Serveur d'exploration SRAS

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 001381 ( Pmc/Corpus ); précédent : 0013809; suivant : 0013820 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Characterization of Human Coronavirus Etiology in Chinese Adults with Acute Upper Respiratory Tract Infection by Real-Time RT-PCR Assays</title>
<author>
<name sortKey="Lu, Roujian" sort="Lu, Roujian" uniqKey="Lu R" first="Roujian" last="Lu">Roujian Lu</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yu, Xiaoyan" sort="Yu, Xiaoyan" uniqKey="Yu X" first="Xiaoyan" last="Yu">Xiaoyan Yu</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff3">
<addr-line>Key Laboratory of Laboratory Medicine, Ministry of Education, and Institute of Medical Virology, Wenzhou Medical College, Zhejiang, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Wen" sort="Wang, Wen" uniqKey="Wang W" first="Wen" last="Wang">Wen Wang</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Duan, Xijie" sort="Duan, Xijie" uniqKey="Duan X" first="Xijie" last="Duan">Xijie Duan</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Peking Union Medical College Hospital, Chinese Academy Medical Sciences, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Linglin" sort="Zhang, Linglin" uniqKey="Zhang L" first="Linglin" last="Zhang">Linglin Zhang</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhou, Weimin" sort="Zhou, Weimin" uniqKey="Zhou W" first="Weimin" last="Zhou">Weimin Zhou</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Xu, Jin" sort="Xu, Jin" uniqKey="Xu J" first="Jin" last="Xu">Jin Xu</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Peking Union Medical College Hospital, Chinese Academy Medical Sciences, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Xu, Lingjie" sort="Xu, Lingjie" uniqKey="Xu L" first="Lingjie" last="Xu">Lingjie Xu</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Peking Union Medical College Hospital, Chinese Academy Medical Sciences, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hu, Qin" sort="Hu, Qin" uniqKey="Hu Q" first="Qin" last="Hu">Qin Hu</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff3">
<addr-line>Key Laboratory of Laboratory Medicine, Ministry of Education, and Institute of Medical Virology, Wenzhou Medical College, Zhejiang, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lu, Jianxin" sort="Lu, Jianxin" uniqKey="Lu J" first="Jianxin" last="Lu">Jianxin Lu</name>
<affiliation>
<nlm:aff id="aff3">
<addr-line>Key Laboratory of Laboratory Medicine, Ministry of Education, and Institute of Medical Virology, Wenzhou Medical College, Zhejiang, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Ruan, Li" sort="Ruan, Li" uniqKey="Ruan L" first="Li" last="Ruan">Li Ruan</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Zhong" sort="Wang, Zhong" uniqKey="Wang Z" first="Zhong" last="Wang">Zhong Wang</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Peking Union Medical College Hospital, Chinese Academy Medical Sciences, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tan, Wenjie" sort="Tan, Wenjie" uniqKey="Tan W" first="Wenjie" last="Tan">Wenjie Tan</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">22719912</idno>
<idno type="pmc">3376151</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3376151</idno>
<idno type="RBID">PMC:3376151</idno>
<idno type="doi">10.1371/journal.pone.0038638</idno>
<date when="2012">2012</date>
<idno type="wicri:Area/Pmc/Corpus">001381</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">001381</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Characterization of Human Coronavirus Etiology in Chinese Adults with Acute Upper Respiratory Tract Infection by Real-Time RT-PCR Assays</title>
<author>
<name sortKey="Lu, Roujian" sort="Lu, Roujian" uniqKey="Lu R" first="Roujian" last="Lu">Roujian Lu</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yu, Xiaoyan" sort="Yu, Xiaoyan" uniqKey="Yu X" first="Xiaoyan" last="Yu">Xiaoyan Yu</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff3">
<addr-line>Key Laboratory of Laboratory Medicine, Ministry of Education, and Institute of Medical Virology, Wenzhou Medical College, Zhejiang, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Wen" sort="Wang, Wen" uniqKey="Wang W" first="Wen" last="Wang">Wen Wang</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Duan, Xijie" sort="Duan, Xijie" uniqKey="Duan X" first="Xijie" last="Duan">Xijie Duan</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Peking Union Medical College Hospital, Chinese Academy Medical Sciences, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Linglin" sort="Zhang, Linglin" uniqKey="Zhang L" first="Linglin" last="Zhang">Linglin Zhang</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhou, Weimin" sort="Zhou, Weimin" uniqKey="Zhou W" first="Weimin" last="Zhou">Weimin Zhou</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Xu, Jin" sort="Xu, Jin" uniqKey="Xu J" first="Jin" last="Xu">Jin Xu</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Peking Union Medical College Hospital, Chinese Academy Medical Sciences, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Xu, Lingjie" sort="Xu, Lingjie" uniqKey="Xu L" first="Lingjie" last="Xu">Lingjie Xu</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Peking Union Medical College Hospital, Chinese Academy Medical Sciences, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hu, Qin" sort="Hu, Qin" uniqKey="Hu Q" first="Qin" last="Hu">Qin Hu</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff3">
<addr-line>Key Laboratory of Laboratory Medicine, Ministry of Education, and Institute of Medical Virology, Wenzhou Medical College, Zhejiang, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lu, Jianxin" sort="Lu, Jianxin" uniqKey="Lu J" first="Jianxin" last="Lu">Jianxin Lu</name>
<affiliation>
<nlm:aff id="aff3">
<addr-line>Key Laboratory of Laboratory Medicine, Ministry of Education, and Institute of Medical Virology, Wenzhou Medical College, Zhejiang, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Ruan, Li" sort="Ruan, Li" uniqKey="Ruan L" first="Li" last="Ruan">Li Ruan</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Zhong" sort="Wang, Zhong" uniqKey="Wang Z" first="Zhong" last="Wang">Zhong Wang</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Peking Union Medical College Hospital, Chinese Academy Medical Sciences, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tan, Wenjie" sort="Tan, Wenjie" uniqKey="Tan W" first="Wenjie" last="Tan">Wenjie Tan</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">PLoS ONE</title>
<idno type="eISSN">1932-6203</idno>
<imprint>
<date when="2012">2012</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs) are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI) needs to be characterized systematically by molecular detection with excellent sensitivity.</p>
</sec>
<sec>
<title>Methodology/Principal Findings</title>
<p>In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV) and human bocavirus (HBoV). 157 of the 981 (16.0%) nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%), OC43 (42 cases, 4.3%), HKU1 (16 cases, 1.6%) and NL63 (11 cases, 1.1%). HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003), and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03). 48 of 157(30.57%) HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu) A were the most common viruses detected (more than 35%) in HCoV co-infections. Respiratory syncytial virus (RSV), human parainfluenza virus (PIV) and HBoV were detected in very low rate (less than 1%) among adult patients with URTI.</p>
</sec>
<sec>
<title>Conclusions/Significance</title>
<p>All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Greenberg, Sb" uniqKey="Greenberg S">SB Greenberg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L van der Hoek</name>
</author>
<author>
<name sortKey="Pyrc, K" uniqKey="Pyrc K">K Pyrc</name>
</author>
<author>
<name sortKey="Jebbink, Mf" uniqKey="Jebbink M">MF Jebbink</name>
</author>
<author>
<name sortKey="Vermeulen Oost, W" uniqKey="Vermeulen Oost W">W Vermeulen-Oost</name>
</author>
<author>
<name sortKey="Berkhout, Rj" uniqKey="Berkhout R">RJ Berkhout</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Woo, Pc" uniqKey="Woo P">PC Woo</name>
</author>
<author>
<name sortKey="Lau, Sk" uniqKey="Lau S">SK Lau</name>
</author>
<author>
<name sortKey="Chu, Cm" uniqKey="Chu C">CM Chu</name>
</author>
<author>
<name sortKey="Chan, Kh" uniqKey="Chan K">KH Chan</name>
</author>
<author>
<name sortKey="Tsoi, Hw" uniqKey="Tsoi H">HW Tsoi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
<author>
<name sortKey="Gunther, S" uniqKey="Gunther S">S Gunther</name>
</author>
<author>
<name sortKey="Preiser, W" uniqKey="Preiser W">W Preiser</name>
</author>
<author>
<name sortKey="Van Der Werf, S" uniqKey="Van Der Werf S">S van der Werf</name>
</author>
<author>
<name sortKey="Brodt, Hr" uniqKey="Brodt H">HR Brodt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ksiazek, Tg" uniqKey="Ksiazek T">TG Ksiazek</name>
</author>
<author>
<name sortKey="Erdman, D" uniqKey="Erdman D">D Erdman</name>
</author>
<author>
<name sortKey="Goldsmith, Cs" uniqKey="Goldsmith C">CS Goldsmith</name>
</author>
<author>
<name sortKey="Zaki, Sr" uniqKey="Zaki S">SR Zaki</name>
</author>
<author>
<name sortKey="Peret, T" uniqKey="Peret T">T Peret</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fouchier, Ra" uniqKey="Fouchier R">RA Fouchier</name>
</author>
<author>
<name sortKey="Hartwig, Ng" uniqKey="Hartwig N">NG Hartwig</name>
</author>
<author>
<name sortKey="Bestebroer, Tm" uniqKey="Bestebroer T">TM Bestebroer</name>
</author>
<author>
<name sortKey="Niemeyer, B" uniqKey="Niemeyer B">B Niemeyer</name>
</author>
<author>
<name sortKey="De Jong, Jc" uniqKey="De Jong J">JC de Jong</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Makela, Mj" uniqKey="Makela M">MJ Makela</name>
</author>
<author>
<name sortKey="Puhakka, T" uniqKey="Puhakka T">T Puhakka</name>
</author>
<author>
<name sortKey="Ruuskanen, O" uniqKey="Ruuskanen O">O Ruuskanen</name>
</author>
<author>
<name sortKey="Leinonen, M" uniqKey="Leinonen M">M Leinonen</name>
</author>
<author>
<name sortKey="Saikku, P" uniqKey="Saikku P">P Saikku</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tsang, Kw" uniqKey="Tsang K">KW Tsang</name>
</author>
<author>
<name sortKey="Ho, Pl" uniqKey="Ho P">PL Ho</name>
</author>
<author>
<name sortKey="Ooi, Gc" uniqKey="Ooi G">GC Ooi</name>
</author>
<author>
<name sortKey="Yee, Wk" uniqKey="Yee W">WK Yee</name>
</author>
<author>
<name sortKey="Wang, T" uniqKey="Wang T">T Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L van der Hoek</name>
</author>
<author>
<name sortKey="Sure, K" uniqKey="Sure K">K Sure</name>
</author>
<author>
<name sortKey="Ihorst, G" uniqKey="Ihorst G">G Ihorst</name>
</author>
<author>
<name sortKey="Stang, A" uniqKey="Stang A">A Stang</name>
</author>
<author>
<name sortKey="Pyrc, K" uniqKey="Pyrc K">K Pyrc</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nokso Koivisto, J" uniqKey="Nokso Koivisto J">J Nokso-Koivisto</name>
</author>
<author>
<name sortKey="Pitkaranta, A" uniqKey="Pitkaranta A">A Pitkaranta</name>
</author>
<author>
<name sortKey="Blomqvist, S" uniqKey="Blomqvist S">S Blomqvist</name>
</author>
<author>
<name sortKey="Kilpi, T" uniqKey="Kilpi T">T Kilpi</name>
</author>
<author>
<name sortKey="Hovi, T" uniqKey="Hovi T">T Hovi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pene, F" uniqKey="Pene F">F Pene</name>
</author>
<author>
<name sortKey="Merlat, A" uniqKey="Merlat A">A Merlat</name>
</author>
<author>
<name sortKey="Vabret, A" uniqKey="Vabret A">A Vabret</name>
</author>
<author>
<name sortKey="Rozenberg, F" uniqKey="Rozenberg F">F Rozenberg</name>
</author>
<author>
<name sortKey="Buzyn, A" uniqKey="Buzyn A">A Buzyn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Esper, F" uniqKey="Esper F">F Esper</name>
</author>
<author>
<name sortKey="Weibel, C" uniqKey="Weibel C">C Weibel</name>
</author>
<author>
<name sortKey="Ferguson, D" uniqKey="Ferguson D">D Ferguson</name>
</author>
<author>
<name sortKey="Landry, Ml" uniqKey="Landry M">ML Landry</name>
</author>
<author>
<name sortKey="Kahn, Js" uniqKey="Kahn J">JS Kahn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gerna, G" uniqKey="Gerna G">G Gerna</name>
</author>
<author>
<name sortKey="Percivalle, E" uniqKey="Percivalle E">E Percivalle</name>
</author>
<author>
<name sortKey="Sarasini, A" uniqKey="Sarasini A">A Sarasini</name>
</author>
<author>
<name sortKey="Campanini, G" uniqKey="Campanini G">G Campanini</name>
</author>
<author>
<name sortKey="Piralla, A" uniqKey="Piralla A">A Piralla</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Koetz, A" uniqKey="Koetz A">A Koetz</name>
</author>
<author>
<name sortKey="Nilsson, P" uniqKey="Nilsson P">P Nilsson</name>
</author>
<author>
<name sortKey="Linden, M" uniqKey="Linden M">M Lindén</name>
</author>
<author>
<name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L van der Hoek</name>
</author>
<author>
<name sortKey="Ripa, T" uniqKey="Ripa T">T Ripa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sloots, Tp" uniqKey="Sloots T">TP Sloots</name>
</author>
<author>
<name sortKey="Mcerlean, P" uniqKey="Mcerlean P">P McErlean</name>
</author>
<author>
<name sortKey="Speicher, Dj" uniqKey="Speicher D">DJ Speicher</name>
</author>
<author>
<name sortKey="Arden, Ke" uniqKey="Arden K">KE Arden</name>
</author>
<author>
<name sortKey="Nissen, Md" uniqKey="Nissen M">MD Nissen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Suzuki, A" uniqKey="Suzuki A">A Suzuki</name>
</author>
<author>
<name sortKey="Okamoto, M" uniqKey="Okamoto M">M Okamoto</name>
</author>
<author>
<name sortKey="Ohmi, A" uniqKey="Ohmi A">A Ohmi</name>
</author>
<author>
<name sortKey="Watanabe, O" uniqKey="Watanabe O">O Watanabe</name>
</author>
<author>
<name sortKey="Miyabayashi, S" uniqKey="Miyabayashi S">S Miyabayashi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dare, Rk" uniqKey="Dare R">RK Dare</name>
</author>
<author>
<name sortKey="Fry, Am" uniqKey="Fry A">AM Fry</name>
</author>
<author>
<name sortKey="Chittaganpitch, M" uniqKey="Chittaganpitch M">M Chittaganpitch</name>
</author>
<author>
<name sortKey="Sawanpanyalert, P" uniqKey="Sawanpanyalert P">P Sawanpanyalert</name>
</author>
<author>
<name sortKey="Olsen, Sj" uniqKey="Olsen S">SJ Olsen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dominguez, Sr" uniqKey="Dominguez S">SR Dominguez</name>
</author>
<author>
<name sortKey="Robinson, Cc" uniqKey="Robinson C">CC Robinson</name>
</author>
<author>
<name sortKey="Holmes, Kv" uniqKey="Holmes K">KV Holmes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Esposito, S" uniqKey="Esposito S">S Esposito</name>
</author>
<author>
<name sortKey="Bosis, S" uniqKey="Bosis S">S Bosis</name>
</author>
<author>
<name sortKey="Niesters, Hg" uniqKey="Niesters H">HG Niesters</name>
</author>
<author>
<name sortKey="Tremolati, E" uniqKey="Tremolati E">E Tremolati</name>
</author>
<author>
<name sortKey="Begliatti, E" uniqKey="Begliatti E">E Begliatti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gorse, Gj" uniqKey="Gorse G">GJ Gorse</name>
</author>
<author>
<name sortKey="O Connor, Tz" uniqKey="O Connor T">TZ O'Connor</name>
</author>
<author>
<name sortKey="Hall, Sl" uniqKey="Hall S">SL Hall</name>
</author>
<author>
<name sortKey="Vitale, Jn" uniqKey="Vitale J">JN Vitale</name>
</author>
<author>
<name sortKey="Nichol, Kl" uniqKey="Nichol K">KL Nichol</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Talbot, Hkb" uniqKey="Talbot H">HKB Talbot</name>
</author>
<author>
<name sortKey="Crowe, Je" uniqKey="Crowe J">JE Crowe</name>
</author>
<author>
<name sortKey="Edwards, Km" uniqKey="Edwards K">KM Edwards</name>
</author>
<author>
<name sortKey="Griffin, Mr" uniqKey="Griffin M">MR Griffin</name>
</author>
<author>
<name sortKey="Zhu, Y" uniqKey="Zhu Y">Y Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vabret, A" uniqKey="Vabret A">A Vabret</name>
</author>
<author>
<name sortKey="Mourez, T" uniqKey="Mourez T">T Mourez</name>
</author>
<author>
<name sortKey="Gouarin, S" uniqKey="Gouarin S">S Gouarin</name>
</author>
<author>
<name sortKey="Petitjean, J" uniqKey="Petitjean J">J Petitjean</name>
</author>
<author>
<name sortKey="Freymuth, F" uniqKey="Freymuth F">F Freymuth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gaunt, Er" uniqKey="Gaunt E">ER Gaunt</name>
</author>
<author>
<name sortKey="Hardie, A" uniqKey="Hardie A">A Hardie</name>
</author>
<author>
<name sortKey="Claas, Ecj" uniqKey="Claas E">ECJ Claas</name>
</author>
<author>
<name sortKey="Simmonds, P" uniqKey="Simmonds P">P Simmonds</name>
</author>
<author>
<name sortKey="Templeton, Ke" uniqKey="Templeton K">KE Templeton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ren, L" uniqKey="Ren L">L Ren</name>
</author>
<author>
<name sortKey="Gonzalez, R" uniqKey="Gonzalez R">R Gonzalez</name>
</author>
<author>
<name sortKey="Xu, J" uniqKey="Xu J">J Xu</name>
</author>
<author>
<name sortKey="Xiao, Y" uniqKey="Xiao Y">Y Xiao</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Druce, J" uniqKey="Druce J">J Druce</name>
</author>
<author>
<name sortKey="Tran, T" uniqKey="Tran T">T Tran</name>
</author>
<author>
<name sortKey="Kelly, H" uniqKey="Kelly H">H Kelly</name>
</author>
<author>
<name sortKey="Kaye, M" uniqKey="Kaye M">M Kaye</name>
</author>
<author>
<name sortKey="Chibo, D" uniqKey="Chibo D">D Chibo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yu, X" uniqKey="Yu X">X Yu</name>
</author>
<author>
<name sortKey="Lu, R" uniqKey="Lu R">R Lu</name>
</author>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author>
<name sortKey="Zhu, N" uniqKey="Zhu N">N Zhu</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mackay, Im" uniqKey="Mackay I">IM Mackay</name>
</author>
<author>
<name sortKey="Jacob, Kc" uniqKey="Jacob K">KC Jacob</name>
</author>
<author>
<name sortKey="Woolhouse, D" uniqKey="Woolhouse D">D Woolhouse</name>
</author>
<author>
<name sortKey="Waller, K" uniqKey="Waller K">K Waller</name>
</author>
<author>
<name sortKey="Syrmis, Mw" uniqKey="Syrmis M">MW Syrmis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Manning, A" uniqKey="Manning A">A Manning</name>
</author>
<author>
<name sortKey="Russell, V" uniqKey="Russell V">V Russell</name>
</author>
<author>
<name sortKey="Eastick, K" uniqKey="Eastick K">K Eastick</name>
</author>
<author>
<name sortKey="Leadbetter, Gh" uniqKey="Leadbetter G">GH Leadbetter</name>
</author>
<author>
<name sortKey="Hallam, N" uniqKey="Hallam N">N Hallam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lau, Sk" uniqKey="Lau S">SK Lau</name>
</author>
<author>
<name sortKey="Woo, Pc" uniqKey="Woo P">PC Woo</name>
</author>
<author>
<name sortKey="Yip, Cc" uniqKey="Yip C">CC Yip</name>
</author>
<author>
<name sortKey="Tse, H" uniqKey="Tse H">H Tse</name>
</author>
<author>
<name sortKey="Tsoi, Hw" uniqKey="Tsoi H">HW Tsoi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vabret, A" uniqKey="Vabret A">A Vabret</name>
</author>
<author>
<name sortKey="Dina, J" uniqKey="Dina J">J Dina</name>
</author>
<author>
<name sortKey="Gouarin, S" uniqKey="Gouarin S">S Gouarin</name>
</author>
<author>
<name sortKey="Petitjean, J" uniqKey="Petitjean J">J Petitjean</name>
</author>
<author>
<name sortKey="Tripey, V" uniqKey="Tripey V">V Tripey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kuypers, J" uniqKey="Kuypers J">J Kuypers</name>
</author>
<author>
<name sortKey="Martin, Et" uniqKey="Martin E">ET Martin</name>
</author>
<author>
<name sortKey="Heugel, J" uniqKey="Heugel J">J Heugel</name>
</author>
<author>
<name sortKey="Wright, N" uniqKey="Wright N">N Wright</name>
</author>
<author>
<name sortKey="Morrow, R" uniqKey="Morrow R">R Morrow</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Risku, M" uniqKey="Risku M">M Risku</name>
</author>
<author>
<name sortKey="Lappalainen, S" uniqKey="Lappalainen S">S Lappalainen</name>
</author>
<author>
<name sortKey="Rasanen, S" uniqKey="Rasanen S">S Rasanen</name>
</author>
<author>
<name sortKey="Vesikari, T" uniqKey="Vesikari T">T Vesikari</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shao, X" uniqKey="Shao X">X Shao</name>
</author>
<author>
<name sortKey="Guo, X" uniqKey="Guo X">X Guo</name>
</author>
<author>
<name sortKey="Esper, F" uniqKey="Esper F">F Esper</name>
</author>
<author>
<name sortKey="Weibel, C" uniqKey="Weibel C">C Weibel</name>
</author>
<author>
<name sortKey="Kahn, Js" uniqKey="Kahn J">JS Kahn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bellei, N" uniqKey="Bellei N">N Bellei</name>
</author>
<author>
<name sortKey="Carraro, E" uniqKey="Carraro E">E Carraro</name>
</author>
<author>
<name sortKey="Perosa, A" uniqKey="Perosa A">A Perosa</name>
</author>
<author>
<name sortKey="Watanabe, A" uniqKey="Watanabe A">A Watanabe</name>
</author>
<author>
<name sortKey="Arruda, E" uniqKey="Arruda E">E Arruda</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Heikkinen, T" uniqKey="Heikkinen T">T Heikkinen</name>
</author>
<author>
<name sortKey="Jarvinen, A" uniqKey="Jarvinen A">A Jarvinen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mahony, Jb" uniqKey="Mahony J">JB Mahony</name>
</author>
<author>
<name sortKey="Petrich, A" uniqKey="Petrich A">A Petrich</name>
</author>
<author>
<name sortKey="Smieja, M" uniqKey="Smieja M">M Smieja</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pyrc, K" uniqKey="Pyrc K">K Pyrc</name>
</author>
<author>
<name sortKey="Sto Ek, K" uniqKey="Sto Ek K">K Stożek</name>
</author>
<author>
<name sortKey="Wojcik, K" uniqKey="Wojcik K">K Wojcik</name>
</author>
<author>
<name sortKey="Gawron, K" uniqKey="Gawron K">K Gawron</name>
</author>
<author>
<name sortKey="Zeglen, S" uniqKey="Zeglen S">S Zeglen</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">PLoS One</journal-id>
<journal-id journal-id-type="iso-abbrev">PLoS ONE</journal-id>
<journal-id journal-id-type="publisher-id">plos</journal-id>
<journal-id journal-id-type="pmc">plosone</journal-id>
<journal-title-group>
<journal-title>PLoS ONE</journal-title>
</journal-title-group>
<issn pub-type="epub">1932-6203</issn>
<publisher>
<publisher-name>Public Library of Science</publisher-name>
<publisher-loc>San Francisco, USA</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">22719912</article-id>
<article-id pub-id-type="pmc">3376151</article-id>
<article-id pub-id-type="publisher-id">PONE-D-12-04432</article-id>
<article-id pub-id-type="doi">10.1371/journal.pone.0038638</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research Article</subject>
</subj-group>
<subj-group subj-group-type="Discipline-v2">
<subject>Biology</subject>
<subj-group>
<subject>Anatomy and Physiology</subject>
<subj-group>
<subject>Respiratory System</subject>
</subj-group>
</subj-group>
<subj-group>
<subject>Microbiology</subject>
<subj-group>
<subject>Virology</subject>
<subj-group>
<subject>Viral classification</subject>
<subj-group>
<subject>RNA viruses</subject>
</subj-group>
</subj-group>
</subj-group>
</subj-group>
</subj-group>
<subj-group subj-group-type="Discipline-v2">
<subject>Medicine</subject>
<subj-group>
<subject>Diagnostic Medicine</subject>
<subj-group>
<subject>Test Evaluation</subject>
</subj-group>
</subj-group>
<subj-group>
<subject>Epidemiology</subject>
</subj-group>
<subj-group>
<subject>Infectious Diseases</subject>
</subj-group>
<subj-group>
<subject>Pulmonology</subject>
<subj-group>
<subject>Respiratory Infections</subject>
<subj-group>
<subject>Upper Respiratory Tract Infections</subject>
</subj-group>
</subj-group>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Characterization of Human Coronavirus Etiology in Chinese Adults with Acute Upper Respiratory Tract Infection by Real-Time RT-PCR Assays</article-title>
<alt-title alt-title-type="running-head">Coronaviruses Infection in Adult</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Lu</surname>
<given-names>Roujian</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yu</surname>
<given-names>Xiaoyan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Wen</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Duan</surname>
<given-names>Xijie</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Linglin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhou</surname>
<given-names>Weimin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xu</surname>
<given-names>Jin</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xu</surname>
<given-names>Lingjie</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hu</surname>
<given-names>Qin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lu</surname>
<given-names>Jianxin</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ruan</surname>
<given-names>Li</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Zhong</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="cor1">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tan</surname>
<given-names>Wenjie</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="cor1">
<sup>*</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<addr-line>National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China</addr-line>
</aff>
<aff id="aff2">
<label>2</label>
<addr-line>Peking Union Medical College Hospital, Chinese Academy Medical Sciences, Beijing, China</addr-line>
</aff>
<aff id="aff3">
<label>3</label>
<addr-line>Key Laboratory of Laboratory Medicine, Ministry of Education, and Institute of Medical Virology, Wenzhou Medical College, Zhejiang, China</addr-line>
</aff>
<contrib-group>
<contrib contrib-type="editor">
<name>
<surname>Pyrc</surname>
<given-names>Krzysztof</given-names>
</name>
<role>Editor</role>
<xref ref-type="aff" rid="edit1"></xref>
</contrib>
</contrib-group>
<aff id="edit1">Faculty of Biochemistry Biophysics and Biotechnology, Jagiellonian University, Poland</aff>
<author-notes>
<corresp id="cor1">* E-mail:
<email>wangzhong523@vip.163.com</email>
(ZW);
<email>tanwj28@yahoo.cn</email>
(WT)</corresp>
<fn fn-type="con">
<p>Conceived and designed the experiments: RL ZW WT. Performed the experiments: RL XY WW QH LZ WMZ JX LX XD. Analyzed the data: RL XY JL LR WZ WT. Contributed reagents/materials/analysis tools: JX LX. Wrote the paper: RL ZW WT.</p>
</fn>
</author-notes>
<pub-date pub-type="collection">
<year>2012</year>
</pub-date>
<pub-date pub-type="epub">
<day>15</day>
<month>6</month>
<year>2012</year>
</pub-date>
<volume>7</volume>
<issue>6</issue>
<elocation-id>e38638</elocation-id>
<history>
<date date-type="received">
<day>10</day>
<month>2</month>
<year>2012</year>
</date>
<date date-type="accepted">
<day>8</day>
<month>5</month>
<year>2012</year>
</date>
</history>
<permissions>
<copyright-statement>Lu et al.</copyright-statement>
<copyright-year>2012</copyright-year>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are properly credited.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs) are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI) needs to be characterized systematically by molecular detection with excellent sensitivity.</p>
</sec>
<sec>
<title>Methodology/Principal Findings</title>
<p>In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV) and human bocavirus (HBoV). 157 of the 981 (16.0%) nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%), OC43 (42 cases, 4.3%), HKU1 (16 cases, 1.6%) and NL63 (11 cases, 1.1%). HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003), and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03). 48 of 157(30.57%) HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu) A were the most common viruses detected (more than 35%) in HCoV co-infections. Respiratory syncytial virus (RSV), human parainfluenza virus (PIV) and HBoV were detected in very low rate (less than 1%) among adult patients with URTI.</p>
</sec>
<sec>
<title>Conclusions/Significance</title>
<p>All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.</p>
</sec>
</abstract>
<counts>
<page-count count="7"></page-count>
</counts>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>Human coronaviruses (HCoVs) are enveloped viruses with a single-strand RNA genome
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
. 5 species are known to infect humans, 229E and OC43 first were identified in the 1960s, NL63 and HKU1 identified in 2004 and 2005, respectively
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
<xref rid="pone.0038638-Woo1" ref-type="bibr">[3]</xref>
, and SARS-CoV was identified during the severe acute respiratory syndrome epidemic in 2003
<xref rid="pone.0038638-Drosten1" ref-type="bibr">[4]</xref>
<xref rid="pone.0038638-Ksiazek1" ref-type="bibr">[5]</xref>
. HCoVs are associated with respiratory syndromes ranging from mild upper to severe lower respiratory tract infections including pneumonia and bronchiolitis
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Fouchier1" ref-type="bibr">[6]</xref>
<xref rid="pone.0038638-vanderHoek2" ref-type="bibr">[9]</xref>
. Specifically, HCoVs can elicit a more serious respiratory disease in children, the elderly and people with underlying disease
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Fouchier1" ref-type="bibr">[6]</xref>
,
<xref rid="pone.0038638-NoksoKoivisto1" ref-type="bibr">[10]</xref>
<xref rid="pone.0038638-Pene1" ref-type="bibr">[11]</xref>
. HCoVs circulate worldwide, although their frequencies differ from country to country depending on seasonality and detection annum
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Esper1" ref-type="bibr">[12]</xref>
<xref rid="pone.0038638-Suzuki1" ref-type="bibr">[16]</xref>
. Most studies have focused on children or adults with more serious respiratory disease including lower respiratory tract infections
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Dare1" ref-type="bibr">[17]</xref>
<xref rid="pone.0038638-Vabret1" ref-type="bibr">[22]</xref>
.</p>
<p>Upper respiratory tract infections (URTI) or “the common cold” are a significant health burden, especially among children. The major viral agents of URTI in children include rhinoviruses, HCoVs (–OC43 and –229E), RSV,PIV, adenovirus(ADV) and influenza(Flu). newly identified viruses (hMPV, HCoV-NL63,HCoV-HKU1 and HBoV) are also included. Although HCoVs are recognized as one of the most frequent causes of URTI or common colds in adults
<xref rid="pone.0038638-Makela1" ref-type="bibr">[7]</xref>
, epidemiological data and clinical profiles are limited on HCoVs infection in adults with URTI continuously for several years with sensitive molecular methods
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Gerna1" ref-type="bibr">[13]</xref>
,
<xref rid="pone.0038638-Gorse1" ref-type="bibr">[20]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
<xref rid="pone.0038638-Druce1" ref-type="bibr">[25]</xref>
, especially for HCoV-NL63 and HCoV-HKU1 in China after 2009 H1N1 pandemic. Ren et al reported the prevalence of HCoVs was 1% in adults with ARTI in Beijing from 2005 to 2009 by RT-PCR assays
<xref rid="pone.0038638-Ren1" ref-type="bibr">[24]</xref>
, which was significantly lower than in previous literatures indicated above 2.1%
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Gerna1" ref-type="bibr">[13]</xref>
,
<xref rid="pone.0038638-Gorse1" ref-type="bibr">[20]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
. In the present study, 981 nasopharyngeal swabs were collected continuously from adults with URTI in Beijing between March 2009 and February 2011. HCoVs infections were detected by Real-Time RT-PCR with excellent specifity and sensitivity
<xref rid="pone.0038638-Esposito1" ref-type="bibr">[19]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
,
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
, other 11 respiratory viruses infection among all specimens were also detected by sensitive molecular assays
<xref rid="pone.0038638-Druce1" ref-type="bibr">[25]</xref>
<xref rid="pone.0038638-Manning1" ref-type="bibr">[28]</xref>
. HCoVs infection and their clinical and epidemiological characteristics were analyzed.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and Methods</title>
<sec id="s2a">
<title>Ethics Issues</title>
<p>All aspects of the study were performed in accordance with the national ethics regulations and approved by the Institutional Review Boards of the Centre for Disease Control and Prevention of China, as well as the Ethics Committee of Peking Union Medical College Hospital. Participants were received "Written Informed Consent" on the study’s purpose and of their right to keep information confidential. Written consent was obtained from all participants or their guardians.</p>
</sec>
<sec id="s2b">
<title>Patients and Specimens</title>
<p>Nasopharyngeal swabs were collected from adults presenting with URTI to the Peking Union Medical College Hospital, Beijing, China, between March 2009 and February 2011. Patients provided informed consent for specimen collection and testing. All patients over 14 years of age were selected according to a set of criteria that included respiratory symptoms, a body temperature above 37.5°C, and a normal or low leukocyte count(≤10
<sup>10</sup>
/L), but not LRTI identified by pulmonary abnormalities on radiography and clinical descriptions(without bronchitis, bronchiolitis and pneumonia). Demographic data and clinical findings at the time of diagnosis were recorded on a standard form. All swabs were collected into viral transport medium and transported for immediate testing to the National Institute for Viral Disease Control and Prevention (NIVDC), China Center for Disease Control and Prevention.</p>
</sec>
<sec id="s2c">
<title>Nucleic Acid Extraction and cDNA Synthesis</title>
<p>Viral RNA was extracted from 200 µl of sample using QIAamp MinElute Virus Spin kits (Qiagen, Germany). cDNA was synthesized with AMV reverse transcriptase and random hexamer primers (Promega, USA) as described previously
<xref rid="pone.0038638-Esposito1" ref-type="bibr">[19]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
,
<xref rid="pone.0038638-Druce1" ref-type="bibr">[25]</xref>
.</p>
</sec>
<sec id="s2d">
<title>Real-time RT-PCR for HCoV Detection</title>
<p>Real-time RT-PCR amplification was performed using TaqMan® One-Step RT-PCR Master Mix Reagents Kit (Applied Biosystems, USA)
<xref rid="pone.0038638-Esposito1" ref-type="bibr">[19]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
,
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
. A real-time reverse transcription (RT)-PCR technique was used to screen for each of the 4 non-SARS HCoVs (
<xref ref-type="table" rid="pone-0038638-t001">Table 1</xref>
). PCR was performed under the following conditions: 48°C for 30 min, 95°C for 15 min, followed by 40 cycles at 95°C for 15s, 68°C for 1min.The lower limit of detection of each HCoV real-time RT-PCR assay was 50–100 copies/25uL.The assay sensitivity, specificity and coefficients of variability(CVs) were evaluated and validated as previously described
<xref rid="pone.0038638-Esposito1" ref-type="bibr">[19]</xref>
,
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
.</p>
<table-wrap id="pone-0038638-t001" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0038638.t001</object-id>
<label>Table 1</label>
<caption>
<title>Primers and Probes (5′–3′), and Their Gene Product Targets, Used for the Respiratory Viruses Identified in the Study.</title>
</caption>
<alternatives>
<graphic id="pone-0038638-t001-1" xlink:href="pone.0038638.t001"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Assays andViruses detected</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">Primer
<xref ref-type="table-fn" rid="nt101">*</xref>
and probe</td>
<td align="left" rowspan="1" colspan="1">Target genes</td>
<td align="left" rowspan="1" colspan="1">Ref</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>Real-time rtPCR</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">HCoV-OC43</td>
<td align="left" rowspan="1" colspan="1">OC43-F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GCTCAGGAAGGTCTGCTCC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">N</td>
<td align="left" rowspan="1" colspan="1">19</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">OC43-R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">TCCTGCACTAGAGGCTCTGC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">OC43-P</td>
<td align="left" rowspan="1" colspan="1">FAM –TTCCAGATCTACTTCGCGCACATCC-TAMRA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">HCoV-229E</td>
<td align="left" rowspan="1" colspan="1">229E-F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CGCAAGAATTCAGAACCAGAG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">N</td>
<td align="left" rowspan="1" colspan="1">19</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">229E-R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GGCAGTCAGGTTCTTCAACAA</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">229E-P</td>
<td align="left" rowspan="1" colspan="1">FAM –CCACACTTCAATCAAAAGCTCCCAAATG-TAMRA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">HCoV-NL63</td>
<td align="left" rowspan="1" colspan="1">NL63-F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">AGGACCTTAAATTCAGACAACGTTCT</named-content>
</td>
<td align="left" rowspan="1" colspan="1">N</td>
<td align="left" rowspan="1" colspan="1">19</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">NL63-R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GATTACGTTTGCGATTACCAAGACT</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">NL63-P</td>
<td align="left" rowspan="1" colspan="1">FAM- TAACAGTTTTAGCACCTTCCTTAGCAACCCAAACA-TAMRA</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">HCoV-HKU1</td>
<td align="left" rowspan="1" colspan="1">HKU1-F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">AGTTCCCATTGCTTTCGGAGTA</named-content>
</td>
<td align="left" rowspan="1" colspan="1">N</td>
<td align="left" rowspan="1" colspan="1">19</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HKU1-R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CCGGCTGTGTCTATACCAATATCC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HKU1-P</td>
<td align="left" rowspan="1" colspan="1">FAM -CCCCTTCTGAAGCAA- MGB</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>Multiple-nested PCR</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>Mix1</bold>
FluA</td>
<td align="left" rowspan="1" colspan="1">FA-1F</td>
<td align="left" rowspan="1" colspan="1">CAGAGACTTGARRATGTYTTTGC</td>
<td align="left" rowspan="1" colspan="1">Matrix</td>
<td align="left" rowspan="1" colspan="1">26</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">FA-1R</td>
<td align="left" rowspan="1" colspan="1">GGCAAGYGCACCRGYWGARTARCT</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">FA-2F</td>
<td align="left" rowspan="1" colspan="1">GACCRATCCTGTCACCTCTGACT</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">FA-2R</td>
<td align="left" rowspan="1" colspan="1">AYYTCYTT GC
<named-content content-type="gene">CCATGGAATGT</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">FluB</td>
<td align="left" rowspan="1" colspan="1">FB-1F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GTGACTGGTGTGATACCACT</named-content>
</td>
<td align="left" rowspan="1" colspan="1">HA</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">FB-1R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">TGTTTTCACCCATATTGGGC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">FB-2F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CATTTTGCAAATCTCAAAGG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">FB-2R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">TGGAGGCAATCTGCTTCACC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">ADV</td>
<td align="left" rowspan="1" colspan="1">AD-1F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GCCGCAGTGGTCTTACATGCACATC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">Hexon</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AD-1R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CAGCACGCCGCGGATGTCAAAGT</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AD-2F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GCCACCGAGACGTACTTCAGCCTG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AD-2R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">TTGTACGAGTACGCGGTATCCTCGCGGTC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AD-2F9</td>
<td align="left" rowspan="1" colspan="1">CMGASACSTACTTCAGYMTG</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AD-2R9</td>
<td align="left" rowspan="1" colspan="1">GTASGYRKTRTCYTCSCGGTC</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>Mix2</bold>
hRSV</td>
<td align="left" rowspan="1" colspan="1">RS-1F</td>
<td align="left" rowspan="1" colspan="1">TGGGAGARGTRGCTCCAGAATACAGGC</td>
<td align="left" rowspan="1" colspan="1">N</td>
<td align="left" rowspan="1" colspan="1">26</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">RS-1R</td>
<td align="left" rowspan="1" colspan="1">ARCATYACTTGCCCTGMACCATAGGC</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">RS-2F</td>
<td align="left" rowspan="1" colspan="1">ACYAAATTAGCAGCAGGG</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">RS-2R</td>
<td align="left" rowspan="1" colspan="1">CTCTKGTWGAWGATTGTGC</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Picornavirus</td>
<td align="left" rowspan="1" colspan="1">PIC-1F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GCACTTCTGTTTCCCC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">5?-UTR</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">PIC-1R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CGGACACCCAAAGTAG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">PIC-2F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GCACTTCTGTTTCCCC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>Mix3</bold>
PIV (-1,-2,-3)</td>
<td align="left" rowspan="1" colspan="1">P123-1F</td>
<td align="left" rowspan="1" colspan="1">GTWCAAGGAGAYAATCARGC</td>
<td align="left" rowspan="1" colspan="1">L</td>
<td align="left" rowspan="1" colspan="1">26</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">P123-1R</td>
<td align="left" rowspan="1" colspan="1">GRTCYGGAGTTTCWARWCC</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">P1-2F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GCATCAGACCCTTATTCATG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">P1-2R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GTTGTATCAAGCATCCCGGC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">P2-2F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CAGCCGATCCATACTCATTG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">P2-2R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CTTGTGGTGTCAAAAAATCC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">P3-2F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GCTGTTACTACAAGAGTACC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">P3-2R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GTTGCCAGATTTGAGGATGC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>rtPCR</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">hMPV</td>
<td align="left" rowspan="1" colspan="1">hMPV-F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">AACCGTGTACTAAGTGATGCACTC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">N</td>
<td align="left" rowspan="1" colspan="1">27</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">hMPV-R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CATTGTTTGACCGGCCCCATAA</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>Nested PCR</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">HBoV</td>
<td align="left" rowspan="1" colspan="1">HBoV-1F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CCAGCAAGTCCTCCAAACTCACCTGC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">NP-1</td>
<td align="left" rowspan="1" colspan="1">28</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HBoV-1R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GGAGCTTCAGGATTGGAAGCTCTGTG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HBoV-2F</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">GACCTCTGTAAGTACTATTAC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">HBoV-2R</td>
<td align="left" rowspan="1" colspan="1">
<named-content content-type="gene">CTCTGTGTTGACTGAATACAG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt101">
<label>*</label>
<p>K  =  G+T, M  =  A+C, R  =  A+G, S  =  G+C, W  =  A+T, Y  =  C+T.</p>
</fn>
<fn id="nt102">
<label></label>
<p>1st round primers:–1F,–1R; 2 nd round primers: –2F or –2F9, –2R or –2R9.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2e">
<title>Gel-based RT-PCR for Detection of non-HCoV Respiratory Viruses</title>
<p>Specimens were also screened for influenza virus types A and B, parainfluenza virus types 1 to 3, respiratory syncytial virus (RSV), picornaviruses (including enteroviruses and rhinoviruses) and adenoviruses using three multiple-nested PCR assays
<xref rid="pone.0038638-Druce1" ref-type="bibr">[25]</xref>
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
(
<xref ref-type="table" rid="pone-0038638-t001">Table 1</xref>
), for human metapneumovirus (hMPV) and human bocavirus (HBoV) using PCR and nested-PCR assays
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
<xref rid="pone.0038638-Manning1" ref-type="bibr">[28]</xref>
(
<xref ref-type="table" rid="pone-0038638-t001">Table 1</xref>
). Multiple-nested PCR and nested PCR programs were run as follows: 1
<sup>st</sup>
round: 94°C for 2 min; 94°C for 30 s, 55/50°C 30 s, 72°C for 1 min, 35 cycles; 72°C 5 min. 2
<sup>nd</sup>
round: 94°C for 2 min; 94°C for 30s, 55/50°C 30s, 72°C for 1 min, 25 cycles; 72°C 5 min. RT-PCR program was run as follows: 50°C 30 min; 95 °C 15 min; 95°C 30s, 60°C 30s, 72°C 1 min, 40 cycles; 72°C 5 min. The lower limits of detection for nested PCR and RT-PCR assays were 10–100 single virus molecules/25 ul. All PCR products were confirmed by sequencing.</p>
</sec>
<sec id="s2f">
<title>Statistical Analysis</title>
<p>Statistical analysis was performed using the predictive analysis software (PASW) statistics 18 package with X
<sup>2</sup>
-test and Fisher’s exact test.</p>
</sec>
</sec>
<sec id="s3">
<title>Results</title>
<sec id="s3a">
<title>Detection of HCoVs and Other 11 Respiratory Viruses Infection</title>
<p>A total of 981 nasopharyngeal swabs were collected. The male: female ratio was 438∶543 (1∶1.24) and the median age was 29 years (age range 14 years to 91 years). HCoVs were detected by real-time RT-PCR in 157 (16.0%) of the 981 specimens: 229E in 96 (9.8%), OC43 in 42 (4.3%), HKU1 in 16 (1.6%) and NL63 in 11(1.1%). The detection rates of HCoVs are summarized in
<xref ref-type="table" rid="pone-0038638-t002">Table 2</xref>
. Differences in the detection rates of OC43 and NL63 during 2009/10 and 2010/11 were statistically significant (P<0.001 and P = 0.003, respectively).</p>
<table-wrap id="pone-0038638-t002" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0038638.t002</object-id>
<label>Table 2</label>
<caption>
<title>Prevalence of Different Respiratory Virus Infections from March 2009 to February 2011.</title>
</caption>
<alternatives>
<graphic id="pone-0038638-t002-2" xlink:href="pone.0038638.t002"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td colspan="2" align="left" rowspan="1">Respiratory Virus</td>
<td colspan="2" align="left" rowspan="1">No. of detections (%)</td>
<td align="left" rowspan="1" colspan="1">Total</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1"></td>
<td align="left" rowspan="1" colspan="1">03/09–02/10</td>
<td align="left" rowspan="1" colspan="1">03/10–02/11</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1"></td>
<td align="left" rowspan="1" colspan="1">(N = 539 cases)</td>
<td align="left" rowspan="1" colspan="1">(N = 442 cases)</td>
<td align="left" rowspan="1" colspan="1">981</td>
</tr>
</thead>
<tbody>
<tr>
<td colspan="2" align="left" rowspan="1">HCoV-OC43</td>
<td align="left" rowspan="1" colspan="1">38(7.1)
<xref ref-type="table-fn" rid="nt103">**</xref>
</td>
<td align="left" rowspan="1" colspan="1">4(0.9)</td>
<td align="left" rowspan="1" colspan="1">42(4.3)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">HCoV-229E</td>
<td align="left" rowspan="1" colspan="1">58(10.8)</td>
<td align="left" rowspan="1" colspan="1">38(8.6)</td>
<td align="left" rowspan="1" colspan="1">96(9.8)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">HCoV-NL63</td>
<td align="left" rowspan="1" colspan="1">11(2.0) *</td>
<td align="left" rowspan="1" colspan="1">0(0)</td>
<td align="left" rowspan="1" colspan="1">11(1.1)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">HCoV-HKU1</td>
<td align="left" rowspan="1" colspan="1">12(2.2)</td>
<td align="left" rowspan="1" colspan="1">4(0.9)</td>
<td align="left" rowspan="1" colspan="1">16(1.6)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">Flu A</td>
<td align="left" rowspan="1" colspan="1">84(15.6)
<xref ref-type="table-fn" rid="nt103">**</xref>
</td>
<td align="left" rowspan="1" colspan="1">3(0.7)</td>
<td align="left" rowspan="1" colspan="1">87(8.9)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">Flu B</td>
<td align="left" rowspan="1" colspan="1">17(3.2)</td>
<td align="left" rowspan="1" colspan="1">1(0.2)</td>
<td align="left" rowspan="1" colspan="1">18(1.8)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">PIV-1</td>
<td align="left" rowspan="1" colspan="1">4(0.7)</td>
<td align="left" rowspan="1" colspan="1">1(0.2)</td>
<td align="left" rowspan="1" colspan="1">5(0.5)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">PIV-2</td>
<td align="left" rowspan="1" colspan="1">1(0.2)</td>
<td align="left" rowspan="1" colspan="1">0(0)</td>
<td align="left" rowspan="1" colspan="1">1(0.1)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">PIV-3</td>
<td align="left" rowspan="1" colspan="1">0(0)</td>
<td align="left" rowspan="1" colspan="1">0(0)</td>
<td align="left" rowspan="1" colspan="1">0(0)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">ADV</td>
<td align="left" rowspan="1" colspan="1">19(3.5)</td>
<td align="left" rowspan="1" colspan="1">1(0.2)</td>
<td align="left" rowspan="1" colspan="1">20(2.0)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">hRSV</td>
<td align="left" rowspan="1" colspan="1">1(0.2)</td>
<td align="left" rowspan="1" colspan="1">0(0)</td>
<td align="left" rowspan="1" colspan="1">1(0.1)</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Piconavirus</td>
<td align="left" rowspan="1" colspan="1">Rhinoviruses</td>
<td align="left" rowspan="1" colspan="1">57(10.6)</td>
<td align="left" rowspan="1" colspan="1">14(3.2)</td>
<td align="left" rowspan="1" colspan="1">71(7.2)</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">Enterovirus</td>
<td align="left" rowspan="1" colspan="1">7(1.3)</td>
<td align="left" rowspan="1" colspan="1">0(0)</td>
<td align="left" rowspan="1" colspan="1">7(0.7)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">hMPV</td>
<td align="left" rowspan="1" colspan="1">13(2.4)</td>
<td align="left" rowspan="1" colspan="1">13(2.9)</td>
<td align="left" rowspan="1" colspan="1">26(2.7)</td>
</tr>
<tr>
<td colspan="2" align="left" rowspan="1">HBoV</td>
<td align="left" rowspan="1" colspan="1">0(0)</td>
<td align="left" rowspan="1" colspan="1">2(0.5)</td>
<td align="left" rowspan="1" colspan="1">2(0.2)</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt103">
<label>**</label>
<p>P<0.001; *P = 0.003.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>Other 11 respiratory viruses infection among all specimens were also detected by sensitive molecular assays (
<xref ref-type="table" rid="pone-0038638-t001">Table 1</xref>
). During the same period, Flu A virus was detected in 87(8.9%) patients, Flu B virus was detected in 18(1.8%) patients, PIV-1 was detected in 5(0.5%) patients, PIV-2 was detected in 1(0.1%) patient, ADV was detected in 20(2.0%) patients, RSV was 1(0.1%) patient, rhinoviruses was detected in 71(7.2%) patients, enterovirus was detected in 7(0.7%) patients, hMPV was detected in 26(2.7%), and HBoV was detected in 2(0.2%) patients(
<xref ref-type="table" rid="pone-0038638-t002">Table 2</xref>
).</p>
</sec>
<sec id="s3b">
<title>Epidemiology of HcoVs</title>
<p>The seasonal distribution of HCoVs is shown in
<xref ref-type="fig" rid="pone-0038638-g001">Fig.1</xref>
. HCoV-229E was the most common species, appearing in most months and without an obvious seasonal distribution. Peaks in 229E detections occurred in May 2009, December 2009 and August 2010, corresponding with spring, winter and summer, respectively, in Beijing. HCoV-OC43 detections peaked in April 2009. This virus continued to circulate for the next 10 months but only sporadic infections were detected in the second half of the study. In 2009, when most coronavirus infections occurred, 229E and OC43 were detected in every evaluable month, with the exception of 229E in September. A peak of NL63 activity occurred in March and April 2009 with little or no subsequent activity. HCoV-HKU1 activity was sporadic throughout, with no obvious seasonal distribution.</p>
<fig id="pone-0038638-g001" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0038638.g001</object-id>
<label>Figure 1</label>
<caption>
<title>Temporal distribution of the 4 HCoV species between March 2009 and February 2011 inclusive.</title>
</caption>
<graphic xlink:href="pone.0038638.g001"></graphic>
</fig>
<p>HCoVs were detected across all age groups, although NL63 cases were absent in the 30–39 years age group (
<xref ref-type="fig" rid="pone-0038638-g002">Fig.2</xref>
). A significantly higher detection frequency of HKU1 occurred in patients aged over 60 years (P = 0.03), but there were no significant differences in age group distribution for 229E, OC43 and NL63.</p>
<fig id="pone-0038638-g002" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0038638.g002</object-id>
<label>Figure 2</label>
<caption>
<title>Frequencies of the four non SARS HCoVs infections detection by different age groups.</title>
</caption>
<graphic xlink:href="pone.0038638.g002"></graphic>
</fig>
</sec>
<sec id="s3c">
<title>Clinical Characteristics of Patients with HCoVs Infection</title>
<p>Approximately equal numbers of males and females were infected with OC43, HKU1 and NL63; 229E infected significantly more female than males (62.5% versus 37.5%, P = 0.009). The clinical characteristics are summarized in
<xref ref-type="table" rid="pone-0038638-t003">Table 3</xref>
. All HCoV positive patients presented with URTI. Fever, sore throat and headache were the most common symptoms at presentation. Gastrointestinal tract associated symptoms were rare. Overall there were no statistically significant differences in the clinical symptoms between species-specific HCoVs except for rhinorrhea, which was observed less in 229E-infected patients than in the other cases (P = 0.025).</p>
<table-wrap id="pone-0038638-t003" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0038638.t003</object-id>
<label>Table 3</label>
<caption>
<title>Clinical characteristics of patients with HCoV infections in the study.</title>
</caption>
<alternatives>
<graphic id="pone-0038638-t003-3" xlink:href="pone.0038638.t003"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Characteristics</td>
<td align="left" rowspan="1" colspan="1">OC43 (N = 42)</td>
<td align="left" rowspan="1" colspan="1">229E (N = 96)</td>
<td align="left" rowspan="1" colspan="1">NL63 (N = 11)</td>
<td align="left" rowspan="1" colspan="1">HKU1(N = 16)</td>
<td align="left" rowspan="1" colspan="1">P-value</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>Demographics:</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Gender ratio (M/F)</td>
<td align="left" rowspan="1" colspan="1">1.1</td>
<td align="left" rowspan="1" colspan="1">0.58</td>
<td align="left" rowspan="1" colspan="1">0.83</td>
<td align="left" rowspan="1" colspan="1">0.78</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Age in years mean/median</td>
<td align="left" rowspan="1" colspan="1">33.5/28.5</td>
<td align="left" rowspan="1" colspan="1">32.3/28</td>
<td align="left" rowspan="1" colspan="1">41.45/41</td>
<td align="left" rowspan="1" colspan="1">38.1/31.5</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td colspan="6" align="left" rowspan="1">
<bold>Respiratory symptoms:</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Fever(>38°C)</td>
<td align="left" rowspan="1" colspan="1">37 (88.1%)</td>
<td align="left" rowspan="1" colspan="1">79 (82.3%)</td>
<td align="left" rowspan="1" colspan="1">10 (90.9%)</td>
<td align="left" rowspan="1" colspan="1">12 (85.7%)</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Chills</td>
<td align="left" rowspan="1" colspan="1">6 (14.3%)</td>
<td align="left" rowspan="1" colspan="1">24 (25%)</td>
<td align="left" rowspan="1" colspan="1">2 (18.2%)</td>
<td align="left" rowspan="1" colspan="1">4 (25%)</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Sore throat</td>
<td align="left" rowspan="1" colspan="1">27 (64.3%)</td>
<td align="left" rowspan="1" colspan="1">63 (65.6%)</td>
<td align="left" rowspan="1" colspan="1">8 (72.7%)</td>
<td align="left" rowspan="1" colspan="1">10 (62.5%)</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Nasal obstruction</td>
<td align="left" rowspan="1" colspan="1">9 (21.4%)</td>
<td align="left" rowspan="1" colspan="1">18 (18.8%)</td>
<td align="left" rowspan="1" colspan="1">3 (27.3%)</td>
<td align="left" rowspan="1" colspan="1">2 (12.5%)</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Rhinorrhea</td>
<td align="left" rowspan="1" colspan="1">17 (40.5%)</td>
<td align="left" rowspan="1" colspan="1">23 (24%)</td>
<td align="left" rowspan="1" colspan="1">5 (45.5%)</td>
<td align="left" rowspan="1" colspan="1">9 (56.2%)</td>
<td align="left" rowspan="1" colspan="1"> = 0.025</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Cough</td>
<td align="left" rowspan="1" colspan="1">14 (33.3%)</td>
<td align="left" rowspan="1" colspan="1">30 (31.2%)</td>
<td align="left" rowspan="1" colspan="1">7 (63.6%)</td>
<td align="left" rowspan="1" colspan="1">9 (56.3%)</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Sputum production</td>
<td align="left" rowspan="1" colspan="1">8 (19%)</td>
<td align="left" rowspan="1" colspan="1">16 (16.7%)</td>
<td align="left" rowspan="1" colspan="1">5 (45.5%)</td>
<td align="left" rowspan="1" colspan="1">4 (25%)</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
<tr>
<td colspan="6" align="left" rowspan="1">
<bold>Gastrointestinal symptoms:</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Vomiting</td>
<td align="left" rowspan="1" colspan="1">4 (9.5%)</td>
<td align="left" rowspan="1" colspan="1">5 (5.2%)</td>
<td align="left" rowspan="1" colspan="1">1 (9.1%)</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Diarrhea</td>
<td align="left" rowspan="1" colspan="1">1 (2.4%)</td>
<td align="left" rowspan="1" colspan="1">6 (6.2%)</td>
<td align="left" rowspan="1" colspan="1">1 (9.1%)</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
<tr>
<td colspan="6" align="left" rowspan="1">
<bold>Other symptoms:</bold>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Headache</td>
<td align="left" rowspan="1" colspan="1">30 (71.4%)</td>
<td align="left" rowspan="1" colspan="1">68 (70.8%)</td>
<td align="left" rowspan="1" colspan="1">5 (45.5%)</td>
<td align="left" rowspan="1" colspan="1">11 (68.8%)</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Muscle pain</td>
<td align="left" rowspan="1" colspan="1">1 (2.4%)</td>
<td align="left" rowspan="1" colspan="1">4 (4.2%)</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">1 (6.3%)</td>
<td align="left" rowspan="1" colspan="1">ns</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
</sec>
<sec id="s3d">
<title>Co-detections of other Respiratory Virus in HCoV-positive Cases</title>
<p>High rates of co-infection with non-HCoV respiratory viruses were observed (
<xref ref-type="table" rid="pone-0038638-t004">Table 4</xref>
). Of the 157 HCoV positive patients, 48 (30.57%) were co-infected, 38 of them with one other virus and 10 with 2 other viruses. Most HCoV-associated co-infections involved human rhinoviruses (all picornaviruses positive samples were confirmed to be rhinoviruses by DNA sequencing) and Flu A virus (more than 30%). Compared to single HCoV infections, there was no evidence to indicate that patients with co-infections had more serious illnesses (results not shown).</p>
<table-wrap id="pone-0038638-t004" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0038638.t004</object-id>
<label>Table 4</label>
<caption>
<title>Co-Detections of HCoVs and other Respiratory Virus in the study population.</title>
</caption>
<alternatives>
<graphic id="pone-0038638-t004-4" xlink:href="pone.0038638.t004"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Co-Detection withHCoVs(n = 157)</td>
<td align="left" rowspan="1" colspan="1">Number of cases (n = 48)</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>HCoVs+ Flu A</bold>
</td>
<td align="left" rowspan="1" colspan="1">18</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">229E+ Flu A</td>
<td align="left" rowspan="1" colspan="1">10</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NL63+ Flu A</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">HKU1+ Flu A</td>
<td align="left" rowspan="1" colspan="1">2</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">OC43+229E+ Flu A</td>
<td align="left" rowspan="1" colspan="1">2</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">OC43+HKU1+ Flu A</td>
<td align="left" rowspan="1" colspan="1">2</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NL63+HKU1 + Flu A</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>HCoVs +Flu B</bold>
</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">229E+Flu B</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>HCoV+ ADV</bold>
</td>
<td align="left" rowspan="1" colspan="1">6</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">OC43+ADV</td>
<td align="left" rowspan="1" colspan="1">3</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">229E+ADV</td>
<td align="left" rowspan="1" colspan="1">2</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NL63+ADV+rhinoviruses
<xref ref-type="table-fn" rid="nt104">*</xref>
</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>HCoVs+ hRSV</bold>
</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">OC43+HKU1+hRSV</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>HCoVs+ rhinoviruses</bold>
</td>
<td align="left" rowspan="1" colspan="1">18</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">OC43+rhinoviruses</td>
<td align="left" rowspan="1" colspan="1">5</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">229E+rhinoviruses</td>
<td align="left" rowspan="1" colspan="1">9</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">HKU1+rhinoviruses</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">OC43+NL63+rhinoviruses</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NL63+HKU1+rhinoviruses</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NL63+ADV+rhinoviruses
<xref ref-type="table-fn" rid="nt104">*</xref>
</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>HCoVs+hMPV</bold>
</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">229E+hMPV</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<bold>HCoVs+HCoVs</bold>
</td>
<td align="left" rowspan="1" colspan="1">4</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">OC43+229E</td>
<td align="left" rowspan="1" colspan="1">3</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">OC43+229E+NL63</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt104">
<label>*</label>
<p>Be only counted once in the total.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
</sec>
<sec id="s4">
<title>Discussion</title>
<p>HCoVs circulate worldwide and the prevalence of the different species varies by year and geographical location
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
. Recent reports show that HCoVs have been detected in Hong Kong
<xref rid="pone.0038638-Lau1" ref-type="bibr">[29]</xref>
, Italy
<xref rid="pone.0038638-Gerna1" ref-type="bibr">[13]</xref>
, France
<xref rid="pone.0038638-Vabret1" ref-type="bibr">[22]</xref>
,
<xref rid="pone.0038638-Vabret2" ref-type="bibr">[30]</xref>
, USA
<xref rid="pone.0038638-Dominguez1" ref-type="bibr">[18]</xref>
,
<xref rid="pone.0038638-Talbot1" ref-type="bibr">[21]</xref>
,
<xref rid="pone.0038638-Kuypers1" ref-type="bibr">[31]</xref>
, UK
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
, Netherlands
<xref rid="pone.0038638-Esposito1" ref-type="bibr">[19]</xref>
, Finland
<xref rid="pone.0038638-Risku1" ref-type="bibr">[32]</xref>
, and China
<xref rid="pone.0038638-Ren1" ref-type="bibr">[24]</xref>
<xref rid="pone.0038638-Druce1" ref-type="bibr">[25]</xref>
in respiratory and/or stool samples obtained from young children
<xref rid="pone.0038638-Dominguez1" ref-type="bibr">[18]</xref>
,
<xref rid="pone.0038638-Talbot1" ref-type="bibr">[21]</xref>
<xref rid="pone.0038638-Vabret1" ref-type="bibr">[22]</xref>
,
<xref rid="pone.0038638-Kuypers1" ref-type="bibr">[31]</xref>
and adults
<xref rid="pone.0038638-Gorse1" ref-type="bibr">[20]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
<xref rid="pone.0038638-Ren1" ref-type="bibr">[24]</xref>
,
<xref rid="pone.0038638-Garbino1" ref-type="bibr">[33]</xref>
. In our retrospective study, a 16.0% detection rate for HCoVs infection was found in adults with URTI; 229E was the most common infection (9.8% of all cases), followed by OC43 (4.3%), HKU1 (1.6%) and NL63 (1.1%). The detection rates for 229E and OC43 are consistent with other studies performed worldwide (0.1–26% &0.5–10.1%)
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Pene1" ref-type="bibr">[11]</xref>
,
<xref rid="pone.0038638-Vabret1" ref-type="bibr">[22]</xref>
,
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
,
<xref rid="pone.0038638-Lau1" ref-type="bibr">[29]</xref>
<xref rid="pone.0038638-Mahony1" ref-type="bibr">[37]</xref>
, but higher than in a recent study undertaken in Beijing
<xref rid="pone.0038638-Ren1" ref-type="bibr">[24]</xref>
, perhaps due in our study to the exclusion of patients with lower respiratory tract infections via clinical descriptions and radiography, the use of a screening criteria leukocyte count of ≤10
<sup>10</sup>
/L which is likely to have excluded most patients with bacterial infection, and the use of real-time PCR with excellent sensitivity
<xref rid="pone.0038638-Dare1" ref-type="bibr">[17]</xref>
,
<xref rid="pone.0038638-Esposito1" ref-type="bibr">[19]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
. The studies were also undertaken in different years, suggesting that the presence or absence of circulating HCoV species during these times may have influenced these differed outcomes
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Dare1" ref-type="bibr">[17]</xref>
,
<xref rid="pone.0038638-Ren1" ref-type="bibr">[24]</xref>
. In addition, Flu A detection rate was 15.6% among URTI adult patients between 2009/2–2010/3 with the occurrence of pandemic H1N1 virus 2009, which was signicantly higher than that (0.7%) of patients between 2010/2–2011/3 (
<xref ref-type="table" rid="pone-0038638-t002">Table 2</xref>
). Whether the circulating patterns of HCoVs might be affected by FluA pandemic, warrants further studies.</p>
<p>HCoVs exhibit variable circulation approximately every 2–3 years
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Dare1" ref-type="bibr">[17]</xref>
,
<xref rid="pone.0038638-Ren1" ref-type="bibr">[24]</xref>
,
<xref rid="pone.0038638-Shao1" ref-type="bibr">[34]</xref>
<xref rid="pone.0038638-Bellei1" ref-type="bibr">[35]</xref>
, and this was confirmed by our observation that detection rates for both OC43 and NL63 were statistically significant between 2009/10 and 2010/11. Nevertheless, 229E strains circulated throughout the 2 years of study, often in high numbers and without discernible seasonality, in contrast to that reported in the UK
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
.</p>
<p>A previous study in Beijing reported higher detection rates for HCoVs in individuals over 65 years of age
<xref rid="pone.0038638-Ren1" ref-type="bibr">[24]</xref>
. In contrast, in this study HCoVs were detected essentially in all adult age groups. Of note, however, HKU1 infection predominated in patients aged over 60 years, suggesting that adults in this category may be at higher risk for infection with this species.</p>
<p>URTI occurs commonly in both children and adults and is a major cause of mild morbidity which have a high cost to society. URTI among adults are responsible for missed work and unnecessary medical care (antibiotic prescriptions), also occasionally associated serious sequelae. The clinical diagnosis of all HCoVs positive patients we studied was URTI. The main clinical signs at presentation were fever, cough, sore throat and headache, in accord with several previous studies
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Makela1" ref-type="bibr">[7]</xref>
,
<xref rid="pone.0038638-Vabret1" ref-type="bibr">[22]</xref>
. Some cases also showed gastrointestinal symptoms except in HCoV-HKU1 infection patients
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Risku1" ref-type="bibr">[32]</xref>
. Rhinorrhea was observed in significantly fewer patients infected with 229E. Many previous reports have indicated that HCoVs have high rates of co-infection with other respiratory viruses
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Esposito1" ref-type="bibr">[19]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
,
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
, including rhinoviruses, influenza, HMPV, ADV and RSV. In this study, co-infections were associated with each of the non-SARS HCoVs at rates similar to previous studies
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Dominguez1" ref-type="bibr">[18]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
,
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
. Human rhinoviruses and influenza A viruses were the most common respiratory viruses detected in HCoVs-positive patients, possibly reflect the level of their circulation at the time, and which were consistent with rhinoviruses being the most common respiratory viruses for common cold
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Heikkinen1" ref-type="bibr">[36]</xref>
. In contrast with virus infection among children with URTI
<xref rid="pone.0038638-Greenberg1" ref-type="bibr">[1]</xref>
,
<xref rid="pone.0038638-Makela1" ref-type="bibr">[7]</xref>
,
<xref rid="pone.0038638-Gaunt1" ref-type="bibr">[23]</xref>
,
<xref rid="pone.0038638-Heikkinen1" ref-type="bibr">[36]</xref>
, RSV, PIV and HBoV were detected in very low rate(less than 1%) among adults with URTI in this study. It was consistent with the previous reports
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
,
<xref rid="pone.0038638-Mahony1" ref-type="bibr">[37]</xref>
. Comparison of clinical symptoms experienced by patients with and without co-infections indicated that co-infection with HCoVs did not affect illness severity.</p>
<p>In summary, we found that the four non-SARS HCoVs are regularly associated with URTI in adult patients in China, although distinct seasonal patterns of circulation are not obvious. Our observation that elderly adults may be are at high risk of HKU1 infection requires further study. Our results suggest that testing algorithms that include sensitive HCoVs detection contribute to the likelihood of obtaining a laboratory diagnosis when respiratory virus infection is suspected
<xref rid="pone.0038638-Yu1" ref-type="bibr">[26]</xref>
,
<xref rid="pone.0038638-Mahony1" ref-type="bibr">[37]</xref>
<xref rid="pone.0038638-Pyrc1" ref-type="bibr">[38]</xref>
. To the best of our knowledge, this is the first comprehensive analysis of the potential impact of four non-SARS HCoVs (HCoV-OC43, HCoV-229E, HCoV-NL63 and HCoV-HKU1) as causes of URTIs in adults admitted to hospital in China by real time RT-PCR assays. To identify the role of HCoVs infection in URTI of adults, more specimens include control subjects with clear clinical and epidemiological profiles warrant be investigated.</p>
</sec>
</body>
<back>
<ack>
<p>The authors thank Chris Birch and Julian Druce of the Victorian Infectious Diseases Reference Laboratory, North Melbourne, Australia, for their assistance when developing multiplex RT-PCR for other common respiratory viruses and preparation of the manuscript. We also thank the staff of the Peking Union Medical College Hospital for providing samples.</p>
</ack>
<fn-group>
<fn fn-type="COI-statement">
<p>
<bold>Competing Interests: </bold>
The authors have declared that no competing interests exist.</p>
</fn>
<fn fn-type="financial-disclosure">
<p>
<bold>Funding: </bold>
This work was funded by the Project of the National Natural Science Foundation of China (81100062); 973 Program of China (Grant numbers: 2011CB504704); the Control and Prevention of Major Infectious Diseases Program in China (2011ZX10004-001) and China-Australia Health and HIV/AIDS Facility (CAHHF EID07). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="pone.0038638-Greenberg1">
<label>1</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Greenberg</surname>
<given-names>SB</given-names>
</name>
</person-group>
<year>2011</year>
<article-title>Update on rhinovirus and coronavirus infections.</article-title>
<source>Semin Resoir Crit Care Med</source>
<volume>32</volume>
<fpage>433</fpage>
<lpage>446</lpage>
</element-citation>
</ref>
<ref id="pone.0038638-vanderHoek1">
<label>2</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>van der Hoek</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Pyrc</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Jebbink</surname>
<given-names>MF</given-names>
</name>
<name>
<surname>Vermeulen-Oost</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Berkhout</surname>
<given-names>RJ</given-names>
</name>
<etal></etal>
</person-group>
<year>2004</year>
<article-title>Identification of a new human coronavirus.</article-title>
<source>Nat Med</source>
<volume>10</volume>
<fpage>368</fpage>
<lpage>73</lpage>
<pub-id pub-id-type="pmid">15034574</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Woo1">
<label>3</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Woo</surname>
<given-names>PC</given-names>
</name>
<name>
<surname>Lau</surname>
<given-names>SK</given-names>
</name>
<name>
<surname>Chu</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Chan</surname>
<given-names>KH</given-names>
</name>
<name>
<surname>Tsoi</surname>
<given-names>HW</given-names>
</name>
<etal></etal>
</person-group>
<year>2005</year>
<article-title>Characterization and complete genome sequence of a novel coronavirus, coronavirus HKU1, from patients with pneumonia.</article-title>
<source>J Virol</source>
<volume>79</volume>
<fpage>884</fpage>
<lpage>95</lpage>
<pub-id pub-id-type="pmid">15613317</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Drosten1">
<label>4</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Drosten</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Gunther</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Preiser</surname>
<given-names>W</given-names>
</name>
<name>
<surname>van der Werf</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Brodt</surname>
<given-names>HR</given-names>
</name>
<etal></etal>
</person-group>
<year>2003</year>
<article-title>Identification of a novel coronavirus in patients with severe acute respiratory syndrome.</article-title>
<source>N Engl J Med</source>
<volume>348</volume>
<fpage>1967</fpage>
<lpage>76</lpage>
<pub-id pub-id-type="pmid">12690091</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Ksiazek1">
<label>5</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ksiazek</surname>
<given-names>TG</given-names>
</name>
<name>
<surname>Erdman</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Goldsmith</surname>
<given-names>CS</given-names>
</name>
<name>
<surname>Zaki</surname>
<given-names>SR</given-names>
</name>
<name>
<surname>Peret</surname>
<given-names>T</given-names>
</name>
<etal></etal>
</person-group>
<year>2003</year>
<article-title>A novel coronavirus associated with severe acute respiratory syndrome.</article-title>
<source>N Engl J Med</source>
<volume>348</volume>
<fpage>1953</fpage>
<lpage>66</lpage>
<pub-id pub-id-type="pmid">12690092</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Fouchier1">
<label>6</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fouchier</surname>
<given-names>RA</given-names>
</name>
<name>
<surname>Hartwig</surname>
<given-names>NG</given-names>
</name>
<name>
<surname>Bestebroer</surname>
<given-names>TM</given-names>
</name>
<name>
<surname>Niemeyer</surname>
<given-names>B</given-names>
</name>
<name>
<surname>de Jong</surname>
<given-names>JC</given-names>
</name>
<etal></etal>
</person-group>
<year>2004</year>
<article-title>A previously undescribed coronavirus associated with respiratory disease in humans.</article-title>
<source>Proc Natl Acad Sci USA</source>
<volume>101</volume>
<fpage>6212</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="pmid">15073334</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Makela1">
<label>7</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Makela</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Puhakka</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Ruuskanen</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Leinonen</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Saikku</surname>
<given-names>P</given-names>
</name>
<etal></etal>
</person-group>
<year>1998</year>
<article-title>Viruses and bacteria in the etiology of the common cold.</article-title>
<source>J Clin Microbiol</source>
<volume>36</volume>
<fpage>539</fpage>
<lpage>42</lpage>
<pub-id pub-id-type="pmid">9466772</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Tsang1">
<label>8</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tsang</surname>
<given-names>KW</given-names>
</name>
<name>
<surname>Ho</surname>
<given-names>PL</given-names>
</name>
<name>
<surname>Ooi</surname>
<given-names>GC</given-names>
</name>
<name>
<surname>Yee</surname>
<given-names>WK</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>T</given-names>
</name>
<etal></etal>
</person-group>
<year>2003</year>
<article-title>A cluster of cases of severe acute respiratory syndrome in Hong Kong.</article-title>
<source>N Engl J Med</source>
<volume>348</volume>
<fpage>1977</fpage>
<lpage>85</lpage>
<pub-id pub-id-type="pmid">12671062</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-vanderHoek2">
<label>9</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>van der Hoek</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Sure</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Ihorst</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Stang</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Pyrc</surname>
<given-names>K</given-names>
</name>
<etal></etal>
</person-group>
<year>2005</year>
<article-title>Croup is associated with the novel coronavirus NL63.</article-title>
<source>PLoS Med</source>
<volume>2</volume>
<fpage>e240</fpage>
<pub-id pub-id-type="pmid">16104827</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-NoksoKoivisto1">
<label>10</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nokso-Koivisto</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Pitkaranta</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Blomqvist</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Kilpi</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Hovi</surname>
<given-names>T</given-names>
</name>
</person-group>
<year>2000</year>
<article-title>Respiratory coronavirus infections in children younger than two years of age.</article-title>
<source>Pediatr Infect Dis</source>
<volume>19</volume>
<fpage>164</fpage>
<lpage>6</lpage>
</element-citation>
</ref>
<ref id="pone.0038638-Pene1">
<label>11</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pene</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Merlat</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Vabret</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Rozenberg</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Buzyn</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<year>2003</year>
<article-title>Coronavirus 229E-related pneumonia in immunocompromised patients.</article-title>
<source>Clin Infect Dis</source>
<volume>37</volume>
<fpage>929</fpage>
<lpage>32</lpage>
<pub-id pub-id-type="pmid">13130404</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Esper1">
<label>12</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Esper</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Weibel</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ferguson</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Landry</surname>
<given-names>ML</given-names>
</name>
<name>
<surname>Kahn</surname>
<given-names>JS</given-names>
</name>
</person-group>
<year>2006</year>
<article-title>Coronavirus HKU1 infection in the United States.</article-title>
<source>Emerg Infect Dis</source>
<volume>12</volume>
<fpage>775</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">16704837</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Gerna1">
<label>13</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gerna</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Percivalle</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Sarasini</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Campanini</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Piralla</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Human respiratory coronavirus HKU1 versus other coronavirus infections in Italian hospitalised patients.</article-title>
<source>J Clin Virol</source>
<volume>38</volume>
<fpage>244</fpage>
<lpage>50</lpage>
<pub-id pub-id-type="pmid">17222582</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Koetz1">
<label>14</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koetz</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Nilsson</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Lindén</surname>
<given-names>M</given-names>
</name>
<name>
<surname>van der Hoek</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Ripa</surname>
<given-names>T</given-names>
</name>
</person-group>
<year>2006</year>
<article-title>Detection of human coronavirus NL63, human metapneumovirus and respiratory syncytial virus in children with respiratory tract infections in southwest Sweden.</article-title>
<source>Clin Microbiol Infect</source>
<volume>12</volume>
<fpage>1089</fpage>
<lpage>96</lpage>
<pub-id pub-id-type="pmid">17002608</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Sloots1">
<label>15</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sloots</surname>
<given-names>TP</given-names>
</name>
<name>
<surname>McErlean</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Speicher</surname>
<given-names>DJ</given-names>
</name>
<name>
<surname>Arden</surname>
<given-names>KE</given-names>
</name>
<name>
<surname>Nissen</surname>
<given-names>MD</given-names>
</name>
<etal></etal>
</person-group>
<year>2006</year>
<article-title>Evidence of human coronavirus HKU1 and human bocavirus in Australian children.</article-title>
<source>J Clin Virol</source>
<volume>35</volume>
<fpage>99</fpage>
<lpage>102</lpage>
<pub-id pub-id-type="pmid">16257260</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Suzuki1">
<label>16</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suzuki</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Okamoto</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ohmi</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Watanabe</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Miyabayashi</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2005</year>
<article-title>Detection of human coronavirus-NL63 in children in Japan.</article-title>
<source>Pediatr Infect Dis J</source>
<volume>24</volume>
<fpage>645</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="pmid">15999010</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Dare1">
<label>17</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dare</surname>
<given-names>RK</given-names>
</name>
<name>
<surname>Fry</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Chittaganpitch</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Sawanpanyalert</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Olsen</surname>
<given-names>SJ</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Human coronaviruses infections in rural Tailand: A comprehensive study using real-time reverse-transcription polymerase chain reaction assays.</article-title>
<source>J Infect Dis</source>
<volume>196</volume>
<fpage>1321</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="pmid">17922396</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Dominguez1">
<label>18</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dominguez</surname>
<given-names>SR</given-names>
</name>
<name>
<surname>Robinson</surname>
<given-names>CC</given-names>
</name>
<name>
<surname>Holmes</surname>
<given-names>KV</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>Detection of Four Human Coronaviruses in Respiratory Infections in Children: A One-Year Study in Colorado.</article-title>
<source>J Med Virol</source>
<volume>81</volume>
<fpage>1597</fpage>
<lpage>604</lpage>
<pub-id pub-id-type="pmid">19626607</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Esposito1">
<label>19</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Esposito</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Bosis</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Niesters</surname>
<given-names>HG</given-names>
</name>
<name>
<surname>Tremolati</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Begliatti</surname>
<given-names>E</given-names>
</name>
<etal></etal>
</person-group>
<year>2006</year>
<article-title>Impact of human coronavirus infections in otherwise healthy children who attended an emergency department.</article-title>
<source>J Med Virol 2006</source>
<volume>78</volume>
<fpage>1609</fpage>
<lpage>15</lpage>
</element-citation>
</ref>
<ref id="pone.0038638-Gorse1">
<label>20</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gorse</surname>
<given-names>GJ</given-names>
</name>
<name>
<surname>O'Connor</surname>
<given-names>TZ</given-names>
</name>
<name>
<surname>Hall</surname>
<given-names>SL</given-names>
</name>
<name>
<surname>Vitale</surname>
<given-names>JN</given-names>
</name>
<name>
<surname>Nichol</surname>
<given-names>KL</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>Human coronavirus and acute respiratory illness in older adults with chronic obstructive pulmonary disease.</article-title>
<source>J Infect Dis</source>
<volume>199</volume>
<fpage>847</fpage>
<lpage>57</lpage>
<pub-id pub-id-type="pmid">19239338</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Talbot1">
<label>21</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Talbot</surname>
<given-names>HKB</given-names>
</name>
<name>
<surname>Crowe</surname>
<given-names>JE</given-names>
<suffix>Jr</suffix>
</name>
<name>
<surname>Edwards</surname>
<given-names>KM</given-names>
</name>
<name>
<surname>Griffin</surname>
<given-names>MR</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>Y</given-names>
</name>
<etal></etal>
</person-group>
<year>2009</year>
<article-title>Coronavirus infection and hospitalizations for acute respiratory illness in young children.</article-title>
<source>J Med Virol</source>
<volume>81</volume>
<fpage>853</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="pmid">19319948</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Vabret1">
<label>22</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vabret</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Mourez</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Gouarin</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Petitjean</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Freymuth</surname>
<given-names>F</given-names>
</name>
</person-group>
<year>2003</year>
<article-title>An outbreak of coronavirus OC43 respiratory infection in Normandy, France.</article-title>
<source>Clin Infect Dis</source>
<volume>36</volume>
<fpage>985</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">12684910</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Gaunt1">
<label>23</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gaunt</surname>
<given-names>ER</given-names>
</name>
<name>
<surname>Hardie</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Claas</surname>
<given-names>ECJ</given-names>
</name>
<name>
<surname>Simmonds</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Templeton</surname>
<given-names>KE</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Epidemiology and Clinical Presentations of the Four Human Coronaviruses 229E, HKU1, NL63, and OC43 Detected over 3 Years Using a Novel Multiplex Real-Time PCR Method.</article-title>
<source>J Clin Microbiol</source>
<volume>48</volume>
<fpage>2940</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="pmid">20554810</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Ren1">
<label>24</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ren</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Gonzalez</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y</given-names>
</name>
<etal></etal>
</person-group>
<year>2011</year>
<article-title>Prevalence of Human Coronaviruses in Adults With Acute Respiratory Tract Infections in Beijing, China.</article-title>
<source>J Med Virol</source>
<volume>83</volume>
<fpage>291</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="pmid">21181925</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Druce1">
<label>25</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Druce</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Tran</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Kelly</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Kaye</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Chibo</surname>
<given-names>D</given-names>
</name>
<etal></etal>
</person-group>
<year>2005</year>
<article-title>Laboratory Diagnosis and Surveillance of Human Respiratory Viruses by PCR in Victoria, Australia, 2002–2003.</article-title>
<source>J Med Virol</source>
<volume>75</volume>
<fpage>122</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">15543580</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Yu1">
<label>26</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>W</given-names>
</name>
<etal></etal>
</person-group>
<year>2012</year>
<article-title>Etiology and clinical characterization of respiratory virus infections in adult patients attending an emergency department in Beijing.</article-title>
<source>PLoS One</source>
<volume>7(2)</volume>
<fpage>e32174</fpage>
<pub-id pub-id-type="pmid">22389685</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Mackay1">
<label>27</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mackay</surname>
<given-names>IM</given-names>
</name>
<name>
<surname>Jacob</surname>
<given-names>KC</given-names>
</name>
<name>
<surname>Woolhouse</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Waller</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Syrmis</surname>
<given-names>MW</given-names>
</name>
<etal></etal>
</person-group>
<year>2003</year>
<article-title>Molecular assays for detection of human metapneumovirus.</article-title>
<source>J Clin Microbiol</source>
<volume>41</volume>
<fpage>100</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="pmid">12517833</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Manning1">
<label>28</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Manning</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Russell</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Eastick</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Leadbetter</surname>
<given-names>GH</given-names>
</name>
<name>
<surname>Hallam</surname>
<given-names>N</given-names>
</name>
<etal></etal>
</person-group>
<year>2006</year>
<article-title>Epidemiological profil and clinical associations of human bocavirus and other human parvoviruses.</article-title>
<source>J Infect Dis</source>
<volume>194</volume>
<fpage>1283</fpage>
<lpage>90</lpage>
<pub-id pub-id-type="pmid">17041855</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Lau1">
<label>29</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lau</surname>
<given-names>SK</given-names>
</name>
<name>
<surname>Woo</surname>
<given-names>PC</given-names>
</name>
<name>
<surname>Yip</surname>
<given-names>CC</given-names>
</name>
<name>
<surname>Tse</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Tsoi</surname>
<given-names>HW</given-names>
</name>
<etal></etal>
</person-group>
<year>2006</year>
<article-title>Coronavirus HKU1 and other coronavirus infections in Hong Kong.</article-title>
<source>J Clin Microbiol</source>
<volume>44</volume>
<fpage>2063</fpage>
<lpage>71</lpage>
<pub-id pub-id-type="pmid">16757599</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Vabret2">
<label>30</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vabret</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Dina</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Gouarin</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Petitjean</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Tripey</surname>
<given-names>V</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Human (non-severe acute respiratory syndrome) coronavirus infections in hospitalized children in France.</article-title>
<source>J Paediatr Child Health</source>
<volume>44</volume>
<fpage>176</fpage>
<lpage>81</lpage>
<pub-id pub-id-type="pmid">17999671</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Kuypers1">
<label>31</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kuypers</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>ET</given-names>
</name>
<name>
<surname>Heugel</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wright</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Morrow</surname>
<given-names>R</given-names>
</name>
<etal></etal>
</person-group>
<year>2007</year>
<article-title>Clinical disease in children associated with newly described coronavirus subtypes.</article-title>
<source>Pediatrics</source>
<volume>119</volume>
<fpage>e70</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="pmid">17130280</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Risku1">
<label>32</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Risku</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Lappalainen</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Rasanen</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Vesikari</surname>
<given-names>T</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Detection of human coronaviruses in children with acute gastroenteritis.</article-title>
<source>J Clin Virol</source>
<volume>48</volume>
<fpage>27</fpage>
<lpage>30</lpage>
<pub-id pub-id-type="pmid">20233673</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Garbino1">
<label>33</label>
<element-citation publication-type="journal">
<article-title>Garbino J, Crespo S, Aubert JD, Rochat T, Ninet B, et al. (2006 ) A prospective hospital-based study of the clinical impact of non-severe acute respiratory syndrome (Non-SARS)-related human coronavirus infection.</article-title>
<source>Clin Infect Dis</source>
<volume>43(8)</volume>
<fpage>1009</fpage>
<lpage>15</lpage>
<pub-id pub-id-type="pmid">16983613</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Shao1">
<label>34</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shao</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Esper</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Weibel</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Kahn</surname>
<given-names>JS</given-names>
</name>
</person-group>
<year>2007</year>
<article-title>Seroepidemiology of group I human coronaviruses in children.</article-title>
<source>J Clin Virol</source>
<volume>40</volume>
<fpage>207</fpage>
<lpage>1</lpage>
<pub-id pub-id-type="pmid">17889596</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Bellei1">
<label>35</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bellei</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Carraro</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Perosa</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Watanabe</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Arruda</surname>
<given-names>E</given-names>
</name>
<etal></etal>
</person-group>
<year>2008</year>
<article-title>Acute respiratory infection and influenza-like illness viral etiologies in Brazilian adults.</article-title>
<source>J Med Virol</source>
<volume>80</volume>
<fpage>1824</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="pmid">18712837</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Heikkinen1">
<label>36</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Heikkinen</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Jarvinen</surname>
<given-names>A</given-names>
</name>
</person-group>
<year>2003</year>
<article-title>The common cold.</article-title>
<source>Lancet</source>
<volume>361</volume>
<fpage>51</fpage>
<lpage>59</lpage>
<pub-id pub-id-type="pmid">12517470</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Mahony1">
<label>37</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mahony</surname>
<given-names>JB</given-names>
</name>
<name>
<surname>Petrich</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Smieja</surname>
<given-names>M</given-names>
</name>
</person-group>
<year>2011</year>
<article-title>Molecular diagnosis of respiratory virus infections.</article-title>
<source>Crit Rev Clin Lab Sci</source>
<volume>48(5–6)</volume>
<fpage>217</fpage>
<lpage>49</lpage>
<pub-id pub-id-type="pmid">22185616</pub-id>
</element-citation>
</ref>
<ref id="pone.0038638-Pyrc1">
<label>38</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pyrc</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Stożek</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Wojcik</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Gawron</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Zeglen</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2012</year>
<article-title>Use of sensitive, broad-spectrum molecular assays and human airway epithelium cultures for detection of respiratory pathogens.</article-title>
<source>PLoS One</source>
<volume>7(3)</volume>
<fpage>e32582</fpage>
<pub-id pub-id-type="pmid">22403676</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/SrasV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 001381  | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 001381  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    SrasV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Tue Apr 28 14:49:16 2020. Site generation: Sat Mar 27 22:06:49 2021