="Cerdeno Tarraga A">A. Cerdeno-Tárraga</name>
</author>
<author>
<name sortKey="Cheng, Y" uniqKey="Cheng Y">Y. Cheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sun, S" uniqKey="Sun S">S. Sun</name>
</author>
<author>
<name sortKey="Chen, J" uniqKey="Chen J">J. Chen</name>
</author>
<author>
<name sortKey="Li, W" uniqKey="Li W">W. Li</name>
</author>
<author>
<name sortKey="Altintas, I" uniqKey="Altintas I">I. Altintas</name>
</author>
<author>
<name sortKey="Lin, A" uniqKey="Lin A">A. Lin</name>
</author>
<author>
<name sortKey="Peltier, S" uniqKey="Peltier S">S. Peltier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Meyer, F" uniqKey="Meyer F">F. Meyer</name>
</author>
<author>
<name sortKey="Paarmann, D" uniqKey="Paarmann D">D. Paarmann</name>
</author>
<author>
<name sortKey="D Ouza, M" uniqKey="D Ouza M">M. D’Souza</name>
</author>
<author>
<name sortKey="Olson, R" uniqKey="Olson R">R. Olson</name>
</author>
<author>
<name sortKey="Glass, E M" uniqKey="Glass E">E.M. Glass</name>
</author>
<author>
<name sortKey="Kubal, M" uniqKey="Kubal M">M. Kubal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bunge, J" uniqKey="Bunge J">J. Bunge</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Behnke, A" uniqKey="Behnke A">A. Behnke</name>
</author>
<author>
<name sortKey="Bunge, J" uniqKey="Bunge J">J. Bunge</name>
</author>
<author>
<name sortKey="Barger, K" uniqKey="Barger K">K. Barger</name>
</author>
<author>
<name sortKey="Breiner, H W" uniqKey="Breiner H">H.W. Breiner</name>
</author>
<author>
<name sortKey="Alla, V" uniqKey="Alla V">V. Alla</name>
</author>
<author>
<name sortKey="Stoeck, T" uniqKey="Stoeck T">T. Stoeck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hong, S H" uniqKey="Hong S">S.-H. Hong</name>
</author>
<author>
<name sortKey="Bunge, J" uniqKey="Bunge J">J. Bunge</name>
</author>
<author>
<name sortKey="Jeon, S O" uniqKey="Jeon S">S.-O. Jeon</name>
</author>
<author>
<name sortKey="Epstein, S S" uniqKey="Epstein S">S.S. Epstein</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stoeck, T" uniqKey="Stoeck T">T. Stoeck</name>
</author>
<author>
<name sortKey="Kasper, J" uniqKey="Kasper J">J. Kasper</name>
</author>
<author>
<name sortKey="Bunge, J" uniqKey="Bunge J">J. Bunge</name>
</author>
<author>
<name sortKey="Leslin, C" uniqKey="Leslin C">C. Leslin</name>
</author>
<author>
<name sortKey="Ilyin, V" uniqKey="Ilyin V">V. Ilyin</name>
</author>
<author>
<name sortKey="Epstein, S" uniqKey="Epstein S">S. Epstein</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zuendorf, A" uniqKey="Zuendorf A">A. Zuendorf</name>
</author>
<author>
<name sortKey="Bunge, J" uniqKey="Bunge J">J. Bunge</name>
</author>
<author>
<name sortKey="Behnke, A" uniqKey="Behnke A">A. Behnke</name>
</author>
<author>
<name sortKey="Barger, K J A" uniqKey="Barger K">K.J.A. Barger</name>
</author>
<author>
<name sortKey="Stoeck, T" uniqKey="Stoeck T">T. Stoeck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bartram, A K" uniqKey="Bartram A">A.K. Bartram</name>
</author>
<author>
<name sortKey="Lynch, M D J" uniqKey="Lynch M">M.D.J. Lynch</name>
</author>
<author>
<name sortKey="Stearns, J C" uniqKey="Stearns J">J.C. Stearns</name>
</author>
<author>
<name sortKey="Moreno Hagelsieb, G" uniqKey="Moreno Hagelsieb G">G. Moreno-Hagelsieb</name>
</author>
<author>
<name sortKey="Neufeld, J D" uniqKey="Neufeld J">J.D. Neufeld</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Youssef, N H" uniqKey="Youssef N">N.H. Youssef</name>
</author>
<author>
<name sortKey="Couger, M B" uniqKey="Couger M">M.B. Couger</name>
</author>
<author>
<name sortKey="Elshahed, M S" uniqKey="Elshahed M">M.S. Elshahed</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lauber, C L" uniqKey="Lauber C">C.L. Lauber</name>
</author>
<author>
<name sortKey="Hamady, M" uniqKey="Hamady M">M. Hamady</name>
</author>
<author>
<name sortKey="Knight, R" uniqKey="Knight R">R. Knight</name>
</author>
<author>
<name sortKey="Fierer, N" uniqKey="Fierer N">N. Fierer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Webster, N S" uniqKey="Webster N">N.S. Webster</name>
</author>
<author>
<name sortKey="Taylor, M W" uniqKey="Taylor M">M.W. Taylor</name>
</author>
<author>
<name sortKey="Behnam, F" uniqKey="Behnam F">F. Behnam</name>
</author>
<author>
<name sortKey="Lucker, S" uniqKey="Lucker S">S. Lucker</name>
</author>
<author>
<name sortKey="Rattei, T" uniqKey="Rattei T">T. Rattei</name>
</author>
<author>
<name sortKey="Whalan, S" uniqKey="Whalan S">S. Whalan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hollister, E B" uniqKey="Hollister E">E.B. Hollister</name>
</author>
<author>
<name sortKey="Engledow, A S" uniqKey="Engledow A">A.S. Engledow</name>
</author>
<author>
<name sortKey="Hammett, A J M" uniqKey="Hammett A">A.J.M. Hammett</name>
</author>
<author>
<name sortKey="Provin, T L" uniqKey="Provin T">T.L. Provin</name>
</author>
<author>
<name sortKey="Wilkinson, H H" uniqKey="Wilkinson H">H.H. Wilkinson</name>
</author>
<author>
<name sortKey="Gentry, T J" uniqKey="Gentry T">T.J. Gentry</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schutte, U M E" uniqKey="Schutte U">U.M.E. SchÜtte</name>
</author>
<author>
<name sortKey="Abdo, Z" uniqKey="Abdo Z">Z. Abdo</name>
</author>
<author>
<name sortKey="Foster, J" uniqKey="Foster J">J. Foster</name>
</author>
<author>
<name sortKey="Ravel, J" uniqKey="Ravel J">J. Ravel</name>
</author>
<author>
<name sortKey="Bunge, J" uniqKey="Bunge J">J. Bunge</name>
</author>
<author>
<name sortKey="Solheim, B" uniqKey="Solheim B">B. Solheim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Elshahed, M S" uniqKey="Elshahed M">M.S. Elshahed</name>
</author>
<author>
<name sortKey="Youssef, N H" uniqKey="Youssef N">N.H. Youssef</name>
</author>
<author>
<name sortKey="Spain, A M" uniqKey="Spain A">A.M. Spain</name>
</author>
<author>
<name sortKey="Sheik, C" uniqKey="Sheik C">C. Sheik</name>
</author>
<author>
<name sortKey="Najar, F Z" uniqKey="Najar F">F.Z. Najar</name>
</author>
<author>
<name sortKey="Sukharnikov, L O" uniqKey="Sukharnikov L">L.O. Sukharnikov</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kirk Harris, J" uniqKey="Kirk Harris J">J. Kirk Harris</name>
</author>
<author>
<name sortKey="Gregory Caporaso, J" uniqKey="Gregory Caporaso J">J. Gregory Caporaso</name>
</author>
<author>
<name sortKey="Walker, J J" uniqKey="Walker J">J.J. Walker</name>
</author>
<author>
<name sortKey="Spear, J R" uniqKey="Spear J">J.R. Spear</name>
</author>
<author>
<name sortKey="Gold, N J" uniqKey="Gold N">N.J. Gold</name>
</author>
<author>
<name sortKey="Robertson, C E" uniqKey="Robertson C">C.E. Robertson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kelly, J" uniqKey="Kelly J">J. Kelly</name>
</author>
<author>
<name sortKey="Peterson, E" uniqKey="Peterson E">E. Peterson</name>
</author>
<author>
<name sortKey="Winkelman, J" uniqKey="Winkelman J">J. Winkelman</name>
</author>
<author>
<name sortKey="Walter, T" uniqKey="Walter T">T. Walter</name>
</author>
<author>
<name sortKey="Rier, S" uniqKey="Rier S">S. Rier</name>
</author>
<author>
<name sortKey="Tuchman, N" uniqKey="Tuchman N">N. Tuchman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Borrel, G" uniqKey="Borrel G">G. Borrel</name>
</author>
<author>
<name sortKey="Lehours, A C" uniqKey="Lehours A">A.C. Lehours</name>
</author>
<author>
<name sortKey="Bardot, C" uniqKey="Bardot C">C. Bardot</name>
</author>
<author>
<name sortKey="Bailly, X" uniqKey="Bailly X">X. Bailly</name>
</author>
<author>
<name sortKey="Fonty, G" uniqKey="Fonty G">G. Fonty</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Youssef, N" uniqKey="Youssef N">N. Youssef</name>
</author>
<author>
<name sortKey="Steidley, B L" uniqKey="Steidley B">B.L. Steidley</name>
</author>
<author>
<name sortKey="Elshahed, M S" uniqKey="Elshahed M">M.S. Elshahed</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lynch, M D J" uniqKey="Lynch M">M.D.J. Lynch</name>
</author>
<author>
<name sortKey="Bartram, A K" uniqKey="Bartram A">A.K. Bartram</name>
</author>
<author>
<name sortKey="Neufeld, J D" uniqKey="Neufeld J">J.D. Neufeld</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stein, J L" uniqKey="Stein J">J.L. Stein</name>
</author>
<author>
<name sortKey="Marsh, T L" uniqKey="Marsh T">T.L. Marsh</name>
</author>
<author>
<name sortKey="Wu, K Y" uniqKey="Wu K">K.Y. Wu</name>
</author>
<author>
<name sortKey="Shizuya, H" uniqKey="Shizuya H">H. Shizuya</name>
</author>
<author>
<name sortKey="Delong, E F" uniqKey="Delong E">E.F. DeLong</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tyson, G W" uniqKey="Tyson G">G.W. Tyson</name>
</author>
<author>
<name sortKey="Chapman, J" uniqKey="Chapman J">J. Chapman</name>
</author>
<author>
<name sortKey="Hugenholtz, P" uniqKey="Hugenholtz P">P. Hugenholtz</name>
</author>
<author>
<name sortKey="Allen, E E" uniqKey="Allen E">E.E. Allen</name>
</author>
<author>
<name sortKey="Ram, R J" uniqKey="Ram R">R.J. Ram</name>
</author>
<author>
<name sortKey="Richardson, P M" uniqKey="Richardson P">P.M. Richardson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Isenbarger, T A" uniqKey="Isenbarger T">T.A. Isenbarger</name>
</author>
<author>
<name sortKey="Finney, M" uniqKey="Finney M">M. Finney</name>
</author>
<author>
<name sortKey="Rios Velazquez, C" uniqKey="Rios Velazquez C">C. Rios-Velazquez</name>
</author>
<author>
<name sortKey="Handelsman, J" uniqKey="Handelsman J">J. Handelsman</name>
</author>
<author>
<name sortKey="Ruvkun, G" uniqKey="Ruvkun G">G. Ruvkun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ettwig, K F" uniqKey="Ettwig K">K.F. Ettwig</name>
</author>
<author>
<name sortKey="Van Alen, T" uniqKey="Van Alen T">T. van Alen</name>
</author>
<author>
<name sortKey="Van De Pas Schoonen, K T" uniqKey="Van De Pas Schoonen K">K.T. van de Pas-Schoonen</name>
</author>
<author>
<name sortKey="Jetten, M S" uniqKey="Jetten M">M.S. Jetten</name>
</author>
<author>
<name sortKey="Strous, M" uniqKey="Strous M">M. Strous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Castelle, C J" uniqKey="Castelle C">C.J. Castelle</name>
</author>
<author>
<name sortKey="Hug, L A" uniqKey="Hug L">L.A. Hug</name>
</author>
<author>
<name sortKey="Wrighton, K C" uniqKey="Wrighton K">K.C. Wrighton</name>
</author>
<author>
<name sortKey="Thomas, B C" uniqKey="Thomas B">B.C. Thomas</name>
</author>
<author>
<name sortKey="Williams, K H" uniqKey="Williams K">K.H. Williams</name>
</author>
<author>
<name sortKey="Wu, D" uniqKey="Wu D">D. Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Di Rienzi, S C" uniqKey="Di Rienzi S">S.C. Di Rienzi</name>
</author>
<author>
<name sortKey="Sharon, I" uniqKey="Sharon I">I. Sharon</name>
</author>
<author>
<name sortKey="Wrighton, K C" uniqKey="Wrighton K">K.C. Wrighton</name>
</author>
<author>
<name sortKey="Koren, O" uniqKey="Koren O">O. Koren</name>
</author>
<author>
<name sortKey="Hug, L A" uniqKey="Hug L">L.A. Hug</name>
</author>
<author>
<name sortKey="Thomas, B C" uniqKey="Thomas B">B.C. Thomas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hug, L" uniqKey="Hug L">L. Hug</name>
</author>
<author>
<name sortKey="Castelle, C" uniqKey="Castelle C">C. Castelle</name>
</author>
<author>
<name sortKey="Wrighton, K" uniqKey="Wrighton K">K. Wrighton</name>
</author>
<author>
<name sortKey="Thomas, B" uniqKey="Thomas B">B. Thomas</name>
</author>
<author>
<name sortKey="Sharon, I" uniqKey="Sharon I">I. Sharon</name>
</author>
<author>
<name sortKey="Frischkorn, K" uniqKey="Frischkorn K">K. Frischkorn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kantor, R S" uniqKey="Kantor R">R.S. Kantor</name>
</author>
<author>
<name sortKey="Wrighton, K C" uniqKey="Wrighton K">K.C. Wrighton</name>
</author>
<author>
<name sortKey="Handley, K M" uniqKey="Handley K">K.M. Handley</name>
</author>
<author>
<name sortKey="Sharon, I" uniqKey="Sharon I">I. Sharon</name>
</author>
<author>
<name sortKey="Hug, L A" uniqKey="Hug L">L.A. Hug</name>
</author>
<author>
<name sortKey="Castelle, C J" uniqKey="Castelle C">C.J. Castelle</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sharon, I" uniqKey="Sharon I">I. Sharon</name>
</author>
<author>
<name sortKey="Morowitz, M J" uniqKey="Morowitz M">M.J. Morowitz</name>
</author>
<author>
<name sortKey="Thomas, B C" uniqKey="Thomas B">B.C. Thomas</name>
</author>
<author>
<name sortKey="Costello, E K" uniqKey="Costello E">E.K. Costello</name>
</author>
<author>
<name sortKey="Relman, D A" uniqKey="Relman D">D.A. Relman</name>
</author>
<author>
<name sortKey="Banfield, J F" uniqKey="Banfield J">J.F. Banfield</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rinke, C" uniqKey="Rinke C">C. Rinke</name>
</author>
<author>
<name sortKey="Schwientek, P" uniqKey="Schwientek P">P. Schwientek</name>
</author>
<author>
<name sortKey="Sczyrba, A" uniqKey="Sczyrba A">A. Sczyrba</name>
</author>
<author>
<name sortKey="Ivanova, N N" uniqKey="Ivanova N">N.N. Ivanova</name>
</author>
<author>
<name sortKey="Anderson, I J" uniqKey="Anderson I">I.J. Anderson</name>
</author>
<author>
<name sortKey="Cheng, J F" uniqKey="Cheng J">J.F. Cheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Youssef, N H" uniqKey="Youssef N">N.H. Youssef</name>
</author>
<author>
<name sortKey="Rinke, C" uniqKey="Rinke C">C. Rinke</name>
</author>
<author>
<name sortKey="Stepanauskas, R" uniqKey="Stepanauskas R">R. Stepanauskas</name>
</author>
<author>
<name sortKey="Farag, I" uniqKey="Farag I">I. Farag</name>
</author>
<author>
<name sortKey="Woyke, T" uniqKey="Woyke T">T. Woyke</name>
</author>
<author>
<name sortKey="Elshahed, M S" uniqKey="Elshahed M">M.S. Elshahed</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stamatakis, A" uniqKey="Stamatakis A">A. Stamatakis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hall, B G" uniqKey="Hall B">B.G. Hall</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ludwig, W" uniqKey="Ludwig W">W. Ludwig</name>
</author>
<author>
<name sortKey="Strunk, O" uniqKey="Strunk O">O. Strunk</name>
</author>
<author>
<name sortKey="Westram, R" uniqKey="Westram R">R. Westram</name>
</author>
<author>
<name sortKey="Richter, L" uniqKey="Richter L">L. Richter</name>
</author>
<author>
<name sortKey="Meier, H" uniqKey="Meier H">H. Meier</name>
</author>
<author>
<name sortKey="Yadhukumar" uniqKey="Yadhukumar">Yadhukumar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baker, G C" uniqKey="Baker G">G.C. Baker</name>
</author>
<author>
<name sortKey="Smith, J J" uniqKey="Smith J">J.J. Smith</name>
</author>
<author>
<name sortKey="Cowan, D A" uniqKey="Cowan D">D.A. Cowan</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="review-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">J Adv Res</journal-id>
<journal-id journal-id-type="iso-abbrev">J Adv Res</journal-id>
<journal-title-group>
<journal-title>Journal of Advanced Research</journal-title>
</journal-title-group>
<issn pub-type="ppub">2090-1232</issn>
<issn pub-type="epub">2090-1224</issn>
<publisher>
<publisher-name>Elsevier</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">26257925</article-id>
<article-id pub-id-type="pmc">4522544</article-id>
<article-id pub-id-type="publisher-id">S2090-1232(14)00128-3</article-id>
<article-id pub-id-type="doi">10.1016/j.jare.2014.10.005</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Review</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Assessing the global phylum level diversity within the bacterial domain: A review</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Youssef</surname>
<given-names>Noha H.</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Couger</surname>
<given-names>M.B.</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>McCully</surname>
<given-names>Alexandra L.</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Criado</surname>
<given-names>Andrés Eduardo Guerrero</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Elshahed</surname>
<given-names>Mostafa S.</given-names>
</name>
<email>Mostafa@okstate.edu</email>
<xref rid="cor1" ref-type="corresp"></xref>
</contrib>
</contrib-group>
<aff id="af005">Department of Microbiology and Molecular Genetics, Oklahoma State University, Stillwater, OK, USA</aff>
<author-notes>
<corresp id="cor1">
<label></label>
Corresponding author. Tel.: +1 (405) 744 1192; fax: +1 (405) 744 1112.
<email>Mostafa@okstate.edu</email>
</corresp>
</author-notes>
<pub-date pub-type="pmc-release">
<day>04</day>
<month>11</month>
<year>2014</year>
</pub-date>
<pmc-comment> PMC Release delay is 0 months and 0 days and was based on .</pmc-comment>
<pub-date pub-type="ppub">
<month>5</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="epub">
<day>04</day>
<month>11</month>
<year>2014</year>
</pub-date>
<volume>6</volume>
<issue>3</issue>
<fpage>269</fpage>
<lpage>282</lpage>
<history>
<date date-type="received">
<day>21</day>
<month>8</month>
<year>2014</year>
</date>
<date date-type="rev-recd">
<day>6</day>
<month>10</month>
<year>2014</year>
</date>
<date date-type="accepted">
<day>23</day>
<month>10</month>
<year>2014</year>
</date>
</history>
<permissions>
<copyright-statement>© 2014 Production and hosting by Elsevier B.V. on behalf of Cairo University.</copyright-statement>
<copyright-year>2014</copyright-year>
<copyright-holder></copyright-holder>
<license license-type="CC BY-NC-ND" xlink:href="http://creativecommons.org/licenses/by-nc-nd/3.0/">
<license-p>This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).</license-p>
</license>
</permissions>
<abstract abstract-type="graphical">
<title>Graphical abstract</title>
<fig id="f0035" position="anchor">
<graphic xlink:href="fx2"></graphic>
</fig>
</abstract>
<abstract>
<p>Microbial ecology is the study of microbes in the natural environment and their interactions with each other. Investigating the nature of microorganisms residing within a specific habitat is an extremely important component of microbial ecology. Such microbial diversity surveys aim to determine the identity, physiological preferences, metabolic capabilities, and genomic features of microbial taxa within a specific ecosystem. A comprehensive review of various aspects of microbial diversity (phylogenetic, functional, and genomic diversities) in the microbial (bacterial, archaeal, and microeukaryotic) world is clearly a daunting task that could not be aptly summarized in a single review. Here, we focus on one aspect of diversity (phylogenetic diversity) in one microbial domain (the Bacteria). We restrict our analysis to the highest taxonomic rank (phylum) and attempt to investigate the extent of global phylum level diversity within the Bacteria. We present a brief historical perspective on the subject and highlight how the adaptation of molecular biological and phylogenetic approaches has greatly expanded our view of global bacterial diversity. We also summarize recent progress toward the discovery of novel bacterial phyla, present evidences that the scope of phylum level diversity in nature has hardly been exhausted, and propose novel approaches that could greatly facilitate the discovery process of novel bacterial phyla within various ecosystems.</p>
</abstract>
<kwd-group>
<title>Keywords</title>
<kwd>Phylogenetic diversity</kwd>
<kwd>Candidate phyla</kwd>
<kwd>16S rRNA gene</kwd>
<kwd>Culture-independant diversité surveys</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="f0005">
<label>Fig. 1</label>
<caption>
<p>Phylogenetic tree depicting the twelve “original” bacterial phyla proposed by Carl Woese in his seminal review on bacterial evolution. Adapted from Ref.
<xref rid="b0045" ref-type="bibr">[9]</xref>
. These phyla are Thermotogae, Chloroflexi (Green non-sulfur Bacteria), Deinococcus, Spirochaetes, Chlorobia (Green sulfur bacteria), Bacteroidetes, Planctomycetes, Chlamydia, Cyanobacteria, Gram-positive Bacteria (comprising the high GC Actinobacteria, and the low GC Firmicutes), Proteobacteria (Purple bacteria).</p>
</caption>
<graphic xlink:href="gr1"></graphic>
</fig>
<fig id="f0010">
<label>Fig. 2</label>
<caption>
<p>Flowchart depicting the “16S rRNA analysis” protocol. The protocol starts by DNA extraction, followed by amplifying the small subunit rRNA gene using universal or domain-specific primers. PCR products are then cloned and sequenced. Obtained small subunit rRNA gene sequences are then analyzed, binned into operational taxonomic units (OTUs), and used for phylogenetic inferences.</p>
</caption>
<graphic xlink:href="gr2"></graphic>
</fig>
<fig id="f0015">
<label>Fig. 3</label>
<caption>
<p>Flowchart depicting a targeted approach developed for the identification of novel bacterial phyla within the rare biosphere. The approach combines the sequence read length and accuracy of the Sanger sequencing approach with the high throughput capability of next generation (Pyrosequencing or Illumina) sequencing approaches. Pyrosequencing or Illumina sequencing output are first used to identify potentially novel members within rare members of the community. The short sequences are then used to design custom primers. The newly designed primers are then used in conjunction with a forward, or reverse bacterial primer for amplification of near-complete 16S rRNA gene sequences. Obtained PCR products are cloned and Sanger-sequenced, and the sequences obtained are used for detailed phylogenetic inferences.</p>
</caption>
<graphic xlink:href="gr3"></graphic>
</fig>
<fig id="f0020">
<label>Fig. 4</label>
<caption>
<p>Secondary structure of regions (A) 8–27, and (B) 1492–1510 of the 16S rRNA molecule. Canonical base pairing (shown as lines) is targeted for designing degenerate primers such that a change in one base is associated with a complementary change in the pairing position. Noncanonical base pairings (A-A, C-C, G-G, C-A, U-G, G-A, U-U), and wobble base pairing (G-U), often a consequence of canonical pairings, are theoretically less necessary for maintaining ribosomal integrity, and so are not targeted for primer design. The sequences of all possible degenerate 27F and 1492R primers are shown in
<xref rid="t0015" ref-type="table">Table 3</xref>
.</p>
</caption>
<graphic xlink:href="gr4"></graphic>
</fig>
<fig id="f0025">
<label>Fig. 5</label>
<caption>
<p>Maximum likelihood dendogram based on the 16S rRNA gene sequences affiliated with representatives of the putatively novel phyla (PNP1-PNP8). Bootstrap values (in percentages) are based on 1000 replicates and are shown for branches with more than 50% bootstrap support. Sequences obtained from the ENA database (
<italic>n</italic>
 = 3,178,046) were classified in MOTHUR using classify.seqs command with the Greengenes taxonomy outline and Wang method. Sequences that failed to classify into a known phylum with at least 50% bootstrap support (
<italic>n</italic>
 = 664,621) were considered potentially novel and were subjected to extensive phylogenetic analysis using a combination of Mega
<xref rid="b0620" ref-type="bibr">[124]</xref>
, RaxML
<xref rid="b0615" ref-type="bibr">[123]</xref>
, and Arb
<xref rid="b0625" ref-type="bibr">[125]</xref>
. Seventy-nine sequences formed 8 independent, deep-branching, reproducibly monophyletic, bootstrap-supported clusters, upon applying various tree-building algorithms as well as upon varying the composition and size of the data set used for phylogenetic analysis. Representatives of these 8 novel phyla are shown in the tree along with their source.</p>
</caption>
<graphic xlink:href="gr5"></graphic>
</fig>
<table-wrap id="t0005" position="float">
<label>Table 1</label>
<caption>
<p>Bacteria phyla names according to Greengenes
<xref rid="b0455" ref-type="bibr">[91]</xref>
and SILVA
<xref rid="b0165" ref-type="bibr">[33]</xref>
databases (August 2014).
<xref rid="tblfn1" ref-type="table-fn">a</xref>
</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Greengenes</th>
<th>SILVA</th>
</tr>
</thead>
<tbody>
<tr>
<td>AC1</td>
<td></td>
</tr>
<tr>
<td>
<italic>Acidobacteria</italic>
</td>
<td>
<italic>Acidobacteria</italic>
</td>
</tr>
<tr>
<td>
<bold>Actinobacteria</bold>
</td>
<td>
<bold>Actinobacteria</bold>
</td>
</tr>
<tr>
<td>AD3</td>
<td></td>
</tr>
<tr>
<td>AncK6</td>
<td></td>
</tr>
<tr>
<td></td>
<td>aquifer1</td>
</tr>
<tr>
<td></td>
<td>aquifer2</td>
</tr>
<tr>
<td>
<italic>Aquificae</italic>
</td>
<td>
<italic>Aquificae</italic>
</td>
</tr>
<tr>
<td>
<italic>Armatimonadetes</italic>
</td>
<td>
<italic>Armatimonadetes</italic>
</td>
</tr>
<tr>
<td>
<bold>Bacteroidetes</bold>
</td>
<td>
<bold>Bacteroidetes</bold>
</td>
</tr>
<tr>
<td></td>
<td>BD1-5</td>
</tr>
<tr>
<td>BHI80-139</td>
<td>BHI80-139</td>
</tr>
<tr>
<td>BRC1</td>
<td>BRC1</td>
</tr>
<tr>
<td>
<italic>Caldiserica</italic>
</td>
<td>
<italic>Caldiserica</italic>
</td>
</tr>
<tr>
<td>
<italic>Caldithrix</italic>
</td>
<td></td>
</tr>
<tr>
<td>CD12</td>
<td></td>
</tr>
<tr>
<td>
<bold>Chlamydiae</bold>
</td>
<td>
<bold>Chlamydiae</bold>
</td>
</tr>
<tr>
<td>
<bold>Chlorobi</bold>
</td>
<td>
<bold>Chlorobi</bold>
</td>
</tr>
<tr>
<td>
<bold>Chloroflexi</bold>
</td>
<td>
<bold>Chloroflexi</bold>
</td>
</tr>
<tr>
<td>
<italic>Chrysiogenetes</italic>
</td>
<td>
<italic>Chrysiogenetes</italic>
</td>
</tr>
<tr>
<td></td>
<td>CKC4</td>
</tr>
<tr>
<td>
<bold>Cyanobacteria</bold>
</td>
<td>
<bold>Cyanobacteria</bold>
</td>
</tr>
<tr>
<td>
<italic>Deferribacteres</italic>
</td>
<td>
<italic>Deferribacteres</italic>
</td>
</tr>
<tr>
<td>
<bold>Thermi</bold>
</td>
<td>
<bold>Deinococcus-Thermus</bold>
</td>
</tr>
<tr>
<td>
<italic>Dictyoglomi</italic>
</td>
<td>
<italic>Dictyoglomi</italic>
</td>
</tr>
<tr>
<td>
<italic>Elusimicrobia</italic>
</td>
<td>
<italic>Elusimicrobia</italic>
</td>
</tr>
<tr>
<td>EM3</td>
<td></td>
</tr>
<tr>
<td>EM19</td>
<td></td>
</tr>
<tr>
<td>FBP</td>
<td></td>
</tr>
<tr>
<td>FCPU426</td>
<td></td>
</tr>
<tr>
<td>
<italic>Fibrobacteres</italic>
</td>
<td>
<italic>Fibrobacteres</italic>
</td>
</tr>
<tr>
<td>
<bold>Firmicutes</bold>
</td>
<td>
<bold>Firmicutes</bold>
</td>
</tr>
<tr>
<td>
<italic>Fusobacteria</italic>
</td>
<td>
<italic>Fusobacteria</italic>
</td>
</tr>
<tr>
<td></td>
<td>GAL08</td>
</tr>
<tr>
<td>GAL15</td>
<td></td>
</tr>
<tr>
<td>
<italic>Gemmatimonadetes</italic>
</td>
<td>
<italic>Gemmatimonadetes</italic>
</td>
</tr>
<tr>
<td>GN01</td>
<td></td>
</tr>
<tr>
<td>GN02</td>
<td></td>
</tr>
<tr>
<td>GN04</td>
<td></td>
</tr>
<tr>
<td>GOUTA4</td>
<td>GOUTA4</td>
</tr>
<tr>
<td>H-178</td>
<td></td>
</tr>
<tr>
<td>Hyd24-12</td>
<td>Hyd24-12</td>
</tr>
<tr>
<td>Kazan-3B-28</td>
<td></td>
</tr>
<tr>
<td></td>
<td>KB1</td>
</tr>
<tr>
<td>KSB3</td>
<td></td>
</tr>
<tr>
<td>LCP-89</td>
<td></td>
</tr>
<tr>
<td></td>
<td>JL-ETNP-Z39</td>
</tr>
<tr>
<td></td>
<td>JS1</td>
</tr>
<tr>
<td>LD1</td>
<td>LD1-PA38</td>
</tr>
<tr>
<td>
<italic>Lentisphaerae</italic>
</td>
<td>
<italic>Lentisphaerae</italic>
</td>
</tr>
<tr>
<td>MAT-CR-M4-B07</td>
<td></td>
</tr>
<tr>
<td>MVP-21</td>
<td></td>
</tr>
<tr>
<td>MVS-104</td>
<td></td>
</tr>
<tr>
<td>NC10</td>
<td></td>
</tr>
<tr>
<td>
<italic>Nitrospirae</italic>
</td>
<td>
<italic>Nitrospirae</italic>
</td>
</tr>
<tr>
<td>NKB19</td>
<td></td>
</tr>
<tr>
<td>NPL-UPA2</td>
<td>NPL-UPA2</td>
</tr>
<tr>
<td>OC31</td>
<td>OC31</td>
</tr>
<tr>
<td>OctSpA1-106</td>
<td></td>
</tr>
<tr>
<td>OD1</td>
<td>OD1</td>
</tr>
<tr>
<td>OP1</td>
<td></td>
</tr>
<tr>
<td>OP3</td>
<td>OP3</td>
</tr>
<tr>
<td>OP8</td>
<td>OP8</td>
</tr>
<tr>
<td>OP9</td>
<td>OP9</td>
</tr>
<tr>
<td>OP11</td>
<td>OP11</td>
</tr>
<tr>
<td>PAUC34f</td>
<td></td>
</tr>
<tr>
<td>
<bold>Planctomycetes</bold>
</td>
<td>
<bold>Planctomycetes</bold>
</td>
</tr>
<tr>
<td>Poribacteria</td>
<td></td>
</tr>
<tr>
<td>
<bold>Proteobacteria</bold>
</td>
<td>
<bold>Proteobacteria</bold>
</td>
</tr>
<tr>
<td></td>
<td>RsaHF231</td>
</tr>
<tr>
<td></td>
<td>S2R-29</td>
</tr>
<tr>
<td>SAR406</td>
<td></td>
</tr>
<tr>
<td>SBR1093</td>
<td></td>
</tr>
<tr>
<td></td>
<td>SBYG-2791</td>
</tr>
<tr>
<td>SC4</td>
<td></td>
</tr>
<tr>
<td></td>
<td>SHA-109</td>
</tr>
<tr>
<td></td>
<td>SM2F11</td>
</tr>
<tr>
<td>
<bold>Spirochaetes</bold>
</td>
<td>
<bold>Spirochaetae</bold>
</td>
</tr>
<tr>
<td>SR1</td>
<td>SR1</td>
</tr>
<tr>
<td>
<italic>Synergistetes</italic>
</td>
<td>
<italic>Synergistetes</italic>
</td>
</tr>
<tr>
<td>TA06</td>
<td>TA06</td>
</tr>
<tr>
<td>
<italic>Tenericutes</italic>
</td>
<td>
<italic>Tenericutes</italic>
</td>
</tr>
<tr>
<td></td>
<td>
<italic>Thermodesulfobacteria</italic>
</td>
</tr>
<tr>
<td>
<bold>Thermotogae</bold>
</td>
<td>
<bold>Thermotogae</bold>
</td>
</tr>
<tr>
<td>TM6</td>
<td>TM6</td>
</tr>
<tr>
<td>TM7</td>
<td>TM7</td>
</tr>
<tr>
<td>TPD-58</td>
<td></td>
</tr>
<tr>
<td>
<italic>Verrucomicrobia</italic>
</td>
<td>
<italic>Verrucomicrobia</italic>
</td>
</tr>
<tr>
<td>VHS-B3-43</td>
<td></td>
</tr>
<tr>
<td></td>
<td>WCHB1-60</td>
</tr>
<tr>
<td></td>
<td>WD272</td>
</tr>
<tr>
<td>WPS-2</td>
<td></td>
</tr>
<tr>
<td>WS1</td>
<td></td>
</tr>
<tr>
<td>WS2</td>
<td></td>
</tr>
<tr>
<td>WS3</td>
<td>WS3</td>
</tr>
<tr>
<td>WS4</td>
<td></td>
</tr>
<tr>
<td>WS5</td>
<td></td>
</tr>
<tr>
<td>WS6</td>
<td>WS6</td>
</tr>
<tr>
<td>WWE1</td>
<td></td>
</tr>
<tr>
<td>ZB3</td>
<td></td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tblfn1">
<label>a</label>
<p>Phyla shown in Boldface are those already known with cultured representatives prior to the advent of 16S rRNA gene diversity surveys. Phyla in italics are those with cultured representatives originally identified using 16S rRNA sequencing as uncultured bacterial phyla, with representative isolates subsequently obtained. The rest of the phyla currently have no cultured representatives.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="t0010" position="float">
<label>Table 2</label>
<caption>
<p>Common 16S rRNA bacterial primers used for culture-independent analysis.
<xref rid="tblfn2" ref-type="table-fn">a</xref>
</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Primer name</th>
<th>Primer sequence
<xref rid="tblfn3" ref-type="table-fn">b</xref>
</th>
</tr>
</thead>
<tbody>
<tr>
<td>8F</td>
<td>AGAGTTTGATCCTGGCTCAG</td>
</tr>
<tr>
<td>27F</td>
<td>AGAGTTTGATCMTGGCTCAG</td>
</tr>
<tr>
<td>338R</td>
<td>GCCTTGCCAGCCCGCTCAG</td>
</tr>
<tr>
<td>338F</td>
<td>ACTCCTACGGGAGGCWGCAGC</td>
</tr>
<tr>
<td>518R</td>
<td>GTATTACCGCGGCTGCTGG</td>
</tr>
<tr>
<td>530F</td>
<td>ACGCTTGCACCCTCCGTATT</td>
</tr>
<tr>
<td>805R</td>
<td>GGATTAGATACCCTGGTAGTC</td>
</tr>
<tr>
<td>967F</td>
<td>CAACGCGAAGAACCTTACC</td>
</tr>
<tr>
<td>1238R</td>
<td>GTAGCRCGTGTGTMGCCC</td>
</tr>
<tr>
<td>1100F</td>
<td>YAACGAGCGCAACCC</td>
</tr>
<tr>
<td>1492R</td>
<td>CGGTTACCTTGTTACGACTT</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tblfn2">
<label>a</label>
<p>F indicates a forward primer and R indicates a reverse primer. Number in the primer name indicates the starting position of the primer sequence within the
<italic>E. coli</italic>
16S rRNA gene sequence.</p>
</fn>
</table-wrap-foot>
<table-wrap-foot>
<fn id="tblfn3">
<label>b</label>
<p>Data from references
<xref rid="b0285 b0630" ref-type="bibr">[57,126]</xref>
.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="t0015" position="float">
<label>Table 3</label>
<caption>
<p>List of degenerate primers for 27F and 1492R designed as specified in the text. The sequences of the non-degenerate 27F and 1492R are given in the table heading.</p>
</caption>
<table frame="hsides" rules="groups">
<tbody>
<tr>
<td>AGAGUUUGAUCAUGGCUCAG</td>
<td>AAGUCGUAACAAGGUAACC</td>
</tr>
<tr>
<td>
<bold>B</bold>
GAGUUUGAUCAUGGCUCAG</td>
<td>
<bold>G</bold>
AGUCGUAACAAGGUAACC</td>
</tr>
<tr>
<td>A
<bold>H</bold>
AGUUUGAUCAUGGCU
<bold>D</bold>
AG</td>
<td>A
<bold>G</bold>
GUCGUAACAAGGUAACC</td>
</tr>
<tr>
<td>AG
<bold>B</bold>
GUUUGAUCAUGGC
<bold>V</bold>
CAG</td>
<td>AA
<bold>H</bold>
UCGUAACAAGGUAACC</td>
</tr>
<tr>
<td>AGA
<bold>H</bold>
UUUGAUCAUGH
<bold>D</bold>
UCAG</td>
<td>AAG
<bold>C</bold>
CGUAACAAGGUAACC</td>
</tr>
<tr>
<td>AGAG
<bold>G</bold>
UUGAUCAUG
<bold>H</bold>
CUCAG</td>
<td>AAGU
<bold>D</bold>
GUAACAAGGUAACC</td>
</tr>
<tr>
<td>AGAG
<bold>A</bold>
UUGAUCAUG
<bold>H</bold>
CUCAG</td>
<td>AAGUC
<bold>H</bold>
UAACAAGGUAACC</td>
</tr>
<tr>
<td>AGAG
<bold>C</bold>
UUGAUCAUG
<bold>H</bold>
CUCAG</td>
<td>AAGUCG
<bold>C</bold>
AACAAGGUAACC</td>
</tr>
<tr>
<td>AGAGU
<bold>G</bold>
UGAUCAUG
<bold>H</bold>
CUCAG</td>
<td>AAGUCGU
<bold>G</bold>
ACAAGGUAACC</td>
</tr>
<tr>
<td>AGAGU
<bold>A</bold>
UGAUCAUG
<bold>H</bold>
CUCAG</td>
<td>AAGUCGUA
<bold>B</bold>
CAAGGUAACC</td>
</tr>
<tr>
<td>AGAGU
<bold>C</bold>
UGAUCAUG
<bold>H</bold>
CUCAG</td>
<td>AAGUCGUAA
<bold>D</bold>
AAGGUAACC</td>
</tr>
<tr>
<td>AGAGUU
<bold>C</bold>
GAUCAUGGCUCAG</td>
<td>AAGUCGUAAC
<bold>G</bold>
AGGUAACC</td>
</tr>
<tr>
<td>AGAGUUU
<bold>A</bold>
AUCAUGGCUCAG</td>
<td>AAGUCGUAACA
<bold>G</bold>
GGUAACC</td>
</tr>
<tr>
<td>AGAGUUUG
<bold>G</bold>
UCAUGGCUCAG</td>
<td>AAGUCGUAACAA
<bold>A</bold>
GUAACC</td>
</tr>
<tr>
<td>AGAGUUUGA
<bold>V</bold>
CAUGGCUCAG</td>
<td>AAGUCGUAACAAG
<bold>A</bold>
UAACC</td>
</tr>
<tr>
<td>AGAGUUUGAU
<bold>D</bold>
AUGGCUCAG</td>
<td>AAGUCGUAACAAGG
<bold>V</bold>
AACC</td>
</tr>
<tr>
<td>AGAGUUUGAUC
<bold>B</bold>
UGGCUCAG</td>
<td>AAGUCGUAACAAGGU
<bold>B</bold>
ACC</td>
</tr>
<tr>
<td>AGAGUUUGAUCA
<bold>C</bold>
GGCUCAG</td>
<td>AAGUCGUAACAAGGUA
<bold>B</bold>
CC</td>
</tr>
<tr>
<td>AGAGUUUGAUCAU
<bold>U</bold>
GCUCAG</td>
<td>AAGUCGUAACAAGGUAA
<bold>D</bold>
C</td>
</tr>
<tr>
<td>AGAGUUUGAUCAUG
<bold>U</bold>
CUCAG</td>
<td>AAGUCGUAACAAGGUAAC
<bold>D</bold>
</td>
</tr>
<tr>
<td>AGAGUUUGAUCAUGGCUC
<bold>G</bold>
G</td>
<td></td>
</tr>
<tr>
<td>AGAGUUUGAUCAUGGCUCA
<bold>H</bold>
</td>
<td></td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Ticri/CIDE/explor/CyberinfraV1/Data/Pmc/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000707 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd -nk 000707 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Ticri/CIDE
   |area=    CyberinfraV1
   |flux=    Pmc
   |étape=   Curation
   |type=    RBID
   |clé=     PMC:4522544
   |texte=   Assessing the global phylum level diversity within the bacterial domain: A review
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Curation/RBID.i   -Sk "pubmed:26257925" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd   \
       | NlmPubMed2Wicri -a CyberinfraV1 

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Thu Oct 27 09:30:58 2016. Site generation: Sun Mar 10 23:08:40 2024