Serveur d'exploration Cyberinfrastructure

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Afrocantharellus gen. stat. nov. is part of a rich diversity of African Cantharellaceae

Identifieur interne : 000454 ( Pmc/Checkpoint ); précédent : 000453; suivant : 000455

Afrocantharellus gen. stat. nov. is part of a rich diversity of African Cantharellaceae

Auteurs : Donatha D. Tibuhwa [Suède] ; Sanja Savi [Suède] ; Leif Tibell [Suède] ; Amelia K. Kivaisi

Source :

RBID : PMC:3399100

Abstract

A new genus in the Cantharellaceae, Afrocantharellus, is recognized based on results from phylogenetic analyses of rDNA LSU and concatenated LSU/5.8-ITS2/ATP6 data. It was previously recognized as a subgenus, but comprehensive fieldwork and the acquisition of numerous sequences for previously neglected African Cantharellus species formed the basis for a reappraisal of generic and species delimitations. Afrocantharellus is characterized morphologically by the basidiomes having thick, distantly spaced diverging folds of variegated colour. In contrast to most of Cantharellus, Afrocantharellus mostly lacks clamp connections. Phylogenies of Cantharellus and Afrocantharellus based on LSU and a concatenated data set are provided, along with descriptions of and a key to the four species and one form of Afrocantharellus recognized. Six new combinations are made.


Url:
DOI: 10.5598/imafungus.2012.03.01.04
PubMed: 23155498
PubMed Central: 3399100


Affiliations:


Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:3399100

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">
<italic>Afrocantharellus</italic>
gen. stat. nov. is part of a rich diversity of African
<italic>Cantharellaceae</italic>
</title>
<author>
<name sortKey="Tibuhwa, Donatha D" sort="Tibuhwa, Donatha D" uniqKey="Tibuhwa D" first="Donatha D." last="Tibuhwa">Donatha D. Tibuhwa</name>
<affiliation>
<nlm:aff id="A1">Department of Molecular Biology and Biotechnology, University of Dar es Salaam, P.O. Box 35179, Dar es Salaam, Tanzania (Permanent address)</nlm:aff>
<wicri:noCountry code="subfield">Tanzania (Permanent address)</wicri:noCountry>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="A2">Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden</nlm:aff>
<country xml:lang="fr">Suède</country>
<wicri:regionArea>Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala</wicri:regionArea>
<orgName type="university">Université d'Uppsala</orgName>
<placeName>
<settlement type="city">Uppsala</settlement>
<region nuts="1">Svealand</region>
<region nuts="1">East Middle Sweden</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Savi, Sanja" sort="Savi, Sanja" uniqKey="Savi S" first="Sanja" last="Savi">Sanja Savi</name>
<affiliation wicri:level="4">
<nlm:aff id="A2">Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden</nlm:aff>
<country xml:lang="fr">Suède</country>
<wicri:regionArea>Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala</wicri:regionArea>
<orgName type="university">Université d'Uppsala</orgName>
<placeName>
<settlement type="city">Uppsala</settlement>
<region nuts="1">Svealand</region>
<region nuts="1">East Middle Sweden</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Tibell, Leif" sort="Tibell, Leif" uniqKey="Tibell L" first="Leif" last="Tibell">Leif Tibell</name>
<affiliation wicri:level="4">
<nlm:aff id="A2">Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden</nlm:aff>
<country xml:lang="fr">Suède</country>
<wicri:regionArea>Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala</wicri:regionArea>
<orgName type="university">Université d'Uppsala</orgName>
<placeName>
<settlement type="city">Uppsala</settlement>
<region nuts="1">Svealand</region>
<region nuts="1">East Middle Sweden</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kivaisi, Amelia K" sort="Kivaisi, Amelia K" uniqKey="Kivaisi A" first="Amelia K." last="Kivaisi">Amelia K. Kivaisi</name>
<affiliation>
<nlm:aff id="A1">Department of Molecular Biology and Biotechnology, University of Dar es Salaam, P.O. Box 35179, Dar es Salaam, Tanzania (Permanent address)</nlm:aff>
<wicri:noCountry code="subfield">Tanzania (Permanent address)</wicri:noCountry>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">23155498</idno>
<idno type="pmc">3399100</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3399100</idno>
<idno type="RBID">PMC:3399100</idno>
<idno type="doi">10.5598/imafungus.2012.03.01.04</idno>
<date when="2012">2012</date>
<idno type="wicri:Area/Pmc/Corpus">000548</idno>
<idno type="wicri:Area/Pmc/Curation">000548</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000454</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">
<italic>Afrocantharellus</italic>
gen. stat. nov. is part of a rich diversity of African
<italic>Cantharellaceae</italic>
</title>
<author>
<name sortKey="Tibuhwa, Donatha D" sort="Tibuhwa, Donatha D" uniqKey="Tibuhwa D" first="Donatha D." last="Tibuhwa">Donatha D. Tibuhwa</name>
<affiliation>
<nlm:aff id="A1">Department of Molecular Biology and Biotechnology, University of Dar es Salaam, P.O. Box 35179, Dar es Salaam, Tanzania (Permanent address)</nlm:aff>
<wicri:noCountry code="subfield">Tanzania (Permanent address)</wicri:noCountry>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="A2">Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden</nlm:aff>
<country xml:lang="fr">Suède</country>
<wicri:regionArea>Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala</wicri:regionArea>
<orgName type="university">Université d'Uppsala</orgName>
<placeName>
<settlement type="city">Uppsala</settlement>
<region nuts="1">Svealand</region>
<region nuts="1">East Middle Sweden</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Savi, Sanja" sort="Savi, Sanja" uniqKey="Savi S" first="Sanja" last="Savi">Sanja Savi</name>
<affiliation wicri:level="4">
<nlm:aff id="A2">Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden</nlm:aff>
<country xml:lang="fr">Suède</country>
<wicri:regionArea>Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala</wicri:regionArea>
<orgName type="university">Université d'Uppsala</orgName>
<placeName>
<settlement type="city">Uppsala</settlement>
<region nuts="1">Svealand</region>
<region nuts="1">East Middle Sweden</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Tibell, Leif" sort="Tibell, Leif" uniqKey="Tibell L" first="Leif" last="Tibell">Leif Tibell</name>
<affiliation wicri:level="4">
<nlm:aff id="A2">Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden</nlm:aff>
<country xml:lang="fr">Suède</country>
<wicri:regionArea>Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala</wicri:regionArea>
<orgName type="university">Université d'Uppsala</orgName>
<placeName>
<settlement type="city">Uppsala</settlement>
<region nuts="1">Svealand</region>
<region nuts="1">East Middle Sweden</region>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Kivaisi, Amelia K" sort="Kivaisi, Amelia K" uniqKey="Kivaisi A" first="Amelia K." last="Kivaisi">Amelia K. Kivaisi</name>
<affiliation>
<nlm:aff id="A1">Department of Molecular Biology and Biotechnology, University of Dar es Salaam, P.O. Box 35179, Dar es Salaam, Tanzania (Permanent address)</nlm:aff>
<wicri:noCountry code="subfield">Tanzania (Permanent address)</wicri:noCountry>
</affiliation>
</author>
</analytic>
<series>
<title level="j">IMA Fungus : The Global Mycological Journal</title>
<idno type="ISSN">2210-6340</idno>
<idno type="eISSN">2210-6359</idno>
<imprint>
<date when="2012">2012</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>A new genus in the
<italic>Cantharellaceae</italic>
,
<italic>Afrocantharellus</italic>
, is recognized based on results from phylogenetic analyses of rDNA LSU and concatenated LSU/5.8-ITS2/ATP6 data. It was previously recognized as a subgenus, but comprehensive fieldwork and the acquisition of numerous sequences for previously neglected African
<italic>Cantharellus</italic>
species formed the basis for a reappraisal of generic and species delimitations.
<italic>Afrocantharellus</italic>
is characterized morphologically by the basidiomes having thick, distantly spaced diverging folds of variegated colour. In contrast to most of
<italic>Cantharellus</italic>
,
<italic>Afrocantharellus</italic>
mostly lacks clamp connections. Phylogenies of
<italic>Cantharellus</italic>
and
<italic>Afrocantharellus</italic>
based on LSU and a concatenated data set are provided, along with descriptions of and a key to the four species and one form of
<italic>Afrocantharellus</italic>
recognized. Six new combinations are made.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Bas, C" uniqKey="Bas C">C Bas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Binder, M" uniqKey="Binder M">M Binder</name>
</author>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett D">DS Hibbett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Binder, M" uniqKey="Binder M">M Binder</name>
</author>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett D">DS Hibbett</name>
</author>
<author>
<name sortKey="Larsson, Kh" uniqKey="Larsson K">KH Larsson</name>
</author>
<author>
<name sortKey="Larsson, E" uniqKey="Larsson E">E Larsson</name>
</author>
<author>
<name sortKey="Langer, E" uniqKey="Langer E">E Langer</name>
</author>
<author>
<name sortKey="Langer, G" uniqKey="Langer G">G Langer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
<author>
<name sortKey="Nzigidahera, B" uniqKey="Nzigidahera B">B Nzigidahera</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
<author>
<name sortKey="Hofstetter, V" uniqKey="Hofstetter V">V Hofstetter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
<author>
<name sortKey="Hofstetter, V" uniqKey="Hofstetter V">V Hofstetter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
<author>
<name sortKey="Cruaud, C" uniqKey="Cruaud C">C Cruaud</name>
</author>
<author>
<name sortKey="Couloux, A" uniqKey="Couloux A">A Couloux</name>
</author>
<author>
<name sortKey="Hofstetter, V" uniqKey="Hofstetter V">V Hofstetter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
<author>
<name sortKey="Eyssartier, G" uniqKey="Eyssartier G">G Eyssartier</name>
</author>
<author>
<name sortKey="Kivaisi, A" uniqKey="Kivaisi A">A Kivaisi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Carriconde, F" uniqKey="Carriconde F">F Carriconde</name>
</author>
<author>
<name sortKey="Gardes, M" uniqKey="Gardes M">M Gardes</name>
</author>
<author>
<name sortKey="Jargeat, P" uniqKey="Jargeat P">P Jargeat</name>
</author>
<author>
<name sortKey="Heilmann Clausen, J" uniqKey="Heilmann Clausen J">J Heilmann-Clausen</name>
</author>
<author>
<name sortKey="Mouhamadou, B" uniqKey="Mouhamadou B">B Mouhamadou</name>
</author>
<author>
<name sortKey="Gryta, H" uniqKey="Gryta H">H Gryta</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dahlman, M" uniqKey="Dahlman M">M Dahlman</name>
</author>
<author>
<name sortKey="Danell, E" uniqKey="Danell E">E Danell</name>
</author>
<author>
<name sortKey="Spatafora, Jw" uniqKey="Spatafora J">JW Spatafora</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dunham, Sm" uniqKey="Dunham S">SM Dunham</name>
</author>
<author>
<name sortKey="Kretzer, A" uniqKey="Kretzer A">A Kretzer</name>
</author>
<author>
<name sortKey="Pfrender, Me" uniqKey="Pfrender M">ME Pfrender</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eyssartier, G" uniqKey="Eyssartier G">G Eyssartier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eyssartier, G" uniqKey="Eyssartier G">G Eyssartier</name>
</author>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eyssartier, G" uniqKey="Eyssartier G">G Eyssartier</name>
</author>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eyssartier, G" uniqKey="Eyssartier G">G Eyssartier</name>
</author>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
<author>
<name sortKey="Courtecuisse, R" uniqKey="Courtecuisse R">R Courtecuisse</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eyssartier, G" uniqKey="Eyssartier G">G Eyssartier</name>
</author>
<author>
<name sortKey="Stubbe, D" uniqKey="Stubbe D">D Stubbe</name>
</author>
<author>
<name sortKey="Walleyn, R" uniqKey="Walleyn R">R Walleyn</name>
</author>
<author>
<name sortKey="Verbeken, A" uniqKey="Verbeken A">A Verbeken</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Feibelman, Tp" uniqKey="Feibelman T">TP Feibelman</name>
</author>
<author>
<name sortKey="Bayman, P" uniqKey="Bayman P">P Bayman</name>
</author>
<author>
<name sortKey="Cibula, Wg" uniqKey="Cibula W">WG Cibula</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Feibelman, Tp" uniqKey="Feibelman T">TP Feibelman</name>
</author>
<author>
<name sortKey="Doudrick, Rl" uniqKey="Doudrick R">RL Doudrick</name>
</author>
<author>
<name sortKey="Cibula, Wg" uniqKey="Cibula W">WG Cibula</name>
</author>
<author>
<name sortKey="Bennett, Jw" uniqKey="Bennett J">JW Bennett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fr Slev, Tg" uniqKey="Fr Slev T">TG Frøslev</name>
</author>
<author>
<name sortKey="Jeppesen, Ts" uniqKey="Jeppesen T">TS Jeppesen</name>
</author>
<author>
<name sortKey="L Ss E, T" uniqKey="L Ss E T">T Læssøe</name>
</author>
<author>
<name sortKey="Kj Ller, R" uniqKey="Kj Ller R">R Kjøller-</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Geml, J" uniqKey="Geml J">J Geml</name>
</author>
<author>
<name sortKey="Laursen, Ga" uniqKey="Laursen G">GA Laursen</name>
</author>
<author>
<name sortKey="O Eill, K" uniqKey="O Eill K">K O’Neill</name>
</author>
<author>
<name sortKey="Nusbaum, Hc" uniqKey="Nusbaum H">HC Nusbaum</name>
</author>
<author>
<name sortKey="Taylor, Dl" uniqKey="Taylor D">DL Taylor</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guindon, S" uniqKey="Guindon S">S Guindon</name>
</author>
<author>
<name sortKey="Gascuel, O" uniqKey="Gascuel O">O Gascuel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="H Rkonen, M" uniqKey="H Rkonen M">M Härkönen</name>
</author>
<author>
<name sortKey="Niemel, T" uniqKey="Niemel T">T Niemelä</name>
</author>
<author>
<name sortKey="Mwasumbi, L" uniqKey="Mwasumbi L">L Mwasumbi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="H Rkonen, M" uniqKey="H Rkonen M">M Härkönen</name>
</author>
<author>
<name sortKey="Niemel, T" uniqKey="Niemel T">T Niemelä</name>
</author>
<author>
<name sortKey="Mwasumbi, L" uniqKey="Mwasumbi L">L Mwasumbi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Heinemann, P" uniqKey="Heinemann P">P Heinemann</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Heinemann, P" uniqKey="Heinemann P">P Heinemann</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Henkel, Tw" uniqKey="Henkel T">TW Henkel</name>
</author>
<author>
<name sortKey="Meszaros, R" uniqKey="Meszaros R">R Meszaros</name>
</author>
<author>
<name sortKey="Catherine, Am" uniqKey="Catherine A">AM Catherine</name>
</author>
<author>
<name sortKey="Kennedy, A" uniqKey="Kennedy A">A Kennedy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hey, J" uniqKey="Hey J">J Hey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett D">DS Hibbett</name>
</author>
<author>
<name sortKey="Donoghue, Mj" uniqKey="Donoghue M">MJ Donoghue</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett D">DS Hibbett</name>
</author>
<author>
<name sortKey="Gilbert, Lb" uniqKey="Gilbert L">LB Gilbert</name>
</author>
<author>
<name sortKey="Donoghue, Mj" uniqKey="Donoghue M">MJ Donoghue</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett D">DS Hibbett</name>
</author>
<author>
<name sortKey="Pine, Em" uniqKey="Pine E">EM Pine</name>
</author>
<author>
<name sortKey="Langer, E" uniqKey="Langer E">E Langer</name>
</author>
<author>
<name sortKey="Langer, G" uniqKey="Langer G">G Langer</name>
</author>
<author>
<name sortKey="Donoghue, Mj" uniqKey="Donoghue M">MJ Donoghue</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Katoh, K" uniqKey="Katoh K">K Katoh</name>
</author>
<author>
<name sortKey="Kuma, K" uniqKey="Kuma K">K Kuma</name>
</author>
<author>
<name sortKey="Toh, H" uniqKey="Toh H">H Toh</name>
</author>
<author>
<name sortKey="Miyata, T" uniqKey="Miyata T">T Miyata</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Katoh, K" uniqKey="Katoh K">K Katoh</name>
</author>
<author>
<name sortKey="Misawa, K" uniqKey="Misawa K">K Misawa</name>
</author>
<author>
<name sortKey="Kuma, K" uniqKey="Kuma K">K Kuma</name>
</author>
<author>
<name sortKey="Miyata, T" uniqKey="Miyata T">T Miyata</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kretzer, Am" uniqKey="Kretzer A">AM Kretzer</name>
</author>
<author>
<name sortKey="Bruns, Td" uniqKey="Bruns T">TD Bruns</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Larsson, Kh" uniqKey="Larsson K">KH Larsson</name>
</author>
<author>
<name sortKey="Larsson, E" uniqKey="Larsson E">E Larsson</name>
</author>
<author>
<name sortKey="Koljalg, U" uniqKey="Koljalg U">U Köljalg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mason Gamer, R" uniqKey="Mason Gamer R">R Mason-Gamer</name>
</author>
<author>
<name sortKey="Kellogg, E" uniqKey="Kellogg E">E Kellogg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Matheny, Pb" uniqKey="Matheny P">PB Matheny</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Matheny, Pb" uniqKey="Matheny P">PB Matheny</name>
</author>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author>
<name sortKey="Binder, M" uniqKey="Binder M">M Binder</name>
</author>
<author>
<name sortKey="Curtis, Jm" uniqKey="Curtis J">JM Curtis</name>
</author>
<author>
<name sortKey="Lim, Yw" uniqKey="Lim Y">YW Lim</name>
</author>
<author>
<name sortKey="Nilsson, Rh" uniqKey="Nilsson R">RH Nilsson</name>
</author>
<author>
<name sortKey="Hughes, Kw" uniqKey="Hughes K">KW Hughes</name>
</author>
<author>
<name sortKey="Hofstetter, V" uniqKey="Hofstetter V">V Hofstetter</name>
</author>
<author>
<name sortKey="Ammirati, Jf" uniqKey="Ammirati J">JF Ammirati</name>
</author>
<author>
<name sortKey="Schoch, Cl" uniqKey="Schoch C">CL Schoch</name>
</author>
<author>
<name sortKey="Langer, Ge" uniqKey="Langer G">GE Langer</name>
</author>
<author>
<name sortKey="Mclaughlin, Dj" uniqKey="Mclaughlin D">DJ McLaughlin</name>
</author>
<author>
<name sortKey="Wilson, Aw" uniqKey="Wilson A">AW Wilson</name>
</author>
<author>
<name sortKey="Fr Slev, T" uniqKey="Fr Slev T">T Frøslev</name>
</author>
<author>
<name sortKey="Ge, Zw" uniqKey="Ge Z">ZW Ge</name>
</author>
<author>
<name sortKey="Kerrigan, Rw" uniqKey="Kerrigan R">RW Kerrigan</name>
</author>
<author>
<name sortKey="Slot, Jc" uniqKey="Slot J">JC Slot</name>
</author>
<author>
<name sortKey="Vellinga, Ec" uniqKey="Vellinga E">EC Vellinga</name>
</author>
<author>
<name sortKey="Liang, Zl" uniqKey="Liang Z">ZL Liang</name>
</author>
<author>
<name sortKey="Baroni, Tj" uniqKey="Baroni T">TJ Baroni</name>
</author>
<author>
<name sortKey="Fischer, M" uniqKey="Fischer M">M Fischer</name>
</author>
<author>
<name sortKey="Hosaka, K" uniqKey="Hosaka K">K Hosaka</name>
</author>
<author>
<name sortKey="Matsuura, K" uniqKey="Matsuura K">K Matsuura</name>
</author>
<author>
<name sortKey="Seidl, Mt" uniqKey="Seidl M">MT Seidl</name>
</author>
<author>
<name sortKey="Vaura, J" uniqKey="Vaura J">J Vaura</name>
</author>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett D">DS Hibbett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moncalvo, Jm" uniqKey="Moncalvo J">JM Moncalvo</name>
</author>
<author>
<name sortKey="Nilsson, Rh" uniqKey="Nilsson R">RH Nilsson</name>
</author>
<author>
<name sortKey="Koster, B" uniqKey="Koster B">B Koster</name>
</author>
<author>
<name sortKey="Dunham, Sm" uniqKey="Dunham S">SM Dunham</name>
</author>
<author>
<name sortKey="Bernauer, T" uniqKey="Bernauer T">T Bernauer</name>
</author>
<author>
<name sortKey="Matheny, Pb" uniqKey="Matheny P">PB Matheny</name>
</author>
<author>
<name sortKey="Mclenon, T" uniqKey="Mclenon T">T McLenon</name>
</author>
<author>
<name sortKey="Margaritescu, S" uniqKey="Margaritescu S">S Margaritescu</name>
</author>
<author>
<name sortKey="Wei, M" uniqKey="Wei M">M Weiß</name>
</author>
<author>
<name sortKey="Garnica, S" uniqKey="Garnica S">S Garnica</name>
</author>
<author>
<name sortKey="Danell, E" uniqKey="Danell E">E Danell</name>
</author>
<author>
<name sortKey="Langer, G" uniqKey="Langer G">G Langer</name>
</author>
<author>
<name sortKey="Langer, E" uniqKey="Langer E">E Langer</name>
</author>
<author>
<name sortKey="Larsson, E" uniqKey="Larsson E">E Larsson</name>
</author>
<author>
<name sortKey="Larsson, Kh" uniqKey="Larsson K">KH Larsson</name>
</author>
<author>
<name sortKey="Vilgalys, R" uniqKey="Vilgalys R">R Vilgalys</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nagy, Lg" uniqKey="Nagy L">LG Nagy</name>
</author>
<author>
<name sortKey="Hazi, J" uniqKey="Hazi J">J Házi</name>
</author>
<author>
<name sortKey="Vagvolgyi, C" uniqKey="Vagvolgyi C">C Vágvölgyi</name>
</author>
<author>
<name sortKey="Papp, T" uniqKey="Papp T">T Papp</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Olariaga, I" uniqKey="Olariaga I">I Olariaga</name>
</author>
<author>
<name sortKey="Jugo, Bm" uniqKey="Jugo B">BM Jugo</name>
</author>
<author>
<name sortKey="Garcia Etxebarria, K" uniqKey="Garcia Etxebarria K">K García-Etxebarria</name>
</author>
<author>
<name sortKey="Salcedo, I" uniqKey="Salcedo I">I Salcedo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pilz, D" uniqKey="Pilz D">D Pilz</name>
</author>
<author>
<name sortKey="Norvell, L" uniqKey="Norvell L">L Norvell</name>
</author>
<author>
<name sortKey="Danell, E" uniqKey="Danell E">E Danell</name>
</author>
<author>
<name sortKey="Molina, R" uniqKey="Molina R">R Molina</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pine, Em" uniqKey="Pine E">EM Pine</name>
</author>
<author>
<name sortKey="Hibbett, Ds" uniqKey="Hibbett D">DS Hibbett</name>
</author>
<author>
<name sortKey="Donoghue, Mj" uniqKey="Donoghue M">MJ Donoghue</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Posada, D" uniqKey="Posada D">D Posada</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ronquist, F" uniqKey="Ronquist F">F Ronquist</name>
</author>
<author>
<name sortKey="Huelsenbeck, Jp" uniqKey="Huelsenbeck J">JP Huelsenbeck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Savi, S" uniqKey="Savi S">S Saviæ</name>
</author>
<author>
<name sortKey="Tibell, L" uniqKey="Tibell L">L Tibell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shao, S C" uniqKey="Shao S">S-C Shao</name>
</author>
<author>
<name sortKey="Tian, X F" uniqKey="Tian X">X-F Tian</name>
</author>
<author>
<name sortKey="Liu, P G" uniqKey="Liu P">P-G Liu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sharpe, C" uniqKey="Sharpe C">C Sharpe</name>
</author>
<author>
<name sortKey="Wursten, B" uniqKey="Wursten B">B Wursten</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stamatakis, A" uniqKey="Stamatakis A">A Stamatakis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stamatakis, A" uniqKey="Stamatakis A">A Stamatakis</name>
</author>
<author>
<name sortKey="Hoover, P" uniqKey="Hoover P">P Hoover</name>
</author>
<author>
<name sortKey="Rougemont, J" uniqKey="Rougemont J">J Rougemont</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Swofford, Dl" uniqKey="Swofford D">DL Swofford</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Thacker, Jr" uniqKey="Thacker J">JR Thacker</name>
</author>
<author>
<name sortKey="Henkel, Tw" uniqKey="Henkel T">TW Henkel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tibuhwa, D" uniqKey="Tibuhwa D">D Tibuhwa</name>
</author>
<author>
<name sortKey="Buyck, B" uniqKey="Buyck B">B Buyck</name>
</author>
<author>
<name sortKey="Kivaisi, A" uniqKey="Kivaisi A">A Kivaisi</name>
</author>
<author>
<name sortKey="Tibell, L" uniqKey="Tibell L">L Tibell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vilgalys, R" uniqKey="Vilgalys R">R Vilgalys</name>
</author>
<author>
<name sortKey="Hester, M" uniqKey="Hester M">M Hester</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">IMA Fungus</journal-id>
<journal-id journal-id-type="iso-abbrev">IMA Fungus</journal-id>
<journal-id journal-id-type="publisher-id">IMA Fungus</journal-id>
<journal-title-group>
<journal-title>IMA Fungus : The Global Mycological Journal</journal-title>
</journal-title-group>
<issn pub-type="ppub">2210-6340</issn>
<issn pub-type="epub">2210-6359</issn>
<publisher>
<publisher-name>Nationaal Herbarium Nederland & Centraallbureau voor Schimmelcultures</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">23155498</article-id>
<article-id pub-id-type="pmc">3399100</article-id>
<article-id pub-id-type="doi">10.5598/imafungus.2012.03.01.04</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>
<italic>Afrocantharellus</italic>
gen. stat. nov. is part of a rich diversity of African
<italic>Cantharellaceae</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Tibuhwa</surname>
<given-names>Donatha D.</given-names>
</name>
<xref ref-type="aff" rid="A1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="A2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="COR1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Saviæ</surname>
<given-names>Sanja</given-names>
</name>
<xref ref-type="aff" rid="A2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tibell</surname>
<given-names>Leif</given-names>
</name>
<xref ref-type="aff" rid="A2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kivaisi</surname>
<given-names>Amelia K.</given-names>
</name>
<xref ref-type="aff" rid="A1">
<sup>1</sup>
</xref>
</contrib>
</contrib-group>
<aff id="A1">
<label>1</label>
Department of Molecular Biology and Biotechnology, University of Dar es Salaam, P.O. Box 35179, Dar es Salaam, Tanzania (Permanent address)</aff>
<aff id="A2">
<label>2</label>
Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden</aff>
<author-notes>
<corresp id="COR1">corresponding author e-mail:
<email>dtibuhwa@yahoo.co.uk</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>21</day>
<month>6</month>
<year>2012</year>
</pub-date>
<pub-date pub-type="ppub">
<month>6</month>
<year>2012</year>
</pub-date>
<volume>3</volume>
<issue>1</issue>
<fpage>25</fpage>
<lpage>38</lpage>
<history>
<date date-type="received">
<day>25</day>
<month>2</month>
<year>2012</year>
</date>
<date date-type="accepted">
<day>16</day>
<month>5</month>
<year>2012</year>
</date>
</history>
<permissions>
<copyright-statement>© 2012 International Mycological Association</copyright-statement>
<copyright-year>2012</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode">
<license-p>You are free to share - to copy, distribute and transmit the work, under the following conditions:</license-p>
<license-p>
<bold>Attribution:</bold>
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).</license-p>
<license-p>
<bold>Non-commercial:</bold>
You may not use this work for commercial purposes.</license-p>
<license-p>
<bold>No derivative works:</bold>
You may not alter, transform, or build upon this work.</license-p>
<license-p>For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode">http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode</ext-link>
. Any of the above conditions can be waived if you get permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.</license-p>
</license>
</permissions>
<abstract abstract-type="executive-summary">
<p>A new genus in the
<italic>Cantharellaceae</italic>
,
<italic>Afrocantharellus</italic>
, is recognized based on results from phylogenetic analyses of rDNA LSU and concatenated LSU/5.8-ITS2/ATP6 data. It was previously recognized as a subgenus, but comprehensive fieldwork and the acquisition of numerous sequences for previously neglected African
<italic>Cantharellus</italic>
species formed the basis for a reappraisal of generic and species delimitations.
<italic>Afrocantharellus</italic>
is characterized morphologically by the basidiomes having thick, distantly spaced diverging folds of variegated colour. In contrast to most of
<italic>Cantharellus</italic>
,
<italic>Afrocantharellus</italic>
mostly lacks clamp connections. Phylogenies of
<italic>Cantharellus</italic>
and
<italic>Afrocantharellus</italic>
based on LSU and a concatenated data set are provided, along with descriptions of and a key to the four species and one form of
<italic>Afrocantharellus</italic>
recognized. Six new combinations are made.</p>
</abstract>
<kwd-group>
<kwd>Africa</kwd>
<kwd>ATP6</kwd>
<kwd>
<italic>Cantharellus</italic>
</kwd>
<kwd>ITS</kwd>
<kwd>LSU</kwd>
<kwd>Molecular phylogeny</kwd>
<kwd>Tanzania</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="F1" orientation="portrait" position="float">
<label>Fig. 1.</label>
<caption>
<p>Map showing the distribution of Miombo-woodlands in Tanzania. Approximate positions of collecting sites are marked with ‘X’.</p>
</caption>
<graphic xlink:href="ima-3-25-g001"></graphic>
</fig>
<fig id="F2" orientation="portrait" position="float">
<label>Fig. 2.</label>
<caption>
<p>Phylogenetic relationships among 92 specimens (
<xref ref-type="table" rid="T1">Table 1</xref>
) representing 54 taxa of cantharelloid fungi based on a Bayesian analysis of the large LSU dataset. The tree was rooted using
<italic>Multiclavula mucida</italic>
. The three support values associated with each internal branch correspond to PP, MPbs and MLb proportions, respectively. Branches in bold indicate a support of PP ≥ 95 % and MPbs, MLb ≥ 70 %. An asterisk on a bold branch indicates that this node has a support of 100 % for all support estimates.</p>
</caption>
<graphic xlink:href="ima-3-25-g002"></graphic>
</fig>
<fig id="F3" orientation="portrait" position="float">
<label>Fig. 3.</label>
<caption>
<p>Phylogenetic relationships among 28 concatenated sequences (
<xref ref-type="table" rid="T1">Table 1</xref>
) representing 17 taxa of cantharelloid fungi based on a Bayesian analysis of a LSU/5.8-ITS2/ATP6 dataset. The tree was rooted using
<italic>Dacrymyces chrysospermus</italic>
. The support values associated with each internal branch correspond to PP, MPbs and MLb proportions, respectively. Branches in bold indicate a support of PP ≥ 95 % and MPbs, MLb ≥ 70 %. An asterisk on a bold branch indicates that this node has a support of 100 % for all support estimates.</p>
</caption>
<graphic xlink:href="ima-3-25-g003"></graphic>
</fig>
<fig id="F4" orientation="portrait" position="float">
<label>Fig. 4.</label>
<caption>
<p>Basidiomes of
<italic>Afrocantharellus</italic>
and
<italic>Cantharellus</italic>
species showing morphological differences of the hymenophores:
<bold>A.</bold>
<italic>Afrocantharellus symoensii</italic>
(
<italic>Tibuhwa 1011.2005</italic>
; UPS).
<bold>B.</bold>
<italic>A</italic>
.
<italic>fistulosus</italic>
(holotype).
<bold>C.</bold>
<italic>A. splendens</italic>
(
<italic>DDT 1053.2011</italic>
; UDSM).
<bold>D.</bold>
<italic>A. platyphyllus</italic>
f.
<italic> cyanescens</italic>
(
<italic>Tibuhwa 1063.2007</italic>
; UPS).
<bold>E.</bold>
<italic>Cantharellus</italic>
<italic>congolensis</italic>
(
<italic>Tibuhwa 1076.2007</italic>
; UDSM).
<bold>F.</bold>
<italic>C. rufopunctatus</italic>
(
<italic>Tibuhwa 1010.2004</italic>
; UDSM). All photos taken in Tanzania by Donatha D. Tibuhwa.</p>
</caption>
<graphic xlink:href="ima-3-25-g004"></graphic>
</fig>
<table-wrap id="T1" orientation="portrait" position="float">
<caption>
<p>
<bold>Table 1.</bold>
Specimens and sequences used in this study, with their respective voucher information. GenBank accession numbers in bold represent sequences published here for the first time; corresponding voucher and collector numbers are provided. Other GenBank ID numbers represent sequences already published.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" rowspan="1" colspan="1">No</th>
<th align="left" rowspan="1" colspan="1">Species</th>
<th align="left" rowspan="1" colspan="1">Voucher</th>
<th align="left" rowspan="1" colspan="1">Locality</th>
<th align="left" rowspan="1" colspan="1">Collection no. (UPS)</th>
<th align="left" rowspan="1" colspan="1">LSU-GB</th>
<th align="left" rowspan="1" colspan="1">5.8-ITS2 GB</th>
<th align="left" rowspan="1" colspan="1">ATP6-GB</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>1</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Afrocantharellus fistulosus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT31</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Kisarawe</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 31.2006</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976959</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>2</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. fistulosus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT43</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Kisarawe</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 43.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976965</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>3</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. platyphyllus</italic>
f.
<italic>cyanescens</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT63</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1063.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976970</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>4</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. platyphyllus</italic>
f.
<italic>platyphyllus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT78</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Iringa</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1078.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976978</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976947</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976926</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>5</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. platyphyllus</italic>
f.
<italic>platyphyllus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT03</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1003.2004</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976950</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976929</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>6</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. platyphyllus</italic>
f.
<italic>platyphyllus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT41</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Kisarawe</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1041.2006</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976964</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>7</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. splendens</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT57</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1057.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976967</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976937</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976916</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>8</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. splendens</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT17</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Geita</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1017.2005</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976956</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976932</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976911</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>9</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. symoensii</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT36</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Kisarawe</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1036.2005</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976961</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976934</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976914</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>10</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. symoensii</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT04</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1004.2005</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976951</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>11</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. symoensii</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT66</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Iringa</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1066.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976971</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976940</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976919</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>12</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. symoensii</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT11</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1011.2005</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976953</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>13</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. symoensii</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT67</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Iringa</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1067.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976972</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976941</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976920</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>14</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>A. symoensii</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT14</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Geita</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1014.2004</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976955</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>15</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Botryobasidium isabellinum</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AF393047</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ534597.1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>16</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. appalachiensis</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ898690</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>17</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. appalachiensis</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750916</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>18</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cascadensis</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041159</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>19</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cascadensis</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041158</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>20</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cascadensis</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041161</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>21</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cascadensis</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041160</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>22</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
var.
<italic> cibarius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041156</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>23</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
var.
<italic> cibarius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041155</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>24</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
var.
<italic> cibarius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041157</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>25</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>cibarius</italic>
var.
<italic>roseocanus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041152</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>26</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>cibarius</italic>
var.
<italic>roseocanus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041153</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>27</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>cibarius</italic>
var.
<italic>roseocanus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041154</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>28</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>cibarius</italic>
var.
<italic>roseocanus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041151</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>29</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>cibarius</italic>
var.
<italic>multiramis</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750920</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>30</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
</td>
<td align="left" rowspan="1" colspan="1">SS574</td>
<td align="left" rowspan="1" colspan="1">SWEDEN: Uppland</td>
<td align="left" rowspan="1" colspan="1">Olariaga & Felipe 2005/503752</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976981</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>31</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">EU522825</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>32</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AJ406428</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>33</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750927</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>34</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY745708</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>35</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ898693</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>36</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cibarius</italic>
var.
<italic> longipes</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750924</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>37</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cinnabarinus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041168</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>38</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cinnabarinus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ898692</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ120944</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ898649</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>39</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. congolensis</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT77</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1077.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976977</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976946</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976925</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>40</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. congolensis</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT76</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Iringa</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1076.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976976</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976945</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976924</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>41</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. densifolius</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT40</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Kisarawe</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1040.2006</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976963</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976935</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976915</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>42</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. densifolius</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT58</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1058.2006</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976968</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976938</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976917</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>43</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. floridulus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT33</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1033.2006</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976960</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976913</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>44</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. floridulus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT38</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1038.2005</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976962</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>45</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>formosus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041166</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>46</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>formosus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041164</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>47</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>formosus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041165</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>48</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>garnierii</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY392767</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>49</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>garnierii</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY392768</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>50</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. isabellinus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750931</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>51</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. isabellinus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT30</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1030.2006</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976958</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>52</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. isabellinus</italic>
var.
<italic>parvisporus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT12</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1012.2004</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976954</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976931</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976910</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>53</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. isabellinus</italic>
var.
<italic>parvisporus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT22</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Geita</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1022.2005</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976957</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976933</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976912</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>54</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. lateritius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ898694</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>55</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. minor</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ898691</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>56</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. minor</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750923</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>57</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. pallens</italic>
</td>
<td align="left" rowspan="1" colspan="1">SS577</td>
<td align="left" rowspan="1" colspan="1">SWEDEN: Uppland</td>
<td align="left" rowspan="1" colspan="1">Danell & Olariaga 2005 (503727)</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976984</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>58</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. persicinus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041169</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>59</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. pseudocibarius</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT02</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1002.2004</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976949</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976928</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976908</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>60</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. pseudocibarius</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT05</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Geita</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1005.2004</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976952</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976929</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976909</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>61</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. pseudoformosus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">GU237071</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>62</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>rhodophyllus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750925</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>63</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. ruber</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT60</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Iringa</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1060.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976969</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976939</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976918</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>64</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. ruber</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT45</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Kisarawe</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1045.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976966</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976936</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>65</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>subalbidus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041148</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>66</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>subalbidus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041150</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>67</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>subalbidus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041146</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>68</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>subalbidus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041147</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>69</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
<italic>subalbidus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041149</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>70</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. tomentosus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT68</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1068.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976973</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976942</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976921</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>71</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. tomentosus</italic>
</td>
<td align="left" rowspan="1" colspan="1">DDT69</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1069.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976974</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976943</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976922</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>72</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750917</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>73</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750922</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>74</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750928</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>75</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750930</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>76</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750926</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>77</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750918</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>78</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750921</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>79</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AJ271192</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>80</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY041167</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>81</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750929</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>82</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp. 2</td>
<td align="left" rowspan="1" colspan="1">DDT70</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1070.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976975</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976944</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976923</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>83</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
sp. 2</td>
<td align="left" rowspan="1" colspan="1">DDT79</td>
<td align="left" rowspan="1" colspan="1">TANZANIA: Morogoro</td>
<td align="left" rowspan="1" colspan="1">Tibuhwa 1079.2007</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976979</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976948</bold>
</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976927</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>84</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Clavulina cinerea</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AM259211</td>
<td align="left" rowspan="1" colspan="1">AF185974</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">
<italic>Clavulina</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ120947</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>85</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Craterellus chantarellus.</italic>
var.
<italic>intermedius</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM750919</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>86</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Craterellus cornucopioides</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY700188</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">JF907967</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>87</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. cornucopioides</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AJ279572</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>88</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. lutescens</italic>
</td>
<td align="left" rowspan="1" colspan="1">SS575</td>
<td align="left" rowspan="1" colspan="1">SWEDEN: Uppland</td>
<td align="left" rowspan="1" colspan="1">Olariaga 2005 (503703)</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976982</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>89</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. lutescens</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">EU522746</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>90</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. melanoxeros</italic>
</td>
<td align="left" rowspan="1" colspan="1">SS576</td>
<td align="left" rowspan="1" colspan="1">SWEDEN: Uppland</td>
<td align="left" rowspan="1" colspan="1">Aronsson 2008 (441865)</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976983</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>91</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C.</italic>
sp
<italic>.</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HM113529</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>92</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. tubaeformis</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AF287851</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AF385632</td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>93</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. tubaeformis</italic>
</td>
<td align="left" rowspan="1" colspan="1">SS572</td>
<td align="left" rowspan="1" colspan="1">SWEDEN: Uppland</td>
<td align="left" rowspan="1" colspan="1">Lindau 2010</td>
<td align="left" rowspan="1" colspan="1">
<bold>JQ976980</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>94</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>C. tubaeformis</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DQ898741</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>95</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Dacrymyces chrysospermus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AF287855</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">EU339249</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>96</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Hydnum rufescens</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AY293187</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>97</italic>
</td>
<td align="left" rowspan="1" colspan="1">
<italic>Multiclavula mucida</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AF287875</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T2" orientation="portrait" position="float">
<caption>
<p>
<bold>Table 2.</bold>
Primers used for amplification of the 5.8S-ITS2 part of ITS region.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" rowspan="1" colspan="1">Primer</th>
<th rowspan="1" colspan="1"></th>
<th align="left" rowspan="1" colspan="1">Sequence</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">forward</td>
<td align="left" rowspan="1" colspan="1">ITS3C</td>
<td align="left" rowspan="1" colspan="1">5′–GCATCGATGAAGAACGCAGT–3′</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">reverse</td>
<td align="left" rowspan="1" colspan="1">Lcan</td>
<td align="left" rowspan="1" colspan="1">5′–GTCCGAGTTGTAGATGAG–3′</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">forward</td>
<td align="left" rowspan="1" colspan="1">5.8Scanf</td>
<td align="left" rowspan="1" colspan="1">5′– CGATGAAGAACGCAGCG–3′</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">forward</td>
<td align="left" rowspan="1" colspan="1">5canf</td>
<td align="left" rowspan="1" colspan="1">5′–CATCGAGTCTTTGAACGCAAAC–3′</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">reverse</td>
<td align="left" rowspan="1" colspan="1">LcanR</td>
<td align="left" rowspan="1" colspan="1">5′– ATCGAGTCTTTGAACGCAAAC–3′</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T3" orientation="portrait" position="float">
<caption>
<p>
<bold>Table 3.</bold>
Morphological features of
<italic>Afrocantharellus</italic>
and
<italic>Cantharellus.</italic>
</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" rowspan="1" colspan="1"></th>
<th align="left" rowspan="1" colspan="1">
<italic>Afrocantharellus</italic>
</th>
<th align="left" rowspan="1" colspan="1">
<italic>Cantharellus</italic>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Basidiome colour</italic>
</td>
<td align="left" rowspan="1" colspan="1">always variegated</td>
<td align="left" rowspan="1" colspan="1">Mostly uniformly coloured</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Hymenophore</italic>
</td>
<td align="left" rowspan="1" colspan="1">well-developed with thick diverging folds</td>
<td align="left" rowspan="1" colspan="1">Poorly-developed, without folds or with thin folds but never with thick diverging folds</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Folds</italic>
</td>
<td align="left" rowspan="1" colspan="1">thick, blunt, always decurrent and distantly spaced</td>
<td align="left" rowspan="1" colspan="1">Relatively thin, sharp, subdecurrent or decurrent and not distantly spaced</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Clamp connections</italic>
</td>
<td align="left" rowspan="1" colspan="1">Mostly absent</td>
<td align="left" rowspan="1" colspan="1">Mostly present</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>Suède</li>
</country>
<region>
<li>East Middle Sweden</li>
<li>Svealand</li>
</region>
<settlement>
<li>Uppsala</li>
</settlement>
<orgName>
<li>Université d'Uppsala</li>
</orgName>
</list>
<tree>
<noCountry>
<name sortKey="Kivaisi, Amelia K" sort="Kivaisi, Amelia K" uniqKey="Kivaisi A" first="Amelia K." last="Kivaisi">Amelia K. Kivaisi</name>
</noCountry>
<country name="Suède">
<region name="Svealand">
<name sortKey="Tibuhwa, Donatha D" sort="Tibuhwa, Donatha D" uniqKey="Tibuhwa D" first="Donatha D." last="Tibuhwa">Donatha D. Tibuhwa</name>
</region>
<name sortKey="Savi, Sanja" sort="Savi, Sanja" uniqKey="Savi S" first="Sanja" last="Savi">Sanja Savi</name>
<name sortKey="Tibell, Leif" sort="Tibell, Leif" uniqKey="Tibell L" first="Leif" last="Tibell">Leif Tibell</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Ticri/CIDE/explor/CyberinfraV1/Data/Pmc/Checkpoint
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000454 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd -nk 000454 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Ticri/CIDE
   |area=    CyberinfraV1
   |flux=    Pmc
   |étape=   Checkpoint
   |type=    RBID
   |clé=     PMC:3399100
   |texte=   Afrocantharellus gen. stat. nov. is part of a rich diversity of African Cantharellaceae
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/RBID.i   -Sk "pubmed:23155498" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd   \
       | NlmPubMed2Wicri -a CyberinfraV1 

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Thu Oct 27 09:30:58 2016. Site generation: Sun Mar 10 23:08:40 2024