Serveur d'exploration sur les pandémies grippales

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Influenza A H1N1pdm 2009 Virus in Paraguay: Nucleotide Point Mutations in Hemagglutinin and Neuraminidase Genes are not Associated with Drug Resistance

Identifieur interne : 000B74 ( Pmc/Curation ); précédent : 000B73; suivant : 000B75

Influenza A H1N1pdm 2009 Virus in Paraguay: Nucleotide Point Mutations in Hemagglutinin and Neuraminidase Genes are not Associated with Drug Resistance

Auteurs : Emilio E. Espínola [Paraguay] ; Alberto A. Amarilla [Paraguay, Brésil] ; Magaly Martínez [Paraguay] ; Víctor H. Aquino [Brésil] ; Graciela Russomando [Paraguay]

Source :

RBID : PMC:4200701

Abstract

Influenza virus is associated with upper respiratory tract infections. The fourth influenza pandemic was declared in 2009. The aim of this study was to determine the genetic variability of the 2009 H1N1 pandemic virus circulating in Paraguay. Nasal swabs were collected from 181 patients with flu symptoms managed at the Hospital of the Medical School in Asunción, Paraguay, between August and October 2009. Virus detection was carried out by real-time reverse transcription-polymerase chain reaction, followed by sequencing of the hemagglutinin and neuraminidase genes, and phylogenetic analysis. H1N1pdm09 was detected in 14.9% (27/181) of the suspected cases. Analysis of 13 samples showed that these viruses the clustered in a single genetic group. Neither the mutation related to exacerbation of disease (D239G in hemagglutinin) nor that related to antiviral resistance (H275Y in neuraminidase), both detected in neighboring countries, were found. This genetic analysis of H1N1pdm09 will help to understand the spread of the disease.


Url:
DOI: 10.2174/1874357901408010009
PubMed: 25328558
PubMed Central: 4200701

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:4200701

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Influenza A H1N1pdm 2009 Virus in Paraguay: Nucleotide Point Mutations in Hemagglutinin and Neuraminidase Genes are not Associated with Drug Resistance</title>
<author>
<name sortKey="Espinola, Emilio E" sort="Espinola, Emilio E" uniqKey="Espinola E" first="Emilio E" last="Espínola">Emilio E. Espínola</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
<country xml:lang="fr">Paraguay</country>
<wicri:regionArea>Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Amarilla, Alberto A" sort="Amarilla, Alberto A" uniqKey="Amarilla A" first="Alberto A" last="Amarilla">Alberto A. Amarilla</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
<country xml:lang="fr">Paraguay</country>
<wicri:regionArea>Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="aff2">Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</nlm:aff>
<country xml:lang="fr">Brésil</country>
<wicri:regionArea>Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Martinez, Magaly" sort="Martinez, Magaly" uniqKey="Martinez M" first="Magaly" last="Martínez">Magaly Martínez</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
<country xml:lang="fr">Paraguay</country>
<wicri:regionArea>Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Aquino, Victor H" sort="Aquino, Victor H" uniqKey="Aquino V" first="Víctor H" last="Aquino">Víctor H. Aquino</name>
<affiliation wicri:level="1">
<nlm:aff id="aff2">Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</nlm:aff>
<country xml:lang="fr">Brésil</country>
<wicri:regionArea>Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Russomando, Graciela" sort="Russomando, Graciela" uniqKey="Russomando G" first="Graciela" last="Russomando">Graciela Russomando</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
<country xml:lang="fr">Paraguay</country>
<wicri:regionArea>Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción</wicri:regionArea>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">25328558</idno>
<idno type="pmc">4200701</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4200701</idno>
<idno type="RBID">PMC:4200701</idno>
<idno type="doi">10.2174/1874357901408010009</idno>
<date when="2014">2014</date>
<idno type="wicri:Area/Pmc/Corpus">000B74</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000B74</idno>
<idno type="wicri:Area/Pmc/Curation">000B74</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000B74</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Influenza A H1N1pdm 2009 Virus in Paraguay: Nucleotide Point Mutations in Hemagglutinin and Neuraminidase Genes are not Associated with Drug Resistance</title>
<author>
<name sortKey="Espinola, Emilio E" sort="Espinola, Emilio E" uniqKey="Espinola E" first="Emilio E" last="Espínola">Emilio E. Espínola</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
<country xml:lang="fr">Paraguay</country>
<wicri:regionArea>Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Amarilla, Alberto A" sort="Amarilla, Alberto A" uniqKey="Amarilla A" first="Alberto A" last="Amarilla">Alberto A. Amarilla</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
<country xml:lang="fr">Paraguay</country>
<wicri:regionArea>Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="aff2">Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</nlm:aff>
<country xml:lang="fr">Brésil</country>
<wicri:regionArea>Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Martinez, Magaly" sort="Martinez, Magaly" uniqKey="Martinez M" first="Magaly" last="Martínez">Magaly Martínez</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
<country xml:lang="fr">Paraguay</country>
<wicri:regionArea>Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Aquino, Victor H" sort="Aquino, Victor H" uniqKey="Aquino V" first="Víctor H" last="Aquino">Víctor H. Aquino</name>
<affiliation wicri:level="1">
<nlm:aff id="aff2">Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</nlm:aff>
<country xml:lang="fr">Brésil</country>
<wicri:regionArea>Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Russomando, Graciela" sort="Russomando, Graciela" uniqKey="Russomando G" first="Graciela" last="Russomando">Graciela Russomando</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
<country xml:lang="fr">Paraguay</country>
<wicri:regionArea>Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción</wicri:regionArea>
</affiliation>
</author>
</analytic>
<series>
<title level="j">The Open Virology Journal</title>
<idno type="eISSN">1874-3579</idno>
<imprint>
<date when="2014">2014</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Influenza virus is associated with upper respiratory tract infections. The fourth influenza pandemic was declared in 2009. The aim of this study was to determine the genetic variability of the 2009 H1N1 pandemic virus circulating in Paraguay. Nasal swabs were collected from 181 patients with flu symptoms managed at the Hospital of the Medical School in Asunción, Paraguay, between August and October 2009. Virus detection was carried out by real-time reverse transcription-polymerase chain reaction, followed by sequencing of the hemagglutinin and neuraminidase genes, and phylogenetic analysis. H1N1pdm09 was detected in 14.9% (27/181) of the suspected cases. Analysis of 13 samples showed that these viruses the clustered in a single genetic group. Neither the mutation related to exacerbation of disease (D239G in hemagglutinin) nor that related to antiviral resistance (H275Y in neuraminidase), both detected in neighboring countries, were found. This genetic analysis of H1N1pdm09 will help to understand the spread of the disease.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Knipe, Dm" uniqKey="Knipe D">DM Knipe</name>
</author>
<author>
<name sortKey=" Howley, Pm" uniqKey=" Howley P">PM Howley</name>
</author>
<author>
<name sortKey=" Griffin, De" uniqKey=" Griffin D">DE Griffin</name>
</author>
<author>
<name sortKey="Lamb, Ra" uniqKey="Lamb R">RA Lamb</name>
</author>
<author>
<name sortKey=" Krug, Rm" uniqKey=" Krug R">RM Krug</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tong, S" uniqKey="Tong S">S Tong</name>
</author>
<author>
<name sortKey="Zhu, X" uniqKey="Zhu X">X Zhu</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Qu, Y" uniqKey="Qu Y">Y Qu</name>
</author>
<author>
<name sortKey="Zhang, R" uniqKey="Zhang R">R Zhang</name>
</author>
<author>
<name sortKey="Cui, P" uniqKey="Cui P">P Cui</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Babakir Mina, M" uniqKey="Babakir Mina M">M Babakir-Mina</name>
</author>
<author>
<name sortKey="Dimonte, S" uniqKey="Dimonte S">S Dimonte</name>
</author>
<author>
<name sortKey="Perno, Cf" uniqKey="Perno C">CF Perno</name>
</author>
<author>
<name sortKey=" Ciotti, M" uniqKey=" Ciotti M">M Ciotti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Garten, Rj" uniqKey="Garten R">RJ Garten</name>
</author>
<author>
<name sortKey=" Davis, Ct" uniqKey=" Davis C">CT Davis</name>
</author>
<author>
<name sortKey=" Russell, Ca" uniqKey=" Russell C">CA Russell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Barrero, Pr" uniqKey="Barrero P">PR Barrero</name>
</author>
<author>
<name sortKey=" Viegas, M" uniqKey=" Viegas M">M Viegas</name>
</author>
<author>
<name sortKey="Valinotto, Le" uniqKey="Valinotto L">LE Valinotto</name>
</author>
<author>
<name sortKey=" Mistchenko, As" uniqKey=" Mistchenko A">AS Mistchenko</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Souza, Tm" uniqKey="Souza T">TM Souza</name>
</author>
<author>
<name sortKey=" Resende, Pc" uniqKey=" Resende P">PC Resende</name>
</author>
<author>
<name sortKey=" Fintelman Rodrigues, N" uniqKey=" Fintelman Rodrigues N">N Fintelman-Rodrigues</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cabello, A" uniqKey="Cabello A">A Cabello</name>
</author>
<author>
<name sortKey="Von Horoch, M" uniqKey="Von Horoch M">M von Horoch</name>
</author>
<author>
<name sortKey="Ojeda, A" uniqKey="Ojeda A">A Ojeda</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hall, Ta" uniqKey="Hall T">TA Hall</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Thompson, Jd" uniqKey="Thompson J">JD Thompson</name>
</author>
<author>
<name sortKey=" Higgins, Dg" uniqKey=" Higgins D">DG Higgins</name>
</author>
<author>
<name sortKey=" Gibson, Tj" uniqKey=" Gibson T">TJ Gibson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Espinola, Ee" uniqKey="Espinola E">EE Espinola</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tamura, K" uniqKey="Tamura K">K Tamura</name>
</author>
<author>
<name sortKey="Peterson, D" uniqKey="Peterson D">D Peterson</name>
</author>
<author>
<name sortKey="Peterson, N" uniqKey="Peterson N">N Peterson</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ekiert, Dc" uniqKey="Ekiert D">DC Ekiert</name>
</author>
<author>
<name sortKey=" Bhabha, G" uniqKey=" Bhabha G">G Bhabha</name>
</author>
<author>
<name sortKey="Elsliger, Ma" uniqKey="Elsliger M">MA Elsliger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kilander, A" uniqKey="Kilander A">A Kilander</name>
</author>
<author>
<name sortKey="Rykkvin, R" uniqKey="Rykkvin R">R Rykkvin</name>
</author>
<author>
<name sortKey="Dudman, S" uniqKey="Dudman S">S Dudman</name>
</author>
<author>
<name sortKey="Hungnes, O" uniqKey="Hungnes O">O Hungnes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y Liu</name>
</author>
<author>
<name sortKey="Childs, Ra" uniqKey="Childs R">RA Childs</name>
</author>
<author>
<name sortKey=" Matrosovich, T" uniqKey=" Matrosovich T">T Matrosovich</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ikonen, N" uniqKey="Ikonen N">N Ikonen</name>
</author>
<author>
<name sortKey="Haanpaa, M" uniqKey="Haanpaa M">M Haanpaa</name>
</author>
<author>
<name sortKey="Ronkko, E" uniqKey="Ronkko E">E Ronkko</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pan, C" uniqKey="Pan C">C Pan</name>
</author>
<author>
<name sortKey="Cheung, B" uniqKey="Cheung B">B Cheung</name>
</author>
<author>
<name sortKey="Tan, S" uniqKey="Tan S">S Tan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Deyde, Vm" uniqKey="Deyde V">VM Deyde</name>
</author>
<author>
<name sortKey=" Nguyen, T" uniqKey=" Nguyen T">T Nguyen</name>
</author>
<author>
<name sortKey="Bright, Ra" uniqKey="Bright R">RA Bright</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Der Vries, E" uniqKey="Van Der Vries E">E van der Vries</name>
</author>
<author>
<name sortKey="Stelma, Ff" uniqKey="Stelma F">FF Stelma</name>
</author>
<author>
<name sortKey=" Boucher, Ca" uniqKey=" Boucher C">CA Boucher</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Harvala, H" uniqKey="Harvala H">H Harvala</name>
</author>
<author>
<name sortKey="Gunson, R" uniqKey="Gunson R">R Gunson</name>
</author>
<author>
<name sortKey="Simmonds, P" uniqKey="Simmonds P">P Simmonds</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Open Virol J</journal-id>
<journal-id journal-id-type="iso-abbrev">Open Virol J</journal-id>
<journal-id journal-id-type="publisher-id">TOVJ</journal-id>
<journal-title-group>
<journal-title>The Open Virology Journal</journal-title>
</journal-title-group>
<issn pub-type="epub">1874-3579</issn>
<publisher>
<publisher-name>Bentham Open</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">25328558</article-id>
<article-id pub-id-type="pmc">4200701</article-id>
<article-id pub-id-type="publisher-id">TOVJ-8-9</article-id>
<article-id pub-id-type="doi">10.2174/1874357901408010009</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Influenza A H1N1pdm 2009 Virus in Paraguay: Nucleotide Point Mutations in Hemagglutinin and Neuraminidase Genes are not Associated with Drug Resistance</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Espínola</surname>
<given-names>Emilio E</given-names>
</name>
<xref ref-type="corresp" rid="cor1">*</xref>
<xref ref-type="aff" rid="aff1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Amarilla</surname>
<given-names>Alberto A</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
<xref ref-type="aff" rid="aff2">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Martínez</surname>
<given-names>Magaly</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Aquino</surname>
<given-names>Víctor H</given-names>
</name>
<xref ref-type="aff" rid="aff2">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Russomando</surname>
<given-names>Graciela</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</aff>
<aff id="aff2">
<label>2</label>
Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</aff>
<author-notes>
<corresp id="cor1">
<label>*</label>
Address correspondence to this author at the Rio de la Plata y Lagerenza, CP1120, Asunción, Paraguay; Tel: +595 21 424 520; Fax: +595 21 480 185; E-mail:
<email xlink:href="emilioespinola@hotmail.com">emilioespinola@hotmail.com</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>29 </day>
<month>9</month>
<year>2014</year>
</pub-date>
<pub-date pub-type="collection">
<year>2014</year>
</pub-date>
<volume>8</volume>
<fpage>9</fpage>
<lpage>13</lpage>
<history>
<date date-type="received">
<day>13</day>
<month>6</month>
<year>2014</year>
</date>
<date date-type="rev-recd">
<day>15</day>
<month>7</month>
<year>2014</year>
</date>
<date date-type="accepted">
<day>18</day>
<month>7</month>
<year>2014</year>
</date>
</history>
<permissions>
<copyright-statement>© Bobardt
<italic>et al.</italic>
; Licensee
<italic>Bentham Open.</italic>
</copyright-statement>
<copyright-year>2014</copyright-year>
<copyright-holder>Bobardt</copyright-holder>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">
<license-p>This is an open access article licensed under the terms of the Creative Commons Attribution Non-Commercial License (
<uri xlink:type="simple" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">http://creativecommons.org/licenses/by-nc/3.0/</uri>
) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.</license-p>
</license>
</permissions>
<abstract>
<p>Influenza virus is associated with upper respiratory tract infections. The fourth influenza pandemic was declared in 2009. The aim of this study was to determine the genetic variability of the 2009 H1N1 pandemic virus circulating in Paraguay. Nasal swabs were collected from 181 patients with flu symptoms managed at the Hospital of the Medical School in Asunción, Paraguay, between August and October 2009. Virus detection was carried out by real-time reverse transcription-polymerase chain reaction, followed by sequencing of the hemagglutinin and neuraminidase genes, and phylogenetic analysis. H1N1pdm09 was detected in 14.9% (27/181) of the suspected cases. Analysis of 13 samples showed that these viruses the clustered in a single genetic group. Neither the mutation related to exacerbation of disease (D239G in hemagglutinin) nor that related to antiviral resistance (H275Y in neuraminidase), both detected in neighboring countries, were found. This genetic analysis of H1N1pdm09 will help to understand the spread of the disease.</p>
</abstract>
<kwd-group>
<title>Keywords</title>
<kwd>Hemagglutinin</kwd>
<kwd>pandemic influenza H1N1 2009</kwd>
<kwd>neuraminidase</kwd>
<kwd>respiratory disease</kwd>
<kwd>swine flu.</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="F1" position="float">
<label>Fig. (1)</label>
<caption>
<p>Phylogenetic trees corresponding to complete coding nucleotide sequences for the (
<bold>A</bold>
) HA and (
<bold>B</bold>
) NA genes, respectively, each comparing all known subtypes, four worldwide H1N1pdm09 strains (randomly selected), 13 Paraguayan isolates, and the vaccine strain A/California/07/2009. Each sequence is indicated with its GenBank accession number, host of origin (omitted for human strains), geographical origin, name of isolate, and year of isolation. Bootstrap values greater than 70%are shown at branch nodes. Paraguayan isolates are shown with a filled circle. Branch distances are indicated by a scale bar (0.02 nt substitution per site) at the bottom of each tree. </p>
</caption>
<graphic xlink:href="TOVJ-8-9_F1"></graphic>
</fig>
<table-wrap id="T1" position="float">
<label>Table 1.</label>
<caption>
<p>Primers used for complete amplification of the HA and NA coding sequences.</p>
</caption>
<table frame="border" rules="all" width="100%">
<thead>
<tr>
<th align="center" rowspan="1" colspan="1">
<bold>Primer</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Gene</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Position*</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Sense</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Sequence (5' → 3')</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" rowspan="1" colspan="1">ha 635</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">-40 to -22</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">ATACGACTAGCAAAAGCAGGGG </td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 635'</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">574 to 595</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">GATGGTGAATGCCCCATAGCAC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 864</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">514 to 532</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">GGAAATTCATACCCAAAGC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 864'</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">1,356 to 1,377</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">CACATTTGAATCGTGGTAGTCC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 813</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">938 to 962</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">ATCCGATCACAATTGGAAAATGTCC </td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 813'</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">1,727 to 1,750</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">GTGTCAGTAGAAACAAGGGTGTTT</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 584</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">-20 to -6</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">AGCAAAAGCAGGAGT </td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 584'</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">545 to 564</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">GATGCCATCATGACAAGCAC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 681</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">466 to 485</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">CGAACCCTAATGAGCTGTCC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 681'</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">1,126 to 1,146</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">CCCAGTCCATCCGTTCGGATC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 473</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">966 to 988</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">CGGAGACAATCCACGCCCTAATG</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 473'</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">1,424 to 1,438</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">AGTAGAAACAAGGAG</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="T1F1">
<label>*</label>
<p>Nucleotide positions are based on the H1N1pdm 09 vaccine strain A/California/07/2009.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="T2" position="float">
<label>Table 2.</label>
<caption>
<p>Expected and observed amino acid mutations for the HA and NA genes found in this study. </p>
</caption>
<table frame="border" rules="all" width="100%">
<thead>
<tr>
<th align="center" rowspan="1" colspan="1">
<bold>Mutation*</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Gene</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Percentage (Expected)**</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Percentage (Observed)</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" rowspan="1" colspan="1">S101N</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">0.2%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">S220T</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">76.7%</td>
<td align="center" rowspan="1" colspan="1">100%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">D239E</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">5.5%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">D239G</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">2.6%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">N387H</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">1.7%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">E391K</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">15.6%</td>
<td align="center" rowspan="1" colspan="1">30.8%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">V106I</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">85.1%</td>
<td align="center" rowspan="1" colspan="1">100%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">D199N</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">0.3%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">I223R</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">0.2%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">N248D</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">85.9%</td>
<td align="center" rowspan="1" colspan="1">100%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">H275Y</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">2.0%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="T2F1">
<label>*</label>
<p>Amino acid positions are based on the H1N1pdm 09 vaccine strain A/California/07/2009.</p>
</fn>
<fn id="T2F2">
<label>**</label>
<p>Expected percentage of mutations for the HA and NA genes, based on published worldwide data [14].</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/PandemieGrippaleV1/Data/Pmc/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000B74 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd -nk 000B74 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    PandemieGrippaleV1
   |flux=    Pmc
   |étape=   Curation
   |type=    RBID
   |clé=     PMC:4200701
   |texte=   Influenza A H1N1pdm 2009 Virus in Paraguay: Nucleotide Point Mutations in Hemagglutinin and Neuraminidase Genes are not Associated with Drug Resistance
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Curation/RBID.i   -Sk "pubmed:25328558" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd   \
       | NlmPubMed2Wicri -a PandemieGrippaleV1 

Wicri

This area was generated with Dilib version V0.6.34.
Data generation: Wed Jun 10 11:04:28 2020. Site generation: Sun Mar 28 09:10:28 2021