The 29-Nucleotide Deletion Present in Human but Not in Animal Severe Acute Respiratory Syndrome Coronaviruses Disrupts the Functional Expression of Open Reading Frame 8▿
Identifieur interne : 000724 ( Pmc/Corpus ); précédent : 000723; suivant : 000725The 29-Nucleotide Deletion Present in Human but Not in Animal Severe Acute Respiratory Syndrome Coronaviruses Disrupts the Functional Expression of Open Reading Frame 8▿
Auteurs : Monique Oostra ; Cornelis A. M. De Haan ; Peter J. M. RottierSource :
- Journal of Virology [ 0022-538X ] ; 2007.
Abstract
One of the most striking and dramatic genomic changes observed in the severe acute respiratory syndrome coronavirus (SARS-CoV) isolated from humans soon after its zoonotic transmission from palm civets was the acquisition of a characteristic 29-nucleotide deletion. This occurred in open reading frame 8 (ORF8), one of the accessory genes unique to the SARS-CoV. The function of ORF8 and the significance of the deletion are unknown. The intact ORF8 present in animal and some early human isolates encodes a 122-amino-acid polypeptide (8ab+), which we expressed in cells using the vaccinia virus T7 expression system. It was found to contain a cleavable signal sequence, which directs the precursor to the endoplasmic reticulum (ER) and mediates its translocation into the lumen. The cleaved protein became N-glycosylated, assembled into disulfide-linked homomultimeric complexes, and remained stably in the ER. The 29-nucleotide deletion splits ORF8 into two ORFs, 8a and 8b, encoding 39- and 84-residue polypeptides. The 8a polypeptide is likely to remain in the cytoplasm, as it is too small for its signal sequence to function and will therefore be directly released from the ribosome. However, we could not confirm this experimentally due to the lack of proper antibodies. ORF8b appeared not to be expressed in SARS-CoV-infected cells or when expressed from mRNA's mimicking mRNA8. This was due to the context of the internal AUG initiation codon, as we demonstrated after placing the ORF8b immediately behind the T7 promoter. A soluble, unmodified and monomeric 8b protein was now expressed in the cytoplasm, which was highly unstable and rapidly degraded. Clearly, the 29-nucleotide deletion disrupts the proper expression of the SARS-CoV ORF8, the implications of which are discussed.
Url:
DOI: 10.1128/JVI.01631-07
PubMed: 17928347
PubMed Central: 2168875
Links to Exploration step
PMC:2168875Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">The 29-Nucleotide Deletion Present in Human but Not in Animal Severe Acute Respiratory Syndrome Coronaviruses Disrupts the Functional Expression of Open Reading Frame 8<xref ref-type="fn" rid="fn1">▿</xref> </title><author><name sortKey="Oostra, Monique" sort="Oostra, Monique" uniqKey="Oostra M" first="Monique" last="Oostra">Monique Oostra</name><affiliation><nlm:aff id="aff0">Virology Division, Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands</nlm:aff></affiliation></author><author><name sortKey="De Haan, Cornelis A M" sort="De Haan, Cornelis A M" uniqKey="De Haan C" first="Cornelis A. M." last="De Haan">Cornelis A. M. De Haan</name><affiliation><nlm:aff id="aff0">Virology Division, Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands</nlm:aff></affiliation></author><author><name sortKey="Rottier, Peter J M" sort="Rottier, Peter J M" uniqKey="Rottier P" first="Peter J. M." last="Rottier">Peter J. M. Rottier</name><affiliation><nlm:aff id="aff0">Virology Division, Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands</nlm:aff></affiliation></author></titleStmt><publicationStmt><idno type="wicri:source">PMC</idno><idno type="pmid">17928347</idno><idno type="pmc">2168875</idno><idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2168875</idno><idno type="RBID">PMC:2168875</idno><idno type="doi">10.1128/JVI.01631-07</idno><date when="2007">2007</date><idno type="wicri:Area/Pmc/Corpus">000724</idno><idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000724</idno></publicationStmt><sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">The 29-Nucleotide Deletion Present in Human but Not in Animal Severe Acute Respiratory Syndrome Coronaviruses Disrupts the Functional Expression of Open Reading Frame 8<xref ref-type="fn" rid="fn1">▿</xref> </title><author><name sortKey="Oostra, Monique" sort="Oostra, Monique" uniqKey="Oostra M" first="Monique" last="Oostra">Monique Oostra</name><affiliation><nlm:aff id="aff0">Virology Division, Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands</nlm:aff></affiliation></author><author><name sortKey="De Haan, Cornelis A M" sort="De Haan, Cornelis A M" uniqKey="De Haan C" first="Cornelis A. M." last="De Haan">Cornelis A. M. De Haan</name><affiliation><nlm:aff id="aff0">Virology Division, Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands</nlm:aff></affiliation></author><author><name sortKey="Rottier, Peter J M" sort="Rottier, Peter J M" uniqKey="Rottier P" first="Peter J. M." last="Rottier">Peter J. M. Rottier</name><affiliation><nlm:aff id="aff0">Virology Division, Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands</nlm:aff></affiliation></author></analytic><series><title level="j">Journal of Virology</title><idno type="ISSN">0022-538X</idno><idno type="eISSN">1098-5514</idno><imprint><date when="2007">2007</date></imprint></series></biblStruct></sourceDesc></fileDesc><profileDesc><textClass></textClass></profileDesc></teiHeader><front><div type="abstract" xml:lang="en"><p>One of the most striking and dramatic genomic changes observed in the severe acute respiratory syndrome coronavirus (SARS-CoV) isolated from humans soon after its zoonotic transmission from palm civets was the acquisition of a characteristic 29-nucleotide deletion. This occurred in open reading frame 8 (ORF8), one of the accessory genes unique to the SARS-CoV. The function of ORF8 and the significance of the deletion are unknown. The intact ORF8 present in animal and some early human isolates encodes a 122-amino-acid polypeptide (8ab<sup>+</sup>), which we expressed in cells using the vaccinia virus T7 expression system. It was found to contain a cleavable signal sequence, which directs the precursor to the endoplasmic reticulum (ER) and mediates its translocation into the lumen. The cleaved protein became N-glycosylated, assembled into disulfide-linked homomultimeric complexes, and remained stably in the ER. The 29-nucleotide deletion splits ORF8 into two ORFs, 8a and 8b, encoding 39- and 84-residue polypeptides. The 8a polypeptide is likely to remain in the cytoplasm, as it is too small for its signal sequence to function and will therefore be directly released from the ribosome. However, we could not confirm this experimentally due to the lack of proper antibodies. ORF8b appeared not to be expressed in SARS-CoV-infected cells or when expressed from mRNA's mimicking mRNA8. This was due to the context of the internal AUG initiation codon, as we demonstrated after placing the ORF8b immediately behind the T7 promoter. A soluble, unmodified and monomeric 8b protein was now expressed in the cytoplasm, which was highly unstable and rapidly degraded. Clearly, the 29-nucleotide deletion disrupts the proper expression of the SARS-CoV ORF8, the implications of which are discussed.</p></div></front></TEI><pmc article-type="research-article"><pmc-comment>The publisher of this article does not allow downloading of the full text in XML form.</pmc-comment>
<front><journal-meta><journal-id journal-id-type="nlm-ta">J Virol</journal-id><journal-title>Journal of Virology</journal-title><issn pub-type="ppub">0022-538X</issn><issn pub-type="epub">1098-5514</issn><publisher><publisher-name>American Society for Microbiology (ASM)</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="pmid">17928347</article-id><article-id pub-id-type="pmc">2168875</article-id><article-id pub-id-type="publisher-id">1631-07</article-id><article-id pub-id-type="doi">10.1128/JVI.01631-07</article-id><article-categories><subj-group subj-group-type="heading"><subject>Genetic Diversity and Evolution</subject></subj-group></article-categories><title-group><article-title>The 29-Nucleotide Deletion Present in Human but Not in Animal Severe Acute Respiratory Syndrome Coronaviruses Disrupts the Functional Expression of Open Reading Frame 8<xref ref-type="fn" rid="fn1">▿</xref> </article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Oostra</surname><given-names>Monique</given-names></name><xref ref-type="aff" rid="aff0"></xref></contrib><contrib contrib-type="author"><name><surname>de Haan</surname><given-names>Cornelis A. M.</given-names></name><xref ref-type="aff" rid="aff0"></xref></contrib><contrib contrib-type="author"><name><surname>Rottier</surname><given-names>Peter J. M.</given-names></name><xref ref-type="aff" rid="aff0"></xref><xref ref-type="corresp" rid="cor1">*</xref></contrib></contrib-group><aff id="aff0">Virology Division, Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands</aff><author-notes><fn id="cor1"><label>*</label><p>Corresponding author. Mailing address: Virology Division, Department of Infectious Diseases and Immunology, Utrecht University, Yalelaan 1, 3584 CL Utrecht, The Netherlands. Phone: 31 30 253 2462. Fax: 31 30 253 6723. E-mail: <email>P.J.M.Rottier@vet.uu.nl</email></p></fn></author-notes><pub-date pub-type="ppub"><month>12</month><year>2007</year></pub-date><pub-date pub-type="epub"><day>10</day><month>10</month><year>2007</year></pub-date><volume>81</volume><issue>24</issue><fpage>13876</fpage><lpage>13888</lpage><history><date date-type="received"><day>26</day><month>7</month><year>2007</year></date><date date-type="accepted"><day>27</day><month>9</month><year>2007</year></date></history><permissions><copyright-statement>Copyright © 2007, American Society for Microbiology</copyright-statement></permissions><self-uri xlink:title="pdf" xlink:href="zjv02407013876.pdf"></self-uri><abstract><p>One of the most striking and dramatic genomic changes observed in the severe acute respiratory syndrome coronavirus (SARS-CoV) isolated from humans soon after its zoonotic transmission from palm civets was the acquisition of a characteristic 29-nucleotide deletion. This occurred in open reading frame 8 (ORF8), one of the accessory genes unique to the SARS-CoV. The function of ORF8 and the significance of the deletion are unknown. The intact ORF8 present in animal and some early human isolates encodes a 122-amino-acid polypeptide (8ab<sup>+</sup>), which we expressed in cells using the vaccinia virus T7 expression system. It was found to contain a cleavable signal sequence, which directs the precursor to the endoplasmic reticulum (ER) and mediates its translocation into the lumen. The cleaved protein became N-glycosylated, assembled into disulfide-linked homomultimeric complexes, and remained stably in the ER. The 29-nucleotide deletion splits ORF8 into two ORFs, 8a and 8b, encoding 39- and 84-residue polypeptides. The 8a polypeptide is likely to remain in the cytoplasm, as it is too small for its signal sequence to function and will therefore be directly released from the ribosome. However, we could not confirm this experimentally due to the lack of proper antibodies. ORF8b appeared not to be expressed in SARS-CoV-infected cells or when expressed from mRNA's mimicking mRNA8. This was due to the context of the internal AUG initiation codon, as we demonstrated after placing the ORF8b immediately behind the T7 promoter. A soluble, unmodified and monomeric 8b protein was now expressed in the cytoplasm, which was highly unstable and rapidly degraded. Clearly, the 29-nucleotide deletion disrupts the proper expression of the SARS-CoV ORF8, the implications of which are discussed.</p></abstract></article-meta></front><floats-wrap><fig position="float" id="f1"><label>FIG. 1.</label><caption><p>Schematic representation of the animal and human SARS-CoV ORF8 genome region and of expression constructs used. (A) A schematic representation of the genetic organization of the animal and human SARS-CoV in the region of ORF8 is shown. A deletion of 29 nt occurred in the human virus isolates compared to the animal isolates, splitting the full-length ORF8 (8ab<sup>+</sup>) into ORF8a and ORF8b. (B) The protein sequences of the different ORF8 products are depicted, with the amino acids changed due to the deletion shown in italics and the N-glycosylation site shown in bold. (C) Overview of the different ORF8-related constructs used in this study.</p></caption><graphic xlink:href="zjv0240700090001"></graphic></fig><fig position="float" id="f2"><label>FIG. 2.</label><caption><p>Expression of ORF8 products. (A) vTF7-3-infected OST7-1 cells were transfected with constructs containing 8a-EGFP or 8b-EGFP directly behind the T7 promoter (8a-EGFP and 8b-EGFP) or containing the 8ab<sup>+</sup>-EGFP (L-8ab<sup>+</sup>-EGFP) or 8ab<sup>Δ</sup>-EGFP (L-8ab<sup>Δ</sup>-EGFP) sequences with the viral leader (L) and TRS behind the T7 promoter. The cells were labeled with <sup>35</sup>S-labeled amino acids from 5 to 6 h p.i., lysed and processed for immunoprecipitation with anti-EGFP antiserum followed by SDS-15% PAGE. (B) Vero E6 cells infected with SARS-CoV were fixed at 8 h p.i. and processed for immunofluorescence with serum of a SARS-CoV-infected ferret or with rabbit serum against the 8b or M protein. Recombinant vaccinia virus vTF7-3-infected OST7-1 cells were transfected with a construct containing 8b-EGFP. The cells were fixed at 6 h p.i. and processed for immunofluorescence with rabbit serum against the 8b protein. (C) vTF7-3-infected OST7-1 cells were transfected with constructs containing the 8b-EGFP or 8ab<sup>+</sup>-EGFP genes directly behind the T7 promoter. The cells were labeled with <sup>35</sup>S-labeled amino acids from 5 to 6 h p.i., lysed directly (p) or chased for 2 h and then lysed (c) and processed for immunoprecipitation with EGFP antiserum followed by SDS-15% PAGE. The positions and masses (in kDa) of the molecular mass protein markers are indicated. Only the relevant portions of the gels are shown.</p></caption><graphic xlink:href="zjv0240700090002"></graphic></fig><fig position="float" id="f3"><label>FIG. 3.</label><caption><p>Intracellular localization of ORF8 products. vTF7-3-infected OST7-1 cells were transfected with constructs encoding the 8a-EGFP, 8b-EGFP, or 8ab<sup>+</sup>-EGFP proteins. The cells were fixed at 6 h p.i. and processed for immunofluorescence microscopy using the anti-calreticulin serum and a Cy5-conjugated antiserum. At the right a merged image of the EGFP and the anti-calreticulin signal is shown. α, anti.</p></caption><graphic xlink:href="zjv0240700090003"></graphic></fig><fig position="float" id="f4"><label>FIG. 4.</label><caption><p>Processing of the 8ab<sup>+</sup> protein. vTF7-3-infected OST7-1 cells were transfected with the indicated constructs, in the presence (+) or absence (−) of tunicamycin (TM). The cells were labeled with <sup>35</sup>S-labeled amino acids from 5 to 6 h p.i., lysed, and processed for immunoprecipitation with specific antibodies followed by SDS-15% PAGE. (A) Cells were transfected with a construct encoding 8ab<sup>+</sup>-EGFP. The same construct was also in vitro transcribed and translated using the TNT coupled reticulocyte lysate system from Promega (ivt). Immunoprecipitations were performed with rabbit antiserum against the EGFP tag. (B) 8ab<sup>+</sup>-EGFP expressed in the absence of tunicamycin was treated with PNGase F or endo H after immunoprecipitation with rabbit serum against the EGFP tag. (C) Cells were transfected with a construct encoding 8ab<sup>+</sup>. The same construct was also in vitro transcribed and translated using the TNT coupled reticulocyte lysate system from Promega (ivt). Immunoprecipitations were performed with rabbit antiserum against 8ab<sup>+</sup>. (D) Cells were transfected with constructs expressing 8ab<sup>+</sup> or 8ab<sup>+</sup>-EGFP, either full-length or after deletion of the predicted signal sequence (sig. seq.). The full-length constructs were also in vitro transcribed and translated using the TNT coupled reticulocyte lysate system from Promega (ivt). Immunoprecipitations were performed with rabbit antiserum against EGFP or 8ab<sup>+</sup>. (E) Cells were transfected with a construct encoding 8a carrying a wild-type EGFP tag (8a-EGFP) or with an EGFP tag containing an N-glycosylation site (8a-EGFP<sup>glyc</sup>). The same constructs were also transcribed and translated in vitro using the TNT coupled reticulocyte lysate system from Promega (ivt). Immunoprecipitations were performed with rabbit antiserum against the EGFP tag. The positions and masses (in kDa) of the molecular mass protein markers are indicated. Only the relevant portions of the gels are shown.</p></caption><graphic xlink:href="zjv0240700090004"></graphic></fig><fig position="float" id="f5"><label>FIG. 5.</label><caption><p>Membrane association of the 8ab<sup>+</sup> and 8b proteins. The 8ab<sup>+</sup>-EGFP, 8b-EGFP, and M constructs were in vitro transcribed and translated using the TNT coupled reticulocyte lysate system from Promega in the presence of canine microsomal membranes and labeled with [<sup>35</sup>S]methionine. Membranes were pelleted after treatment at pH 7.5 or 11, as indicated. Membrane pellets (p) and supernatants (s) were processed for immunoprecipitation and analyzed by SDS-15% PAGE. The positions and masses (in kDa) of the molecular mass protein markers are indicated. (Top) Autoradiographic image of the gel. The glycosylated (glyc) 8ab<sup>+</sup>-EGFP and M proteins are indicated by the arrows at the right. Only the relevant portion of the gel is shown. (Bottom) Graph of the quantification of the protein bands. For each treatment the percentages of each protein present in the soluble and pellet fractions were determined by phosphorimager analysis.</p></caption><graphic xlink:href="zjv0240700090005"></graphic></fig><fig position="float" id="f6"><label>FIG. 6.</label><caption><p>Maturation of the oligosaccharides N-linked to the 8ab<sup>+</sup> protein. vTF7-3 infected OST7-1 cells were transfected with constructs encoding 8ab<sup>+</sup> or 8ab<sup>+</sup>-EGFP. The cells were labeled with <sup>35</sup>S-labeled amino acids from 5 to 6 h p.i., lysed directly (pulse), or chased for 2 h before lysis (chase), and processed for immunoprecipitation with rabbit antiserum against 8ab<sup>+</sup> or the EGFP tag. Precipitated immunocomplexes were treated with PNGase F (F) or endo H (H) or were mock treated (−) and then subjected to SDS-15% PAGE analysis. The positions and masses (in kDa) of the molecular mass protein markers are indicated. Only the relevant portions of the gels are shown.</p></caption><graphic xlink:href="zjv0240700090006"></graphic></fig><fig position="float" id="f7"><label>FIG. 7.</label><caption><p>Multimerization of the 8ab<sup>+</sup> protein. (A) vTF7-3-infected OST7-1 cells were transfected with constructs encoding 8b-EGFP or 8ab<sup>+</sup>-EGFP. The cells were labeled with [<sup>35</sup>S]methionine from 5 to 6 h p.i., lysed, and processed for immunoprecipitation with the rabbit antiserum against the EGFP tag. The precipitated proteins were analyzed by SDS—12.5% PAGE under reducing (with β-mercaptoethanol [+β-ME]) or nonreducing (−β-ME]) conditions. (B) vTF7-3 infected OST7-1 cells were transfected with constructs encoding 8ab<sup>+</sup> and/or 8ab<sup>+</sup>-EGFP. The cells were labeled with <sup>35</sup>S-labeled amino acids from 5 to 6 h p.i., lysed, and processed for immunoprecipitation with rabbit antiserum against the EGFP tag (upper gel) or against 8ab<sup>+</sup> (bottom gel). The precipitated proteins were analyzed by SDS-15% PAGE. The bottom gel shows only the expression of the 8ab<sup>+</sup> protein. The positions and masses (in kDa) of the molecular mass protein markers are indicated. Only the relevant portions of the gels are shown.</p></caption><graphic xlink:href="zjv0240700090007"></graphic></fig><table-wrap position="float" id="t1"><label>TABLE 1.</label><caption><p>Sequence, polarity, and purpose of primers used in this study</p></caption><table frame="hsides" rules="groups"><thead><tr><th colspan="1" rowspan="1" align="center" valign="bottom">Primer no. (description)<xref ref-type="table-fn" rid="t1fn1"><italic>a</italic></xref></th><th colspan="1" rowspan="1" align="center" valign="bottom">Sequence (5′ to 3′)<xref ref-type="table-fn" rid="t1fn2"><italic>b</italic></xref></th><th colspan="1" rowspan="1" align="center" valign="bottom">Polarity</th><th colspan="1" rowspan="1" align="center" valign="bottom">Purpose</th></tr></thead><tbody><tr><td colspan="1" rowspan="1" align="left" valign="top">2220 (8a rev SOE)</td><td colspan="1" rowspan="1" align="left" valign="top">ccattcaggttggtaaccagtaggACAAGGATCTTCAAGCACAT</td><td colspan="1" rowspan="1" align="center" valign="top">−</td><td colspan="1" rowspan="1" align="left" valign="top">8ab<sup>+</sup></td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">2221 (8b for SOE)</td><td colspan="1" rowspan="1" align="left" valign="top">ctggttaccaacctgaatggaatatAAGGTACAACACTAGGGGTAA</td><td colspan="1" rowspan="1" align="center" valign="top">+</td><td colspan="1" rowspan="1" align="left" valign="top">8ab<sup>+</sup></td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">2267 (8b for)</td><td colspan="1" rowspan="1" align="left" valign="top"><underline>gaattc</underline>accATGTGCTTGAAGATCCT</td><td colspan="1" rowspan="1" align="center" valign="top">+</td><td colspan="1" rowspan="1" align="left" valign="top">8b-EGFP</td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">2985 (8a for)</td><td colspan="1" rowspan="1" align="left" valign="top"><underline>gaattc</underline>accATGAAACTTCTCATTGTTTT</td><td colspan="1" rowspan="1" align="center" valign="top">+</td><td colspan="1" rowspan="1" align="left" valign="top">8a-EGFP, 8ab<sup>Δ</sup>-EGFP, 8ab<sup>+</sup>, 8ab<sup>+</sup>-EGFP</td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">2268 (8b rev)</td><td colspan="1" rowspan="1" align="left" valign="top"><underline>ggatcc</underline>TTAATTTGTTCGTTTATTT</td><td colspan="1" rowspan="1" align="center" valign="top">−</td><td colspan="1" rowspan="1" align="left" valign="top">8ab<sup>+</sup></td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">3191 (8a rev stop)</td><td colspan="1" rowspan="1" align="left" valign="top"><underline>ggatcc</underline>GTGTTGTACCTTACAAGGA</td><td colspan="1" rowspan="1" align="center" valign="top">−</td><td colspan="1" rowspan="1" align="left" valign="top">8a-EGFP</td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">2986 (8b rev stop)</td><td colspan="1" rowspan="1" align="left" valign="top"><underline>ggatcc</underline>ATTTGTTCGTTTATTTAAAAC</td><td colspan="1" rowspan="1" align="center" valign="top">−</td><td colspan="1" rowspan="1" align="left" valign="top">8b-EGFP, 8ab<sup>Δ</sup>-EGFP, 8ab<sup>+</sup>-EGFP</td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">3207 (leader for)</td><td colspan="1" rowspan="1" align="left" valign="top"><underline>ctcgag</underline>accATATTAGGTTTTTACCTACC</td><td colspan="1" rowspan="1" align="center" valign="top">+</td><td colspan="1" rowspan="1" align="left" valign="top">L-8ab<sup>+</sup>-EGFP, L-8ab<sup>Δ</sup>-EGFP</td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">3208 (leader rev)</td><td colspan="1" rowspan="1" align="left" valign="top">gaagtttcatGTTCGTTTAGAGAACAGATCT</td><td colspan="1" rowspan="1" align="center" valign="top">−</td><td colspan="1" rowspan="1" align="left" valign="top">L-8ab<sup>+</sup>-EGFP, L-8ab<sup>Δ</sup>-EGFP</td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">3209 (TRS 8a for)</td><td colspan="1" rowspan="1" align="left" valign="top">TCTAAACGAACATGAAACTTCT</td><td colspan="1" rowspan="1" align="center" valign="top">+</td><td colspan="1" rowspan="1" align="left" valign="top">L-8ab<sup>+</sup>-EGFP, L-8ab<sup>Δ</sup>-EGFP</td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">3043 (8a for −ss)</td><td colspan="1" rowspan="1" align="left" valign="top"><underline>gaattc</underline>accATGATATGCACTGTAGTACAGCG</td><td colspan="1" rowspan="1" align="center" valign="top">+</td><td colspan="1" rowspan="1" align="left" valign="top">8ab<sup>+,−ss</sup>, 8ab<sup>+,−ss</sup>-EGFP</td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">3212 (EGFP<sup>glyc</sup> for)</td><td colspan="1" rowspan="1" align="left" valign="top">GCGACGTAAACGGCacCAAGTTCAGCGTG</td><td colspan="1" rowspan="1" align="center" valign="top">+</td><td colspan="1" rowspan="1" align="left" valign="top">N-glycosylation site in EGFP</td></tr><tr><td colspan="1" rowspan="1" align="left" valign="top">3213 (EGFP<sup>glyc</sup> rev)</td><td colspan="1" rowspan="1" align="left" valign="top">CACGCTGAACTTGgtGCCGTTTACGTCGC</td><td colspan="1" rowspan="1" align="center" valign="top">−</td><td colspan="1" rowspan="1" align="left" valign="top">N-glycosylation site in EGFP</td></tr></tbody></table><table-wrap-foot><fn id="t1fn1"><label>a</label><p>for, forward primer; rev, reverse primer.</p></fn><fn id="t1fn2"><label>b</label><p>Coding sequences are shown in uppercase. Lowercase letters indicate nucleotides added for cloning purposes, with the restriction enzyme recognition sites underlined.</p></fn></table-wrap-foot></table-wrap></floats-wrap></pmc></record>Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Sante/explor/SrasV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000724 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000724 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien
|wiki= Sante
|area= SrasV1
|flux= Pmc
|étape= Corpus
|type= RBID
|clé= PMC:2168875
|texte= The 29-Nucleotide Deletion Present in Human but Not in Animal Severe Acute Respiratory Syndrome Coronaviruses Disrupts the Functional Expression of Open Reading Frame 8▿
}}
Pour générer des pages wiki
HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i -Sk "pubmed:17928347" \
| HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd \
| NlmPubMed2Wicri -a SrasV1
| This area was generated with Dilib version V0.6.33. |  |