SrasV1, Pmc, Corpus, bibRecord, 001009

***** Acces problem to record *****\

Identifieur interne : 001009 ( Pmc/Corpus ); précédent : 0010089; suivant : 0010100 ***** probable Xml problem with record *****

Links to Exploration step

Le document en format XML

<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Silencing SARS‐CoV Spike protein expression in cultured cells by RNA interference</title>
<author><name sortKey="Zhang, Yuanjiang" sort="Zhang, Yuanjiang" uniqKey="Zhang Y" first="Yuanjiang" last="Zhang">Yuanjiang Zhang</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Li, Tieshi" sort="Li, Tieshi" uniqKey="Li T" first="Tieshi" last="Li">Tieshi Li</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fu, Ling" sort="Fu, Ling" uniqKey="Fu L" first="Ling" last="Fu">Ling Fu</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF2"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yu, Changming" sort="Yu, Changming" uniqKey="Yu C" first="Changming" last="Yu">Changming Yu</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF2"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Li, Yinghua" sort="Li, Yinghua" uniqKey="Li Y" first="Yinghua" last="Li">Yinghua Li</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Xu, Xialian" sort="Xu, Xialian" uniqKey="Xu X" first="Xialian" last="Xu">Xialian Xu</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wang, Yinyin" sort="Wang, Yinyin" uniqKey="Wang Y" first="Yinyin" last="Wang">Yinyin Wang</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ning, Hongxiu" sort="Ning, Hongxiu" uniqKey="Ning H" first="Hongxiu" last="Ning">Hongxiu Ning</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Zhang, Shuping" sort="Zhang, Shuping" uniqKey="Zhang S" first="Shuping" last="Zhang">Shuping Zhang</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Chen, Wei" sort="Chen, Wei" uniqKey="Chen W" first="Wei" last="Chen">Wei Chen</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF2"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Babiuk, Lorne A" sort="Babiuk, Lorne A" uniqKey="Babiuk L" first="Lorne A" last="Babiuk">Lorne A. Babiuk</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF3"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Chang, Zhijie" sort="Chang, Zhijie" uniqKey="Chang Z" first="Zhijie" last="Chang">Zhijie Chang</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">14988013</idno>
<idno type="pmc">7127813</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7127813</idno>
<idno type="RBID">PMC:7127813</idno>
<idno type="doi">10.1016/S0014-5793(04)00087-0</idno>
<date when="2004">2004</date>
<idno type="wicri:Area/Pmc/Corpus">001009</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">001009</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Silencing SARS‐CoV Spike protein expression in cultured cells by RNA interference</title>
<author><name sortKey="Zhang, Yuanjiang" sort="Zhang, Yuanjiang" uniqKey="Zhang Y" first="Yuanjiang" last="Zhang">Yuanjiang Zhang</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Li, Tieshi" sort="Li, Tieshi" uniqKey="Li T" first="Tieshi" last="Li">Tieshi Li</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fu, Ling" sort="Fu, Ling" uniqKey="Fu L" first="Ling" last="Fu">Ling Fu</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF2"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yu, Changming" sort="Yu, Changming" uniqKey="Yu C" first="Changming" last="Yu">Changming Yu</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF2"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Li, Yinghua" sort="Li, Yinghua" uniqKey="Li Y" first="Yinghua" last="Li">Yinghua Li</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Xu, Xialian" sort="Xu, Xialian" uniqKey="Xu X" first="Xialian" last="Xu">Xialian Xu</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wang, Yinyin" sort="Wang, Yinyin" uniqKey="Wang Y" first="Yinyin" last="Wang">Yinyin Wang</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ning, Hongxiu" sort="Ning, Hongxiu" uniqKey="Ning H" first="Hongxiu" last="Ning">Hongxiu Ning</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Zhang, Shuping" sort="Zhang, Shuping" uniqKey="Zhang S" first="Shuping" last="Zhang">Shuping Zhang</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Chen, Wei" sort="Chen, Wei" uniqKey="Chen W" first="Wei" last="Chen">Wei Chen</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF2"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Babiuk, Lorne A" sort="Babiuk, Lorne A" uniqKey="Babiuk L" first="Lorne A" last="Babiuk">Lorne A. Babiuk</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF3"></nlm:aff>
</affiliation>
</author>
<author><name sortKey="Chang, Zhijie" sort="Chang, Zhijie" uniqKey="Chang Z" first="Zhijie" last="Chang">Zhijie Chang</name>
<affiliation><nlm:aff id="feb2s0014579304000870-aff-AFF1"></nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">Febs Letters</title>
<idno type="ISSN">0014-5793</idno>
<idno type="eISSN">1873-3468</idno>
<imprint><date when="2004">2004</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>The severe acute respiratory syndrome (SARS) has been one of the most epidemic diseases threatening human health all over the world. Based on clinical studies, SARS‐CoV (the SARS‐associated coronavirus), a novel coronavirus, is reported as the pathogen responsible for the disease. To date, no effective and specific therapeutic method can be used to treat patients suffering from SARS‐CoV infection. RNA interference (RNAi) is a process by which the introduced small interfering RNA (siRNA) could cause the degradation of mRNA with identical sequence specificity. The RNAi methodology has been used as a tool to silence genes in cultured cells and in animals. Recently, this technique was employed in anti‐virus infections in human immunodeficiency virus and hepatitis C/B virus. In this study, RNAi technology has been applied to explore the possibility for prevention of SARS‐CoV infection. We constructed specific siRNAs targeting the S gene in SARS‐CoV. We demonstrated that the siRNAs could effectively and specifically inhibit gene expression of Spike protein in SARS‐CoV‐infected cells. Our study provided evidence that RNAi could be a tool for inhibition of SARS‐CoV.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
  <front><journal-meta><journal-id journal-id-type="nlm-ta">FEBS Lett</journal-id>
<journal-id journal-id-type="iso-abbrev">FEBS Lett</journal-id>
<journal-id journal-id-type="doi">10.1002/(ISSN)1873-3468</journal-id>
<journal-id journal-id-type="publisher-id">FEB2</journal-id>
<journal-title-group><journal-title>Febs Letters</journal-title>
</journal-title-group>
<issn pub-type="ppub">0014-5793</issn>
<issn pub-type="epub">1873-3468</issn>
<publisher><publisher-name>John Wiley and Sons Inc.</publisher-name>
<publisher-loc>Hoboken</publisher-loc>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">14988013</article-id>
<article-id pub-id-type="pmc">7127813</article-id>
<article-id pub-id-type="doi">10.1016/S0014-5793(04)00087-0</article-id>
<article-id pub-id-type="publisher-id">FEB2S0014579304000870</article-id>
<article-categories><subj-group subj-group-type="overline"><subject>Full‐length Article</subject>
</subj-group>
<subj-group subj-group-type="heading"><subject>Full‐length Articles</subject>
</subj-group>
</article-categories>
<title-group><article-title>Silencing SARS‐CoV Spike protein expression in cultured cells by RNA interference</article-title>
</title-group>
<contrib-group><contrib id="feb2s0014579304000870-cr-0001" contrib-type="author"><name><surname>Zhang</surname>
<given-names>Yuanjiang</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF1"><sup>1</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0002" contrib-type="author"><name><surname>Li</surname>
<given-names>Tieshi</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF1"><sup>1</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0003" contrib-type="author"><name><surname>Fu</surname>
<given-names>Ling</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF2"><sup>2</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0004" contrib-type="author"><name><surname>Yu</surname>
<given-names>Changming</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF2"><sup>2</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0005" contrib-type="author"><name><surname>Li</surname>
<given-names>Yinghua</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF1"><sup>1</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0006" contrib-type="author"><name><surname>Xu</surname>
<given-names>Xialian</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF1"><sup>1</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0007" contrib-type="author"><name><surname>Wang</surname>
<given-names>Yinyin</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF1"><sup>1</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0008" contrib-type="author"><name><surname>Ning</surname>
<given-names>Hongxiu</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF1"><sup>1</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0009" contrib-type="author"><name><surname>Zhang</surname>
<given-names>Shuping</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF1"><sup>1</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0010" contrib-type="author"><name><surname>Chen</surname>
<given-names>Wei</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF2"><sup>2</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0011" contrib-type="author"><name><surname>Babiuk</surname>
<given-names>Lorne A</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF3"><sup>3</sup>
</xref>
</contrib>
<contrib id="feb2s0014579304000870-cr-0012" contrib-type="author" corresp="yes"><name><surname>Chang</surname>
<given-names>Zhijie</given-names>
</name>
<xref ref-type="aff" rid="feb2s0014579304000870-aff-AFF1"><sup>1</sup>
</xref>
<address><email>zhijiec@tsinghua.edu.cn</email>
</address>
</contrib>
</contrib-group>
<aff id="feb2s0014579304000870-aff-AFF1"><label><sup>1</sup>
</label>
Institute of Biomedicine, Tsinghua University, Beijing, PR China</aff>
<aff id="feb2s0014579304000870-aff-AFF2"><label><sup>2</sup>
</label>
The Institute of Microbiology and Epidemiology, AMMS, Beijing, PR China</aff>
<aff id="feb2s0014579304000870-aff-AFF3"><label><sup>3</sup>
</label>
Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, SK, Canada</aff>
<author-notes><corresp id="correspondenceTo"><label>*</label>
Corresponding author: Fax: (86)-10-6277 3624</corresp>
</author-notes>
<pub-date pub-type="ppub"><day>27</day>
<month>2</month>
<year>2004</year>
</pub-date>
<pub-date pub-type="epub"><day>04</day>
<month>2</month>
<year>2004</year>
</pub-date>
<volume>560</volume>
<issue>1-3</issue>
<issue-id pub-id-type="doi">10.1002/feb2.2004.560.issue-1-3</issue-id>
<fpage>141</fpage>
<lpage>146</lpage>
<history><date date-type="received"><day>07</day>
<month>7</month>
<year>2003</year>
</date>
<date date-type="rev-recd"><day>08</day>
<month>1</month>
<year>2004</year>
</date>
<date date-type="accepted"><day>12</day>
<month>1</month>
<year>2004</year>
</date>
</history>
<permissions><pmc-comment> © 2015 Federation of European Biochemical Societies </pmc-comment>
        <copyright-statement content-type="article-copyright">FEBS Letters 560 (2004) 1873-3468 © 2015 Federation of European Biochemical Societies</copyright-statement>
<license><license-p>This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.</license-p>
</license>
</permissions>
<self-uri content-type="pdf" xlink:href="file:FEB2-560-141.pdf"></self-uri>
<abstract><p>The severe acute respiratory syndrome (SARS) has been one of the most epidemic diseases threatening human health all over the world. Based on clinical studies, SARS‐CoV (the SARS‐associated coronavirus), a novel coronavirus, is reported as the pathogen responsible for the disease. To date, no effective and specific therapeutic method can be used to treat patients suffering from SARS‐CoV infection. RNA interference (RNAi) is a process by which the introduced small interfering RNA (siRNA) could cause the degradation of mRNA with identical sequence specificity. The RNAi methodology has been used as a tool to silence genes in cultured cells and in animals. Recently, this technique was employed in anti‐virus infections in human immunodeficiency virus and hepatitis C/B virus. In this study, RNAi technology has been applied to explore the possibility for prevention of SARS‐CoV infection. We constructed specific siRNAs targeting the S gene in SARS‐CoV. We demonstrated that the siRNAs could effectively and specifically inhibit gene expression of Spike protein in SARS‐CoV‐infected cells. Our study provided evidence that RNAi could be a tool for inhibition of SARS‐CoV.</p>
</abstract>
<kwd-group><kwd id="feb2s0014579304000870-kwd-0001">Severe acute respiratory syndrome</kwd>
<kwd id="feb2s0014579304000870-kwd-0002">Spike protein</kwd>
<kwd id="feb2s0014579304000870-kwd-0003">RNA interference</kwd>
<kwd id="feb2s0014579304000870-kwd-0004">Gene silencing</kwd>
</kwd-group>
<counts><page-count count="6"></page-count>
</counts>
<custom-meta-group><custom-meta><meta-name>source-schema-version-number</meta-name>
<meta-value>2.0</meta-value>
</custom-meta>
<custom-meta><meta-name>cover-date</meta-name>
<meta-value>February 27, 2004</meta-value>
</custom-meta>
<custom-meta><meta-name>details-of-publishers-convertor</meta-name>
<meta-value>Converter:WILEY_ML3GV2_TO_JATSPMC version:5.8.0 mode:remove_FC converted:15.04.2020</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
<notes><p content-type="self-citation"><mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-0000"><string-name><surname>Zhang</surname>
<given-names>Yuanjiang</given-names>
</string-name>
,<string-name><surname>Li</surname>
<given-names>Tieshi</given-names>
</string-name>
,<string-name><surname>Fu</surname>
<given-names>Ling</given-names>
</string-name>
,<string-name><surname>Yu</surname>
<given-names>Changming</given-names>
</string-name>
,<string-name><surname>Li</surname>
<given-names>Yinghua</given-names>
</string-name>
,<string-name><surname>Xu</surname>
<given-names>Xialian</given-names>
</string-name>
,<string-name><surname>Wang</surname>
<given-names>Yinyin</given-names>
</string-name>
,<string-name><surname>Ning</surname>
<given-names>Hongxiu</given-names>
</string-name>
,<string-name><surname>Zhang</surname>
<given-names>Shuping</given-names>
</string-name>
,<string-name><surname>Chen</surname>
<given-names>Wei</given-names>
</string-name>
,<string-name><surname>Babiuk</surname>
<given-names>Lorne A</given-names>
</string-name>
 and <string-name><surname>Chang</surname>
<given-names>Zhijie</given-names>
</string-name>
(<year>2004</year>
), <article-title>Silencing SARS-CoV Spike protein expression in cultured cells by RNA interference</article-title>
, <source xml:lang="en">FEBS Letters</source>
, <volume>560</volume>
, doi: 10.1016/S0014-5793(04)00087-0</mixed-citation>
</p>
</notes>
</front>
<body id="feb2s0014579304000870-body-0001"><sec id="feb2s0014579304000870-sec-1"><label>1</label>
<title>Introduction</title>
<p>SARS‐CoV (the SARS‐associated coronavirus), which causes the severe acute respiratory syndrome, threatens the health of populations throughout the world [<xref rid="feb2s0014579304000870-bib-BIB1" ref-type="ref">1</xref>
, <xref rid="feb2s0014579304000870-bib-BIB2" ref-type="ref">2</xref>
]. Although SARS is reported [<xref rid="feb2s0014579304000870-bib-BIB3" ref-type="ref">3</xref>
, <xref rid="feb2s0014579304000870-bib-BIB4" ref-type="ref">4</xref>
, <xref rid="feb2s0014579304000870-bib-BIB5" ref-type="ref">5</xref>
, <xref rid="feb2s0014579304000870-bib-BIB6" ref-type="ref">6</xref>
, <xref rid="feb2s0014579304000870-bib-BIB7" ref-type="ref">7</xref>
] as a novel coronavirus, it retains similar protein structures as other members of the coronavirus family <xref rid="feb2s0014579304000870-bib-BIB8" ref-type="ref">[8]</xref>
.</p>
<p>The Spike protein of the coronavirus, with a molecular weight of 150 kDa, contains a large amino‐terminal ectodomain and short carboxy‐terminal endodomain bridged with a transmembrane domain. The ectodomain of the Spike protein is extensively glycosylated with <italic>N</italic>
‐linked glycosylation and seems important for the interaction with the receptors on the surface of the host cells. The conformation change through dimerization of the Spike protein is reported to be critical for the fusion event between the viral envelope and cellular membrane for the coronavirus family <xref rid="feb2s0014579304000870-bib-BIB9" ref-type="ref">[9]</xref>
. Therefore, binding of antibody to the Spike protein could block the viron entrance into host cells for some of the coronaviruses.</p>
<p>RNA interference (RNAi) (for reviews see [<xref rid="feb2s0014579304000870-bib-BIB10" ref-type="ref">10</xref>
, <xref rid="feb2s0014579304000870-bib-BIB11" ref-type="ref">11</xref>
, <xref rid="feb2s0014579304000870-bib-BIB12" ref-type="ref">12</xref>
, <xref rid="feb2s0014579304000870-bib-BIB13" ref-type="ref">13</xref>
, <xref rid="feb2s0014579304000870-bib-BIB14" ref-type="ref">14</xref>
]) is an innate cellular process, which is activated by a double‐stranded RNA molecule with 19–23‐nucleotide duplexes in cells from <italic>Caenorhabditis elegans</italic>
 to mammals <xref rid="feb2s0014579304000870-bib-BIB15" ref-type="ref">[15]</xref>
. The RNAi is triggered by degradation of single‐stranded RNAs of identical sequences. Therefore, RNAi technology can be used to silence gene expression by directly targeting its specific sequence of mRNA. Beside the widely used strategies for knocking down gene expression in academic research, RNAi technology, generated by small interfering RNAi (siRNA), has been used in therapeutic studies of human diseases including cancer, neurogenerative diseases and viral infectious diseases (reviewed in <xref rid="feb2s0014579304000870-bib-BIB14" ref-type="ref">[14]</xref>
).</p>
<p>To date, RNAi technology is reported as an ideal tool to inhibit infectious virus replication in host cells because siRNA can target and silence the important genes of the virus <xref rid="feb2s0014579304000870-bib-BIB16" ref-type="ref">[16]</xref>
. Using poliovirus as a model, Gitlin et al. <xref rid="feb2s0014579304000870-bib-BIB17" ref-type="ref">[17]</xref>
 demonstrated that siRNA could effectively protect human cells against infection by a rapidly replicating and highly cytolytic RNA virus. Hu et al. <xref rid="feb2s0014579304000870-bib-BIB18" ref-type="ref">[18]</xref>
 reported that siRNA could block retroviral infection in chick embryos and inhibit the growth of the Rous sarcoma virus and human immunodeficiency virus (HIV) in cell culture. They found that the siRNA primarily prevented accumulation of the viral RNAs synthesized in the late stage of the infection, but did not degrade the RNA genome in the virus in the early stage of the infection. Other groups reported that siRNA could specifically inhibit HIV‐1 replication and virus propagation <xref rid="feb2s0014579304000870-bib-BIB19" ref-type="ref">[19]</xref>
 through targeting major genes in the HIV life cycle, including p24 (the HIV long terminal repeat) [<xref rid="feb2s0014579304000870-bib-BIB20" ref-type="ref">20</xref>
, <xref rid="feb2s0014579304000870-bib-BIB21" ref-type="ref">21</xref>
], vif, nef <xref rid="feb2s0014579304000870-bib-BIB19" ref-type="ref">[19]</xref>
, tat and rev [<xref rid="feb2s0014579304000870-bib-BIB22" ref-type="ref">22</xref>
, <xref rid="feb2s0014579304000870-bib-BIB23" ref-type="ref">23</xref>
].</p>
<p>RNAi has been also used in anti‐hepatitis C or B virus (HCV, HBV), which causes chronic liver disease including cirrhosis and hepatocellular carcinoma [<xref rid="feb2s0014579304000870-bib-BIB24" ref-type="ref">24</xref>
, <xref rid="feb2s0014579304000870-bib-BIB25" ref-type="ref">25</xref>
, <xref rid="feb2s0014579304000870-bib-BIB26" ref-type="ref">26</xref>
, <xref rid="feb2s0014579304000870-bib-BIB27" ref-type="ref">27</xref>
, <xref rid="feb2s0014579304000870-bib-BIB28" ref-type="ref">28</xref>
]. Papadia et al. <xref rid="feb2s0014579304000870-bib-BIB28" ref-type="ref">[28]</xref>
, using a cell culture system, showed that the siRNAs generated from the HCV replicon could inhibit the HCV mRNA transcripts and protein expression. Those siRNAs could even inhibit HCV cDNA copies and OAS gene expression, which was induced by interferon‐α in virus‐infected host cells. Recently, McCaffrey et al. <xref rid="feb2s0014579304000870-bib-BIB26" ref-type="ref">[26]</xref>
 reported that RNAi could be used in a mouse model to inhibit HBV replication.</p>
<p>To search for a potential therapeutic method to prevent SARS‐CoV infection, we adopted RNAi technology based on reported studies in other infectious diseases. In this report, we targeted the Spike protein of SARS‐CoV using siRNAs generated from the DNA vector. We demonstrated that the siRNA could effectively and specifically silence gene expression of the Spike protein in SARS‐infected cells.</p>
</sec>
<sec id="feb2s0014579304000870-sec-2"><label>2</label>
<title>Materials and methods</title>
<sec id="feb2s0014579304000870-sec-2.1"><label>2.1</label>
<title>Vector construction</title>
<p>The vector with a U6 promoter (pBS/U6, a gift from Dr. Yang Shi at Harvard Medical School, Boson, MA, USA) was used to construct a 22 bp siRNAs. The hairpin cDNAs were generated through annealing of the complementary oligos synthesized, where <italic>Apa</italic>
I and <italic>Eco</italic>
RI sites were constructed. The hairpin cDNA insert was subcloned into the pBS/U6 vector through <italic>Apa</italic>
I and <italic>Eco</italic>
RI sites. The clones were verified by <italic>Xho</italic>
I digestion. Finally the clones were sequence‐confirmed.</p>
<p>The full length cDNA of the Spike protein was subcloned into a pCMV‐Myc expression vector (Invitrogen) with <italic>Bam</italic>
HI and <italic>Eco</italic>
RI through polymerase chain reaction (PCR) generating restrictive enzymes in the 5′ and 3′ ends of the insert. The subcloned vector, pCMV‐Myc/HA‐Spike, was sequence‐confirmed for the correct frame in the expression vector. pEGFP‐N1 was from Clontech Laboratories.</p>
</sec>
<sec id="feb2s0014579304000870-sec-2.2"><label>2.2</label>
<title>Cell culture and transfection</title>
<p>Human embryonic kidney cell line 293T and African green monkey kidney cell line Vero E6 were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat‐inactivated fetal bovine serum (FBS), 100 U/ml penicillin and 100 μg/ml streptomycin. 293T cells were plated onto 6 well plates at a density of 4×10<sup>5</sup>
 cells per well and cultured at 37°C with 5% CO<sub>2</sub>
 overnight for transfection. A total amount of 5 μg DNA per well was used for transient transfection with CalPhos (Clontech) according to the manufacturer's protocol. Vero E6 cells were plated onto 12 well plates at a density of 2×10<sup>5</sup>
 cells per well and cultured at 37°C with 5% CO<sub>2</sub>
 overnight. The transfection was performed at 90% cell confluence with a total amount of 4 μg DNA per well using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol.</p>
</sec>
<sec id="feb2s0014579304000870-sec-2.3"><label>2.3</label>
<title>SARS‐CoV culture and infection</title>
<p>SARS‐CoV (strain BJ01, GenBank accession number <ext-link ext-link-type="uri" xlink:href="genbank:AY278488">genbank:AY278488</ext-link>
), provided by the Institute of Microbiology and Epidemiology, AMMS, China, was propagated on Vero E6 cells. The virus was released from the infected cells by three freeze–thaw cycles. The titration of the virus was determined by plaque assay on Vero E6 cell monolayer. For the test of inhibition of the virus by siRNA, 2×10<sup>5</sup>
 transfected Vero E6 cells (with siRNA vectors) were infected with 5×10<sup>5</sup>
 multiplicity of infection (MOI) of SARS‐CoV (BJ01), in a final volume of 1 ml of DMEM with 2% FBS for 2 h at 37°C. Cells were then washed once with phosphate‐buffered saline (PBS, pH 7.4), before adding 2 ml complete medium to allow growth for 48 h at 37°C with 5% CO<sub>2</sub>
. All those operations were performed in a bio‐safety P3 level lab.</p>
</sec>
<sec id="feb2s0014579304000870-sec-2.4"><label>2.4</label>
<title>Western blot</title>
<p>Cells overexpressing hemagglutinin (HA)‐tagged Spike protein were harvested 48 h post transfection and lysed with 0.3 ml of cold lysis buffer (20 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X‐100, 1 mM NaVO<sub>3</sub>
, 2.5 mM sodium pyrophosphate, 1 mM β‐glycerol phosphate, 1 mM phenylmethylsulfonyl fluoride, 5 μg/ml aprotinin, and 5 μg/ml leupeptin, pH 7.5). 30 μg of total protein from cell lysate was separated on 6% sodium dodecyl sulfate–polyacrylamide gel electrophoresis, electro‐transferred to nitrocellulose membrane (Hyclone ECI, Amersham Pharmacia Biotech). Antibodies directly to HA, enhanced green fluorescent protein (EGFP) and β‐actin, obtained from Santa Cruz, were used to blot the membranes according to the conditions the manufacturer provided. The signals were detected by enhanced chemiluminescence (ECL, Amersham).</p>
</sec>
<sec id="feb2s0014579304000870-sec-2.5"><label>2.5</label>
<title>Immunostaining</title>
<p>Transfected cells were incubated for about 24 h. Cells were fixed in 4% paraformaldehyde for 20 min at room temperature, and permeabilized with PBS containing 0.2% Triton X‐100 for 10 min. The cells were blocked with FDB (PBS with 1 mM CaCl<sub>2</sub>
, 1 mM MgCl<sub>2</sub>
, 5% normal goat serum, 10% fetal bovine serum and 2% bovine serum albumin) for 1 h, and were incubated with primary antibodies in FDB for 3 h. After washing with PBS containing 0.1% Triton X‐100, the cells were incubated with suitable secondary antibodies conjugated with fluorescent isothiocyanate (TRITC) for 1 h. Cells were washed with PBS three times before observation. The results were analyzed using a Nikon TE300 fluorescence microscope. Pictures were taken with a CCD camera (SPOT, Diagnostic Instrument, USA) equipped with a computer‐based image acquisition system.</p>
</sec>
<sec id="feb2s0014579304000870-sec-2.6"><label>2.6</label>
<title>RNA isolation and reverse transcription (RT) PCR</title>
<p>Total RNA from the transfected cells or infected cells was extracted using Trizol (Invitrogen). The PCR reaction was performed using the One Step RNA PCR kit (Takara, Japan) with 1 μg of total RNA for each sample. 1 μM of forward primer (5′‐TATAGGATCCCACCATGTTTATTTTCTTATTATTTCTTAC‐3′) and reverse primer (5′‐TATAGAATTCTGTGTAATGTAATTTGACACC‐3′) was used for the PCR reaction with 25 cycles of denaturation (94°C, 30 s), annealing (55°C, 1 min) and extension (68°C, 4 min). β‐Actin (forward primer, 5′‐CAAGAGATGGCCACGGCTGCT‐3′; reverse primer, 5′‐TCCTTCTGCATCCTGTCGGCA‐3′) was used as an internal control and the reaction conditions were 25 cycles of denaturation (94°C, 30 s), annealing (55°C, 50 s) and extension (68°C, 1 min).</p>
</sec>
<sec id="feb2s0014579304000870-sec-2.7"><label>2.7</label>
<title>Northern blot</title>
<p>Total RNA (10 μg) from SARS‐CoV‐infected cells was fractionated on a 1.3% formaldehyde‐agarose gel and transferred to a nitrocellulose membrane. Probe S‐gene (1350–1950 bp from ATG from the CDS of the S gene) was labeled with <sup>32</sup>
P using the Prime‐a‐Gene kit (Promega) according to the manufacturer's protocol. Hybridization was performed at 68°C for 2 h in hybridization buffer (Promega). Membranes were washed three times in 2×SSC with 0.1% sodium dodecyl sulfate at 50°C and autoradiographed by PhosphorImager (DNA Storm, Amersham Pharmacia Biotech).</p>
</sec>
<sec id="feb2s0014579304000870-sec-2.8"><label>2.8</label>
<title>Virus titration</title>
<p>Vero E6 cells were infected with 4×10<sup>3</sup>
 MOI SARS‐CoV (BJ01) per well 48 h post transfection with plasmids including pBS/U6, pBS/U6/GFPi and pBS/U6/S‐RNAi1/2. The virus was allowed to infect the cells for 2 h and then was completely withdrawn by washing with PBS. After incubation for 72 h, the cells were lysed and assayed for the level of virus (MOI) in 96 well plates.</p>
</sec>
</sec>
<sec id="feb2s0014579304000870-sec-3"><label>3</label>
<title>Results</title>
<sec id="feb2s0014579304000870-sec-3.1"><label>3.1</label>
<title>Selection of siRNA target sequences in mRNA of Spike protein</title>
<p>The coronavirus Spike protein plays a critical role in virus infection. Therefore, we chose the S gene as a target for inhibition of SARS‐CoV infection. To locate the target site of siRNA in the SARS‐CoV genome, we selected those sequences of 22 bp with the structure of AGN<sub>18</sub>
TT. As an empirical design, we preferably chose the sites with GC/AT ratios between 30% and 60%. Also we used the selected sequences to search GenBank to confirm their specificity. In matching for those criteria, two specific target sequences were determined and noted, S‐RNAi1 and S‐RNAi2. A schematic presentation of the sequences is shown in <xref rid="feb2s0014579304000870-FIG1" ref-type="fig">Fig. 1A</xref>
. Those two targeted sequences in the Spike protein were at 1358–1376 and 3081–3099 bp from the first ATG of the cDNA of the gene, which were located in the S1 and S2 region of the protein, respectively.</p>
<fig fig-type="Figure" xml:lang="en" id="feb2s0014579304000870-FIG1" orientation="portrait" position="float"><label>Figure 1</label>
<caption><p>Target sites and vector information. A: Locations of siRNA target sites. S1 and S2 represent the S1 and S2 regions of Spike protein respectively. The targeted sequences for siRNA design are listed. B: Schematic of vector for generating siRNA. pBS/U6 promoter, sequence generating siRNA hairpin and transcriptional terminal signal are shown as indicated. C: Diagram of predicted structure of siRNAs from pBS/U6/S‐RNA1 and pBS/U6/S‐RNA2. UUCAAGAGA was used to generate the hairpin loop, indicated as a cycle.</p>
</caption>
<graphic id="nlm-graphic-1" xlink:href="FEB2-560-141-g001"><alt-text>figure image</alt-text>
</graphic>
</fig>
</sec>
<sec id="feb2s0014579304000870-sec-3.2"><label>3.2</label>
<title>Construction of the vectors generating siRNA</title>
<p>Although siRNA could be chemically synthesized directly, the cDNA vector driven by a promoter is used in most cases <xref rid="feb2s0014579304000870-bib-BIB14" ref-type="ref">[14]</xref>
 for convenience and economy reasons. In this study, we adopted the U6 promoter vector <xref rid="feb2s0014579304000870-bib-BIB29" ref-type="ref">[29]</xref>
 and constructed a 22 bp siRNA through the hairpin, which could be produced by the DNA vector. The hairpin cDNAs were generated through annealing of the complementary oligos synthesized, where <italic>Apa</italic>
I and <italic>Eco</italic>
RI sites were constructed. The hairpin cDNA as an insert was subcloned into pBS/U6 vector through <italic>Apa</italic>
I and <italic>Eco</italic>
RI sites. The correct clones were verified by <italic>Xho</italic>
I digestion, which was replaced by the insert. Finally, the clones were sequence‐confirmed. The single‐strand hairpin RNAs generated from the vectors were predicted as in <xref rid="feb2s0014579304000870-FIG1" ref-type="fig">Fig. 1C</xref>
.</p>
</sec>
<sec id="feb2s0014579304000870-sec-3.3"><label>3.3</label>
<title>Expression of Spike protein in cultured cells</title>
<p>To generate an in vitro expression system of the Spike protein from SARS‐CoV, we adopted the mammalian cell culture method. The cDNA encoding the Spike protein from SARS‐CoV was constructed into pCMV‐Myc, a mammalian expression vector with a CMV promoter, which could drive the expression of the Spike protein in cultured cells. To detect the protein expression, the cDNA of Spike protein was tagged with HA at the C‐terminus (<xref rid="feb2s0014579304000870-FIG2" ref-type="fig">Fig. 2A</xref>
, top panel). This construct was transfected into 293T cells and the expression of Spike protein was measured by Western blot. The data showed that the vector could drive the expression of Spike protein of SARS‐CoV in the cells at a high level (<xref rid="feb2s0014579304000870-FIG2" ref-type="fig">Fig. 2</xref>
, top panel, lane 1) although the molecular weight of the expressed protein (>90 kDa) was smaller than the predicted one (105 kDa). To avoid different transfection efficiencies, we balanced the total amount of DNA with an EGFP expression vector. The data showed that the EGFP expressions were very even (<xref rid="feb2s0014579304000870-FIG2" ref-type="fig">Fig. 2</xref>
, bottom panel, lanes 1, 3, and 4) and β‐actin level showed equal loading of samples (<xref rid="feb2s0014579304000870-FIG2" ref-type="fig">Fig. 2</xref>
, middle panel), suggesting that the transfection experiments were controlled under identical conditions. Taken together, we overexpressed the Spike protein from SARS‐CoV in 293T cells, which could be used for the study of the gene silencing in the cultured cells.</p>
<fig fig-type="Figure" xml:lang="en" id="feb2s0014579304000870-FIG2" orientation="portrait" position="float"><label>Figure 2</label>
<caption><p>Inhibition of expression of the Spike protein. Transfected siRNAs as indicated inhibited Spike protein expression. The Spike protein tagged with HA at the C‐terminus (HA‐Spike) overexpressed in the cells, which were co‐transfected with the indicated plasmids, was detected by Western blot using anti‐HA antibody from the lysates of the cells. β‐Actin and EGFP were used as internal and positive controls.</p>
</caption>
<graphic id="nlm-graphic-3" xlink:href="FEB2-560-141-g002"><alt-text>figure image</alt-text>
</graphic>
</fig>
</sec>
<sec id="feb2s0014579304000870-sec-3.4"><label>3.4</label>
<title>Silencing of S gene expression in cells by siRNA</title>
<p>To determine whether the siRNA we generated could effectively reduce the expression of Spike protein in cultured cells, we first transfected the siRNA vectors pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 into 293T cells where Spike protein was overexpressed. To show the specificity of the siRNA targeting, we used EGFP as a control. From the data, it was clearly demonstrated that pBS/U6/EGFP‐RNAi could specifically silence the expression of EGFP protein in cells (<xref rid="feb2s0014579304000870-FIG2" ref-type="fig">Fig. 2</xref>
, bottom panel, lane 2). However, pBS/U6/S‐RNAi1, pBS/U6/S‐RNAi2 or the vector alone (pBS/U6) had no effect on EGFP expression (<xref rid="feb2s0014579304000870-FIG2" ref-type="fig">Fig. 2</xref>
, bottom panel, lanes 1, 3 and 4). Interestingly, both pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 could specifically impair the expression of Spike protein in cultured cells (<xref rid="feb2s0014579304000870-FIG2" ref-type="fig">Fig. 2</xref>
, top panel, lanes 3 and 4), while pBS/U6/EGFP‐RNAi or the vector did not (<xref rid="feb2s0014579304000870-FIG2" ref-type="fig">Fig. 2</xref>
, top panel, lanes 1 and 2). Meanwhile, all of the constructs had no effect on β‐actin expression (<xref rid="feb2s0014579304000870-FIG2" ref-type="fig">Fig. 2</xref>
, middle panel). All these data suggest that siRNA targeting of the Spike protein in SARS‐CoV could block or silence the expression of Spike protein in mammalian cells.</p>
<p>To show the silencing of the Spike protein in transfected cells, we also performed an immunostaining experiment using anti‐HA antibody. Similarly, we assessed EGFP expression by using fluorescence microscopy. The results showed that EGFP proteins were highly expressed in cells transfected with the expression vector in the presence of the co‐transfected pBS/U6 vector (<xref rid="feb2s0014579304000870-FIG3" ref-type="fig">Fig. 3a</xref>
), pBS/U6/S‐RNAi1 (<xref rid="feb2s0014579304000870-FIG3" ref-type="fig">Fig. 3e</xref>
) and pBS/U6/S‐RNAi2 (<xref rid="feb2s0014579304000870-FIG3" ref-type="fig">Fig. 3g</xref>
), but rarely expressed in cells in the presence of the co‐transfected pBS/U6/EGFP‐RNAi (<xref rid="feb2s0014579304000870-FIG3" ref-type="fig">Fig. 3c</xref>
). In contrast, Spike protein could be detected at levels similar to the EGFP protein in the control panel (<xref rid="feb2s0014579304000870-FIG3" ref-type="fig">Fig. 3a,b</xref>
). However, when pBS/U6/S‐RNAi1 (<xref rid="feb2s0014579304000870-FIG3" ref-type="fig">Fig. 3f</xref>
) and pBS/U6/S‐RNAi2 (<xref rid="feb2s0014579304000870-FIG3" ref-type="fig">Fig. 3h</xref>
) respectively were transfected into cells, Spike proteins were shown to be gradually reduced. These data suggest that pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 significantly blocked the expression of Spike protein in the cells, indicating that the siRNAs we designed functioned in our mammalian system.</p>
<fig fig-type="Figure" xml:lang="en" id="feb2s0014579304000870-FIG3" orientation="portrait" position="float"><label>Figure 3</label>
<caption><p>Immunostaining for Spike protein in transfected cells. 293T cells were co‐transfected with pCMV‐Myc/HA‐Spike and pEGFP‐N1 vectors for 48 h in the presence of different siRNA plasmids as indicated. The cells were immunostained with anti‐HA antibody plus TRITC‐conjugated secondary antibody (red). The pictures were viewed with a Nikon TE300 microscope and captured with SPOT CCD software. The EGFP pictures were observed before immunostaining. The co‐transfected vectors are (a,b) empty vector pBS/U6, (c,d) pBS/U6/EGFP‐RNAi, (e,f) pBS/U6/S‐RNAi1, and (g,h) pBS/U6/S‐RNAi2.</p>
</caption>
<graphic id="nlm-graphic-5" xlink:href="FEB2-560-141-g003"><alt-text>figure image</alt-text>
</graphic>
</fig>
<p>To verify the inhibition of Spike protein expression by siRNAs through the inhibition of the S gene, semi‐quantitative RT‐PCR was performed. The data show that pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 reduced the accumulation of mRNA S gene (<xref rid="feb2s0014579304000870-FIG4" ref-type="fig">Fig. 4</xref>
, lanes 3 and 4 compared to lane 2) while it had no effect on β‐actin mRNA. These data indicate that siRNAs inhibited Spike protein expression through blocking mRNA accumulation.</p>
<fig fig-type="Figure" xml:lang="en" id="feb2s0014579304000870-FIG4" orientation="portrait" position="float"><label>Figure 4</label>
<caption><p>Reduced mRNA accumulation of the S gene in cells overexpressing Spike protein. 293T cells were co‐transfected with the S gene expression vector (pCMV‐Myc/HA‐Spike) and the indicated plasmids for siRNA or control vectors. Cells were harvested after transfection for 2 days. RT‐PCR products for the S gene and the internal control, β‐actin, are shown as indicated molecular weights.</p>
</caption>
<graphic id="nlm-graphic-7" xlink:href="FEB2-560-141-g004"><alt-text>figure image</alt-text>
</graphic>
</fig>
</sec>
<sec id="feb2s0014579304000870-sec-3.5"><label>3.5</label>
<title>Inhibition of SARS‐CoV infection by siRNA in cultured cells</title>
<p>To determine whether the vector‐based siRNA could efficiently prevent SARS‐CoV infection of cells, we transfected 2, 3 and 4 μg of pBS/U6/S‐RNAi1 (<xref rid="feb2s0014579304000870-FIG5" ref-type="fig">Fig. 5</xref>
, lanes 3–5), and pBS/U6/S‐RNAi2 (<xref rid="feb2s0014579304000870-FIG5" ref-type="fig">Fig. 5</xref>
, lanes 6–8) into Vero E6 cells in a 12 well plate. As controls, the pBS/U6 vector alone (<xref rid="feb2s0014579304000870-FIG5" ref-type="fig">Fig. 5</xref>
, lane 1) and pBS/U6/EGFP‐RNAi (as a non‐related gene RNAi, <xref rid="feb2s0014579304000870-FIG5" ref-type="fig">Fig. 5</xref>
, lane 2) were also transfected into parallel cells. After incubation for 1 day, the transfected cells were infected with SARS‐CoV (BJ01) at 5×10<sup>5</sup>
 MOI per well with 2×10<sup>5</sup>
 cells. The cells were harvested and the total RNA was isolated for RT‐PCR to measure S gene expression. The data indicate that both pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 could effectively inhibit gene expression of the Spike protein in the SARS‐CoV‐infected cells (compare lanes 3 and 6 to lanes 1 and 2 in <xref rid="feb2s0014579304000870-FIG5" ref-type="fig">Fig. 5</xref>
). As expected, with the increasing amounts of siRNA transfected, there was increasing inhibition of S gene expression (compare lanes 3–5 and lanes 6–8 in <xref rid="feb2s0014579304000870-FIG5" ref-type="fig">Fig. 5</xref>
). Those data were reconfirmed by Northern blots (<xref rid="feb2s0014579304000870-FIG6" ref-type="fig">Fig. 6</xref>
, same design as <xref rid="feb2s0014579304000870-FIG5" ref-type="fig">Fig. 5</xref>
), suggesting that the siRNA we generated could block S gene expression of SARS‐CoV in the infected cells.</p>
<fig fig-type="Figure" xml:lang="en" id="feb2s0014579304000870-FIG5" orientation="portrait" position="float"><label>Figure 5</label>
<caption><p>Dose‐dependent inhibition of S gene mRNA accumulation. The Vero E6 cells were transfected with the indicated plasmids for one day. Thereafter, the cells were infected with SARS‐CoV (BJ01) at 5×10<sup>5</sup>
 MOI/ml. After 2 days of infection, the cells were harvested with Trizol (Promega) for RNA isolation in a P3 lab. RT‐PCR was performed to show the accumulation of S gene mRNA from the infected SARS‐CoV. Increasing amounts of siRNA vectors transfected are indicated. RT‐PCR products for the S gene and the internal control, β‐actin, are shown as indicated molecular weights.</p>
</caption>
<graphic id="nlm-graphic-9" xlink:href="FEB2-560-141-g005"><alt-text>figure image</alt-text>
</graphic>
</fig>
<fig fig-type="Figure" xml:lang="en" id="feb2s0014579304000870-FIG6" orientation="portrait" position="float"><label>Figure 6</label>
<caption><p>Northern blot of S gene mRNA in the transfected cells. The Vero E6 cells were transfected with the indicated plasmids and treated with SARS‐CoV as in <xref rid="feb2s0014579304000870-FIG5" ref-type="fig">Fig. 5</xref>
. The total RNA was subjected to Northern blot analysis with <sup>32</sup>
P‐labeled probes amplified from SARS‐CoV cDNA (BJ01) and GAPDH. The abundance of S gene mRNA and GAPDH is indicated.</p>
</caption>
<graphic id="nlm-graphic-11" xlink:href="FEB2-560-141-g006"><alt-text>figure image</alt-text>
</graphic>
</fig>
</sec>
<sec id="feb2s0014579304000870-sec-3.6"><label>3.6</label>
<title>siRNA inhibited the replication of SARS‐CoV from the infected cells</title>
<p>Since SARS‐CoV can replicate rapidly in cells we tested the ability of siRNA to inhibit virus production. After 72 h of culture, the virus in the medium of the cells should represent the newly replicated virus in the cells. To validate the siRNA effects on replication of SARS‐CoV, we performed virus titration assays by assaying for extracellular virus in infected cells 72 h post infection. The data showed that the control plate had high titers of virus (<xref rid="feb2s0014579304000870-FIG7" ref-type="fig">Fig. 7</xref>
, lane 1), suggesting the virus replicated in the cells during the 72 h culture period. In contrast, the virus titer was dramatically decreased in the plate where the cells were transfected with siRNA (<xref rid="feb2s0014579304000870-FIG7" ref-type="fig">Fig. 7</xref>
, lanes 2 and 3), demonstrating that the siRNA inhibited virus replication. Both pBS/U6 and pBS/U6/EGFP‐RNAi treatments had similar levels of virus to that of the control, suggesting the RNAi effect was specific.</p>
<fig fig-type="Figure" xml:lang="en" id="feb2s0014579304000870-FIG7" orientation="portrait" position="float"><label>Figure 7</label>
<caption><p>SARS‐CoV titration in the medium of the infected cells. The indicated Vero E6 cells were infected with SARS‐CoV for 2 h and then the virus was washed off with medium. The virus titrations were determined for the supernatant (medium) of the infected cells cultured for 72 h after infection. (+) indicates cells infected with SARS‐CoV, (−) indicates normal cultured cells.</p>
</caption>
<graphic id="nlm-graphic-13" xlink:href="FEB2-560-141-g007"><alt-text>figure image</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec id="feb2s0014579304000870-sec-4"><label>4</label>
<title>Discussion</title>
<p>SARS‐CoV has been classified as a novel member of the coronavirus family with significantly different genome sequences [<xref rid="feb2s0014579304000870-bib-BIB4" ref-type="ref">4</xref>
, <xref rid="feb2s0014579304000870-bib-BIB7" ref-type="ref">7</xref>
, <xref rid="feb2s0014579304000870-bib-BIB30" ref-type="ref">30</xref>
]. However, the structure of the virus is similar to the other coronaviruses, which contain a spike protein thought to play an important role in viral entry and pathogenesis <xref rid="feb2s0014579304000870-bib-BIB9" ref-type="ref">[9]</xref>
. In an attempt to prevent and inhibit SARS‐CoV replication, we employed RNAi technology, which has been used to silence virus gene expression in HIV and HCV/HBV. In this paper, we provide evidence that a DNA vector‐based siRNA could effectively and specifically inhibit gene expression of the Spike protein from SARS‐CoV. Initially, we showed that siRNAs silenced the expression of Spike protein in cells transfected with S gene expression vector. Both Western blot and immunostaining experiments consistently suggested that the DNA vectors carrying the siRNA hairpin targeted the overexpressed S gene in cells. We also showed that the mRNA level was decreased when siRNAs were transfected into the cells. This model system demonstrated the inhibition of gene expression of the virus as in the case of inhibition of HIV and HCV/HBV [<xref rid="feb2s0014579304000870-bib-BIB18" ref-type="ref">18</xref>
, <xref rid="feb2s0014579304000870-bib-BIB19" ref-type="ref">19</xref>
, <xref rid="feb2s0014579304000870-bib-BIB21" ref-type="ref">21</xref>
, <xref rid="feb2s0014579304000870-bib-BIB22" ref-type="ref">22</xref>
, <xref rid="feb2s0014579304000870-bib-BIB23" ref-type="ref">23</xref>
, <xref rid="feb2s0014579304000870-bib-BIB27" ref-type="ref">27</xref>
, <xref rid="feb2s0014579304000870-bib-BIB28" ref-type="ref">28</xref>
, <xref rid="feb2s0014579304000870-bib-BIB31" ref-type="ref">31</xref>
, <xref rid="feb2s0014579304000870-bib-BIB32" ref-type="ref">32</xref>
, <xref rid="feb2s0014579304000870-bib-BIB33" ref-type="ref">33</xref>
].</p>
<p>The genome sequence revealed SARS‐CoV as a novel coronavirus, in which the typical Spike protein and other proteins were predicted. However, there is no report on the isolation and purification of Spike protein from SARS‐CoV‐infected cells or tissues. In this report we used the recombinant Spike protein cDNA from the SARS‐CoV genome and expressed the protein in 293T cells. The molecular weight of the expressed HA‐tagged protein was smaller than the predicted one, suggesting the modification of Spike protein in mammalian cells. Our data showed that this expression vector could be targeted by the siRNAs. Because there is no anti‐Spike protein antibody generated, this is a direct way to detect the inhibition of the protein expression by siRNA in cultured cells.</p>
<p>Importantly, after demonstration that siRNAs inhibited Spike protein expression in cells transfected with the expression vector, we used Vero E6 cells, which were reported to be susceptible to SARS‐CoV infection and replication. We infected the cells with SARS‐CoV (strain BJ01) and found, through both RT‐PCR and Northern blot, that siRNAs could significantly inhibit S gene mRNA accumulation, suggesting that siRNAs might inhibit SARS‐CoV replication in cells. This could be further demonstrated by the evaluation of the virus yields from the cells. We consider that the virus in the medium after 72 h of culture represents newly replicated virus. Therefore, the decreased yields of virus in the medium confirmed that virus replication was inhibited by the siRNAs we designed.</p>
<p>Taken together, we report that the designed siRNA vectors targeting the mRNA of Spike protein from SARS‐CoV could specifically and effectively silence gene expression in mammalian cells. This study provides evidence that siRNA could be employed as a potential tool to inhibit gene expression of the Spike protein of SARS‐CoV. To our knowledge, this is the first report that siRNA could be used for inhibition of SARS‐CoV in cells. Whether those siRNAs could be used in animal models for SARS‐CoV infection is under investigation.</p>
</sec>
</body>
<back><ack id="feb2s0014579304000870-sec-0000"><title>Acknowledgements</title>
<p>This work was supported by a special grant (fd0311) in Tsinghua University 985 Program and grants from the Chinese National Academic Foundation (Nos. 39970369, 30070703, and 30030050) and 973 Project (2001CB510006, 2002CB513000) to Z.J.C. We would like to thank Dr. Yang Shi at Harvard University for kindly providing pBS/U6 and pBS/U6/EGFP‐RNAi vectors. We specially thank Dr. Yongzhang Luo (Tsinghua University) for providing full‐length cDNA of the S gene. We thank the Genome Institute of Singapore for proving SARS whole genome clones and S gene expression vector, which were used as references in our study. We thank Dr. Q. Zhu (The Institute of Microbiology and Epidemiology, AMMS, China) for providing SARS‐CoV (BJ01) virus strain.</p>
</ack>
<ref-list content-type="cited-references"><title>References</title>
<ref id="feb2s0014579304000870-bib-BIB1"><label>1</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB1"><string-name><given-names>T.</given-names>
<surname>Blackmore</surname>
</string-name>,
<article-title>Severe acute respiratory syndrome: a storm in a teacup?</article-title>.
<source xml:lang="en">NZ Med. J.</source>,
<volume>116</volume>,
(<year>2003</year>),
<fpage>U397</fpage>–
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB2"><label>2</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB2"><string-name><given-names>J.</given-names>
<surname>Parry</surname>
</string-name>,
<article-title>SARS virus identified, but the disease is still spreading</article-title>.
<source xml:lang="en">Br. Med. J.</source>,
<volume>326</volume>,
(<year>2003</year>),
<fpage>897</fpage>–
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB3"><label>3</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB3"><string-name><given-names>K.V.</given-names>
<surname>Holmes</surname>
</string-name>,
<article-title>SARS-associated coronavirus</article-title>.
<source xml:lang="en">New Engl. J. Med.</source>,
<volume>348</volume>,
(<year>2003</year>),
<fpage>1948</fpage>–
<lpage>1951</lpage>.
<pub-id pub-id-type="pmid">12748314</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB4"><label>4</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB4"><string-name><given-names>C.</given-names>
<surname>Drosten</surname>
</string-name>,
<article-title>Identification of a novel coronavirus in patients with severe acute respiratory syndrome</article-title>.
<source xml:lang="en">New Engl. J. Med.</source>,
<volume>348</volume>,
(<year>2003</year>),
<fpage>1967</fpage>–
<lpage>1976</lpage>.
<pub-id pub-id-type="pmid">12690091</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB5"><label>5</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB5"><string-name><given-names>T.G.</given-names>
<surname>Ksiazek</surname>
</string-name>,
<article-title>A novel coronavirus associated with severe acute respiratory syndrome</article-title>.
<source xml:lang="en">New Engl. J. Med.</source>,
<volume>348</volume>,
(<year>2003</year>),
<fpage>1953</fpage>–
<lpage>1966</lpage>.
<pub-id pub-id-type="pmid">12690092</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB6"><label>6</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB6"><string-name><given-names>J.S.</given-names>
<surname>Peiris</surname>
</string-name>,
<article-title>Coronavirus as a possible cause of severe acute respiratory syndrome</article-title>.
<source xml:lang="en">Lancet</source>,
<volume>361</volume>,
(<year>2003</year>),
<fpage>1319</fpage>–
<lpage>1325</lpage>.
<pub-id pub-id-type="pmid">12711465</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB7"><label>7</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB7"><string-name><given-names>Y.</given-names>
<surname>Wang</surname>
</string-name>,
<article-title>Gene sequence analysis of SARS-associated coronavirus by nested RT-PCR</article-title>.
<source xml:lang="en">Di Yi Jun Yi Da Xue Xue Bao</source>,
<volume>23</volume>,
(<year>2003</year>),
<fpage>421</fpage>–
<lpage>423</lpage>.
<pub-id pub-id-type="pmid">12754117</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB8"><label>8</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB8"><string-name><given-names>K.</given-names>
<surname>Anand</surname>
</string-name>,
<article-title>Coronavirus main proteinase (3CLpro) structure: basis for design of anti-SARS drugs</article-title>.
<source xml:lang="en">Science</source>,
<volume>300</volume>,
(<year>2003</year>),
<fpage>1763</fpage>–
<lpage>1767</lpage>.
<pub-id pub-id-type="pmid">12746549</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB9"><label>9</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB9"><string-name><given-names>T.M.</given-names>
<surname>Gallagher</surname>
</string-name>,
<string-name><given-names>M.J.</given-names>
<surname>Buchmeier</surname>
</string-name>,
<article-title>Coronavirus spike proteins in viral entry and pathogenesis</article-title>.
<source xml:lang="en">Virology</source>,
<volume>279</volume>,
(<year>2001</year>),
<fpage>371</fpage>–
<lpage>374</lpage>.
<pub-id pub-id-type="pmid">11162792</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB10"><label>10</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB10"><string-name><given-names>A.</given-names>
<surname>Fire</surname>
</string-name>,
<article-title>RNA-triggered gene silencing</article-title>.
<source xml:lang="en">Trends Genet.</source>,
<volume>15</volume>,
(<year>1999</year>),
<fpage>358</fpage>–
<lpage>363</lpage>.
<pub-id pub-id-type="pmid">10461204</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB11"><label>11</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB11"><string-name><given-names>G.</given-names>
<surname>Hutvagner</surname>
</string-name>,
<string-name><given-names>P.D.</given-names>
<surname>Zamore</surname>
</string-name>,
<article-title>RNAi: nature abhors a double-strand</article-title>.
<source xml:lang="en">Curr. Opin. Genet. Dev.</source>,
<volume>12</volume>,
(<year>2002</year>),
<fpage>225</fpage>–
<lpage>232</lpage>.
<pub-id pub-id-type="pmid">11893497</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB12"><label>12</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB12"><string-name><given-names>J.</given-names>
<surname>Marx</surname>
</string-name>,
<article-title>Interfering with gene expression</article-title>.
<source xml:lang="en">Science</source>,
<volume>288</volume>,
(<year>2000</year>),
<fpage>1370</fpage>–
<lpage>1372</lpage>.
<pub-id pub-id-type="pmid">10847851</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB13"><label>13</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB13"><string-name><given-names>P.A.</given-names>
<surname>Sharp</surname>
</string-name>,
<article-title>RNA interference-2001</article-title>.
<source xml:lang="en">Genes Dev.</source>,
<volume>15</volume>,
(<year>2001</year>),
<fpage>485</fpage>–
<lpage>490</lpage>.
<pub-id pub-id-type="pmid">11238371</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB14"><label>14</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB14"><string-name><given-names>Y.</given-names>
<surname>Shi</surname>
</string-name>,
<article-title>Mammalian RNAi for the masses</article-title>.
<source xml:lang="en">Trends Genet.</source>,
<volume>19</volume>,
(<year>2003</year>),
<fpage>9</fpage>–
<lpage>12</lpage>.
<pub-id pub-id-type="pmid">12493242</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB15"><label>15</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB15"><string-name><given-names>R.</given-names>
<surname>Agami</surname>
</string-name>,
<article-title>RNAi and related mechanisms and their potential use for therapy</article-title>.
<source xml:lang="en">Curr. Opin. Chem. Biol.</source>,
<volume>6</volume>,
(<year>2002</year>),
<fpage>829</fpage>–
<lpage>834</lpage>.
<pub-id pub-id-type="pmid">12470738</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB16"><label>16</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB16"><string-name><given-names>R.</given-names>
<surname>Andino</surname>
</string-name>,
<article-title>RNAi puts a lid on virus replication</article-title>.
<source xml:lang="en">Nat. Biotechnol.</source>,
<volume>21</volume>,
(<year>2003</year>),
<fpage>629</fpage>–
<lpage>630</lpage>.
<pub-id pub-id-type="pmid">12776148</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB17"><label>17</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB17"><string-name><given-names>L.</given-names>
<surname>Gitlin</surname>
</string-name>,
<string-name><given-names>S.</given-names>
<surname>Karelsky</surname>
</string-name>,
<string-name><given-names>R.</given-names>
<surname>Andino</surname>
</string-name>,
<article-title>Short interfering RNA confers intracellular antiviral immunity in human cells</article-title>.
<source xml:lang="en">Nature</source>,
<volume>418</volume>,
(<year>2002</year>),
<fpage>430</fpage>–
<lpage>434</lpage>.
<pub-id pub-id-type="pmid">12087357</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB18"><label>18</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB18"><string-name><given-names>W.Y.</given-names>
<surname>Hu</surname>
</string-name>,
<article-title>Inhibition of retroviral pathogenesis by RNA interference</article-title>.
<source xml:lang="en">Curr. Biol.</source>,
<volume>12</volume>,
(<year>2002</year>),
<fpage>1301</fpage>–
<lpage>1311</lpage>.
<pub-id pub-id-type="pmid">12176358</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB19"><label>19</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB19"><string-name><given-names>J.M.</given-names>
<surname>Jacque</surname>
</string-name>,
<string-name><given-names>K.</given-names>
<surname>Triques</surname>
</string-name>,
<string-name><given-names>M.</given-names>
<surname>Stevenson</surname>
</string-name>,
<article-title>Modulation of HIV-1 replication by RNA interference</article-title>.
<source xml:lang="en">Nature</source>,
<volume>418</volume>,
(<year>2002</year>),
<fpage>435</fpage>–
<lpage>438</lpage>.
<pub-id pub-id-type="pmid">12087358</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB20"><label>20</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB20"><string-name><given-names>W.S.</given-names>
<surname>Park</surname>
</string-name>,
<article-title>Prevention of HIV-1 infection in human peripheral blood mononuclear cells by specific RNA interference</article-title>.
<source xml:lang="en">Nucleic Acids Res.</source>,
<volume>30</volume>,
(<year>2002</year>),
<fpage>4830</fpage>–
<lpage>4835</lpage>.
<pub-id pub-id-type="pmid">12433985</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB21"><label>21</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB21"><string-name><given-names>C.D.</given-names>
<surname>Novina</surname>
</string-name>,
<article-title>siRNA-directed inhibition of HIV-1 infection</article-title>.
<source xml:lang="en">Nat. Med.</source>,
<volume>8</volume>,
(<year>2002</year>),
<fpage>681</fpage>–
<lpage>686</lpage>.
<pub-id pub-id-type="pmid">12042777</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB22"><label>22</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB22"><string-name><given-names>G.A.</given-names>
<surname>Coburn</surname>
</string-name>,
<string-name><given-names>B.R.</given-names>
<surname>Cullen</surname>
</string-name>,
<article-title>Potent and specific inhibition of human immunodeficiency virus type 1 replication by RNA interference</article-title>.
<source xml:lang="en">J. Virol.</source>,
<volume>76</volume>,
(<year>2002</year>),
<fpage>9225</fpage>–
<lpage>9231</lpage>.
<pub-id pub-id-type="pmid">12186906</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB23"><label>23</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB23"><string-name><given-names>M.A.</given-names>
<surname>Martinez</surname>
</string-name>,
<string-name><given-names>B.</given-names>
<surname>Clotet</surname>
</string-name>,
<string-name><given-names>J.A.</given-names>
<surname>Este</surname>
</string-name>,
<article-title>RNA interference of HIV replication</article-title>.
<source xml:lang="en">Trends Immunol.</source>,
<volume>23</volume>,
(<year>2002</year>),
<fpage>559</fpage>–
<lpage>561</lpage>.
<pub-id pub-id-type="pmid">12464559</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB24"><label>24</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB24"><string-name><given-names>K.</given-names>
<surname>Hamasaki</surname>
</string-name>,
<article-title>Short interfering RNA-directed inhibition of hepatitis B virus replication</article-title>.
<source xml:lang="en">FEBS Lett.</source>,
<volume>543</volume>,
(<year>2003</year>),
<fpage>51</fpage>–
<lpage>54</lpage>.
<pub-id pub-id-type="pmid">12753904</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB25"><label>25</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB25"><string-name><given-names>T.</given-names>
<surname>Yokota</surname>
</string-name>,
<article-title>Inhibition of intracellular hepatitis C virus replication by synthetic and vector-derived small interfering RNAs</article-title>.
<source xml:lang="en">EMBO Rep.</source>,
<volume>4</volume>,
(<year>2003</year>),
<fpage>602</fpage>–
<lpage>608</lpage>.
<pub-id pub-id-type="pmid">12740604</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB26"><label>26</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB26"><string-name><given-names>A.P.</given-names>
<surname>McCaffrey</surname>
</string-name>,
<article-title>Inhibition of hepatitis B virus in mice by RNA interference</article-title>.
<source xml:lang="en">Nat. Biotechnol.</source>,
<volume>21</volume>,
(<year>2003</year>),
<fpage>639</fpage>–
<lpage>644</lpage>.
<pub-id pub-id-type="pmid">12740585</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB27"><label>27</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB27"><string-name><given-names>A.</given-names>
<surname>Shlomai</surname>
</string-name>,
<string-name><given-names>Y.</given-names>
<surname>Shaul</surname>
</string-name>,
<article-title>Inhibition of hepatitis B virus expression and replication by RNA interference</article-title>.
<source xml:lang="en">Hepatology</source>,
<volume>37</volume>,
(<year>2003</year>),
<fpage>764</fpage>–
<lpage>770</lpage>.
<pub-id pub-id-type="pmid">12668968</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB28"><label>28</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB28"><string-name><given-names>S.B.</given-names>
<surname>Kapadia</surname>
</string-name>,
<string-name><given-names>A.</given-names>
<surname>Brideau-Andersen</surname>
</string-name>,
<string-name><given-names>F.V.</given-names>
<surname>Chisari</surname>
</string-name>,
<article-title>Interference of hepatitis C virus RNA replication by short interfering RNAs</article-title>.
<source xml:lang="en">Proc. Natl. Acad. Sci. USA</source>,
<volume>100</volume>,
(<year>2003</year>),
<fpage>2014</fpage>–
<lpage>2018</lpage>.
<pub-id pub-id-type="pmid">12566571</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB29"><label>29</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB29"><string-name><given-names>G.</given-names>
<surname>Sui</surname>
</string-name>,
<article-title>A DNA vector-based RNAi technology to suppress gene expression in mammalian cells</article-title>.
<source xml:lang="en">Proc. Natl. Acad. Sci. USA</source>,
<volume>99</volume>,
(<year>2002</year>),
<fpage>5515</fpage>–
<lpage>5520</lpage>.
<pub-id pub-id-type="pmid">11960009</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB30"><label>30</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB30"><string-name><given-names>M.A.</given-names>
<surname>Marra</surname>
</string-name>,
<article-title>The genome sequence of the SARS-associated coronavirus</article-title>.
<source xml:lang="en">Science</source>,
<volume>300</volume>,
(<year>2003</year>),
<fpage>1399</fpage>–
<lpage>1404</lpage>.
<pub-id pub-id-type="pmid">12730501</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB31"><label>31</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB31"><string-name><given-names>N.J.</given-names>
<surname>Caplen</surname>
</string-name>,
<article-title>Inhibition of viral gene expression and replication in mosquito cells by siRNA-triggered RNA interference</article-title>.
<source xml:lang="en">Mol. Ther.</source>,
<volume>6</volume>,
(<year>2002</year>),
<fpage>243</fpage>–
<lpage>251</lpage>.
<pub-id pub-id-type="pmid">12161191</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB32"><label>32</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB32"><string-name><given-names>J.</given-names>
<surname>Capodici</surname>
</string-name>,
<string-name><given-names>K.</given-names>
<surname>Kariko</surname>
</string-name>,
<string-name><given-names>D.</given-names>
<surname>Weissman</surname>
</string-name>,
<article-title>Inhibition of HIV-1 infection by small interfering RNA-mediated RNA interference</article-title>.
<source xml:lang="en">J. Immunol.</source>,
<volume>169</volume>,
(<year>2002</year>),
<fpage>5196</fpage>–
<lpage>5201</lpage>.
<pub-id pub-id-type="pmid">12391237</pub-id>
</mixed-citation>
</ref>
<ref id="feb2s0014579304000870-bib-BIB33"><label>33</label>
<mixed-citation publication-type="journal" id="feb2s0014579304000870-cit-BIB33"><string-name><given-names>Q.</given-names>
<surname>Jia</surname>
</string-name>,
<string-name><given-names>R.</given-names>
<surname>Sun</surname>
</string-name>,
<article-title>Inhibition of gammaherpesvirus replication by RNA interference</article-title>.
<source xml:lang="en">J. Virol.</source>,
<volume>77</volume>,
(<year>2003</year>),
<fpage>3301</fpage>–
<lpage>3306</lpage>.
<pub-id pub-id-type="pmid">12584354</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/SrasV1/Data/Pmc/Corpus

HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 001009  | SxmlIndent | more

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 001009  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    SrasV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

This area was generated with Dilib version V0.6.33.
Data generation: Tue Apr 28 14:49:16 2020. Site generation: Sat Mar 27 22:06:49 2021

	Serveur d'exploration SRAS
	Attention, ce site est en cours de développement ! Attention, site généré par des moyens informatiques à partir de corpus bruts. Les informations ne sont donc pas validées.

Serveur d'exploration SRAS

Links to Exploration step

Le document en format XML

Pour manipuler ce document sous Unix (Dilib)

Pour mettre un lien sur cette page dans le réseau Wicri