Links to Exploration step
Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Upregulation of Mitochondrial Gene Expression in PBMC from Convalescent SARS Patients</title>
<author><name sortKey="Shao, Hongwei" sort="Shao, Hongwei" uniqKey="Shao H" first="Hongwei" last="Shao">Hongwei Shao</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lan, Dongming" sort="Lan, Dongming" uniqKey="Lan D" first="Dongming" last="Lan">Dongming Lan</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Duan, Zhaohui" sort="Duan, Zhaohui" uniqKey="Duan Z" first="Zhaohui" last="Duan">Zhaohui Duan</name>
<affiliation><nlm:aff id="Aff2"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>The Second Affiliated Hospital, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510120 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Liu, Zehuan" sort="Liu, Zehuan" uniqKey="Liu Z" first="Zehuan" last="Liu">Zehuan Liu</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Min, Jun" sort="Min, Jun" uniqKey="Min J" first="Jun" last="Min">Jun Min</name>
<affiliation><nlm:aff id="Aff2"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>The Second Affiliated Hospital, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510120 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Zhang, Lichun" sort="Zhang, Lichun" uniqKey="Zhang L" first="Lichun" last="Zhang">Lichun Zhang</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Huang, Jian" sort="Huang, Jian" uniqKey="Huang J" first="Jian" last="Huang">Jian Huang</name>
<affiliation><nlm:aff id="Aff2"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>The Second Affiliated Hospital, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510120 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Su, Jing" sort="Su, Jing" uniqKey="Su J" first="Jing" last="Su">Jing Su</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Chen, Shangwu" sort="Chen, Shangwu" uniqKey="Chen S" first="Shangwu" last="Chen">Shangwu Chen</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Xu, Anlong" sort="Xu, Anlong" uniqKey="Xu A" first="Anlong" last="Xu">Anlong Xu</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">17024565</idno>
<idno type="pmc">7086694</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7086694</idno>
<idno type="RBID">PMC:7086694</idno>
<idno type="doi">10.1007/s10875-006-9046-y</idno>
<date when="2006">2006</date>
<idno type="wicri:Area/Pmc/Corpus">000413</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000413</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Upregulation of Mitochondrial Gene Expression in PBMC from Convalescent SARS Patients</title>
<author><name sortKey="Shao, Hongwei" sort="Shao, Hongwei" uniqKey="Shao H" first="Hongwei" last="Shao">Hongwei Shao</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lan, Dongming" sort="Lan, Dongming" uniqKey="Lan D" first="Dongming" last="Lan">Dongming Lan</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Duan, Zhaohui" sort="Duan, Zhaohui" uniqKey="Duan Z" first="Zhaohui" last="Duan">Zhaohui Duan</name>
<affiliation><nlm:aff id="Aff2"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>The Second Affiliated Hospital, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510120 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Liu, Zehuan" sort="Liu, Zehuan" uniqKey="Liu Z" first="Zehuan" last="Liu">Zehuan Liu</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Min, Jun" sort="Min, Jun" uniqKey="Min J" first="Jun" last="Min">Jun Min</name>
<affiliation><nlm:aff id="Aff2"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>The Second Affiliated Hospital, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510120 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Zhang, Lichun" sort="Zhang, Lichun" uniqKey="Zhang L" first="Lichun" last="Zhang">Lichun Zhang</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Huang, Jian" sort="Huang, Jian" uniqKey="Huang J" first="Jian" last="Huang">Jian Huang</name>
<affiliation><nlm:aff id="Aff2"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>The Second Affiliated Hospital, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510120 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Su, Jing" sort="Su, Jing" uniqKey="Su J" first="Jing" last="Su">Jing Su</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Chen, Shangwu" sort="Chen, Shangwu" uniqKey="Chen S" first="Shangwu" last="Chen">Shangwu Chen</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Xu, Anlong" sort="Xu, Anlong" uniqKey="Xu A" first="Anlong" last="Xu">Anlong Xu</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">Journal of Clinical Immunology</title>
<idno type="ISSN">0271-9142</idno>
<idno type="eISSN">1573-2592</idno>
<imprint><date when="2006">2006</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>The observations that Lymphopenia is common in severe acute respiratory syndrome (SARS) patients and that peripheral blood mononuclear cell (PBMC) could be infected by SARS-CoV indicate that PBMC could be useful in identifying the gene expression profile in convalescent patients and tracing the host response to SARS-CoV infection. In this study, the altered genes expressions in the PBMC of convalescent SARS patients were investigated with suppression subtractive hybridization (SSH). We found that genes encoded by mitochondrial DNA (mtDNA) were obviously upregulated, while mitochondria were now found to be closely connected with antiviral immunity. The identification of a viral gene, M, in SSH cDNA library shows the long-term existence of SARS-CoV <italic>in vivo</italic>
. In addition, some oxidative stress sensitive genes, heat shock proteins, transcription factors, and cytokines showed remarkable elevation. Thin-section electron microscope shows increased lysosome-like granule and mitochondria in PBMC of patients. These results provide important intracellular clue for tracing host response to SARS-CoV infection and suggest a role of mitochondria in that process.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Peiris, Jsm" uniqKey="Peiris J">JSM Peiris</name>
</author>
<author><name sortKey="Lai, St" uniqKey="Lai S">ST Lai</name>
</author>
<author><name sortKey="Poon, Llm" uniqKey="Poon L">LLM Poon</name>
</author>
<author><name sortKey="Guan, Y" uniqKey="Guan Y">Y Guan</name>
</author>
<author><name sortKey="Yam, Lyc" uniqKey="Yam L">LYC Yam</name>
</author>
<author><name sortKey="Lim, W" uniqKey="Lim W">W Lim</name>
</author>
<author><name sortKey="Nicholls, J" uniqKey="Nicholls J">J Nicholls</name>
</author>
<author><name sortKey="Yee, Wks" uniqKey="Yee W">WKS Yee</name>
</author>
<author><name sortKey="Yan, Ww" uniqKey="Yan W">WW Yan</name>
</author>
<author><name sortKey="Cheung, Mt" uniqKey="Cheung M">MT Cheung</name>
</author>
<author><name sortKey="Cheng, Vcc" uniqKey="Cheng V">VCC Cheng</name>
</author>
<author><name sortKey="Chan, Kh" uniqKey="Chan K">KH Chan</name>
</author>
<author><name sortKey="Tsang, Dnc" uniqKey="Tsang D">DNC Tsang</name>
</author>
<author><name sortKey="Yung, Rwh" uniqKey="Yung R">RWH Yung</name>
</author>
<author><name sortKey="Ng, Tk" uniqKey="Ng T">TK Ng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ksiazek, Tg" uniqKey="Ksiazek T">TG Ksiazek</name>
</author>
<author><name sortKey="Erdman, D" uniqKey="Erdman D">D Erdman</name>
</author>
<author><name sortKey="Goldsmith, Cs" uniqKey="Goldsmith C">CS Goldsmith</name>
</author>
<author><name sortKey="Zaki, Sr" uniqKey="Zaki S">SR Zaki</name>
</author>
<author><name sortKey="Peret, T" uniqKey="Peret T">T Peret</name>
</author>
<author><name sortKey="Emery, S" uniqKey="Emery S">S Emery</name>
</author>
<author><name sortKey="Tong, S" uniqKey="Tong S">S Tong</name>
</author>
<author><name sortKey="Urbani, C" uniqKey="Urbani C">C Urbani</name>
</author>
<author><name sortKey="Corner, Ja" uniqKey="Corner J">JA Corner</name>
</author>
<author><name sortKey="Lim, W" uniqKey="Lim W">W Lim</name>
</author>
<author><name sortKey="Rollin, Pe" uniqKey="Rollin P">PE Rollin</name>
</author>
<author><name sortKey="Dowell, Sf" uniqKey="Dowell S">SF Dowell</name>
</author>
<author><name sortKey="Ling, Ae" uniqKey="Ling A">AE Ling</name>
</author>
<author><name sortKey="Humphrey, Cd" uniqKey="Humphrey C">CD Humphrey</name>
</author>
<author><name sortKey="Shieh, Wj" uniqKey="Shieh W">WJ Shieh</name>
</author>
<author><name sortKey="Guarner, J" uniqKey="Guarner J">J Guarner</name>
</author>
<author><name sortKey="Paddock, Cd" uniqKey="Paddock C">CD Paddock</name>
</author>
<author><name sortKey="Rota, P" uniqKey="Rota P">P Rota</name>
</author>
<author><name sortKey="Fields, B" uniqKey="Fields B">B Fields</name>
</author>
<author><name sortKey="Derisi, J" uniqKey="Derisi J">J DeRisi</name>
</author>
<author><name sortKey="Yang, Jy" uniqKey="Yang J">JY Yang</name>
</author>
<author><name sortKey="Cox, N" uniqKey="Cox N">N Cox</name>
</author>
<author><name sortKey="Hughes, Jm" uniqKey="Hughes J">JM Hughes</name>
</author>
<author><name sortKey="Leduc, Jw" uniqKey="Leduc J">JW LeDuc</name>
</author>
<author><name sortKey="Bellini, Wj" uniqKey="Bellini W">WJ Bellini</name>
</author>
<author><name sortKey="Anderson, Lj" uniqKey="Anderson L">LJ Anderson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="El Sahly, Hm" uniqKey="El Sahly H">HM El-Sahly</name>
</author>
<author><name sortKey="Atmar, Rl" uniqKey="Atmar R">RL Atmar</name>
</author>
<author><name sortKey="Glezen, Wp" uniqKey="Glezen W">WP Glezen</name>
</author>
<author><name sortKey="Greenberg, Sb" uniqKey="Greenberg S">SB Greenberg</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Falsey, Ar" uniqKey="Falsey A">AR Falsey</name>
</author>
<author><name sortKey="Walsh, Ee" uniqKey="Walsh E">EE Walsh</name>
</author>
<author><name sortKey="Hayden, Fg" uniqKey="Hayden F">FG Hayden</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bastien, N" uniqKey="Bastien N">N Bastien</name>
</author>
<author><name sortKey="Robinson, Jl" uniqKey="Robinson J">JL Robinson</name>
</author>
<author><name sortKey="Tse, A" uniqKey="Tse A">A Tse</name>
</author>
<author><name sortKey="Lee, Be" uniqKey="Lee B">BE Lee</name>
</author>
<author><name sortKey="Hart, L" uniqKey="Hart L">L Hart</name>
</author>
<author><name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, Wh" uniqKey="Li W">WH Li</name>
</author>
<author><name sortKey="Moore, Mj" uniqKey="Moore M">MJ Moore</name>
</author>
<author><name sortKey="Vasilieva, N" uniqKey="Vasilieva N">N Vasilieva</name>
</author>
<author><name sortKey="Sui, Jh" uniqKey="Sui J">JH Sui</name>
</author>
<author><name sortKey="Wong, Sk" uniqKey="Wong S">SK Wong</name>
</author>
<author><name sortKey="Berne, Ma" uniqKey="Berne M">MA Berne</name>
</author>
<author><name sortKey="Somasundaran, M" uniqKey="Somasundaran M">M Somasundaran</name>
</author>
<author><name sortKey="Sullivan, Jl" uniqKey="Sullivan J">JL Sullivan</name>
</author>
<author><name sortKey="Luzuriaga, K" uniqKey="Luzuriaga K">K Luzuriaga</name>
</author>
<author><name sortKey="Greenough, Tc" uniqKey="Greenough T">TC Greenough</name>
</author>
<author><name sortKey="Choe, H" uniqKey="Choe H">H Choe</name>
</author>
<author><name sortKey="Farzan, M" uniqKey="Farzan M">M Farzan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hofmann, H" uniqKey="Hofmann H">H Hofmann</name>
</author>
<author><name sortKey="Pyrc, K" uniqKey="Pyrc K">K Pyrc</name>
</author>
<author><name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L Van Der Hoek</name>
</author>
<author><name sortKey="Geier, M" uniqKey="Geier M">M Geier</name>
</author>
<author><name sortKey="Berkhout, B" uniqKey="Berkhout B">B Berkhout</name>
</author>
<author><name sortKey="Pohlmann, S" uniqKey="Pohlmann S">S Pohlmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chiu, Wk" uniqKey="Chiu W">WK Chiu</name>
</author>
<author><name sortKey="Cheung, Pc" uniqKey="Cheung P">PC Cheung</name>
</author>
<author><name sortKey="Ng, Kl" uniqKey="Ng K">KL Ng</name>
</author>
<author><name sortKey="Ip, Pl" uniqKey="Ip P">PL Ip</name>
</author>
<author><name sortKey="Sugunan, Vk" uniqKey="Sugunan V">VK Sugunan</name>
</author>
<author><name sortKey="Luk, Dc" uniqKey="Luk D">DC Luk</name>
</author>
<author><name sortKey="Ma, Lc" uniqKey="Ma L">LC Ma</name>
</author>
<author><name sortKey="Chan, Bh" uniqKey="Chan B">BH Chan</name>
</author>
<author><name sortKey="Lo, Kl" uniqKey="Lo K">KL Lo</name>
</author>
<author><name sortKey="Lai, Wm" uniqKey="Lai W">WM Lai</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lo, Aw" uniqKey="Lo A">AW Lo</name>
</author>
<author><name sortKey="Tang, Nl" uniqKey="Tang N">NL Tang</name>
</author>
<author><name sortKey="To, Kf" uniqKey="To K">KF To</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, L" uniqKey="Li L">L Li</name>
</author>
<author><name sortKey="Wo, J" uniqKey="Wo J">J Wo</name>
</author>
<author><name sortKey="Shao, J" uniqKey="Shao J">J Shao</name>
</author>
<author><name sortKey="Zhu, H" uniqKey="Zhu H">H Zhu</name>
</author>
<author><name sortKey="Wu, N" uniqKey="Wu N">N Wu</name>
</author>
<author><name sortKey="Li, M" uniqKey="Li M">M Li</name>
</author>
<author><name sortKey="Yao, H" uniqKey="Yao H">H Yao</name>
</author>
<author><name sortKey="Hu, M" uniqKey="Hu M">M Hu</name>
</author>
<author><name sortKey="Dennin, Rh" uniqKey="Dennin R">RH Dennin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, Ts" uniqKey="Li T">TS Li</name>
</author>
<author><name sortKey="Qiu, Zf" uniqKey="Qiu Z">ZF Qiu</name>
</author>
<author><name sortKey="Zhang, Lq" uniqKey="Zhang L">LQ Zhang</name>
</author>
<author><name sortKey="Han, Y" uniqKey="Han Y">Y Han</name>
</author>
<author><name sortKey="He, W" uniqKey="He W">W He</name>
</author>
<author><name sortKey="Liu, Zy" uniqKey="Liu Z">ZY Liu</name>
</author>
<author><name sortKey="Ma, Xj" uniqKey="Ma X">XJ Ma</name>
</author>
<author><name sortKey="Fan, Hw" uniqKey="Fan H">HW Fan</name>
</author>
<author><name sortKey="Lu, W" uniqKey="Lu W">W Lu</name>
</author>
<author><name sortKey="Xie, J" uniqKey="Xie J">J Xie</name>
</author>
<author><name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author><name sortKey="Deng, G" uniqKey="Deng G">G Deng</name>
</author>
<author><name sortKey="Wang, A" uniqKey="Wang A">A Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mcwhirter, Sm" uniqKey="Mcwhirter S">SM McWhirter</name>
</author>
<author><name sortKey="Tenoever, Br" uniqKey="Tenoever B">BR Tenoever</name>
</author>
<author><name sortKey="Maniatis, T" uniqKey="Maniatis T">T Maniatis</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Seth, Rb" uniqKey="Seth R">RB Seth</name>
</author>
<author><name sortKey="Sun, L" uniqKey="Sun L">L Sun</name>
</author>
<author><name sortKey="Chen, Zj" uniqKey="Chen Z">ZJ Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Liu, W" uniqKey="Liu W">W Liu</name>
</author>
<author><name sortKey="Tang, F" uniqKey="Tang F">F Tang</name>
</author>
<author><name sortKey="Fontanet, A" uniqKey="Fontanet A">A Fontanet</name>
</author>
<author><name sortKey="Zhan, L" uniqKey="Zhan L">L Zhan</name>
</author>
<author><name sortKey="Zhao, Qm" uniqKey="Zhao Q">QM Zhao</name>
</author>
<author><name sortKey="Zhang, Ph" uniqKey="Zhang P">PH Zhang</name>
</author>
<author><name sortKey="Wu, Xm" uniqKey="Wu X">XM Wu</name>
</author>
<author><name sortKey="Zuo, Sq" uniqKey="Zuo S">SQ Zuo</name>
</author>
<author><name sortKey="Baril, L" uniqKey="Baril L">L Baril</name>
</author>
<author><name sortKey="Vabret, A" uniqKey="Vabret A">A Vabret</name>
</author>
<author><name sortKey="Xin, Zt" uniqKey="Xin Z">ZT Xin</name>
</author>
<author><name sortKey="Shao, Ym" uniqKey="Shao Y">YM Shao</name>
</author>
<author><name sortKey="Yang, H" uniqKey="Yang H">H Yang</name>
</author>
<author><name sortKey="Cao, Wc" uniqKey="Cao W">WC Cao</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chu, Cm" uniqKey="Chu C">CM Chu</name>
</author>
<author><name sortKey="Leung, Ws" uniqKey="Leung W">WS Leung</name>
</author>
<author><name sortKey="Cheng, Vc" uniqKey="Cheng V">VC Cheng</name>
</author>
<author><name sortKey="Chan, Kh" uniqKey="Chan K">KH Chan</name>
</author>
<author><name sortKey="Lin, Aw" uniqKey="Lin A">AW Lin</name>
</author>
<author><name sortKey="Chan, Vl" uniqKey="Chan V">VL Chan</name>
</author>
<author><name sortKey="Lam, Jy" uniqKey="Lam J">JY Lam</name>
</author>
<author><name sortKey="Chan, Ks" uniqKey="Chan K">KS Chan</name>
</author>
<author><name sortKey="Yuen, Ky" uniqKey="Yuen K">KY Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Clayton, Da" uniqKey="Clayton D">DA Clayton</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ojala, D" uniqKey="Ojala D">D Ojala</name>
</author>
<author><name sortKey="Crews, S" uniqKey="Crews S">S Crews</name>
</author>
<author><name sortKey="Montoya, J" uniqKey="Montoya J">J Montoya</name>
</author>
<author><name sortKey="Gelfand, R" uniqKey="Gelfand R">R Gelfand</name>
</author>
<author><name sortKey="Attardi, G" uniqKey="Attardi G">G Attardi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lee, Dy" uniqKey="Lee D">DY Lee</name>
</author>
<author><name sortKey="Clayton, Da" uniqKey="Clayton D">DA Clayton</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Donnelly, Ca" uniqKey="Donnelly C">CA Donnelly</name>
</author>
<author><name sortKey="Ghani, Ac" uniqKey="Ghani A">AC Ghani</name>
</author>
<author><name sortKey="Leung, Gm" uniqKey="Leung G">GM Leung</name>
</author>
<author><name sortKey="Hedley, Aj" uniqKey="Hedley A">AJ Hedley</name>
</author>
<author><name sortKey="Fraser, C" uniqKey="Fraser C">C Fraser</name>
</author>
<author><name sortKey="Riley, S" uniqKey="Riley S">S Riley</name>
</author>
<author><name sortKey="Abu Raddad, Lj" uniqKey="Abu Raddad L">LJ Abu-Raddad</name>
</author>
<author><name sortKey="Ho, Lm" uniqKey="Ho L">LM Ho</name>
</author>
<author><name sortKey="Thach, Tq" uniqKey="Thach T">TQ Thach</name>
</author>
<author><name sortKey="Chau, P" uniqKey="Chau P">P Chau</name>
</author>
<author><name sortKey="Chan, Kp" uniqKey="Chan K">KP Chan</name>
</author>
<author><name sortKey="Lam, Th" uniqKey="Lam T">TH Lam</name>
</author>
<author><name sortKey="Tse, Ly" uniqKey="Tse L">LY Tse</name>
</author>
<author><name sortKey="Tsang, T" uniqKey="Tsang T">T Tsang</name>
</author>
<author><name sortKey="Liu, Sh" uniqKey="Liu S">SH Liu</name>
</author>
<author><name sortKey="Kong, Jh" uniqKey="Kong J">JH Kong</name>
</author>
<author><name sortKey="Lau, Em" uniqKey="Lau E">EM Lau</name>
</author>
<author><name sortKey="Ferguson, Nm" uniqKey="Ferguson N">NM Ferguson</name>
</author>
<author><name sortKey="Anderson, Rm" uniqKey="Anderson R">RM Anderson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kakuda, Tn" uniqKey="Kakuda T">TN Kakuda</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Miro, O" uniqKey="Miro O">O Miro</name>
</author>
<author><name sortKey="Lopez, S" uniqKey="Lopez S">S Lopez</name>
</author>
<author><name sortKey="Rodriguez De La Concepcion, M" uniqKey="Rodriguez De La Concepcion M">M Rodriguez de la Concepcion</name>
</author>
<author><name sortKey="Martinez, E" uniqKey="Martinez E">E Martinez</name>
</author>
<author><name sortKey="Pedrol, E" uniqKey="Pedrol E">E Pedrol</name>
</author>
<author><name sortKey="Garrabou, G" uniqKey="Garrabou G">G Garrabou</name>
</author>
<author><name sortKey="Giralt, M" uniqKey="Giralt M">M Giralt</name>
</author>
<author><name sortKey="Cardellach, F" uniqKey="Cardellach F">F Cardellach</name>
</author>
<author><name sortKey="Gatell, Jm" uniqKey="Gatell J">JM Gatell</name>
</author>
<author><name sortKey="Vilarroya, F" uniqKey="Vilarroya F">F Vilarroya</name>
</author>
<author><name sortKey="Casademont, J" uniqKey="Casademont J">J Casademont</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Van Itallie, Cm" uniqKey="Van Itallie C">CM Van Itallie</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Miro, O" uniqKey="Miro O">O Miro</name>
</author>
<author><name sortKey="Lopez, S" uniqKey="Lopez S">S Lopez</name>
</author>
<author><name sortKey="Martinez, E" uniqKey="Martinez E">E Martinez</name>
</author>
<author><name sortKey="Pedrol, E" uniqKey="Pedrol E">E Pedrol</name>
</author>
<author><name sortKey="Milinkovic, A" uniqKey="Milinkovic A">A Milinkovic</name>
</author>
<author><name sortKey="Deig, E" uniqKey="Deig E">E Deig</name>
</author>
<author><name sortKey="Garrabou, G" uniqKey="Garrabou G">G Garrabou</name>
</author>
<author><name sortKey="Casademont, J" uniqKey="Casademont J">J Casademont</name>
</author>
<author><name sortKey="Gatell, Jm" uniqKey="Gatell J">JM Gatell</name>
</author>
<author><name sortKey="Cardellach, F" uniqKey="Cardellach F">F Cardellach</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yuan, X" uniqKey="Yuan X">X Yuan</name>
</author>
<author><name sortKey="Shan, Y" uniqKey="Shan Y">Y Shan</name>
</author>
<author><name sortKey="Yao, Z" uniqKey="Yao Z">Z Yao</name>
</author>
<author><name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author><name sortKey="Zhao, Z" uniqKey="Zhao Z">Z Zhao</name>
</author>
<author><name sortKey="Chen, J" uniqKey="Chen J">J Chen</name>
</author>
<author><name sortKey="Cong, Y" uniqKey="Cong Y">Y Cong</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, Q" uniqKey="Li Q">Q Li</name>
</author>
<author><name sortKey="Wang, L" uniqKey="Wang L">L Wang</name>
</author>
<author><name sortKey="Dong, C" uniqKey="Dong C">C Dong</name>
</author>
<author><name sortKey="Che, Y" uniqKey="Che Y">Y Che</name>
</author>
<author><name sortKey="Jiang, L" uniqKey="Jiang L">L Jiang</name>
</author>
<author><name sortKey="Liu, L" uniqKey="Liu L">L Liu</name>
</author>
<author><name sortKey="Zhao, H" uniqKey="Zhao H">H Zhao</name>
</author>
<author><name sortKey="Liao, Y" uniqKey="Liao Y">Y Liao</name>
</author>
<author><name sortKey="Sheng, Y" uniqKey="Sheng Y">Y Sheng</name>
</author>
<author><name sortKey="Dong, S" uniqKey="Dong S">S Dong</name>
</author>
<author><name sortKey="Ma, S" uniqKey="Ma S">S Ma</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Seth, Rb" uniqKey="Seth R">RB Seth</name>
</author>
<author><name sortKey="Sun, L" uniqKey="Sun L">L Sun</name>
</author>
<author><name sortKey="Ea, Ck" uniqKey="Ea C">CK Ea</name>
</author>
<author><name sortKey="Chen, Zj" uniqKey="Chen Z">ZJ Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xu, Lg" uniqKey="Xu L">LG Xu</name>
</author>
<author><name sortKey="Wang, Yy" uniqKey="Wang Y">YY Wang</name>
</author>
<author><name sortKey="Han, Kj" uniqKey="Han K">KJ Han</name>
</author>
<author><name sortKey="Li, Ly" uniqKey="Li L">LY Li</name>
</author>
<author><name sortKey="Zhai, Z" uniqKey="Zhai Z">Z Zhai</name>
</author>
<author><name sortKey="Shu, Hb" uniqKey="Shu H">HB Shu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kawai, T" uniqKey="Kawai T">T Kawai</name>
</author>
<author><name sortKey="Takahashi, K" uniqKey="Takahashi K">K Takahashi</name>
</author>
<author><name sortKey="Sato, S" uniqKey="Sato S">S Sato</name>
</author>
<author><name sortKey="Coban, C" uniqKey="Coban C">C Coban</name>
</author>
<author><name sortKey="Kumar, H" uniqKey="Kumar H">H Kumar</name>
</author>
<author><name sortKey="Kato, H" uniqKey="Kato H">H Kato</name>
</author>
<author><name sortKey="Ishii, Kj" uniqKey="Ishii K">KJ Ishii</name>
</author>
<author><name sortKey="Takeuchi, O" uniqKey="Takeuchi O">O Takeuchi</name>
</author>
<author><name sortKey="Akira, S" uniqKey="Akira S">S Akira</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Meylan, E" uniqKey="Meylan E">E Meylan</name>
</author>
<author><name sortKey="Curran, J" uniqKey="Curran J">J Curran</name>
</author>
<author><name sortKey="Hofmann, K" uniqKey="Hofmann K">K Hofmann</name>
</author>
<author><name sortKey="Moradpour, D" uniqKey="Moradpour D">D Moradpour</name>
</author>
<author><name sortKey="Binder, M" uniqKey="Binder M">M Binder</name>
</author>
<author><name sortKey="Bartenschlager, R" uniqKey="Bartenschlager R">R Bartenschlager</name>
</author>
<author><name sortKey="Tschopp, J" uniqKey="Tschopp J">J Tschopp</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yedavalli, Vs" uniqKey="Yedavalli V">VS Yedavalli</name>
</author>
<author><name sortKey="Shih, Hm" uniqKey="Shih H">HM Shih</name>
</author>
<author><name sortKey="Chiang, Yp" uniqKey="Chiang Y">YP Chiang</name>
</author>
<author><name sortKey="Lu, Cy" uniqKey="Lu C">CY Lu</name>
</author>
<author><name sortKey="Chang, Ly" uniqKey="Chang L">LY Chang</name>
</author>
<author><name sortKey="Chen, My" uniqKey="Chen M">MY Chen</name>
</author>
<author><name sortKey="Chuang, Cy" uniqKey="Chuang C">CY Chuang</name>
</author>
<author><name sortKey="Dayton, Ai" uniqKey="Dayton A">AI Dayton</name>
</author>
<author><name sortKey="Jeang, Kt" uniqKey="Jeang K">KT Jeang</name>
</author>
<author><name sortKey="Huang, Lm" uniqKey="Huang L">LM Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Carr, Sm" uniqKey="Carr S">SM Carr</name>
</author>
<author><name sortKey="Carnero, E" uniqKey="Carnero E">E Carnero</name>
</author>
<author><name sortKey="Garcia Sastre, A" uniqKey="Garcia Sastre A">A Garcia-Sastre</name>
</author>
<author><name sortKey="Brownlee, Gg" uniqKey="Brownlee G">GG Brownlee</name>
</author>
<author><name sortKey="Fodor, E" uniqKey="Fodor E">E Fodor</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Su, J" uniqKey="Su J">J Su</name>
</author>
<author><name sortKey="Wang, G" uniqKey="Wang G">G Wang</name>
</author>
<author><name sortKey="Barrett, Jw" uniqKey="Barrett J">JW Barrett</name>
</author>
<author><name sortKey="Irvine, Ts" uniqKey="Irvine T">TS Irvine</name>
</author>
<author><name sortKey="Gao, X" uniqKey="Gao X">X Gao</name>
</author>
<author><name sortKey="Mcfadden, G" uniqKey="Mcfadden G">G McFadden</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hiraragi, H" uniqKey="Hiraragi H">H Hiraragi</name>
</author>
<author><name sortKey="Kim, Sj" uniqKey="Kim S">SJ Kim</name>
</author>
<author><name sortKey="Phipps, Aj" uniqKey="Phipps A">AJ Phipps</name>
</author>
<author><name sortKey="Silic Benussi, M" uniqKey="Silic Benussi M">M Silic-Benussi</name>
</author>
<author><name sortKey="Ciminale, V" uniqKey="Ciminale V">V Ciminale</name>
</author>
<author><name sortKey="Ratner, L" uniqKey="Ratner L">L Ratner</name>
</author>
<author><name sortKey="Green, Pl" uniqKey="Green P">PL Green</name>
</author>
<author><name sortKey="Lairmore, Md" uniqKey="Lairmore M">MD Lairmore</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Miranda, S" uniqKey="Miranda S">S Miranda</name>
</author>
<author><name sortKey="Foncea, R" uniqKey="Foncea R">R Foncea</name>
</author>
<author><name sortKey="Guerrero, J" uniqKey="Guerrero J">J Guerrero</name>
</author>
<author><name sortKey="Leighton, F" uniqKey="Leighton F">F Leighton</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lee, Hc" uniqKey="Lee H">HC Lee</name>
</author>
<author><name sortKey="Yin, Ph" uniqKey="Yin P">PH Yin</name>
</author>
<author><name sortKey="Lu, Cy" uniqKey="Lu C">CY Lu</name>
</author>
<author><name sortKey="Chi, Cw" uniqKey="Chi C">CW Chi</name>
</author>
<author><name sortKey="Wei, Yh" uniqKey="Wei Y">YH Wei</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Suliman, Hb" uniqKey="Suliman H">HB Suliman</name>
</author>
<author><name sortKey="Carraway, Ms" uniqKey="Carraway M">MS Carraway</name>
</author>
<author><name sortKey="Welty Wolf, Ke" uniqKey="Welty Wolf K">KE Welty-Wolf</name>
</author>
<author><name sortKey="Whorton, Ar" uniqKey="Whorton A">AR Whorton</name>
</author>
<author><name sortKey="Piantados, Ca" uniqKey="Piantados C">CA Piantados</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Nicholls, Jm" uniqKey="Nicholls J">JM Nicholls</name>
</author>
<author><name sortKey="Poon, Ll" uniqKey="Poon L">LL Poon</name>
</author>
<author><name sortKey="Lee, Kc" uniqKey="Lee K">KC Lee</name>
</author>
<author><name sortKey="Ng, Wf" uniqKey="Ng W">WF Ng</name>
</author>
<author><name sortKey="Lai, St" uniqKey="Lai S">ST Lai</name>
</author>
<author><name sortKey="Leung, Cy" uniqKey="Leung C">CY Leung</name>
</author>
<author><name sortKey="Chu, Cm" uniqKey="Chu C">CM Chu</name>
</author>
<author><name sortKey="Hui, Pk" uniqKey="Hui P">PK Hui</name>
</author>
<author><name sortKey="Mak, Kl" uniqKey="Mak K">KL Mak</name>
</author>
<author><name sortKey="Lim, W" uniqKey="Lim W">W Lim</name>
</author>
<author><name sortKey="Yan, Kw" uniqKey="Yan K">KW Yan</name>
</author>
<author><name sortKey="Chan, Kh" uniqKey="Chan K">KH Chan</name>
</author>
<author><name sortKey="Tsang, Nc" uniqKey="Tsang N">NC Tsang</name>
</author>
<author><name sortKey="Guan, Y" uniqKey="Guan Y">Y Guan</name>
</author>
<author><name sortKey="Yuen, Ky" uniqKey="Yuen K">KY Yuen</name>
</author>
<author><name sortKey="Peiris, Js" uniqKey="Peiris J">JS Peiris</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ding, Y" uniqKey="Ding Y">Y Ding</name>
</author>
<author><name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author><name sortKey="Shen, H" uniqKey="Shen H">H Shen</name>
</author>
<author><name sortKey="Li, Z" uniqKey="Li Z">Z Li</name>
</author>
<author><name sortKey="Geng, J" uniqKey="Geng J">J Geng</name>
</author>
<author><name sortKey="Han, H" uniqKey="Han H">H Han</name>
</author>
<author><name sortKey="Cai, J" uniqKey="Cai J">J Cai</name>
</author>
<author><name sortKey="Li, X" uniqKey="Li X">X Li</name>
</author>
<author><name sortKey="Kang, W" uniqKey="Kang W">W Kang</name>
</author>
<author><name sortKey="Weng, D" uniqKey="Weng D">D Weng</name>
</author>
<author><name sortKey="Lu, Y" uniqKey="Lu Y">Y Lu</name>
</author>
<author><name sortKey="Wu, D" uniqKey="Wu D">D Wu</name>
</author>
<author><name sortKey="He, L" uniqKey="He L">L He</name>
</author>
<author><name sortKey="Yao, K" uniqKey="Yao K">K Yao</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Rabilloud, T" uniqKey="Rabilloud T">T Rabilloud</name>
</author>
<author><name sortKey="Heller, M" uniqKey="Heller M">M Heller</name>
</author>
<author><name sortKey="Gasnier, F" uniqKey="Gasnier F">F Gasnier</name>
</author>
<author><name sortKey="Luche, S" uniqKey="Luche S">S Luche</name>
</author>
<author><name sortKey="Rey, C" uniqKey="Rey C">C Rey</name>
</author>
<author><name sortKey="Aebersold, R" uniqKey="Aebersold R">R Aebersold</name>
</author>
<author><name sortKey="Benahmed, M" uniqKey="Benahmed M">M Benahmed</name>
</author>
<author><name sortKey="Louisot, P" uniqKey="Louisot P">P Louisot</name>
</author>
<author><name sortKey="Lunardi, J" uniqKey="Lunardi J">J Lunardi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pham, Cg" uniqKey="Pham C">CG Pham</name>
</author>
<author><name sortKey="Bubici, C" uniqKey="Bubici C">C Bubici</name>
</author>
<author><name sortKey="Zazzeroni, F" uniqKey="Zazzeroni F">F Zazzeroni</name>
</author>
<author><name sortKey="Papa, S" uniqKey="Papa S">S Papa</name>
</author>
<author><name sortKey="Jones, J" uniqKey="Jones J">J Jones</name>
</author>
<author><name sortKey="Alvarez, K" uniqKey="Alvarez K">K Alvarez</name>
</author>
<author><name sortKey="Jayawardena, S" uniqKey="Jayawardena S">S Jayawardena</name>
</author>
<author><name sortKey="De Smaele, E" uniqKey="De Smaele E">E De Smaele</name>
</author>
<author><name sortKey="Cong, R" uniqKey="Cong R">R Cong</name>
</author>
<author><name sortKey="Beaumont, C" uniqKey="Beaumont C">C Beaumont</name>
</author>
<author><name sortKey="Torti, Fm" uniqKey="Torti F">FM Torti</name>
</author>
<author><name sortKey="Torti, Sv" uniqKey="Torti S">SV Torti</name>
</author>
<author><name sortKey="Franzoso, G" uniqKey="Franzoso G">G Franzoso</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Reghunathan, R" uniqKey="Reghunathan R">R Reghunathan</name>
</author>
<author><name sortKey="Jayapal, M" uniqKey="Jayapal M">M Jayapal</name>
</author>
<author><name sortKey="Hsu, Ly" uniqKey="Hsu L">LY Hsu</name>
</author>
<author><name sortKey="Chng, Hh" uniqKey="Chng H">HH Chng</name>
</author>
<author><name sortKey="Tai, D" uniqKey="Tai D">D Tai</name>
</author>
<author><name sortKey="Leung, Bp" uniqKey="Leung B">BP Leung</name>
</author>
<author><name sortKey="Melendez, Aj" uniqKey="Melendez A">AJ Melendez</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rao, Gn" uniqKey="Rao G">GN Rao</name>
</author>
<author><name sortKey="Berk, Bc" uniqKey="Berk B">BC Berk</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kuba, K" uniqKey="Kuba K">K Kuba</name>
</author>
<author><name sortKey="Imai, Y" uniqKey="Imai Y">Y Imai</name>
</author>
<author><name sortKey="Rao, S" uniqKey="Rao S">S Rao</name>
</author>
<author><name sortKey="Gao, H" uniqKey="Gao H">H Gao</name>
</author>
<author><name sortKey="Guo, F" uniqKey="Guo F">F Guo</name>
</author>
<author><name sortKey="Guan, B" uniqKey="Guan B">B Guan</name>
</author>
<author><name sortKey="Huan, Y" uniqKey="Huan Y">Y Huan</name>
</author>
<author><name sortKey="Yang, P" uniqKey="Yang P">P Yang</name>
</author>
<author><name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author><name sortKey="Deng, W" uniqKey="Deng W">W Deng</name>
</author>
<author><name sortKey="Bao, L" uniqKey="Bao L">L Bao</name>
</author>
<author><name sortKey="Zhang, B" uniqKey="Zhang B">B Zhang</name>
</author>
<author><name sortKey="Liu, G" uniqKey="Liu G">G Liu</name>
</author>
<author><name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author><name sortKey="Chappell, M" uniqKey="Chappell M">M Chappell</name>
</author>
<author><name sortKey="Liu, Y" uniqKey="Liu Y">Y Liu</name>
</author>
<author><name sortKey="Zheng, D" uniqKey="Zheng D">D Zheng</name>
</author>
<author><name sortKey="Leibbrandt, A" uniqKey="Leibbrandt A">A Leibbrandt</name>
</author>
<author><name sortKey="Wada, T" uniqKey="Wada T">T Wada</name>
</author>
<author><name sortKey="Slutsky, As" uniqKey="Slutsky A">AS Slutsky</name>
</author>
<author><name sortKey="Liu, D" uniqKey="Liu D">D Liu</name>
</author>
<author><name sortKey="Qin, C" uniqKey="Qin C">C Qin</name>
</author>
<author><name sortKey="Jiang, C" uniqKey="Jiang C">C Jiang</name>
</author>
<author><name sortKey="Penninger, Jm" uniqKey="Penninger J">JM Penninger</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wu, S" uniqKey="Wu S">S Wu</name>
</author>
<author><name sortKey="Gao, J" uniqKey="Gao J">J Gao</name>
</author>
<author><name sortKey="Ohlemeyer, C" uniqKey="Ohlemeyer C">C Ohlemeyer</name>
</author>
<author><name sortKey="Roos, D" uniqKey="Roos D">D Roos</name>
</author>
<author><name sortKey="Niessen, H" uniqKey="Niessen H">H Niessen</name>
</author>
<author><name sortKey="Kottgen, E" uniqKey="Kottgen E">E Kottgen</name>
</author>
<author><name sortKey="Gessner, R" uniqKey="Gessner R">R Gessner</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="He, R" uniqKey="He R">R He</name>
</author>
<author><name sortKey="Leeson, A" uniqKey="Leeson A">A Leeson</name>
</author>
<author><name sortKey="Andonov, A" uniqKey="Andonov A">A Andonov</name>
</author>
<author><name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author><name sortKey="Bastien, N" uniqKey="Bastien N">N Bastien</name>
</author>
<author><name sortKey="Cao, J" uniqKey="Cao J">J Cao</name>
</author>
<author><name sortKey="Osiowy, C" uniqKey="Osiowy C">C Osiowy</name>
</author>
<author><name sortKey="Dobie, F" uniqKey="Dobie F">F Dobie</name>
</author>
<author><name sortKey="Cutts, T" uniqKey="Cutts T">T Cutts</name>
</author>
<author><name sortKey="Ballantine, M" uniqKey="Ballantine M">M Ballantine</name>
</author>
<author><name sortKey="Li, X" uniqKey="Li X">X Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Forrest, Ms" uniqKey="Forrest M">MS Forrest</name>
</author>
<author><name sortKey="Lan, Q" uniqKey="Lan Q">Q Lan</name>
</author>
<author><name sortKey="Hubbard, Ae" uniqKey="Hubbard A">AE Hubbard</name>
</author>
<author><name sortKey="Zhang, L" uniqKey="Zhang L">L Zhang</name>
</author>
<author><name sortKey="Vermeulen, R" uniqKey="Vermeulen R">R Vermeulen</name>
</author>
<author><name sortKey="Zhao, X" uniqKey="Zhao X">X Zhao</name>
</author>
<author><name sortKey="Li, G" uniqKey="Li G">G Li</name>
</author>
<author><name sortKey="Wu, Yy" uniqKey="Wu Y">YY Wu</name>
</author>
<author><name sortKey="Shen, M" uniqKey="Shen M">M Shen</name>
</author>
<author><name sortKey="Yin, S" uniqKey="Yin S">S Yin</name>
</author>
<author><name sortKey="Chanock, Sj" uniqKey="Chanock S">SJ Chanock</name>
</author>
<author><name sortKey="Rothman, N" uniqKey="Rothman N">N Rothman</name>
</author>
<author><name sortKey="Smith, Mt" uniqKey="Smith M">MT Smith</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sheets, P" uniqKey="Sheets P">P Sheets</name>
</author>
<author><name sortKey="Carlson, G" uniqKey="Carlson G">G Carlson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rana, Sv" uniqKey="Rana S">SV Rana</name>
</author>
<author><name sortKey="Verma, Y" uniqKey="Verma Y">Y Verma</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">J Clin Immunol</journal-id>
<journal-id journal-id-type="iso-abbrev">J. Clin. Immunol</journal-id>
<journal-title-group><journal-title>Journal of Clinical Immunology</journal-title>
</journal-title-group>
<issn pub-type="ppub">0271-9142</issn>
<issn pub-type="epub">1573-2592</issn>
<publisher><publisher-name>Kluwer Academic Publishers-Plenum Publishers</publisher-name>
<publisher-loc>New York</publisher-loc>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">17024565</article-id>
<article-id pub-id-type="pmc">7086694</article-id>
<article-id pub-id-type="publisher-id">9046</article-id>
<article-id pub-id-type="doi">10.1007/s10875-006-9046-y</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Article</subject>
</subj-group>
</article-categories>
<title-group><article-title>Upregulation of Mitochondrial Gene Expression in PBMC from Convalescent SARS Patients</article-title>
</title-group>
<contrib-group><contrib contrib-type="author"><name><surname>SHAO</surname>
<given-names>HONGWEI</given-names>
</name>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author"><name><surname>LAN</surname>
<given-names>DONGMING</given-names>
</name>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author"><name><surname>DUAN</surname>
<given-names>ZHAOHUI</given-names>
</name>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>LIU</surname>
<given-names>ZEHUAN</given-names>
</name>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author"><name><surname>MIN</surname>
<given-names>JUN</given-names>
</name>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>ZHANG</surname>
<given-names>LICHUN</given-names>
</name>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author"><name><surname>HUANG</surname>
<given-names>JIAN</given-names>
</name>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>SU</surname>
<given-names>JING</given-names>
</name>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author"><name><surname>CHEN</surname>
<given-names>SHANGWU</given-names>
</name>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author" corresp="yes"><name><surname>XU</surname>
<given-names>ANLONG</given-names>
</name>
<address><email>lssxal@mail.sysu.edu.cn</email>
</address>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<aff id="Aff1"><label>1</label>
<institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>State Key Laboratory of Biocontrol, Department of Biochemistry,</institution>
<institution>College of Life Sciences, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510275 Guangzhou, P. R. China</aff>
<aff id="Aff2"><label>2</label>
<institution-wrap><institution-id institution-id-type="GRID">grid.12981.33</institution-id>
<institution-id institution-id-type="ISNI">000000012360039X</institution-id>
<institution>The Second Affiliated Hospital, Sun Yat-sen (Zhongshan) University,</institution>
</institution-wrap>
510120 Guangzhou, P. R. China</aff>
</contrib-group>
<pub-date pub-type="epub"><day>6</day>
<month>10</month>
<year>2006</year>
</pub-date>
<pub-date pub-type="ppub"><year>2006</year>
</pub-date>
<volume>26</volume>
<issue>6</issue>
<fpage>546</fpage>
<lpage>554</lpage>
<history><date date-type="received"><day>30</day>
<month>5</month>
<year>2006</year>
</date>
<date date-type="accepted"><day>8</day>
<month>9</month>
<year>2006</year>
</date>
</history>
<permissions><copyright-statement>© Springer Science+Business Media, LLC 2006</copyright-statement>
<license><license-p>This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.</license-p>
</license>
</permissions>
<abstract id="Abs1"><p>The observations that Lymphopenia is common in severe acute respiratory syndrome (SARS) patients and that peripheral blood mononuclear cell (PBMC) could be infected by SARS-CoV indicate that PBMC could be useful in identifying the gene expression profile in convalescent patients and tracing the host response to SARS-CoV infection. In this study, the altered genes expressions in the PBMC of convalescent SARS patients were investigated with suppression subtractive hybridization (SSH). We found that genes encoded by mitochondrial DNA (mtDNA) were obviously upregulated, while mitochondria were now found to be closely connected with antiviral immunity. The identification of a viral gene, M, in SSH cDNA library shows the long-term existence of SARS-CoV <italic>in vivo</italic>
. In addition, some oxidative stress sensitive genes, heat shock proteins, transcription factors, and cytokines showed remarkable elevation. Thin-section electron microscope shows increased lysosome-like granule and mitochondria in PBMC of patients. These results provide important intracellular clue for tracing host response to SARS-CoV infection and suggest a role of mitochondria in that process.</p>
</abstract>
<kwd-group xml:lang="en"><title>KEY WORDS</title>
<kwd>Severe acute respiratory syndrome</kwd>
<kwd>peripheral blood mononuclear cell</kwd>
<kwd>suppression subtractive hybridization</kwd>
<kwd>mitochondria</kwd>
</kwd-group>
<custom-meta-group><custom-meta><meta-name>issue-copyright-statement</meta-name>
<meta-value>© Springer Science+Business Media, LLC 2006</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body><sec id="Sec1" sec-type="introduction"><title>INTRODUCTION</title>
<p>Severe acute respiratory syndrome (SARS) is caused by a novel coronavirus (<xref ref-type="bibr" rid="CR1">1</xref>
, <xref ref-type="bibr" rid="CR2">2</xref>
), called SARS-CoV. Since its outbreak in 2003, some important issues about this novel virus have been clarified. Many questions, especially how this virus causes disease and how the host responds to it, however, remain to be answered. Unlike the other known human coronaviruses such as HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1, which are generally associated with relatively mild respiratory tract infection, occasionally with pneumonia (<xref ref-type="bibr" rid="CR3">3</xref>
–<xref ref-type="bibr" rid="CR5">5</xref>
), SARS-CoV can cause fatal infectious pneumonia. Remarkably, SARS-CoV and HCoV-NL63 employ a co-receptor, ACE2, for cellular entry (<xref ref-type="bibr" rid="CR6">6</xref>
, <xref ref-type="bibr" rid="CR7">7</xref>
). Furthermore, clinical observations show that there is a significant correlation between age and prognosis. Children have a good prognosis (<xref ref-type="bibr" rid="CR8">8</xref>
), while elderly patients with chronic illness fare badly (<xref ref-type="bibr" rid="CR9">9</xref>
). These findings indicate that both the uniqueness of this virus and the host factor are important for this disease.</p>
<p>It was reported that PBMC could be infected by SARS-CoV (<xref ref-type="bibr" rid="CR10">10</xref>
). Lymphopenia is also common in SARS patients (<xref ref-type="bibr" rid="CR11">11</xref>
). These observations indicate that PBMC could be useful in identifying the gene expression profile in convalescent patients and tracing the host response to SARS-CoV infection. In this study, we design to detect the alteration of genes expression in the PBMC from 10 convalescent SARS patients with suppression subtractive hybridization (SSH). We found that genes encoded by mitochondrial DNA (mtDNA) were obviously upregulated, while mitochondria were now found to be closely connected with antiviral immunity (<xref ref-type="bibr" rid="CR12">12</xref>
, <xref ref-type="bibr" rid="CR13">13</xref>
). The identification of a viral gene, M, in SSH cDNA library shows the long-term existence of SARS-CoV <italic>in vivo</italic>
, which is consistent with the reports by two groups (<xref ref-type="bibr" rid="CR14">14</xref>
, <xref ref-type="bibr" rid="CR15">15</xref>
). In addition, some oxidative stress sensitive genes, heat shock proteins, transcription factors, and cytokines showed remarkable elevation.</p>
</sec>
<sec id="Sec2"><title>PATIENTS AND METHODS</title>
<sec id="Sec3"><title>Patients and Controls</title>
<p>Ten convalescent SARS patients diagnosed by the WHO definition of SARS were admitted to the Second Affiliated Hospital of Sun Yat-sen University in Guangzhou during a major SARS outbreak in February 2003 and selected for analyzing the altered genes expression in peripheral blood mononuclear cells (PBMC). These patients are all female with the age range from 20 to 38 (at mean of 26). Ten healthy females with similar age were used as control.</p>
</sec>
<sec id="Sec4"><title>Isolation of PBMC</title>
<p>Peripheral blood samples from 10 convalescent SARS patients were collected in June 19 2003, 17–19 weeks from the onset of SARS in these patients. PBMC were isolated using Ficoll-Paque<sup>TM</sup>
PLUS (Amersham Biosciences) according to manufacturer's protocol and suspended in stock medium (10% DMSO plus 90% autologous serum) and frozen in liquid nitrogen for the study. PBMC of 10 healthy controls were conducted in the same manner as mentioned above.</p>
</sec>
<sec id="Sec5"><title>RNA Preparation</title>
<p>Total RNA was separately extracted from PBMC of 10 convalescent SARS patients using TRIzol<sup>®</sup>
Reagent (Invitrogen), and the concentration was determined with the UV absorption at 260 nm. The total RNA samples from 10 convalescent SARS patients were equally combined to reduce the individual difference in following subtractive hybridization. Before it was used in the following assay, the mixed total RNA was treated with DNase I (RNase free). Total RNA samples of 10 controls were treated in the same way. PolyA+ RNA was isolated from total RNA using the Oligotex mRNA Mini Kit (Qiagen) according to manufacturer's protocol.</p>
</sec>
<sec id="Sec6"><title>Suppression Subtractive Hybridization (SSH) and Cloning of cDNA</title>
<p>As the quantitative insufficiency of RNA, we performed first-strand cDNA and double-strand cDNA synthesis with SMART<sup>TM</sup>
PCR cDNA Synthesis Kit (Clontech). Total RNA and polyA+ RNA were respectively used as starting materials to synthesize cDNA. To eliminate the artificial impact, two separate SSH processes were performed with PCR-Select cDNA Subtraction Kit (Clontech) according to manufacturer's manual. The cDNAs derived from total RNA were subject to the first suppression subtractive hybridization (SSH-I); the cDNAs derived from polyA+ RNA were subject to the second suppression subtractive hybridization (SSH-II). To evaluate the subtraction efficiency, the abundance of GAPDH gene was investigated in subtracted products by PCR.</p>
<p>The subtracted products were purified by QIAquick PCR Purificaton Kit (Qiagen) and linked with pGEM-T Easy Vector (Promega). The recombinants were transformed into <italic>E. coli</italic>
TG1 with Gene Pluser (Bio-Rad). After PCR confirmation, the positive transformants were selected for sequence analysis.</p>
</sec>
<sec id="Sec7"><title>Sequence Analysis</title>
<p>Sequencing of transformants from subtractive cDNA was performed on ABI3730 sequencer (Applied Biosystem). Sequences were jointly analyzed for homology with BLASTN program at NCBI (http://www.ncbi.nlm.nih.gov/BLAST) and BLAT program at UCSC Genome Bioinformatics (http://www.ucsc.edu). Genes were classified by gene annotation given by Gene Ontology (GO) Consortium (http://www.geneontology.org/).</p>
</sec>
<sec id="Sec8"><title>Expression Analysis by Reverse Transcription- Polymerase Chain Reaction (RT-PCR)</title>
<p>Genes of interest were selected for RT-PCR analysis, and the first-strand cDNA derived from total RNA was used for template. With Oligo(dT) as primer, the reverse transcription was performed using SuperScript<sup>TM</sup>
First-Strand Synthesis System (Invitrogen) according to manufacturer's protocol. For PCR, the amplification parameters were 2 min at 94°C, 30 cycles of 30 s at 94°C, 50 s at 53–65°C (change temperature for different primer pairs), and 1.5 min at 72°C, followed by 5 min at 72°C. GAPDH and β-actin were used as quantification references. The primers were shown in Table <xref rid="Tab1" ref-type="table">I</xref>
. The amplified products were subject to electrophoresis, the gels were screened with Gel Doc XR documentation system (BIO-RAD), and the bands were analyzed with Quantity One analysis software (BIO-RAD).<table-wrap id="Tab1"><label>Table I.</label>
<caption><p>The Sequences of Primers of Selected Genes for RT-PCR</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th></th>
<th colspan="2">Primer sequence (5′-3′)</th>
<th></th>
</tr>
<tr><th>Gene</th>
<th>Sense</th>
<th>Antisense</th>
<th>Product size (bp)</th>
</tr>
</thead>
<tbody><tr><td>16s rRNA</td>
<td>CATGACACAGCAAGACGAGAAGAC</td>
<td>CAGGGAGGAATTTGAAGTAGATAG</td>
<td>420</td>
</tr>
<tr><td>ND1</td>
<td>GGCTACTACAACCCTTCGCTGACG</td>
<td>TTGTGTTGTGATAAGGGTGGAGAG</td>
<td>354</td>
</tr>
<tr><td>COX1</td>
<td>GCTTCCTAGGGTTTATCGTGTGAG</td>
<td>ATGGATTTTGGCGTAGGTTTGGTC</td>
<td>398</td>
</tr>
<tr><td>ZNF331</td>
<td>TGGGTTACGCAATGATTTCTTAGT</td>
<td>ACCTCGCTCCCTTATCCTCCTTCT</td>
<td>438</td>
</tr>
<tr><td>FOS</td>
<td>TGTTCCCAGCATCATCCAG</td>
<td>TGCGTTTTGCTACATCTCC</td>
<td>543</td>
</tr>
<tr><td>IFRD1</td>
<td>CTACTGCTGACCATATGCCCAATC</td>
<td>AAAATCCCGTTCCTCCACTG</td>
<td>306</td>
</tr>
<tr><td>DNAJB1</td>
<td>GTGAGAGGCAGACCAGCAG</td>
<td>CCAGACCATCAAGGGAGAGG</td>
<td>343</td>
</tr>
<tr><td>IL1B</td>
<td>TCCTGCGTGTTGAAAGATGATAAG</td>
<td>TCTGCCAGCCCTAGGGATTGAGT</td>
<td>315</td>
</tr>
<tr><td>FTH1</td>
<td>TCACTACTGGAACTGCACAAACTG</td>
<td>CCAAGACCTCAAAGACAACACCTG</td>
<td>397</td>
</tr>
<tr><td>PRDX1</td>
<td>ACGGAGATCATTGCTTTCAGTG</td>
<td>CTTCCCCATGTTTGTCAGTG</td>
<td>355</td>
</tr>
<tr><td>BCL11B</td>
<td>AGTGGTGGTCTTTTGGATGAGG</td>
<td>CTTGTGCTTTGGGATGGCTTAGTC</td>
<td>418</td>
</tr>
<tr><td>HBB</td>
<td>AGTGCTCGGTGCCTTTAGTG</td>
<td>AATATCCCCCAGTTTAGTAGTTG</td>
<td>320</td>
</tr>
<tr><td>SARS-CoV M</td>
<td>GCTTGTTTTCCTCTGGCTCTTG</td>
<td>CTACACGCTGCGACGCTCCTAAT</td>
<td>412</td>
</tr>
<tr><td>GAPDH</td>
<td>ACCACAGTCCATGCCATCAC</td>
<td>TCCACCACCCTGTTGCTGTA</td>
<td>452</td>
</tr>
<tr><td>ACTIN</td>
<td>TTCCAGCCTTCCTTCCTGGG</td>
<td>TTGCGCTCAGGAGGAGCAAT</td>
<td>224</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
<sec id="Sec9"><title>Thin-Section Electron Microscope</title>
<p>PBMC from convalescent SARS patients and healthy controls were washed twice with 1× PBS and were respectively mixed together and subject to centrifugation. Deposited cells (about 5×10<sup>6</sup>
) were fixed with 1 ml 2.5% glutaraldehyde in 0.1 M phosphate buffer overnight at 4°C. After washing with 0.1 M phosphate buffer, the fixed cells were post-fixed with 1% osmium tetroxide in 0.1 M phosphate buffer, dehydrated with gradient alcohol, embedded with spur resin, double-stained with uranyl acetate and lead citrate, and observed under a JEM_100CX II transmission electron microscope. Specimens were observed with 19,000× magnification, and PBMC were divided into three groups according to the number of mitochondria appearing in each intact cross sections of PBMC (<5, PBMC containing less than five mitochondria; 5–10, PBMC containing 5–10 mitochondria; >10, PBMC containing more than 10 mitochondria). Total 150 intact cross sections of PBMC from patients or controls were respectively counted.</p>
</sec>
</sec>
<sec id="Sec10" sec-type="results"><title>RESULTS</title>
<sec id="Sec11"><title>Gene Profile in SSH cDNA Libraries</title>
<p>There are about 300 available sequences obtained in each SSH cDNA library. These sequences were subsequently subject to homology alignment against human genome by jointly using BLASTN program and BLAT program, and a total of 411 individual genes/ sequences were identified. The classification of these genes/sequences is shown in Fig. <xref rid="Fig1" ref-type="fig">1</xref>
.<fig id="Fig1"><label>Fig. 1.</label>
<caption><p>Genes profile in SSH cDNA libraries.</p>
</caption>
<graphic xlink:href="10875_2006_9046_Fig1_HTML" id="MO1"></graphic>
</fig>
<fig id="Fig2"><label>Fig. 2.</label>
<caption><p>The proportion of mitochondrial genes in two SSH libraries.</p>
</caption>
<graphic xlink:href="10875_2006_9046_Fig2_HTML" id="MO2"></graphic>
</fig>
</p>
<p>Unexpectedly, we found that the genes encoded by mtDNA occupied a considerable proportion, ∼30%, in both cDNA libraries (Fig. <xref rid="Fig2" ref-type="fig">2</xref>
). Genes that appeared thrice or more together in two cDNA libraries are shown (Table <xref rid="Tab2" ref-type="table">II</xref>
). These genes occupy about 40% (264 of 667) of the entire EST sequences, while more than 70% of them are mitochondrial genes. Interestingly, three cDNA molecules representing the mitochondrial control region were identified in a SSH cDNA library (Table <xref rid="Tab2" ref-type="table">II</xref>
). Mitochondrial control region also called displacement-loop (D-loop) regulatory region is the non-coding region in mtDNA and also the initial site of mtDNA transcription. Both H-strand and L-strand of mtDNA initiate transcription at this region. The primary transcripts are the polycistronic precursor RNA molecules and are subsequently cleaved and processed to produce the individual tRNA and mRNA molecules (<xref ref-type="bibr" rid="CR16">16</xref>
). RNA molecules matching to D-loop region were regarded as transcription/replication primers (<xref ref-type="bibr" rid="CR17">17</xref>
, <xref ref-type="bibr" rid="CR18">18</xref>
). Furthermore, owing to the annular mtDNA, they may also be the results of strand extension during transcription process. Our finding that two of these three cDNA molecules contain the polyA tail supports this speculation (data not shown). In both cases, however, the repeated appearances of these RNA molecules in SSH cDNA library imply the upregulated transcription of mtDNA. As a whole, the abundant mitochondrial genes appearing in SSH cDNA libraries reflect the unusual activation of mitochondria in PBMC of convalescent SARS patients.<table-wrap id="Tab2"><label>Table II.</label>
<caption><p>Genes Appeared Thrice or More in Suppression Subtractive Hybridization (SSH) cDNA Libraries</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th></th>
<th colspan="3">Redundancy<sup><italic>a</italic>
</sup>
</th>
<th></th>
<th></th>
</tr>
<tr><th>Gene symbol/name</th>
<th align="left">SSH-I</th>
<th align="left">SSH-II</th>
<th align="left">Total</th>
<th>Location<sup><italic>b</italic>
</sup>
</th>
<th>Category</th>
</tr>
</thead>
<tbody><tr><td>RNR2 (16s rRNA)</td>
<td>53</td>
<td>27</td>
<td>80</td>
<td>M</td>
<td>Protein synthesis</td>
</tr>
<tr><td>RNR1 (12s rRNA)</td>
<td>16</td>
<td>22</td>
<td>38</td>
<td>M</td>
<td>Protein synthesis</td>
</tr>
<tr><td>ATP6 (ATP synthase F0 subunit 6)</td>
<td>5</td>
<td>13</td>
<td>18</td>
<td>M</td>
<td>Respiration/redox</td>
</tr>
<tr><td>COX2 (cytochrome c oxidase subunit II)</td>
<td>6</td>
<td>7</td>
<td>13</td>
<td>M</td>
<td>Respiration/redox</td>
</tr>
<tr><td>ND1 (NADH dehydrogenase, subunit 1)</td>
<td>7</td>
<td>3</td>
<td>10</td>
<td>M</td>
<td>Respiration/redox</td>
</tr>
<tr><td>COX1 (cytochrome c oxidase subunit I)</td>
<td>8</td>
<td></td>
<td>8</td>
<td>M</td>
<td>Respiration/redox</td>
</tr>
<tr><td>ND5 (NADH dehydrogenase, subunit 5)</td>
<td>4</td>
<td>4</td>
<td>8</td>
<td>M</td>
<td>Respiration/redox</td>
</tr>
<tr><td>ATP8 (ATP synthase F0 subunit 8)</td>
<td>1</td>
<td>4</td>
<td>5</td>
<td>M</td>
<td>Respiration/redox</td>
</tr>
<tr><td>ND4 (NADH dehydrogenase, subunit 4)</td>
<td>2</td>
<td>3</td>
<td>5</td>
<td>M</td>
<td>Respiration/redox</td>
</tr>
<tr><td>CYTB (cytochrome b)</td>
<td></td>
<td>4</td>
<td>4</td>
<td>M</td>
<td>Respiration/redox</td>
</tr>
<tr><td>mitochondrial control region</td>
<td>3</td>
<td></td>
<td>3</td>
<td>M</td>
<td>Expression regulation/ nucleic acid modification</td>
</tr>
<tr><td>HBB (hemoglobin beta)</td>
<td>10</td>
<td>3</td>
<td>13</td>
<td>—</td>
<td>Transport/motility</td>
</tr>
<tr><td>DNAJB1 (DnaJ (Hsp40) homolog, subfamily B, member 1)</td>
<td>4</td>
<td>4</td>
<td>8</td>
<td>—</td>
<td>Stress response</td>
</tr>
<tr><td>RPL10 (ribosomal protein L10)</td>
<td>1</td>
<td>6</td>
<td>7</td>
<td>—</td>
<td>Protein synthesis</td>
</tr>
<tr><td>28S rRNA (28S ribosomal RNA)</td>
<td>6</td>
<td></td>
<td>6</td>
<td>—</td>
<td>Protein synthesis</td>
</tr>
<tr><td>RPS4X (ribosomal protein S4, X-linked X isoform)</td>
<td></td>
<td>6</td>
<td>6</td>
<td>—</td>
<td>Protein synthesis</td>
</tr>
<tr><td>RPS12 (ribosomal protein S12)</td>
<td></td>
<td>5</td>
<td>5</td>
<td>—</td>
<td>Protein synthesis</td>
</tr>
<tr><td>EEF1A1 (eukaryotic translation elongation factor 1 alpha)</td>
<td></td>
<td>4</td>
<td>4</td>
<td>—</td>
<td>Protein synthesis</td>
</tr>
<tr><td>HSPA8 (heat shock 70 kDa protein 8 isoform 2)</td>
<td></td>
<td>4</td>
<td>4</td>
<td>—</td>
<td>Stress response</td>
</tr>
<tr><td>ZNF331 (zinc finger protein 331)</td>
<td>4</td>
<td></td>
<td>4</td>
<td>—</td>
<td>Expression regulation/ nucleic acid modification</td>
</tr>
<tr><td>BCL11B (B-cell CLL/lymphoma 11B (zinc finger protein))</td>
<td>3</td>
<td></td>
<td>3</td>
<td>—</td>
<td>Cell cycle and development</td>
</tr>
<tr><td>FOS (v-fos FBJ murine osteosarcoma viral oncogene homolog)</td>
<td>1</td>
<td>2</td>
<td>3</td>
<td>—</td>
<td>Expression regulation/ nucleic acid modification</td>
</tr>
<tr><td>FTH1 (ferritin, heavy polypeptide 1)</td>
<td>1</td>
<td>2</td>
<td>3</td>
<td>—</td>
<td>Transport/motility</td>
</tr>
<tr><td>HERPUD1 (homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1)</td>
<td>1</td>
<td>2</td>
<td>3</td>
<td>—</td>
<td>Stress response</td>
</tr>
<tr><td>RPS15A (ribosomal protein S15a)</td>
<td></td>
<td>3</td>
<td>3</td>
<td>—</td>
<td>Protein synthesis</td>
</tr>
<tr><td>SARS-CoV M<sup><italic>c</italic>
</sup>
</td>
<td>1</td>
<td></td>
<td>1</td>
<td></td>
<td></td>
</tr>
</tbody>
</table>
<table-wrap-foot><p><sup><italic>a</italic>
</sup>
Redundancy, the number of individual cDNA clones appearing in SSH cDNA libraries.<sup><italic>b</italic>
</sup>
Where proteins are located in or genes are from: M, mitochondria; (–) nuclear.<sup><italic>c</italic>
</sup>
Gene appeared in SSH cDNA libraries was encoded by SARS-CoV.</p>
</table-wrap-foot>
</table-wrap>
</p>
<p>Remarkably, the M gene of SARS-CoV was found in one cDNA library (Table <xref rid="Tab2" ref-type="table">II</xref>
). Liu <italic>et al.</italic>
(<xref ref-type="bibr" rid="CR14">14</xref>
) reported that the duration of virus excretion in stools of four SARS patients was more than 100 days after onset of symptoms, and suggested that coexisting illness or conditions were associated with longer viral excretion in stools. Chu <italic>et al.</italic>
(<xref ref-type="bibr" rid="CR15">15</xref>
) also reported the long-term duration of RT-PCR positivity in SARS patients after discharge. We collected the PBMC at around 17–19 weeks from the onset of symptoms, and the 10 selected patients were all female. Does this means there is a correlation between long-term persistence and female? Considering the clinical observation of slight predominance of female patients (<xref ref-type="bibr" rid="CR19">19</xref>
), further analysis will be necessary.<fig id="Fig3"><label>Fig. 3.</label>
<caption><p>RT-PCR analysis for selected genes. The altered expressions of selected genes in convalescent SARS patients and healthy controls were shown. The existence of SARS-CoV M gene was also shown. GAPDH and β-actin were used as quantificational reference.</p>
</caption>
<graphic xlink:href="10875_2006_9046_Fig3_HTML" id="MO3"></graphic>
</fig>
</p>
<p>Many other genes, such as those related to expression regulation/nucleic acid modification, transport/movement, signal transduction, stress response, cell cycle/development, and so on, were also present in cDNA libraries (Fig. <xref rid="Fig1" ref-type="fig">1</xref>
). In addition, there were some genes with unknown function and sequences encoding hypothetical proteins.</p>
</sec>
<sec id="Sec12"><title>RT-PCR Analysis of Selected Genes</title>
<p>Some genes of interest were selected for RT-PCR confirmation. The altered expression of these genes is shown (Fig. <xref rid="Fig3" ref-type="fig">3</xref>
). Expectedly, similar upregulated extent of mitochondrial genes, 16S rRNA, NADH dehydrogenase subunit 1 (ND1), and cytochrome <italic>c</italic>
oxidase subunit I (COX1) has been found, corresponding to the special mitochondrial transcription manner, by which the mitochondrial genes are jointly transcribed. The evident upregulation (almost double) of mitochondrial genes confirms the abundant appearance of that in SSH cDNA libraries.</p>
<p>In addition to mitochondrial genes, there are other genes that show prominent increase in expression. Two transcription factors, zinc finger protein 331 (ZNF331) and FBJ murine osteosarcoma viral oncogene homolog (FOS), also called c-fos, display distinct upregulation. The stress response protein DnaJ (Hsp40) homolog subfamily B member 1 (DNAJB1), the differentiation-associated gene (IFRD1) and the cytokine (IL-1B), also show intensely increased expression. Furthermore, two oxidative stress sensitive genes, peroxiredoxin 1 (PRDX1) and ferritin heavy polypeptide 1 (FTH1), show obvious elevation. The upregulation of these genes is consistent with the activated immune status in patients. The presence of M gene of SARS-CoV also reveals its substantial persistence in PBMC of convalescent SARS patients (Fig. <xref rid="Fig3" ref-type="fig">3</xref>
).<fig id="Fig4"><label>Fig. 4.</label>
<caption><p>The statistic result of PBMC from convalescent SARS patients and healthy controls. PBMC were divided into three groups based on the number of mitochondria in each cell: <5, PBMC containing less than five mitochondria; 5–10, PBMC containing 5–10 mitochondria; >10, PBMC containing more than 10 mitochondria.</p>
</caption>
<graphic xlink:href="10875_2006_9046_Fig4_HTML" id="MO4"></graphic>
</fig>
</p>
</sec>
<sec id="Sec13"><title>Thin-Section Electron Microscope Analysis of PBMC</title>
<p>The PBMC of convalescent SARS patients and controls were subject to thin-section electron microscope analysis. We have respectively observed 150 intact cross sections of PBMC from patients and controls. The statistical result is shown in Fig. <xref rid="Fig4" ref-type="fig">4</xref>
. It is found that the difference in the number of mitochondria in PBMC between patients and controls was substantial (<italic>P</italic>
<0.01). We have also found that there were prominently increased lysosome-like granules in PBMC from convalescent SARS patients (Fig. <xref rid="Fig5" ref-type="fig">5</xref>
). The increase of lysosome-like granules could reflect the activated status of these PBMC.</p>
</sec>
</sec>
<sec id="Sec14" sec-type="discussion"><title>DISCUSSION</title>
<p>In the present study, we identified that genes coded in mitochondria, a main origin of intracellular free radicals, also an organelle now being found closely connected with antiviral immunity (<xref ref-type="bibr" rid="CR12">12</xref>
, <xref ref-type="bibr" rid="CR13">13</xref>
), were obviously upregulated in PBMC of convalescent SARS patients. Some of these genes such as PRDX1, FTH1, and FOS responding to oxidative stress also showed remarkable elevation. In addition, the intense upregulations of stress response protein DNAJB1, differentiation-associated gene IFRD1, cytokine IL-1B, and other genes have been observed. In conjunction with the increase of lysosome-like granules and the persistence of viral gene, these results reflect the activated status of the PBMC from convalescent SARS patients.<fig id="Fig5"><label>Fig. 5.</label>
<caption><p>Thin-section electron microscope analysis of PBMC from convalescent SARS patients and healthy controls (original magnification 7200×). M, mitochondria; L, lysosome-like granule.</p>
</caption>
<graphic xlink:href="10875_2006_9046_Fig5_HTML" id="MO5"></graphic>
</fig>
</p>
<p>The active transcription of mitochondrial genes seems to imply that the mitochondria of PBMC have been deeply affected by SARS-CoV infection and/or clinical therapy in some unclear ways. Many factors including virus infection, oxidative stress, nucleoside analogues, and some hormones are able to impact mitochondria and mitochondrial gene transcription. Often, the factors are able not only to influence each other but also to jointly act on mitochondria. It was widely reported that nucleoside analogues, especially nucleoside reverse transcriptase inhibitors (NRTI), could induce mtDNA depletion (<xref ref-type="bibr" rid="CR20">20</xref>
), and subsequently lead to compensatory upregulation of mitochondrial transcription (<xref ref-type="bibr" rid="CR21">21</xref>
). However, none of the patients studied in this trial have been treated with NRTI. Some hormones such as steroid and thyroid can increase mitochondrial gene transcription and respiratory enzyme biosynthesis (<xref ref-type="bibr" rid="CR22">22</xref>
). Four of these patients have ever accepted short-term glucocorticoid treatment (5–11 days). However, the difference of mitochondrial gene expression between them and the other patients is not significant at the time of study (data not shown). These could suggest that there are additional triggers are required for the significant upregulation of mitochondrial transcription.</p>
<p>It was reported that HIV infection was associated with mitochondrial DNA (mtDNA) depletion, extensive mitochondrial respiratory chain (MRC) disturbances and increased oxidative damage (<xref ref-type="bibr" rid="CR23">23</xref>
). This gives us a hint whether SARS-CoV can also affect mitochondria. Interestingly, two proteins of SARS-CoV, 3b and non-structural protein 10 (nsp10), show a close connection with mitochondria. Yuan <italic>et al.</italic>
(<xref ref-type="bibr" rid="CR24">24</xref>
) reported the mitochondrial location of SARS-CoV 3b, and Li <italic>et al.</italic>
(<xref ref-type="bibr" rid="CR25">25</xref>
) found that SARS-CoV nsp10 can specifically interact with the NADH 4L subunit and cytochrome oxidase II. These provide support for our speculation that SARS-CoV could affect the mitochondria in infected cell. Recently, an observation that mitochondrial antiviral signaling (MAVS) (<xref ref-type="bibr" rid="CR26">26</xref>
), also called virus-induced siganling adaptor (VISA) (<xref ref-type="bibr" rid="CR27">27</xref>
), IFN-β promoter stimulator 1 (IPS-1) (<xref ref-type="bibr" rid="CR28">28</xref>
), or CARD adaptor inducing IFN-β (CARDIF) (<xref ref-type="bibr" rid="CR29">29</xref>
), an important protein required for activating type I interferon expression during virus infection requires that it be localized to the mitochondria for its function, establishes a link between mitochondria and innate immunity (<xref ref-type="bibr" rid="CR12">12</xref>
). Furthermore, increasing studies uncover the connections between mitochondria and viruses (<xref ref-type="bibr" rid="CR30">30</xref>
–<xref ref-type="bibr" rid="CR33">33</xref>
). These investigations shed new light on the role of mitochondria in host antiviral immune response, and inspire our further investigation on how SARS-CoV affects infected cell and induces disease.</p>
<p>Despite the inconsistent reports, oxidative stress caused by mitochondria is shown to be involved in the regulation of mitochondrial transcription and proliferation with complicated compensatory mechanism (<xref ref-type="bibr" rid="CR34">34</xref>
–<xref ref-type="bibr" rid="CR36">36</xref>
). In SARS, both pathogen and host factors are considered to be important for the pathogenesis (<xref ref-type="bibr" rid="CR9">9</xref>
). As one kind of important immune factors, free radicals, responsible for oxidative stress, including reactive oxygen species (ROS), and reactive nitrogen species (RNS) produced by mitochondria are essential not only for defense mechanism of cell but also for tissue injury. Activated phagocytes, e.g., neutrophil, monocyte, and macrophage, can rapidly generate a mass of free radicals, so-called respiratory burst, that kill both infected and normal cell at sites of infection. One of primary pathology of SARS is the tissues infiltration of monocyte, neutrophil, and lymphocyte, especially in lung (<xref ref-type="bibr" rid="CR37">37</xref>
, <xref ref-type="bibr" rid="CR38">38</xref>
), so it is reasonable to speculate that PBMC respond actively to the SARS-CoV infection, and that free radicals with cytotoxic properties released by these immune cells and infected cell participate in the tissues injury in SARS. Furthermore, the extreme manifestation of SARS is acute respiratory distress syndrome (ARDS), while many investigations have showed that oxidant stress contributes to the development of ARDS (<xref ref-type="bibr" rid="CR39">39</xref>
). Some recent evidences also suggest that these reactive species at subtoxic levels can serve as second messengers and redox-signaling molecules (<xref ref-type="bibr" rid="CR39">39</xref>
). This assigns reactive species profound biological roles in infection-induced immune response.</p>
<p>In addition to mitochondrial gene, some other genes responding to oxidative stress display prominent expression increase in the present investigation (Fig. <xref rid="Fig3" ref-type="fig">3</xref>
). Their increases support the opinion that oxidative stress participates in the pathogenesis of SARS. The obvious augment of PRDX1, a member of antioxidant enzymes, behaving as a dam upon oxidative stress (<xref ref-type="bibr" rid="CR40">40</xref>
), suggests the oxidant/antioxidant imbalance and the demand of antioxidant for eliminating excessive oxidant in PBMC of SARS patients. As a subunit of the ferritin protein, an iron-binding protein, the elevated expression of FTH1 implies the increase of ferritin. Ferritin is an important antioxidant, and it can suppress ROS accumulation through iron sequestration (<xref ref-type="bibr" rid="CR41">41</xref>
). Another iron-binding protein, lactoferrin was also highly upregulated in patients with SARS reported by Reghunathan <italic>et al.</italic>
(<xref ref-type="bibr" rid="CR42">42</xref>
). FOS is a component of redox-sensitive transcription factor complex activator protein 1 (AP-1), and can be activated by various stimuli including ROS (<xref ref-type="bibr" rid="CR43">43</xref>
). Angiotensin II (Ang-II) is a component of renin–angiotensin system, an important factor known for maintaining blood pressure, and was recently considered contributing to severe acute lung injury in SARS (<xref ref-type="bibr" rid="CR44">44</xref>
). Interestingly, Ang-II can elicit the activation of the redox-sensitive AP-1, while the mediator is mitochondria-derived ROS (<xref ref-type="bibr" rid="CR45">45</xref>
). Does this imply mitochondria-derived ROS induced by Ang-II plays a role in host response to SARS-CoV infection? Moreover, it was reported that the nucleocapsid (N) protein of SARS-CoV could selectively activate the AP-1 pathway (<xref ref-type="bibr" rid="CR46">46</xref>
). Is this related with the induction of reactive species? These questions are interesting and require further investigation. Furthermore, the remarkable upregulation of ZNF331 is noticeable. Knowledge about ZNF331 is limited. It was found highly upregulated in PBMC of benzene-exposed workers, while the question of why benzene should so markedly affect ZNF331 expression was still unclear (<xref ref-type="bibr" rid="CR47">47</xref>
). Recently, it was reported that the adverse effects of benzene were dependent on its metabolites and associated with free radical formation (<xref ref-type="bibr" rid="CR48">48</xref>
, <xref ref-type="bibr" rid="CR49">49</xref>
). This may suggest that ZNF331 is also a probable redox-sensitive transcription factor.</p>
<p>The epidemic of SARS has come to its end. Many questions, particularly how this virus causes disease and how the host responds to it, however, remain unanswered. In this study, we identified the obvious upregulation of mitochondrial genes and genes responding to oxidative stress in PBMC of convalescent SARS patient. These results provide an intracellular clue for tracing host response to SARS-CoV infection and suggest a role of mitochondria in that process. Detailed analysis of these genes could provide more information in understanding this new emerging disease.</p>
</sec>
</body>
<back><fn-group><fn><p>Both authors contributed equally to the work, China</p>
</fn>
</fn-group>
<ack><title>ACKNOWLEDGMENTS</title>
<p>We thank the SARS affected staffs of the second affiliated hospital of Sun Yat-Sen University for their cooperation with this study. This work was partially supported by the ‘973’ National Key Program for Developing Basic Research (No. 2003CB514110), by the anti-SARS grant from Guangdong Province, and by the European Commission's Sixth Framework Programme under contract number 511060—Development of Intervention Strategies against SARS in a European-Chinese Taskforce (DISSECT).</p>
</ack>
<ref-list id="Bib1"><title>REFERENCES</title>
<ref id="CR1"><label>1</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peiris</surname>
<given-names>JSM</given-names>
</name>
<name><surname>Lai</surname>
<given-names>ST</given-names>
</name>
<name><surname>Poon</surname>
<given-names>LLM</given-names>
</name>
<name><surname>Guan</surname>
<given-names>Y</given-names>
</name>
<name><surname>Yam</surname>
<given-names>LYC</given-names>
</name>
<name><surname>Lim</surname>
<given-names>W</given-names>
</name>
<name><surname>Nicholls</surname>
<given-names>J</given-names>
</name>
<name><surname>Yee</surname>
<given-names>WKS</given-names>
</name>
<name><surname>Yan</surname>
<given-names>WW</given-names>
</name>
<name><surname>Cheung</surname>
<given-names>MT</given-names>
</name>
<name><surname>Cheng</surname>
<given-names>VCC</given-names>
</name>
<name><surname>Chan</surname>
<given-names>KH</given-names>
</name>
<name><surname>Tsang</surname>
<given-names>DNC</given-names>
</name>
<name><surname>Yung</surname>
<given-names>RWH</given-names>
</name>
<name><surname>Ng</surname>
<given-names>TK</given-names>
</name>
</person-group>
<article-title>Yuen KY, and members of the SARS study group: Coronavirus as a possible cause of severe acute respiratory syndrome</article-title>
<source>Lancet</source>
<year>2003</year>
<volume>361</volume>
<fpage>1319</fpage>
<lpage>1325</lpage>
<pub-id pub-id-type="pmid">12711465</pub-id>
</element-citation>
</ref>
<ref id="CR2"><label>2</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ksiazek</surname>
<given-names>TG</given-names>
</name>
<name><surname>Erdman</surname>
<given-names>D</given-names>
</name>
<name><surname>Goldsmith</surname>
<given-names>CS</given-names>
</name>
<name><surname>Zaki</surname>
<given-names>SR</given-names>
</name>
<name><surname>Peret</surname>
<given-names>T</given-names>
</name>
<name><surname>Emery</surname>
<given-names>S</given-names>
</name>
<name><surname>Tong</surname>
<given-names>S</given-names>
</name>
<name><surname>Urbani</surname>
<given-names>C</given-names>
</name>
<name><surname>Corner</surname>
<given-names>JA</given-names>
</name>
<name><surname>Lim</surname>
<given-names>W</given-names>
</name>
<name><surname>Rollin</surname>
<given-names>PE</given-names>
</name>
<name><surname>Dowell</surname>
<given-names>SF</given-names>
</name>
<name><surname>Ling</surname>
<given-names>AE</given-names>
</name>
<name><surname>Humphrey</surname>
<given-names>CD</given-names>
</name>
<name><surname>Shieh</surname>
<given-names>WJ</given-names>
</name>
<name><surname>Guarner</surname>
<given-names>J</given-names>
</name>
<name><surname>Paddock</surname>
<given-names>CD</given-names>
</name>
<name><surname>Rota</surname>
<given-names>P</given-names>
</name>
<name><surname>Fields</surname>
<given-names>B</given-names>
</name>
<name><surname>DeRisi</surname>
<given-names>J</given-names>
</name>
<name><surname>Yang</surname>
<given-names>JY</given-names>
</name>
<name><surname>Cox</surname>
<given-names>N</given-names>
</name>
<name><surname>Hughes</surname>
<given-names>JM</given-names>
</name>
<name><surname>LeDuc</surname>
<given-names>JW</given-names>
</name>
<name><surname>Bellini</surname>
<given-names>WJ</given-names>
</name>
<name><surname>Anderson</surname>
<given-names>LJ</given-names>
</name>
</person-group>
<article-title>SARS Working Group: A novel coronavirus associated with severe acute respiratory syndrome</article-title>
<source>N Engl J Med</source>
<year>2003</year>
<volume>348</volume>
<fpage>1953</fpage>
<lpage>1966</lpage>
<pub-id pub-id-type="pmid">12690092</pub-id>
</element-citation>
</ref>
<ref id="CR3"><label>3</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>El-Sahly</surname>
<given-names>HM</given-names>
</name>
<name><surname>Atmar</surname>
<given-names>RL</given-names>
</name>
<name><surname>Glezen</surname>
<given-names>WP</given-names>
</name>
<name><surname>Greenberg</surname>
<given-names>SB</given-names>
</name>
</person-group>
<article-title>Spectrum of clinical illness in hospitalized patients with “Common Cold” virus infections</article-title>
<source>Clin Infect Dis</source>
<year>2000</year>
<volume>31</volume>
<fpage>96</fpage>
<lpage>100</lpage>
<pub-id pub-id-type="doi">10.1086/313937</pub-id>
<pub-id pub-id-type="pmid">10913403</pub-id>
</element-citation>
</ref>
<ref id="CR4"><label>4</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Falsey</surname>
<given-names>AR</given-names>
</name>
<name><surname>Walsh</surname>
<given-names>EE</given-names>
</name>
<name><surname>Hayden</surname>
<given-names>FG</given-names>
</name>
</person-group>
<article-title>Rhinovirus and coronavirus infection associated hospitalizations among older adults</article-title>
<source>J Infect Dis</source>
<year>2002</year>
<volume>185</volume>
<fpage>1338</fpage>
<lpage>1341</lpage>
<pub-id pub-id-type="doi">10.1086/339881</pub-id>
<pub-id pub-id-type="pmid">12001053</pub-id>
</element-citation>
</ref>
<ref id="CR5"><label>5</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bastien</surname>
<given-names>N</given-names>
</name>
<name><surname>Robinson</surname>
<given-names>JL</given-names>
</name>
<name><surname>Tse</surname>
<given-names>A</given-names>
</name>
<name><surname>Lee</surname>
<given-names>BE</given-names>
</name>
<name><surname>Hart</surname>
<given-names>L</given-names>
</name>
<name><surname>Li</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Human coronavirus NL-63 infections in children: A 1-year study</article-title>
<source>J Clin Microbiol</source>
<year>2005</year>
<volume>43</volume>
<fpage>4567</fpage>
<lpage>4573</lpage>
<pub-id pub-id-type="doi">10.1128/JCM.43.9.4567-4573.2005</pub-id>
<pub-id pub-id-type="pmid">16145108</pub-id>
</element-citation>
</ref>
<ref id="CR6"><label>6</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>WH</given-names>
</name>
<name><surname>Moore</surname>
<given-names>MJ</given-names>
</name>
<name><surname>Vasilieva</surname>
<given-names>N</given-names>
</name>
<name><surname>Sui</surname>
<given-names>JH</given-names>
</name>
<name><surname>Wong</surname>
<given-names>SK</given-names>
</name>
<name><surname>Berne</surname>
<given-names>MA</given-names>
</name>
<name><surname>Somasundaran</surname>
<given-names>M</given-names>
</name>
<name><surname>Sullivan</surname>
<given-names>JL</given-names>
</name>
<name><surname>Luzuriaga</surname>
<given-names>K</given-names>
</name>
<name><surname>Greenough</surname>
<given-names>TC</given-names>
</name>
<name><surname>Choe</surname>
<given-names>H</given-names>
</name>
<name><surname>Farzan</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus</article-title>
<source>Nature</source>
<year>2003</year>
<volume>426</volume>
<fpage>450</fpage>
<lpage>454</lpage>
<pub-id pub-id-type="doi">10.1038/nature02145</pub-id>
<pub-id pub-id-type="pmid">14647384</pub-id>
</element-citation>
</ref>
<ref id="CR7"><label>7</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hofmann</surname>
<given-names>H</given-names>
</name>
<name><surname>Pyrc</surname>
<given-names>K</given-names>
</name>
<name><surname>Van Der Hoek</surname>
<given-names>L</given-names>
</name>
<name><surname>Geier</surname>
<given-names>M</given-names>
</name>
<name><surname>Berkhout</surname>
<given-names>B</given-names>
</name>
<name><surname>Pohlmann</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Human coronavirus NL63 employs the severe acute respiratory syndrome coronavirus receptor for cellular entry</article-title>
<source>Proc Natl Acad Sci USA</source>
<year>2005</year>
<volume>102</volume>
<fpage>7988</fpage>
<lpage>7993</lpage>
<pub-id pub-id-type="doi">10.1073/pnas.0409465102</pub-id>
<pub-id pub-id-type="pmid">15897467</pub-id>
</element-citation>
</ref>
<ref id="CR8"><label>8</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chiu</surname>
<given-names>WK</given-names>
</name>
<name><surname>Cheung</surname>
<given-names>PC</given-names>
</name>
<name><surname>Ng</surname>
<given-names>KL</given-names>
</name>
<name><surname>Ip</surname>
<given-names>PL</given-names>
</name>
<name><surname>Sugunan</surname>
<given-names>VK</given-names>
</name>
<name><surname>Luk</surname>
<given-names>DC</given-names>
</name>
<name><surname>Ma</surname>
<given-names>LC</given-names>
</name>
<name><surname>Chan</surname>
<given-names>BH</given-names>
</name>
<name><surname>Lo</surname>
<given-names>KL</given-names>
</name>
<name><surname>Lai</surname>
<given-names>WM</given-names>
</name>
</person-group>
<article-title>Severe acute respiratory syndrome in children: Experience in a regional hospital in Hong Kong</article-title>
<source>Pediatr Crit Care Med</source>
<year>2003</year>
<volume>4</volume>
<fpage>279</fpage>
<lpage>283</lpage>
<pub-id pub-id-type="doi">10.1097/01.PCC.0000077079.42302.81</pub-id>
<pub-id pub-id-type="pmid">12831407</pub-id>
</element-citation>
</ref>
<ref id="CR9"><label>9</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lo</surname>
<given-names>AW</given-names>
</name>
<name><surname>Tang</surname>
<given-names>NL</given-names>
</name>
<name><surname>To</surname>
<given-names>KF</given-names>
</name>
</person-group>
<article-title>How the SARS coronavirus causes disease: Host or organism?</article-title>
<source>J Pathol</source>
<year>2006</year>
<volume>208</volume>
<issue>2</issue>
<fpage>142</fpage>
<lpage>151</lpage>
<pub-id pub-id-type="doi">10.1002/path.1897</pub-id>
<pub-id pub-id-type="pmid">16362992</pub-id>
</element-citation>
</ref>
<ref id="CR10"><label>10</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>L</given-names>
</name>
<name><surname>Wo</surname>
<given-names>J</given-names>
</name>
<name><surname>Shao</surname>
<given-names>J</given-names>
</name>
<name><surname>Zhu</surname>
<given-names>H</given-names>
</name>
<name><surname>Wu</surname>
<given-names>N</given-names>
</name>
<name><surname>Li</surname>
<given-names>M</given-names>
</name>
<name><surname>Yao</surname>
<given-names>H</given-names>
</name>
<name><surname>Hu</surname>
<given-names>M</given-names>
</name>
<name><surname>Dennin</surname>
<given-names>RH</given-names>
</name>
</person-group>
<article-title>SARS-coronavirus replicates in mononuclear cells of peripheral blood (PBMC) from SARS patients</article-title>
<source>J Clin Virol</source>
<year>2003</year>
<volume>28</volume>
<fpage>239</fpage>
<lpage>244</lpage>
<pub-id pub-id-type="doi">10.1016/S1386-6532(03)00195-1</pub-id>
<pub-id pub-id-type="pmid">14522061</pub-id>
</element-citation>
</ref>
<ref id="CR11"><label>11</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>TS</given-names>
</name>
<name><surname>Qiu</surname>
<given-names>ZF</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>LQ</given-names>
</name>
<name><surname>Han</surname>
<given-names>Y</given-names>
</name>
<name><surname>He</surname>
<given-names>W</given-names>
</name>
<name><surname>Liu</surname>
<given-names>ZY</given-names>
</name>
<name><surname>Ma</surname>
<given-names>XJ</given-names>
</name>
<name><surname>Fan</surname>
<given-names>HW</given-names>
</name>
<name><surname>Lu</surname>
<given-names>W</given-names>
</name>
<name><surname>Xie</surname>
<given-names>J</given-names>
</name>
<name><surname>Wang</surname>
<given-names>H</given-names>
</name>
<name><surname>Deng</surname>
<given-names>G</given-names>
</name>
<name><surname>Wang</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Significant changes of peripheral T lymphocyte subsets in patients with severe acute respiratory syndrome</article-title>
<source>J Infect Dis</source>
<year>2004</year>
<volume>189</volume>
<fpage>648</fpage>
<lpage>651</lpage>
<pub-id pub-id-type="doi">10.1086/381535</pub-id>
<pub-id pub-id-type="pmid">14767818</pub-id>
</element-citation>
</ref>
<ref id="CR12"><label>12</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McWhirter</surname>
<given-names>SM</given-names>
</name>
<name><surname>Tenoever</surname>
<given-names>BR</given-names>
</name>
<name><surname>Maniatis</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Connecting mitochondria and innate immunity</article-title>
<source>Cell</source>
<year>2005</year>
<volume>122</volume>
<issue>5</issue>
<fpage>645</fpage>
<lpage>647</lpage>
<pub-id pub-id-type="doi">10.1016/j.cell.2005.08.026</pub-id>
<pub-id pub-id-type="pmid">16143094</pub-id>
</element-citation>
</ref>
<ref id="CR13"><label>13</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seth</surname>
<given-names>RB</given-names>
</name>
<name><surname>Sun</surname>
<given-names>L</given-names>
</name>
<name><surname>Chen</surname>
<given-names>ZJ</given-names>
</name>
</person-group>
<article-title>Antiviral innate immunity pathways</article-title>
<source>Cell Res</source>
<year>2006</year>
<volume>16</volume>
<issue>2</issue>
<fpage>141</fpage>
<lpage>147</lpage>
<pub-id pub-id-type="doi">10.1038/sj.cr.7310019</pub-id>
<pub-id pub-id-type="pmid">16474426</pub-id>
</element-citation>
</ref>
<ref id="CR14"><label>14</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname>
<given-names>W</given-names>
</name>
<name><surname>Tang</surname>
<given-names>F</given-names>
</name>
<name><surname>Fontanet</surname>
<given-names>A</given-names>
</name>
<name><surname>Zhan</surname>
<given-names>L</given-names>
</name>
<name><surname>Zhao</surname>
<given-names>QM</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>PH</given-names>
</name>
<name><surname>Wu</surname>
<given-names>XM</given-names>
</name>
<name><surname>Zuo</surname>
<given-names>SQ</given-names>
</name>
<name><surname>Baril</surname>
<given-names>L</given-names>
</name>
<name><surname>Vabret</surname>
<given-names>A</given-names>
</name>
<name><surname>Xin</surname>
<given-names>ZT</given-names>
</name>
<name><surname>Shao</surname>
<given-names>YM</given-names>
</name>
<name><surname>Yang</surname>
<given-names>H</given-names>
</name>
<name><surname>Cao</surname>
<given-names>WC</given-names>
</name>
</person-group>
<article-title>Long-term SARS coronavirus excretion from patient cohort, China</article-title>
<source>Emerg Infect Dis</source>
<year>2004</year>
<volume>10</volume>
<issue>10</issue>
<fpage>1841</fpage>
<lpage>1843</lpage>
<pub-id pub-id-type="pmid">15504274</pub-id>
</element-citation>
</ref>
<ref id="CR15"><label>15</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chu</surname>
<given-names>CM</given-names>
</name>
<name><surname>Leung</surname>
<given-names>WS</given-names>
</name>
<name><surname>Cheng</surname>
<given-names>VC</given-names>
</name>
<name><surname>Chan</surname>
<given-names>KH</given-names>
</name>
<name><surname>Lin</surname>
<given-names>AW</given-names>
</name>
<name><surname>Chan</surname>
<given-names>VL</given-names>
</name>
<name><surname>Lam</surname>
<given-names>JY</given-names>
</name>
<name><surname>Chan</surname>
<given-names>KS</given-names>
</name>
<name><surname>Yuen</surname>
<given-names>KY</given-names>
</name>
</person-group>
<article-title>Duration of RT-PCR positivity in severe acute respiratory syndrome</article-title>
<source>Eur Respir J</source>
<year>2005</year>
<volume>25</volume>
<issue>1</issue>
<fpage>12</fpage>
<lpage>14</lpage>
<pub-id pub-id-type="doi">10.1183/09031936.04.00057804</pub-id>
<pub-id pub-id-type="pmid">15640317</pub-id>
</element-citation>
</ref>
<ref id="CR16"><label>16</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Clayton</surname>
<given-names>DA</given-names>
</name>
</person-group>
<article-title>Replication and transcription of vertebrate mitochondrial DNA</article-title>
<source>Annu Rev Cell Biol</source>
<year>1991</year>
<volume>7</volume>
<fpage>453</fpage>
<lpage>478</lpage>
<pub-id pub-id-type="doi">10.1146/annurev.cb.07.110191.002321</pub-id>
<pub-id pub-id-type="pmid">1809353</pub-id>
</element-citation>
</ref>
<ref id="CR17"><label>17</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ojala</surname>
<given-names>D</given-names>
</name>
<name><surname>Crews</surname>
<given-names>S</given-names>
</name>
<name><surname>Montoya</surname>
<given-names>J</given-names>
</name>
<name><surname>Gelfand</surname>
<given-names>R</given-names>
</name>
<name><surname>Attardi</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>A small polyadenylated RNA (7 S RNA), containing a putative ribosome attachment site, maps near the origin of human mitochondrial DNA replication</article-title>
<source>J Mol Biol</source>
<year>1981</year>
<volume>150</volume>
<issue>2</issue>
<fpage>303</fpage>
<lpage>314</lpage>
<pub-id pub-id-type="doi">10.1016/0022-2836(81)90454-X</pub-id>
<pub-id pub-id-type="pmid">6172590</pub-id>
</element-citation>
</ref>
<ref id="CR18"><label>18</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname>
<given-names>DY</given-names>
</name>
<name><surname>Clayton</surname>
<given-names>DA</given-names>
</name>
</person-group>
<article-title>RNase mitochondrial RNA processing correctly cleaves a novel R loop at the mitochondrial DNA leading-strand origin of replication</article-title>
<source>Genes Dev</source>
<year>1997</year>
<volume>11</volume>
<issue>5</issue>
<fpage>582</fpage>
<lpage>592</lpage>
<pub-id pub-id-type="pmid">9119223</pub-id>
</element-citation>
</ref>
<ref id="CR19"><label>19</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Donnelly</surname>
<given-names>CA</given-names>
</name>
<name><surname>Ghani</surname>
<given-names>AC</given-names>
</name>
<name><surname>Leung</surname>
<given-names>GM</given-names>
</name>
<name><surname>Hedley</surname>
<given-names>AJ</given-names>
</name>
<name><surname>Fraser</surname>
<given-names>C</given-names>
</name>
<name><surname>Riley</surname>
<given-names>S</given-names>
</name>
<name><surname>Abu-Raddad</surname>
<given-names>LJ</given-names>
</name>
<name><surname>Ho</surname>
<given-names>LM</given-names>
</name>
<name><surname>Thach</surname>
<given-names>TQ</given-names>
</name>
<name><surname>Chau</surname>
<given-names>P</given-names>
</name>
<name><surname>Chan</surname>
<given-names>KP</given-names>
</name>
<name><surname>Lam</surname>
<given-names>TH</given-names>
</name>
<name><surname>Tse</surname>
<given-names>LY</given-names>
</name>
<name><surname>Tsang</surname>
<given-names>T</given-names>
</name>
<name><surname>Liu</surname>
<given-names>SH</given-names>
</name>
<name><surname>Kong</surname>
<given-names>JH</given-names>
</name>
<name><surname>Lau</surname>
<given-names>EM</given-names>
</name>
<name><surname>Ferguson</surname>
<given-names>NM</given-names>
</name>
<name><surname>Anderson</surname>
<given-names>RM</given-names>
</name>
</person-group>
<article-title>Epidemiological determinants of spread of causal agent of severe acute respiratory syndrome in Hong Kong</article-title>
<source>Lancet</source>
<year>2003</year>
<volume>361</volume>
<issue>9371</issue>
<fpage>1761</fpage>
<lpage>1766</lpage>
<pub-id pub-id-type="pmid">12781533</pub-id>
</element-citation>
</ref>
<ref id="CR20"><label>20</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kakuda</surname>
<given-names>TN</given-names>
</name>
</person-group>
<article-title>Pharmacology of nucleoside and nucleotide reverse transcriptase inhibitor-induced mitochondrial toxicity</article-title>
<source>Clin Ther</source>
<year>2000</year>
<volume>22</volume>
<fpage>685</fpage>
<lpage>708</lpage>
<pub-id pub-id-type="doi">10.1016/S0149-2918(00)90004-3</pub-id>
<pub-id pub-id-type="pmid">10929917</pub-id>
</element-citation>
</ref>
<ref id="CR21"><label>21</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Miro</surname>
<given-names>O</given-names>
</name>
<name><surname>Lopez</surname>
<given-names>S</given-names>
</name>
<name><surname>Rodriguez de la Concepcion</surname>
<given-names>M</given-names>
</name>
<name><surname>Martinez</surname>
<given-names>E</given-names>
</name>
<name><surname>Pedrol</surname>
<given-names>E</given-names>
</name>
<name><surname>Garrabou</surname>
<given-names>G</given-names>
</name>
<name><surname>Giralt</surname>
<given-names>M</given-names>
</name>
<name><surname>Cardellach</surname>
<given-names>F</given-names>
</name>
<name><surname>Gatell</surname>
<given-names>JM</given-names>
</name>
<name><surname>Vilarroya</surname>
<given-names>F</given-names>
</name>
<name><surname>Casademont</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Upregulatory mechanisms compensate for mitochondrial DNA depletion in asymptomatic individuals receiving stavudine plus didanosine</article-title>
<source>J Acquir Immune Defic Syndr</source>
<year>2004</year>
<volume>37</volume>
<issue>5</issue>
<fpage>1550</fpage>
<lpage>1555</lpage>
<pub-id pub-id-type="pmid">15577406</pub-id>
</element-citation>
</ref>
<ref id="CR22"><label>22</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Van Itallie</surname>
<given-names>CM</given-names>
</name>
</person-group>
<article-title>Thyroid hormone and dexamethasone increase the levels of a messenger ribonucleic acid for a mitochondrially encoded subunit but not for a nuclear-encoded subunit of cytochrome c oxidase</article-title>
<source>Endocrinology</source>
<year>1990</year>
<volume>127</volume>
<issue>1</issue>
<fpage>55</fpage>
<lpage>62</lpage>
<pub-id pub-id-type="doi">10.1210/endo-127-1-55</pub-id>
<pub-id pub-id-type="pmid">1694499</pub-id>
</element-citation>
</ref>
<ref id="CR23"><label>23</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Miro</surname>
<given-names>O</given-names>
</name>
<name><surname>Lopez</surname>
<given-names>S</given-names>
</name>
<name><surname>Martinez</surname>
<given-names>E</given-names>
</name>
<name><surname>Pedrol</surname>
<given-names>E</given-names>
</name>
<name><surname>Milinkovic</surname>
<given-names>A</given-names>
</name>
<name><surname>Deig</surname>
<given-names>E</given-names>
</name>
<name><surname>Garrabou</surname>
<given-names>G</given-names>
</name>
<name><surname>Casademont</surname>
<given-names>J</given-names>
</name>
<name><surname>Gatell</surname>
<given-names>JM</given-names>
</name>
<name><surname>Cardellach</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Mitochondrial effects of HIV infection on the peripheral blood mononuclear cells of HIV-infected patients who were never treated with antiretrovirals</article-title>
<source>Clin Infect Dis</source>
<year>2004</year>
<volume>39</volume>
<issue>5</issue>
<fpage>710</fpage>
<lpage>716</lpage>
<pub-id pub-id-type="doi">10.1086/423176</pub-id>
<pub-id pub-id-type="pmid">15356787</pub-id>
</element-citation>
</ref>
<ref id="CR24"><label>24</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yuan</surname>
<given-names>X</given-names>
</name>
<name><surname>Shan</surname>
<given-names>Y</given-names>
</name>
<name><surname>Yao</surname>
<given-names>Z</given-names>
</name>
<name><surname>Li</surname>
<given-names>J</given-names>
</name>
<name><surname>Zhao</surname>
<given-names>Z</given-names>
</name>
<name><surname>Chen</surname>
<given-names>J</given-names>
</name>
<name><surname>Cong</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Mitochondrial location of severe acute respiratory syndrome coronavirus 3b protein</article-title>
<source>Mol Cells</source>
<year>2006</year>
<volume>21</volume>
<issue>2</issue>
<fpage>186</fpage>
<lpage>191</lpage>
<pub-id pub-id-type="pmid">16682811</pub-id>
</element-citation>
</ref>
<ref id="CR25"><label>25</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>Q</given-names>
</name>
<name><surname>Wang</surname>
<given-names>L</given-names>
</name>
<name><surname>Dong</surname>
<given-names>C</given-names>
</name>
<name><surname>Che</surname>
<given-names>Y</given-names>
</name>
<name><surname>Jiang</surname>
<given-names>L</given-names>
</name>
<name><surname>Liu</surname>
<given-names>L</given-names>
</name>
<name><surname>Zhao</surname>
<given-names>H</given-names>
</name>
<name><surname>Liao</surname>
<given-names>Y</given-names>
</name>
<name><surname>Sheng</surname>
<given-names>Y</given-names>
</name>
<name><surname>Dong</surname>
<given-names>S</given-names>
</name>
<name><surname>Ma</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>The interaction of the SARS coronavirus non-structural protein 10 with the cellular oxido-reductase system causes an extensive cytopathic effect</article-title>
<source>J Clin Virol</source>
<year>2005</year>
<volume>34</volume>
<issue>2</issue>
<fpage>133</fpage>
<lpage>139</lpage>
<pub-id pub-id-type="doi">10.1016/j.jcv.2004.12.019</pub-id>
<pub-id pub-id-type="pmid">16157265</pub-id>
</element-citation>
</ref>
<ref id="CR26"><label>26</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seth</surname>
<given-names>RB</given-names>
</name>
<name><surname>Sun</surname>
<given-names>L</given-names>
</name>
<name><surname>Ea</surname>
<given-names>CK</given-names>
</name>
<name><surname>Chen</surname>
<given-names>ZJ</given-names>
</name>
</person-group>
<article-title>Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF3</article-title>
<source>Cell</source>
<year>2005</year>
<volume>122</volume>
<issue>5</issue>
<fpage>669</fpage>
<lpage>682</lpage>
<pub-id pub-id-type="doi">10.1016/j.cell.2005.08.012</pub-id>
<pub-id pub-id-type="pmid">16125763</pub-id>
</element-citation>
</ref>
<ref id="CR27"><label>27</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname>
<given-names>LG</given-names>
</name>
<name><surname>Wang</surname>
<given-names>YY</given-names>
</name>
<name><surname>Han</surname>
<given-names>KJ</given-names>
</name>
<name><surname>Li</surname>
<given-names>LY</given-names>
</name>
<name><surname>Zhai</surname>
<given-names>Z</given-names>
</name>
<name><surname>Shu</surname>
<given-names>HB</given-names>
</name>
</person-group>
<article-title>VISA is an adapter protein required for virus-triggered IFN-beta signaling</article-title>
<source>Mol Cell</source>
<year>2005</year>
<volume>19</volume>
<issue>6</issue>
<fpage>727</fpage>
<lpage>740</lpage>
<pub-id pub-id-type="doi">10.1016/j.molcel.2005.08.014</pub-id>
<pub-id pub-id-type="pmid">16153868</pub-id>
</element-citation>
</ref>
<ref id="CR28"><label>28</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kawai</surname>
<given-names>T</given-names>
</name>
<name><surname>Takahashi</surname>
<given-names>K</given-names>
</name>
<name><surname>Sato</surname>
<given-names>S</given-names>
</name>
<name><surname>Coban</surname>
<given-names>C</given-names>
</name>
<name><surname>Kumar</surname>
<given-names>H</given-names>
</name>
<name><surname>Kato</surname>
<given-names>H</given-names>
</name>
<name><surname>Ishii</surname>
<given-names>KJ</given-names>
</name>
<name><surname>Takeuchi</surname>
<given-names>O</given-names>
</name>
<name><surname>Akira</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction</article-title>
<source>Nat Immunol</source>
<year>2005</year>
<volume>6</volume>
<issue>10</issue>
<fpage>981</fpage>
<lpage>988</lpage>
<pub-id pub-id-type="doi">10.1038/ni1243</pub-id>
<pub-id pub-id-type="pmid">16127453</pub-id>
</element-citation>
</ref>
<ref id="CR29"><label>29</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Meylan</surname>
<given-names>E</given-names>
</name>
<name><surname>Curran</surname>
<given-names>J</given-names>
</name>
<name><surname>Hofmann</surname>
<given-names>K</given-names>
</name>
<name><surname>Moradpour</surname>
<given-names>D</given-names>
</name>
<name><surname>Binder</surname>
<given-names>M</given-names>
</name>
<name><surname>Bartenschlager</surname>
<given-names>R</given-names>
</name>
<name><surname>Tschopp</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</article-title>
<source>Nature</source>
<year>2005</year>
<volume>437</volume>
<issue>7062</issue>
<fpage>1167</fpage>
<lpage>1172</lpage>
<pub-id pub-id-type="doi">10.1038/nature04193</pub-id>
<pub-id pub-id-type="pmid">16177806</pub-id>
</element-citation>
</ref>
<ref id="CR30"><label>30</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yedavalli</surname>
<given-names>VS</given-names>
</name>
<name><surname>Shih</surname>
<given-names>HM</given-names>
</name>
<name><surname>Chiang</surname>
<given-names>YP</given-names>
</name>
<name><surname>Lu</surname>
<given-names>CY</given-names>
</name>
<name><surname>Chang</surname>
<given-names>LY</given-names>
</name>
<name><surname>Chen</surname>
<given-names>MY</given-names>
</name>
<name><surname>Chuang</surname>
<given-names>CY</given-names>
</name>
<name><surname>Dayton</surname>
<given-names>AI</given-names>
</name>
<name><surname>Jeang</surname>
<given-names>KT</given-names>
</name>
<name><surname>Huang</surname>
<given-names>LM</given-names>
</name>
</person-group>
<article-title>Human immunodeficiency virus type 1 Vpr interacts with antiapoptotic mitochondrial protein HAX-1</article-title>
<source>J Virol</source>
<year>2005</year>
<volume>79</volume>
<issue>21</issue>
<fpage>13735</fpage>
<lpage>13746</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.79.21.13735-13746.2005</pub-id>
<pub-id pub-id-type="pmid">16227293</pub-id>
</element-citation>
</ref>
<ref id="CR31"><label>31</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Carr</surname>
<given-names>SM</given-names>
</name>
<name><surname>Carnero</surname>
<given-names>E</given-names>
</name>
<name><surname>Garcia-Sastre</surname>
<given-names>A</given-names>
</name>
<name><surname>Brownlee</surname>
<given-names>GG</given-names>
</name>
<name><surname>Fodor</surname>
<given-names>E</given-names>
</name>
</person-group>
<article-title>Characterization of a mitochondrial-targeting signal in the PB2 protein of influenza viruses</article-title>
<source>Virology</source>
<year>2006</year>
<volume>344</volume>
<issue>2</issue>
<fpage>492</fpage>
<lpage>508</lpage>
<pub-id pub-id-type="doi">10.1016/j.virol.2005.08.041</pub-id>
<pub-id pub-id-type="pmid">16242167</pub-id>
</element-citation>
</ref>
<ref id="CR32"><label>32</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Su</surname>
<given-names>J</given-names>
</name>
<name><surname>Wang</surname>
<given-names>G</given-names>
</name>
<name><surname>Barrett</surname>
<given-names>JW</given-names>
</name>
<name><surname>Irvine</surname>
<given-names>TS</given-names>
</name>
<name><surname>Gao</surname>
<given-names>X</given-names>
</name>
<name><surname>McFadden</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Myxoma virus M11L blocks apoptosis through inhibition of conformational activation of Bax at the mitochondria</article-title>
<source>J Virol</source>
<year>2006</year>
<volume>80</volume>
<issue>3</issue>
<fpage>1140</fpage>
<lpage>1151</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.80.3.1140-1151.2006</pub-id>
<pub-id pub-id-type="pmid">16414991</pub-id>
</element-citation>
</ref>
<ref id="CR33"><label>33</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hiraragi</surname>
<given-names>H</given-names>
</name>
<name><surname>Kim</surname>
<given-names>SJ</given-names>
</name>
<name><surname>Phipps</surname>
<given-names>AJ</given-names>
</name>
<name><surname>Silic-Benussi</surname>
<given-names>M</given-names>
</name>
<name><surname>Ciminale</surname>
<given-names>V</given-names>
</name>
<name><surname>Ratner</surname>
<given-names>L</given-names>
</name>
<name><surname>Green</surname>
<given-names>PL</given-names>
</name>
<name><surname>Lairmore</surname>
<given-names>MD</given-names>
</name>
</person-group>
<article-title>Human T-lymphotropic virus type 1 mitochondrion-localizing protein p13(II) is required for viral infectivity in vivo</article-title>
<source>J Virol</source>
<year>2006</year>
<volume>80</volume>
<issue>7</issue>
<fpage>3469</fpage>
<lpage>3476</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.80.7.3469-3476.2006</pub-id>
<pub-id pub-id-type="pmid">16537614</pub-id>
</element-citation>
</ref>
<ref id="CR34"><label>34</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Miranda</surname>
<given-names>S</given-names>
</name>
<name><surname>Foncea</surname>
<given-names>R</given-names>
</name>
<name><surname>Guerrero</surname>
<given-names>J</given-names>
</name>
<name><surname>Leighton</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Oxidative stress and upregulation of mitochondrial biogenesis genes in mitochondrial DNA-depleted HeLa cells</article-title>
<source>Biochem Biophys Res Commun</source>
<year>1999</year>
<volume>258</volume>
<issue>1</issue>
<fpage>44</fpage>
<lpage>49</lpage>
<pub-id pub-id-type="doi">10.1006/bbrc.1999.0580</pub-id>
<pub-id pub-id-type="pmid">10222232</pub-id>
</element-citation>
</ref>
<ref id="CR35"><label>35</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname>
<given-names>HC</given-names>
</name>
<name><surname>Yin</surname>
<given-names>PH</given-names>
</name>
<name><surname>Lu</surname>
<given-names>CY</given-names>
</name>
<name><surname>Chi</surname>
<given-names>CW</given-names>
</name>
<name><surname>Wei</surname>
<given-names>YH</given-names>
</name>
</person-group>
<article-title>Increase of mitochondria and mitochondrial DNA in response to oxidative stress in human cells</article-title>
<source>Biochem J</source>
<year>2000</year>
<volume>348</volume>
<issue>Pt 2</issue>
<fpage>425</fpage>
<lpage>432</lpage>
<pub-id pub-id-type="doi">10.1042/0264-6021:3480425</pub-id>
<pub-id pub-id-type="pmid">10816438</pub-id>
</element-citation>
</ref>
<ref id="CR36"><label>36</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Suliman</surname>
<given-names>HB</given-names>
</name>
<name><surname>Carraway</surname>
<given-names>MS</given-names>
</name>
<name><surname>Welty-Wolf</surname>
<given-names>KE</given-names>
</name>
<name><surname>Whorton</surname>
<given-names>AR</given-names>
</name>
<name><surname>Piantados</surname>
<given-names>CA</given-names>
</name>
</person-group>
<article-title>Lipopolysaccharide stimulates mitochondrial biogenesis via activation of nuclear respiratory factor-1</article-title>
<source>J Biol Chem</source>
<year>2003</year>
<volume>278</volume>
<fpage>41510</fpage>
<lpage>41518</lpage>
<pub-id pub-id-type="doi">10.1074/jbc.M304719200</pub-id>
<pub-id pub-id-type="pmid">12902348</pub-id>
</element-citation>
</ref>
<ref id="CR37"><label>37</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nicholls</surname>
<given-names>JM</given-names>
</name>
<name><surname>Poon</surname>
<given-names>LL</given-names>
</name>
<name><surname>Lee</surname>
<given-names>KC</given-names>
</name>
<name><surname>Ng</surname>
<given-names>WF</given-names>
</name>
<name><surname>Lai</surname>
<given-names>ST</given-names>
</name>
<name><surname>Leung</surname>
<given-names>CY</given-names>
</name>
<name><surname>Chu</surname>
<given-names>CM</given-names>
</name>
<name><surname>Hui</surname>
<given-names>PK</given-names>
</name>
<name><surname>Mak</surname>
<given-names>KL</given-names>
</name>
<name><surname>Lim</surname>
<given-names>W</given-names>
</name>
<name><surname>Yan</surname>
<given-names>KW</given-names>
</name>
<name><surname>Chan</surname>
<given-names>KH</given-names>
</name>
<name><surname>Tsang</surname>
<given-names>NC</given-names>
</name>
<name><surname>Guan</surname>
<given-names>Y</given-names>
</name>
<name><surname>Yuen</surname>
<given-names>KY</given-names>
</name>
<name><surname>Peiris</surname>
<given-names>JS</given-names>
</name>
</person-group>
<article-title>Lung pathology of fatal severe acute respiratory syndrome</article-title>
<source>Lancet</source>
<year>2003</year>
<volume>361</volume>
<fpage>1773</fpage>
<lpage>1778</lpage>
<pub-id pub-id-type="doi">10.1016/S0140-6736(03)13413-7</pub-id>
<pub-id pub-id-type="pmid">12781536</pub-id>
</element-citation>
</ref>
<ref id="CR38"><label>38</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname>
<given-names>Y</given-names>
</name>
<name><surname>Wang</surname>
<given-names>H</given-names>
</name>
<name><surname>Shen</surname>
<given-names>H</given-names>
</name>
<name><surname>Li</surname>
<given-names>Z</given-names>
</name>
<name><surname>Geng</surname>
<given-names>J</given-names>
</name>
<name><surname>Han</surname>
<given-names>H</given-names>
</name>
<name><surname>Cai</surname>
<given-names>J</given-names>
</name>
<name><surname>Li</surname>
<given-names>X</given-names>
</name>
<name><surname>Kang</surname>
<given-names>W</given-names>
</name>
<name><surname>Weng</surname>
<given-names>D</given-names>
</name>
<name><surname>Lu</surname>
<given-names>Y</given-names>
</name>
<name><surname>Wu</surname>
<given-names>D</given-names>
</name>
<name><surname>He</surname>
<given-names>L</given-names>
</name>
<name><surname>Yao</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>The clinical pathology of severe acute respiratory syndrome (SARS): A report from China</article-title>
<source>J Pathol</source>
<year>2003</year>
<volume>200</volume>
<fpage>282</fpage>
<lpage>289</lpage>
<pub-id pub-id-type="doi">10.1002/path.1440</pub-id>
<pub-id pub-id-type="pmid">12845623</pub-id>
</element-citation>
</ref>
<ref id="CR39"><label>39</label>
<mixed-citation publication-type="other">Quinlan G, Upton R: Oxidant–antioxidant balance in acute respiratory distress syndrome. In: European Respiratory Monograph: ARDS, T Evans, M Griffiths, B. Keogh (eds). European Respiratory Journals Ltd., 2002, pp 33–46</mixed-citation>
</ref>
<ref id="CR40"><label>40</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rabilloud</surname>
<given-names>T</given-names>
</name>
<name><surname>Heller</surname>
<given-names>M</given-names>
</name>
<name><surname>Gasnier</surname>
<given-names>F</given-names>
</name>
<name><surname>Luche</surname>
<given-names>S</given-names>
</name>
<name><surname>Rey</surname>
<given-names>C</given-names>
</name>
<name><surname>Aebersold</surname>
<given-names>R</given-names>
</name>
<name><surname>Benahmed</surname>
<given-names>M</given-names>
</name>
<name><surname>Louisot</surname>
<given-names>P</given-names>
</name>
<name><surname>Lunardi</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Proteomics analysis of cellular response to oxidative stress. Evidence for in vivo overoxidation of peroxiredoxins at their active site</article-title>
<source>J Biol Chem</source>
<year>2002</year>
<volume>277</volume>
<issue>22</issue>
<fpage>19396</fpage>
<lpage>19401</lpage>
<pub-id pub-id-type="doi">10.1074/jbc.M106585200</pub-id>
<pub-id pub-id-type="pmid">11904290</pub-id>
</element-citation>
</ref>
<ref id="CR41"><label>41</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pham</surname>
<given-names>CG</given-names>
</name>
<name><surname>Bubici</surname>
<given-names>C</given-names>
</name>
<name><surname>Zazzeroni</surname>
<given-names>F</given-names>
</name>
<name><surname>Papa</surname>
<given-names>S</given-names>
</name>
<name><surname>Jones</surname>
<given-names>J</given-names>
</name>
<name><surname>Alvarez</surname>
<given-names>K</given-names>
</name>
<name><surname>Jayawardena</surname>
<given-names>S</given-names>
</name>
<name><surname>De Smaele</surname>
<given-names>E</given-names>
</name>
<name><surname>Cong</surname>
<given-names>R</given-names>
</name>
<name><surname>Beaumont</surname>
<given-names>C</given-names>
</name>
<name><surname>Torti</surname>
<given-names>FM</given-names>
</name>
<name><surname>Torti</surname>
<given-names>SV</given-names>
</name>
<name><surname>Franzoso</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Ferritin heavy chain upregulation by NF-kappaB inhibits TNFalpha-induced apoptosis by suppressing reactive oxygen species</article-title>
<source>Cell</source>
<year>2004</year>
<volume>119</volume>
<issue>4</issue>
<fpage>529</fpage>
<lpage>542</lpage>
<pub-id pub-id-type="doi">10.1016/j.cell.2004.10.017</pub-id>
<pub-id pub-id-type="pmid">15537542</pub-id>
</element-citation>
</ref>
<ref id="CR42"><label>42</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Reghunathan</surname>
<given-names>R</given-names>
</name>
<name><surname>Jayapal</surname>
<given-names>M</given-names>
</name>
<name><surname>Hsu</surname>
<given-names>LY</given-names>
</name>
<name><surname>Chng</surname>
<given-names>HH</given-names>
</name>
<name><surname>Tai</surname>
<given-names>D</given-names>
</name>
<name><surname>Leung</surname>
<given-names>BP</given-names>
</name>
<name><surname>Melendez</surname>
<given-names>AJ</given-names>
</name>
</person-group>
<article-title>Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome</article-title>
<source>BMC Immunol</source>
<year>2005</year>
<volume>6</volume>
<fpage>2</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2172-6-2</pub-id>
<pub-id pub-id-type="pmid">15655079</pub-id>
</element-citation>
</ref>
<ref id="CR43"><label>43</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rao</surname>
<given-names>GN</given-names>
</name>
<name><surname>Berk</surname>
<given-names>BC</given-names>
</name>
</person-group>
<article-title>Active oxygen species stimulate vascular smooth muscle cell growth and proto-oncogene expression</article-title>
<source>Circ Res</source>
<year>1992</year>
<volume>70</volume>
<issue>3</issue>
<fpage>593</fpage>
<lpage>599</lpage>
<pub-id pub-id-type="pmid">1371430</pub-id>
</element-citation>
</ref>
<ref id="CR44"><label>44</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kuba</surname>
<given-names>K</given-names>
</name>
<name><surname>Imai</surname>
<given-names>Y</given-names>
</name>
<name><surname>Rao</surname>
<given-names>S</given-names>
</name>
<name><surname>Gao</surname>
<given-names>H</given-names>
</name>
<name><surname>Guo</surname>
<given-names>F</given-names>
</name>
<name><surname>Guan</surname>
<given-names>B</given-names>
</name>
<name><surname>Huan</surname>
<given-names>Y</given-names>
</name>
<name><surname>Yang</surname>
<given-names>P</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>Y</given-names>
</name>
<name><surname>Deng</surname>
<given-names>W</given-names>
</name>
<name><surname>Bao</surname>
<given-names>L</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>B</given-names>
</name>
<name><surname>Liu</surname>
<given-names>G</given-names>
</name>
<name><surname>Wang</surname>
<given-names>Z</given-names>
</name>
<name><surname>Chappell</surname>
<given-names>M</given-names>
</name>
<name><surname>Liu</surname>
<given-names>Y</given-names>
</name>
<name><surname>Zheng</surname>
<given-names>D</given-names>
</name>
<name><surname>Leibbrandt</surname>
<given-names>A</given-names>
</name>
<name><surname>Wada</surname>
<given-names>T</given-names>
</name>
<name><surname>Slutsky</surname>
<given-names>AS</given-names>
</name>
<name><surname>Liu</surname>
<given-names>D</given-names>
</name>
<name><surname>Qin</surname>
<given-names>C</given-names>
</name>
<name><surname>Jiang</surname>
<given-names>C</given-names>
</name>
<name><surname>Penninger</surname>
<given-names>JM</given-names>
</name>
</person-group>
<article-title>A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus-induced lung injury</article-title>
<source>Nat Med</source>
<year>2005</year>
<volume>11</volume>
<fpage>875</fpage>
<lpage>879</lpage>
<pub-id pub-id-type="doi">10.1038/nm1267</pub-id>
<pub-id pub-id-type="pmid">16007097</pub-id>
</element-citation>
</ref>
<ref id="CR45"><label>45</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname>
<given-names>S</given-names>
</name>
<name><surname>Gao</surname>
<given-names>J</given-names>
</name>
<name><surname>Ohlemeyer</surname>
<given-names>C</given-names>
</name>
<name><surname>Roos</surname>
<given-names>D</given-names>
</name>
<name><surname>Niessen</surname>
<given-names>H</given-names>
</name>
<name><surname>Kottgen</surname>
<given-names>E</given-names>
</name>
<name><surname>Gessner</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>Activation of AP-1 through reactive oxygen species by angiotensin II in rat cardiomyocytes</article-title>
<source>Free Radic Biol Med</source>
<year>2005</year>
<volume>39</volume>
<issue>12</issue>
<fpage>1601</fpage>
<lpage>1610</lpage>
<pub-id pub-id-type="doi">10.1016/j.freeradbiomed.2005.08.006</pub-id>
<pub-id pub-id-type="pmid">16298685</pub-id>
</element-citation>
</ref>
<ref id="CR46"><label>46</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>He</surname>
<given-names>R</given-names>
</name>
<name><surname>Leeson</surname>
<given-names>A</given-names>
</name>
<name><surname>Andonov</surname>
<given-names>A</given-names>
</name>
<name><surname>Li</surname>
<given-names>Y</given-names>
</name>
<name><surname>Bastien</surname>
<given-names>N</given-names>
</name>
<name><surname>Cao</surname>
<given-names>J</given-names>
</name>
<name><surname>Osiowy</surname>
<given-names>C</given-names>
</name>
<name><surname>Dobie</surname>
<given-names>F</given-names>
</name>
<name><surname>Cutts</surname>
<given-names>T</given-names>
</name>
<name><surname>Ballantine</surname>
<given-names>M</given-names>
</name>
<name><surname>Li</surname>
<given-names>X</given-names>
</name>
</person-group>
<article-title>Activation of AP-1 signal transduction pathway by SARS coronavirus nucleocapsid protein</article-title>
<source>Biochem Biophys Res Commun</source>
<year>2003</year>
<volume>311</volume>
<fpage>870</fpage>
<lpage>876</lpage>
<pub-id pub-id-type="doi">10.1016/j.bbrc.2003.10.075</pub-id>
<pub-id pub-id-type="pmid">14623261</pub-id>
</element-citation>
</ref>
<ref id="CR47"><label>47</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Forrest</surname>
<given-names>MS</given-names>
</name>
<name><surname>Lan</surname>
<given-names>Q</given-names>
</name>
<name><surname>Hubbard</surname>
<given-names>AE</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>L</given-names>
</name>
<name><surname>Vermeulen</surname>
<given-names>R</given-names>
</name>
<name><surname>Zhao</surname>
<given-names>X</given-names>
</name>
<name><surname>Li</surname>
<given-names>G</given-names>
</name>
<name><surname>Wu</surname>
<given-names>YY</given-names>
</name>
<name><surname>Shen</surname>
<given-names>M</given-names>
</name>
<name><surname>Yin</surname>
<given-names>S</given-names>
</name>
<name><surname>Chanock</surname>
<given-names>SJ</given-names>
</name>
<name><surname>Rothman</surname>
<given-names>N</given-names>
</name>
<name><surname>Smith</surname>
<given-names>MT</given-names>
</name>
</person-group>
<article-title>Discovery of novel biomarkers by microarray analysis of peripheral blood mononuclear cell gene expression in benzene-exposed workers</article-title>
<source>Environ Health Perspect</source>
<year>2005</year>
<volume>113</volume>
<issue>6</issue>
<fpage>801</fpage>
<lpage>807</lpage>
<pub-id pub-id-type="doi">10.1289/ehp.7635</pub-id>
<pub-id pub-id-type="pmid">15929907</pub-id>
</element-citation>
</ref>
<ref id="CR48"><label>48</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sheets</surname>
<given-names>P</given-names>
</name>
<name><surname>Carlson</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Kinetic factors involved in the metabolism of benzene in mouse lung and liver</article-title>
<source>J Toxicol Environ Health A</source>
<year>2004</year>
<volume>67</volume>
<issue>5</issue>
<fpage>421</fpage>
<lpage>430</lpage>
<pub-id pub-id-type="pmid">14718178</pub-id>
</element-citation>
</ref>
<ref id="CR49"><label>49</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rana</surname>
<given-names>SV</given-names>
</name>
<name><surname>Verma</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Biochemical toxicity of benzene</article-title>
<source>J Environ Biol</source>
<year>2005</year>
<volume>26</volume>
<issue>2</issue>
<fpage>157</fpage>
<lpage>168</lpage>
<pub-id pub-id-type="pmid">16161967</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Sante/explor/SrasV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000413 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000413 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Sante |area= SrasV1 |flux= Pmc |étape= Corpus |type= RBID |clé= |texte= }}
![]() | This area was generated with Dilib version V0.6.33. | ![]() |