Corpus
Pmc
Racine
Corpus
Checkpoint
Pmc
Racine
Pmc
Exploration
Accueil
Racine
Racine

Serveur d'exploration sur la paléopathologie

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Detection and Molecular Characterization of 9000-Year-Old Mycobacterium tuberculosis from a Neolithic Settlement in the Eastern Mediterranean

Identifieur interne : 000272 ( Pmc/Corpus ); précédent : 000271; suivant : 000273

Detection and Molecular Characterization of 9000-Year-Old Mycobacterium tuberculosis from a Neolithic Settlement in the Eastern Mediterranean

Auteurs : Israel Hershkovitz ; Helen D. Donoghue ; David E. Minnikin ; Gurdyal S. Besra ; Oona Y-C. Lee ; Angela M. Gernaey ; Ehud Galili ; Vered Eshed ; Charles L. Greenblatt ; Eshetu Lemma ; Gila Kahila Bar-Gal ; Mark Spigelman

Source :

RBID : PMC:2565837

Abstract

Background

Mycobacterium tuberculosis is the principal etiologic agent of human tuberculosis. It has no environmental reservoir and is believed to have co-evolved with its host over millennia. This is supported by skeletal evidence of the disease in early humans, and inferred from M. tuberculosis genomic analysis. Direct examination of ancient human remains for M. tuberculosis biomarkers should aid our understanding of the nature of prehistoric tuberculosis and the host/pathogen relationship.

Methodology/Principal Findings

We used conventional PCR to examine bone samples with typical tuberculosis lesions from a woman and infant, who were buried together in the now submerged site of Atlit-Yam in the Eastern Mediterranean, dating from 9250-8160 years ago. Rigorous precautions were taken to prevent contamination, and independent centers were used to confirm authenticity of findings. DNA from five M tuberculosis genetic loci was detected and had characteristics consistent with extant genetic lineages. High performance liquid chromatography was used as an independent method of verification and it directly detected mycolic acid lipid biomarkers, specific for the M. tuberculosis complex.

Conclusions/Significance

Human tuberculosis was confirmed by morphological and molecular methods in a population living in one of the first villages with evidence of agriculture and animal domestication. The widespread use of animals was not a source of infection but may have supported a denser human population that facilitated transmission of the tubercle bacillus. The similarity of the M. tuberculosis genetic signature with those of today gives support to the theory of a long-term co-existence of host and pathogen.


Url:
DOI: 10.1371/journal.pone.0003426
PubMed: 18923677
PubMed Central: 2565837

Links to Exploration step

PMC:2565837

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Detection and Molecular Characterization of 9000-Year-Old
<italic>Mycobacterium tuberculosis</italic>
from a Neolithic Settlement in the Eastern Mediterranean</title>
<author>
<name sortKey="Hershkovitz, Israel" sort="Hershkovitz, Israel" uniqKey="Hershkovitz I" first="Israel" last="Hershkovitz">Israel Hershkovitz</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>Department of Anatomy and Anthropology, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Donoghue, Helen D" sort="Donoghue, Helen D" uniqKey="Donoghue H" first="Helen D." last="Donoghue">Helen D. Donoghue</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Centre for Infectious Diseases and International Health, University College London, London, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Minnikin, David E" sort="Minnikin, David E" uniqKey="Minnikin D" first="David E." last="Minnikin">David E. Minnikin</name>
<affiliation>
<nlm:aff id="aff3">
<addr-line>School of Biosciences, University of Birmingham, Edgbaston, Birmingham, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Besra, Gurdyal S" sort="Besra, Gurdyal S" uniqKey="Besra G" first="Gurdyal S." last="Besra">Gurdyal S. Besra</name>
<affiliation>
<nlm:aff id="aff3">
<addr-line>School of Biosciences, University of Birmingham, Edgbaston, Birmingham, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lee, Oona Y C" sort="Lee, Oona Y C" uniqKey="Lee O" first="Oona Y-C." last="Lee">Oona Y-C. Lee</name>
<affiliation>
<nlm:aff id="aff3">
<addr-line>School of Biosciences, University of Birmingham, Edgbaston, Birmingham, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Gernaey, Angela M" sort="Gernaey, Angela M" uniqKey="Gernaey A" first="Angela M." last="Gernaey">Angela M. Gernaey</name>
<affiliation>
<nlm:aff id="aff4">
<addr-line>Biosciences Research Institute, University of Salford, Salford, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Galili, Ehud" sort="Galili, Ehud" uniqKey="Galili E" first="Ehud" last="Galili">Ehud Galili</name>
<affiliation>
<nlm:aff id="aff5">
<addr-line>Marine Archaeology Branch, Israel Antiquities Authority, Jerusalem, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Eshed, Vered" sort="Eshed, Vered" uniqKey="Eshed V" first="Vered" last="Eshed">Vered Eshed</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>Department of Anatomy and Anthropology, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Greenblatt, Charles L" sort="Greenblatt, Charles L" uniqKey="Greenblatt C" first="Charles L." last="Greenblatt">Charles L. Greenblatt</name>
<affiliation>
<nlm:aff id="aff6">
<addr-line>Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University-Hadassah Medical School, Jerusalem, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lemma, Eshetu" sort="Lemma, Eshetu" uniqKey="Lemma E" first="Eshetu" last="Lemma">Eshetu Lemma</name>
<affiliation>
<nlm:aff id="aff6">
<addr-line>Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University-Hadassah Medical School, Jerusalem, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bar Gal, Gila Kahila" sort="Bar Gal, Gila Kahila" uniqKey="Bar Gal G" first="Gila Kahila" last="Bar-Gal">Gila Kahila Bar-Gal</name>
<affiliation>
<nlm:aff id="aff7">
<addr-line>Koret School of Veterinary Medicine, Hebrew University of Jerusalem, Rehovot, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Spigelman, Mark" sort="Spigelman, Mark" uniqKey="Spigelman M" first="Mark" last="Spigelman">Mark Spigelman</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Centre for Infectious Diseases and International Health, University College London, London, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff6">
<addr-line>Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University-Hadassah Medical School, Jerusalem, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">18923677</idno>
<idno type="pmc">2565837</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2565837</idno>
<idno type="RBID">PMC:2565837</idno>
<idno type="doi">10.1371/journal.pone.0003426</idno>
<date when="2008">2008</date>
<idno type="wicri:Area/Pmc/Corpus">000272</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000272</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Detection and Molecular Characterization of 9000-Year-Old
<italic>Mycobacterium tuberculosis</italic>
from a Neolithic Settlement in the Eastern Mediterranean</title>
<author>
<name sortKey="Hershkovitz, Israel" sort="Hershkovitz, Israel" uniqKey="Hershkovitz I" first="Israel" last="Hershkovitz">Israel Hershkovitz</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>Department of Anatomy and Anthropology, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Donoghue, Helen D" sort="Donoghue, Helen D" uniqKey="Donoghue H" first="Helen D." last="Donoghue">Helen D. Donoghue</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Centre for Infectious Diseases and International Health, University College London, London, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Minnikin, David E" sort="Minnikin, David E" uniqKey="Minnikin D" first="David E." last="Minnikin">David E. Minnikin</name>
<affiliation>
<nlm:aff id="aff3">
<addr-line>School of Biosciences, University of Birmingham, Edgbaston, Birmingham, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Besra, Gurdyal S" sort="Besra, Gurdyal S" uniqKey="Besra G" first="Gurdyal S." last="Besra">Gurdyal S. Besra</name>
<affiliation>
<nlm:aff id="aff3">
<addr-line>School of Biosciences, University of Birmingham, Edgbaston, Birmingham, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lee, Oona Y C" sort="Lee, Oona Y C" uniqKey="Lee O" first="Oona Y-C." last="Lee">Oona Y-C. Lee</name>
<affiliation>
<nlm:aff id="aff3">
<addr-line>School of Biosciences, University of Birmingham, Edgbaston, Birmingham, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Gernaey, Angela M" sort="Gernaey, Angela M" uniqKey="Gernaey A" first="Angela M." last="Gernaey">Angela M. Gernaey</name>
<affiliation>
<nlm:aff id="aff4">
<addr-line>Biosciences Research Institute, University of Salford, Salford, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Galili, Ehud" sort="Galili, Ehud" uniqKey="Galili E" first="Ehud" last="Galili">Ehud Galili</name>
<affiliation>
<nlm:aff id="aff5">
<addr-line>Marine Archaeology Branch, Israel Antiquities Authority, Jerusalem, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Eshed, Vered" sort="Eshed, Vered" uniqKey="Eshed V" first="Vered" last="Eshed">Vered Eshed</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>Department of Anatomy and Anthropology, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Greenblatt, Charles L" sort="Greenblatt, Charles L" uniqKey="Greenblatt C" first="Charles L." last="Greenblatt">Charles L. Greenblatt</name>
<affiliation>
<nlm:aff id="aff6">
<addr-line>Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University-Hadassah Medical School, Jerusalem, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lemma, Eshetu" sort="Lemma, Eshetu" uniqKey="Lemma E" first="Eshetu" last="Lemma">Eshetu Lemma</name>
<affiliation>
<nlm:aff id="aff6">
<addr-line>Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University-Hadassah Medical School, Jerusalem, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bar Gal, Gila Kahila" sort="Bar Gal, Gila Kahila" uniqKey="Bar Gal G" first="Gila Kahila" last="Bar-Gal">Gila Kahila Bar-Gal</name>
<affiliation>
<nlm:aff id="aff7">
<addr-line>Koret School of Veterinary Medicine, Hebrew University of Jerusalem, Rehovot, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Spigelman, Mark" sort="Spigelman, Mark" uniqKey="Spigelman M" first="Mark" last="Spigelman">Mark Spigelman</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Centre for Infectious Diseases and International Health, University College London, London, United Kingdom</addr-line>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff6">
<addr-line>Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University-Hadassah Medical School, Jerusalem, Israel</addr-line>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">PLoS ONE</title>
<idno type="eISSN">1932-6203</idno>
<imprint>
<date when="2008">2008</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>
<italic>Mycobacterium tuberculosis</italic>
is the principal etiologic agent of human tuberculosis. It has no environmental reservoir and is believed to have co-evolved with its host over millennia. This is supported by skeletal evidence of the disease in early humans, and inferred from
<italic>M. tuberculosis</italic>
genomic analysis. Direct examination of ancient human remains for
<italic>M. tuberculosis</italic>
biomarkers should aid our understanding of the nature of prehistoric tuberculosis and the host/pathogen relationship.</p>
</sec>
<sec>
<title>Methodology/Principal Findings</title>
<p>We used conventional PCR to examine bone samples with typical tuberculosis lesions from a woman and infant, who were buried together in the now submerged site of Atlit-Yam in the Eastern Mediterranean, dating from 9250-8160 years ago. Rigorous precautions were taken to prevent contamination, and independent centers were used to confirm authenticity of findings. DNA from five
<italic>M tuberculosis</italic>
genetic loci was detected and had characteristics consistent with extant genetic lineages. High performance liquid chromatography was used as an independent method of verification and it directly detected mycolic acid lipid biomarkers, specific for the
<italic>M. tuberculosis</italic>
complex.</p>
</sec>
<sec>
<title>Conclusions/Significance</title>
<p>Human tuberculosis was confirmed by morphological and molecular methods in a population living in one of the first villages with evidence of agriculture and animal domestication. The widespread use of animals was not a source of infection but may have supported a denser human population that facilitated transmission of the tubercle bacillus. The similarity of the
<italic>M. tuberculosis</italic>
genetic signature with those of today gives support to the theory of a long-term co-existence of host and pathogen.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article" xml:lang="EN">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">PLoS ONE</journal-id>
<journal-id journal-id-type="publisher-id">plos</journal-id>
<journal-id journal-id-type="pmc">plosone</journal-id>
<journal-title>PLoS ONE</journal-title>
<issn pub-type="epub">1932-6203</issn>
<publisher>
<publisher-name>Public Library of Science</publisher-name>
<publisher-loc>San Francisco, USA</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">18923677</article-id>
<article-id pub-id-type="pmc">2565837</article-id>
<article-id pub-id-type="publisher-id">08-PONE-RA-05497R1</article-id>
<article-id pub-id-type="doi">10.1371/journal.pone.0003426</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research Article</subject>
</subj-group>
<subj-group subj-group-type="Discipline">
<subject>Chemical Biology</subject>
<subject>Pathology</subject>
<subject>Evolutionary Biology/Microbial Evolution and Genomics</subject>
<subject>Microbiology/Microbial Evolution and Genomics</subject>
<subject>Infectious Diseases/Bacterial Infections</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Detection and Molecular Characterization of 9000-Year-Old
<italic>Mycobacterium tuberculosis</italic>
from a Neolithic Settlement in the Eastern Mediterranean</article-title>
<alt-title alt-title-type="running-head">Neolithic
<italic>M. tuberculosis</italic>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Hershkovitz</surname>
<given-names>Israel</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Donoghue</surname>
<given-names>Helen D.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="cor1">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Minnikin</surname>
<given-names>David E.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Besra</surname>
<given-names>Gurdyal S.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lee</surname>
<given-names>Oona Y-C.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Gernaey</surname>
<given-names>Angela M.</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="author-notes" rid="fn1">
<sup>¤a</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Galili</surname>
<given-names>Ehud</given-names>
</name>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Eshed</surname>
<given-names>Vered</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Greenblatt</surname>
<given-names>Charles L.</given-names>
</name>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lemma</surname>
<given-names>Eshetu</given-names>
</name>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
<xref ref-type="author-notes" rid="fn2">
<sup>¤b</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bar-Gal</surname>
<given-names>Gila Kahila</given-names>
</name>
<xref ref-type="aff" rid="aff7">
<sup>7</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Spigelman</surname>
<given-names>Mark</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<addr-line>Department of Anatomy and Anthropology, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel</addr-line>
</aff>
<aff id="aff2">
<label>2</label>
<addr-line>Centre for Infectious Diseases and International Health, University College London, London, United Kingdom</addr-line>
</aff>
<aff id="aff3">
<label>3</label>
<addr-line>School of Biosciences, University of Birmingham, Edgbaston, Birmingham, United Kingdom</addr-line>
</aff>
<aff id="aff4">
<label>4</label>
<addr-line>Biosciences Research Institute, University of Salford, Salford, United Kingdom</addr-line>
</aff>
<aff id="aff5">
<label>5</label>
<addr-line>Marine Archaeology Branch, Israel Antiquities Authority, Jerusalem, Israel</addr-line>
</aff>
<aff id="aff6">
<label>6</label>
<addr-line>Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University-Hadassah Medical School, Jerusalem, Israel</addr-line>
</aff>
<aff id="aff7">
<label>7</label>
<addr-line>Koret School of Veterinary Medicine, Hebrew University of Jerusalem, Rehovot, Israel</addr-line>
</aff>
<contrib-group>
<contrib contrib-type="editor">
<name>
<surname>Ahmed</surname>
<given-names>Niyaz</given-names>
</name>
<role>Editor</role>
<xref ref-type="aff" rid="edit1"></xref>
</contrib>
</contrib-group>
<aff id="edit1">Centre for DNA Fingerprinting and Diagnostics, India</aff>
<author-notes>
<corresp id="cor1">* E-mail:
<email>h.donoghue@ucl.ac.uk</email>
</corresp>
<fn fn-type="con">
<p>Conceived and designed the experiments: IH HDD DEM GSB AMG EG CLG GKBG MS. Performed the experiments: IH HDD OYCL AMG EG VE CLG EL GKBG. Analyzed the data: IH HDD DEM GSB AMG EG VE EL GKBG MS. Contributed reagents/materials/analysis tools: GSB. Wrote the paper: IH HDD MS.</p>
</fn>
<fn id="fn1" fn-type="current-aff">
<label>¤a</label>
<p>Current address: None available. AMG was affiliated with the University of Salford until April 30, 2007.</p>
</fn>
<fn id="fn2" fn-type="current-aff">
<label>¤b</label>
<p>Current address: Ethiopian Health and Nutrition Research Institute, Addis Ababa, Ethiopia</p>
</fn>
</author-notes>
<pub-date pub-type="collection">
<year>2008</year>
</pub-date>
<pub-date pub-type="epub">
<day>15</day>
<month>10</month>
<year>2008</year>
</pub-date>
<volume>3</volume>
<issue>10</issue>
<elocation-id>e3426</elocation-id>
<history>
<date date-type="received">
<day>13</day>
<month>7</month>
<year>2008</year>
</date>
<date date-type="accepted">
<day>15</day>
<month>9</month>
<year>2008</year>
</date>
</history>
<copyright-statement>Hershkovitz et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</copyright-statement>
<copyright-year>2008</copyright-year>
<abstract>
<sec>
<title>Background</title>
<p>
<italic>Mycobacterium tuberculosis</italic>
is the principal etiologic agent of human tuberculosis. It has no environmental reservoir and is believed to have co-evolved with its host over millennia. This is supported by skeletal evidence of the disease in early humans, and inferred from
<italic>M. tuberculosis</italic>
genomic analysis. Direct examination of ancient human remains for
<italic>M. tuberculosis</italic>
biomarkers should aid our understanding of the nature of prehistoric tuberculosis and the host/pathogen relationship.</p>
</sec>
<sec>
<title>Methodology/Principal Findings</title>
<p>We used conventional PCR to examine bone samples with typical tuberculosis lesions from a woman and infant, who were buried together in the now submerged site of Atlit-Yam in the Eastern Mediterranean, dating from 9250-8160 years ago. Rigorous precautions were taken to prevent contamination, and independent centers were used to confirm authenticity of findings. DNA from five
<italic>M tuberculosis</italic>
genetic loci was detected and had characteristics consistent with extant genetic lineages. High performance liquid chromatography was used as an independent method of verification and it directly detected mycolic acid lipid biomarkers, specific for the
<italic>M. tuberculosis</italic>
complex.</p>
</sec>
<sec>
<title>Conclusions/Significance</title>
<p>Human tuberculosis was confirmed by morphological and molecular methods in a population living in one of the first villages with evidence of agriculture and animal domestication. The widespread use of animals was not a source of infection but may have supported a denser human population that facilitated transmission of the tubercle bacillus. The similarity of the
<italic>M. tuberculosis</italic>
genetic signature with those of today gives support to the theory of a long-term co-existence of host and pathogen.</p>
</sec>
</abstract>
<counts>
<page-count count="6"></page-count>
</counts>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>Tuberculosis is a major global cause of death and disease and around 2 billion people, about one third of the world's total population, are believed to be infected with tubercle bacilli
<xref ref-type="bibr" rid="pone.0003426-World1">[1]</xref>
. However, only around 10% of infected persons become ill with active disease, and this high level of latent infection is an indication of long-term co-existence of human host and bacterial pathogen
<xref ref-type="bibr" rid="pone.0003426-Hirsh1">[2]</xref>
. Tuberculosis is caused by a group of closely related bacterial species termed the
<italic>Mycobacterium tuberculosis</italic>
complex. Today the principal cause of human tuberculosis is
<italic>Mycobacterium tuberculosis</italic>
.
<italic>Mycobacterium bovis</italic>
has a wider host range and is the main cause of tuberculosis in other animal species. Humans become infected by
<italic>M. bovis</italic>
, usually via milk, milk products or meat from an infected animal. It is estimated that in the pre-antibiotic era
<italic>M. bovis</italic>
was responsible for about 6% of tuberculosis deaths in humans
<xref ref-type="bibr" rid="pone.0003426-Hardie1">[3]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-OReilly1">[4]</xref>
. Other members of the
<italic>M. tuberculosis</italic>
complex include the human pathogens
<italic>Mycobacterium canettii</italic>
,
<italic>Mycobacterium africanum</italic>
, and species usually associated with animal infections, such as
<italic>Mycobacterium microti</italic>
,
<italic>Mycobacterium caprae</italic>
and
<italic>Mycobacterium pinnipedii</italic>
.</p>
<p>Tuberculosis can cause characteristic skeletal changes, such as collapse of the vertebrae (Pott's disease), periosteal reactive lesions, and osteomyelitis
<xref ref-type="bibr" rid="pone.0003426-Ortner1">[5]</xref>
. Such paleopathological changes have been reported in pre-dynastic (3500-2650 BC) Egypt
<xref ref-type="bibr" rid="pone.0003426-Zink1">[6]</xref>
, and Neolithic (3200-2300 BC) Sweden culturally associated with the earliest cattle breeders
<xref ref-type="bibr" rid="pone.0003426-Nuorala1">[7]</xref>
. These are the oldest cases of human tuberculosis confirmed by ancient DNA. Older cases recognized by skeletal changes alone were found in Neolithic Italy at the beginning of the fourth millennium BC
<xref ref-type="bibr" rid="pone.0003426-Formicola1">[8]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Canci1">[9]</xref>
.</p>
<p>Erosive lesions suggestive of tuberculosis have been found on fossil fauna from the Natural Trap Cave in Wyoming, dated from the 17,000 to 20,000 year level
<xref ref-type="bibr" rid="pone.0003426-Rothschild1">[10]</xref>
and tuberculosis in one specimen was confirmed by biomolecular methods
<xref ref-type="bibr" rid="pone.0003426-Rothschild2">[11]</xref>
. Initially it was believed that humans acquired tuberculosis from animals, especially after domestication
<xref ref-type="bibr" rid="pone.0003426-Steinbock1">[12]</xref>
–
<xref ref-type="bibr" rid="pone.0003426-Clark1">[14]</xref>
. Whole genome sequencing has since revealed that the
<italic>M. tuberculosis</italic>
complex has accumulated deletions over time, which can be used to distinguish individual species and lineages
<xref ref-type="bibr" rid="pone.0003426-Parsons1">[15]</xref>
and earlier ideas about the evolution of the
<italic>M. tuberculosis</italic>
complex have been revised
<xref ref-type="bibr" rid="pone.0003426-Brosch1">[16]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Mostowy1">[17]</xref>
. An intriguing indication of the antiquity of the disease is the finding of non-specific morphological changes consistent with tuberculosis in a fossil
<italic>Homo erectus</italic>
dating from the middle Pleistocene (490–510,000 years BP) from Turkey
<xref ref-type="bibr" rid="pone.0003426-Kappelman1">[18]</xref>
.</p>
<p>The emergence of human infectious diseases has been linked to changes in human ecology and to interactions between populations
<xref ref-type="bibr" rid="pone.0003426-McMichael1">[19]</xref>
. The change from a gatherer-hunter lifestyle to settled farming communities appears to coincide with the appearance of diseases such as smallpox, measles, malaria, schistosomiasis, and tuberculosis
<xref ref-type="bibr" rid="pone.0003426-Cohen1">[20]</xref>
. Our aim was to investigate this stage of human history by the use of molecular methods to examine human remains that pre-date the earliest verified cases of tuberculosis, but with paleopathology consistent with this disease. A further aim was to elucidate the molecular characteristics of the causative organism. It is believed that the denser, settled populations associated with agriculture and animal domestication enabled human pathogens such as
<italic>M. tuberculosis</italic>
to be maintained indefinitely
<xref ref-type="bibr" rid="pone.0003426-Weiss1">[21]</xref>
. Therefore, we examined one of the earliest villages with evidence of both animal domestication and agriculture, Atlit-Yam
<xref ref-type="bibr" rid="pone.0003426-Galili1">[22]</xref>
, for the presence of tuberculosis in human remains with characteristic lesions.
<italic>M. tuberculosis</italic>
was confirmed in the skeletal remains of a woman and child, using both ancient DNA and bacterial cell-wall specific lipid markers. Deletion analysis indicates that the modern
<italic>M. tuberculosis</italic>
lineage characterized by the TbD1 deletion existed 9000 years ago.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and Methods</title>
<p>The site of Atlit-Yam is now located 300–500 m offshore, (34°56′ E, 32°42.5′ N), 8–12 m below sea level in the North Bay of Atlit, 10 km south of Haifa (
<xref ref-type="fig" rid="pone-0003426-g001">Figure 1</xref>
). Calibrated radiocarbon dates range from 9250-8160 years BP
<xref ref-type="bibr" rid="pone.0003426-Galili2">[23]</xref>
, indicating a date during the last phase of the Pre-Pottery Neolithic C period, when human society accomplished a full shift from hunting and gathering to farming, fishing and animal husbandry. The rich finds included botanical remains, tools, animal and human bones. The many animal remains that were excavated included goat (44%), cattle (43%), pig (9%), gazelle and deer (3.3%).</p>
<fig id="pone-0003426-g001" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0003426.g001</object-id>
<label>Figure 1</label>
<caption>
<title>Map of Atlit-Yam site in the North Bay of Atlit, 10 km south of Haifa (34°56′ E, 32°42.5′ N). Inset shows general geographical location.</title>
</caption>
<graphic xlink:href="pone.0003426.g001"></graphic>
</fig>
<p>Human skeletons, which were embedded in dark clay, were carefully excavated and soaked in fresh-water tanks to dissolve the salts. The skeletal remains
<xref ref-type="bibr" rid="pone.0003426-Hershkovitz1">[24]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Galili3">[25]</xref>
were generally well-preserved (Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s007">Figure S1A</xref>
) and some showed paleopathological features consistent with a diagnosis of tuberculosis. Samples were taken for molecular examination from the skeletal remains of a woman buried together with an infant (Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s007">Figure S1B</xref>
). We analyzed the ribs, arm bones (adult) and long bones (infant). The work was done in separate centers to provide verification of data, and stringent precautions were taken against contamination (Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s001">Materials and Methods S1</xref>
). Separate areas and pipettes were used for extraction, PCR set-up and product analysis. Filter tips were used routinely and surfaces and equipment were cleaned before each assay. DNA extracts were prepared and, using the polymerase chain reaction (PCR), both multi-copy and single copy target loci were amplified (
<xref ref-type="table" rid="pone-0003426-t001">Table 1</xref>
) and sequenced to confirm their identity. Screening PCRs detected the
<italic>M. tuberculosis</italic>
complex and nested or hemi-nested PCR was used to increase the likelihood of detection (Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s001">Materiasls and Methods S1</xref>
). A single copy conserved membrane protein locus (CMP) found in the
<italic>M. tuberculosis</italic>
complex was examined by PCR to assess the feasibility of seeking further single-copy loci. PCR target regions, based on specific deletions, were used to distinguish between
<italic>M. tuberculosis</italic>
and
<italic>M. bovis</italic>
. Extracts were analyzed further by reverse dot-blot hybridization of the
<italic>M. tuberculosis</italic>
complex-specific Direct Repeat (DR) region, a procedure known as spoligotyping
<xref ref-type="bibr" rid="pone.0003426-Kamerbeek1">[26]</xref>
. In addition, samples from both the infant and adult were analyzed by high performance liquid chromatography (HPLC) for mycobacterial cell wall mycolic acids
<xref ref-type="bibr" rid="pone.0003426-Donoghue1">[27]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Gernaey1">[28]</xref>
(Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s002">Tables S1</xref>
,
<xref ref-type="supplementary-material" rid="pone.0003426.s003">S2</xref>
and
<xref ref-type="supplementary-material" rid="pone.0003426.s004">S3</xref>
and Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s008">Figure S2 A and B</xref>
). Long chain fatty acids were converted to pyrenebutyric acid-pentafluorobenzyl mycolates, and reverse phase HPLC examined for profiles similar to standard
<italic>M. tuberculosis</italic>
. Further normal and reverse phase HPLC was performed to give detailed profiles for each sample. These were used to determine the percentage ratios and absolute amounts of mycolic acids extracted from bone samples.</p>
<table-wrap id="pone-0003426-t001" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0003426.t001</object-id>
<label>Table 1</label>
<caption>
<title>Primer sequences and PCR details.
<xref ref-type="table-fn" rid="nt101">1</xref>
</title>
</caption>
<graphic id="pone-0003426-t001-1" xlink:href="pone.0003426.t001"></graphic>
<table frame="hsides" rules="groups" alternate-form-of="pone-0003426-t001-1">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Locus</td>
<td align="left" rowspan="1" colspan="1">Primers (5′ - 3′)</td>
<td align="left" rowspan="1" colspan="1">MgCl
<sub>2</sub>
(mM)</td>
<td align="left" rowspan="1" colspan="1">Annealing temp. (°C)</td>
<td align="left" rowspan="1" colspan="1">Product (bp)</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">IS
<italic>6110</italic>
</td>
<td align="left" rowspan="1" colspan="1">P1:
<named-content content-type="gene">CTCGTCCAGCGCCGCTTCGG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Outer</td>
<td align="left" rowspan="1" colspan="1">P2:
<named-content content-type="gene">CCTGCGAGCGTAGGCGTCGG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1.5</td>
<td align="left" rowspan="1" colspan="1">68</td>
<td align="left" rowspan="1" colspan="1">123</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">IS
<italic>6110</italic>
</td>
<td align="left" rowspan="1" colspan="1">IS3:
<named-content content-type="gene">TTCGGACCACCAGCACCTAA</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Nested</td>
<td align="left" rowspan="1" colspan="1">IS4:
<named-content content-type="gene">TCGGTGACAAAGGCCACGTA</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1.5</td>
<td align="left" rowspan="1" colspan="1">58</td>
<td align="left" rowspan="1" colspan="1">92</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">IS
<italic>1081</italic>
</td>
<td align="left" rowspan="1" colspan="1">F2:
<named-content content-type="gene">CTGCTCTCGACGTTCATCGCCG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Outer</td>
<td align="left" rowspan="1" colspan="1">R2:
<named-content content-type="gene">GGCACGGGTGTCGAAATCACG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1.5</td>
<td align="left" rowspan="1" colspan="1">58</td>
<td align="left" rowspan="1" colspan="1">135</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">IS
<italic>1081</italic>
</td>
<td align="left" rowspan="1" colspan="1">F2:
<named-content content-type="gene">CTGCTCTCGACGTTCATCGCCG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Hemi-nested</td>
<td align="left" rowspan="1" colspan="1">R3:
<named-content content-type="gene">TGGCGGTAGCCGTTGCGC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
<td align="left" rowspan="1" colspan="1">58</td>
<td align="left" rowspan="1" colspan="1">113</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">TbD1</td>
<td align="left" rowspan="1" colspan="1">TbD1a:
<named-content content-type="gene">CTAACGGGTGCAGGGGATTTC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Flanking outer</td>
<td align="left" rowspan="1" colspan="1">TbD1b:
<named-content content-type="gene">CCAAGGTTACGGTCACGCTGGC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1.5</td>
<td align="left" rowspan="1" colspan="1">60</td>
<td align="left" rowspan="1" colspan="1">128</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">TbD1</td>
<td align="left" rowspan="1" colspan="1">TbD1c:
<named-content content-type="gene">GCAGGGGATTTCAGTGACTG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Flanking inner</td>
<td align="left" rowspan="1" colspan="1">TbD1d:
<named-content content-type="gene">GCTGGCCAGCTGCTCGCCG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1.5</td>
<td align="left" rowspan="1" colspan="1">58</td>
<td align="left" rowspan="1" colspan="1">103</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">CMP</td>
<td align="left" rowspan="1" colspan="1">F2:
<named-content content-type="gene">TCGGTCAGCAAGACGTTGAAG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">R:
<named-content content-type="gene">ACTTCAGTGCTGGTTCGTGG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
<td align="left" rowspan="1" colspan="1">58</td>
<td align="left" rowspan="1" colspan="1">105</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">RD2</td>
<td align="left" rowspan="1" colspan="1">BV1:
<named-content content-type="gene">ATCTTGCGGCCCAATGAATC</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Outer</td>
<td align="left" rowspan="1" colspan="1">BV2:
<named-content content-type="gene">CAACGTCTTGCTGACCGACA</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1.5</td>
<td align="left" rowspan="1" colspan="1">58</td>
<td align="left" rowspan="1" colspan="1">124</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">RD2</td>
<td align="left" rowspan="1" colspan="1">BV3:
<named-content content-type="gene">ATGAATCGGCCGCGTTCG</named-content>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Nested</td>
<td align="left" rowspan="1" colspan="1">BV4:
<named-content content-type="gene">GACCGACATCGGTGCCGCG</named-content>
</td>
<td align="left" rowspan="1" colspan="1">1.5</td>
<td align="left" rowspan="1" colspan="1">58</td>
<td align="left" rowspan="1" colspan="1">99</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">DR</td>
<td align="left" rowspan="1" colspan="1">DRa:
<named-content content-type="gene">GGTTTTGGGTGTGACGAC</named-content>
<xref ref-type="table-fn" rid="nt102">2</xref>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">Not applicable</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">DRb:
<named-content content-type="gene">CCGAGAGGGGACGGAAAC</named-content>
</td>
<td align="left" rowspan="1" colspan="1">3.0</td>
<td align="left" rowspan="1" colspan="1">55</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="nt101">
<label>1</label>
<p>An initial denaturation step (95°C for 15 mins – hot start PCR, or 94°C for 1 min); DNA amplification (initially 40 cycles, with 25 cycles in nested reactions) of strand separation at 94°C for 40 sec, 1 min of primer annealing, followed by strand extension at 72°C for 20 sec plus 1 sec/cycle; and a final extension step at 72°C, were used for all PCR amplifications.</p>
</fn>
<fn id="nt102">
<label>2</label>
<p>The DRa primer was biotinylated at the 5′ end to enable subsequent detection of amplified DNA by reverse hybridization.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3">
<title>Results</title>
<sec id="s3a">
<title>Paleopathology</title>
<p>The infant, though small in size, was estimated to be about 12 months old, based on crown development and long bone dimensions. On the inner aspect of the infant cranial bones were serpentine engravings (
<italic>serpens endocrania symmetrica</italic>
, SES;
<xref ref-type="fig" rid="pone-0003426-g002">Figure 2A</xref>
), a reliable diagnostic criterion for intra-thoracic inflammation
<xref ref-type="bibr" rid="pone.0003426-Hershkovitz2">[29]</xref>
and associated with tuberculosis. The infant tubular bones also demonstrated lesions identified as hypertrophic osteoarthropathy (HOA), highly suggestive of tuberculosis
<xref ref-type="bibr" rid="pone.0003426-Mensforth1">[30]</xref>
and characterized by the formation of an expanded shell of periosteal reactive bone (
<xref ref-type="fig" rid="pone-0003426-g002">Figure 2B and C</xref>
). The woman was estimated to be around 25 years old, based on dental attrition, epiphyseal ring ankylosis and symphysis pubis. There was a slight periosteal reaction affecting the distal diaphysis of the one tibia available for examination, a bony change consistent with HOA
<xref ref-type="bibr" rid="pone.0003426-Ortner1">[5]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Rothschild3">[31]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Mays1">[32]</xref>
. However, the changes were not so marked as to be diagnostic.</p>
<fig id="pone-0003426-g002" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0003426.g002</object-id>
<label>Figure 2</label>
<caption>
<title>Paleopathological lesions on Neolithic infant bones.</title>
<p>A. Endocranial surface of the infant showing marked engravings (
<italic>serpens endocrania symmetrica</italic>
, SES), which indicate chronic respiratory malfunction, and are usually associated with tuberculosis. B. Fragment of long bone of the infant. Note the intensive bone remodeling (hypertrophic osteoarthropathy, HOA) at the surface on the right side. C. Higher magnification of the HOA on the infant bone.</p>
</caption>
<graphic xlink:href="pone.0003426.g002"></graphic>
</fig>
</sec>
<sec id="s3b">
<title>
<italic>Mycobacterium tuberculosis</italic>
complex and
<italic>M. tuberculosis</italic>
DNA</title>
<p>
<italic>M. tuberculosis</italic>
complex DNA was detected in the bones of woman and infant (
<xref ref-type="table" rid="pone-0003426-t002">Table 2</xref>
). Positive results with the multi-copy IS
<italic>6110</italic>
<xref ref-type="bibr" rid="pone.0003426-Eisenach1">[33]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Taylor1">[34]</xref>
and IS
<italic>1081</italic>
<xref ref-type="bibr" rid="pone.0003426-Taylor2">[35]</xref>
PCRs were obtained with the rib sample from the woman and infant long bone sample, and confirmed by sequencing. An IS
<italic>6110</italic>
123 bp product from the woman (right rib) and a 92 bp nested IS
<italic>6110</italic>
product from the infant were obtained, identical to those in the NCBI database. Additionally, a 104 bp sequence identical to the relevant NCBI sequence in the IS
<italic>1081</italic>
product was obtained from the infant.</p>
<table-wrap id="pone-0003426-t002" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0003426.t002</object-id>
<label>Table 2</label>
<caption>
<title>Summary of PCR results.</title>
</caption>
<graphic id="pone-0003426-t002-2" xlink:href="pone.0003426.t002"></graphic>
<table frame="hsides" rules="groups" alternate-form-of="pone-0003426-t002-2">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">PCR locus</td>
<td colspan="2" align="left" rowspan="1">Woman</td>
<td colspan="2" align="left" rowspan="1">Infant</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">1st stage PCR</td>
<td align="left" rowspan="1" colspan="1">2nd stage PCR</td>
<td align="left" rowspan="1" colspan="1">1st stage PCR</td>
<td align="left" rowspan="1" colspan="1">2nd stage PCR</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">IS
<italic>6110</italic>
</td>
<td align="left" rowspan="1" colspan="1">Positive</td>
<td align="left" rowspan="1" colspan="1">Positive</td>
<td align="left" rowspan="1" colspan="1">Positive
<xref ref-type="table-fn" rid="nt103">1</xref>
</td>
<td align="left" rowspan="1" colspan="1">Negative</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">IS
<italic>1081</italic>
</td>
<td align="left" rowspan="1" colspan="1">Positive</td>
<td align="left" rowspan="1" colspan="1">Positive</td>
<td align="left" rowspan="1" colspan="1">Positive
<xref ref-type="table-fn" rid="nt103">1</xref>
</td>
<td align="left" rowspan="1" colspan="1">Positive</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Flanking TbD1</td>
<td align="left" rowspan="1" colspan="1">Positive</td>
<td align="left" rowspan="1" colspan="1">Negative</td>
<td align="left" rowspan="1" colspan="1">Positive
<xref ref-type="table-fn" rid="nt103">1</xref>
</td>
<td align="left" rowspan="1" colspan="1">Positive</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">RD2</td>
<td align="left" rowspan="1" colspan="1">Negative</td>
<td align="left" rowspan="1" colspan="1">Negative</td>
<td align="left" rowspan="1" colspan="1">Negative</td>
<td align="left" rowspan="1" colspan="1">Negative</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">CMP</td>
<td align="left" rowspan="1" colspan="1">Positive</td>
<td align="left" rowspan="1" colspan="1">Not done</td>
<td align="left" rowspan="1" colspan="1">Positive
<xref ref-type="table-fn" rid="nt103">1</xref>
</td>
<td align="left" rowspan="1" colspan="1">Not done</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="nt103">
<label>1</label>
<p>confirmed by sequencing.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>The single copy TbD1 flanking PCR was positive from the infant sample and a complete DNA sequence for the 128 bp amplicon with the outer primers was obtained (Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s009">Figure S3A and B</xref>
). The consensus sequence was identical to that in the NCBI database. The strong signal indicates the excellent preservation at this locus of the
<italic>M. tuberculosis</italic>
DNA template. Nested PCR was also successful. Weak positives were obtained with the outer primers from the female sample. These findings are evidence that the infecting organism was
<italic>M. tuberculosis</italic>
from a lineage in which the TbD1 deletion had occurred
<xref ref-type="bibr" rid="pone.0003426-Brosch1">[16]</xref>
. Results from the infant for the single copy CMP PCR were faint and a partial sequence was obtained (Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s009">Figure S3C</xref>
) with some mismatched bases compared with the database, attributed to poor DNA preservation. No demonstrable amplicons of human nuclear microsatellite DNA were obtained from the bone samples. Spoligotyping provided additional evidence for
<italic>M. tuberculosis</italic>
complex DNA for both the adult and infant specimens (Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s010">Figure S4 A–D</xref>
), although there were several faint or dubious positives and inconsistencies between replicates, as might be expected of ancient specimens.</p>
</sec>
<sec id="s3c">
<title>Lipid biomarkers of
<italic>M. tuberculosis</italic>
</title>
<p>Modifying an established protocol
<xref ref-type="bibr" rid="pone.0003426-Gernaey1">[28]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Minnikin1">[36]</xref>
, long-chain fatty acids were extracted as pentafluorobenzyl (PFB) esters, and fractions corresponding to PFB mycolates were obtained (Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s005">Tables S4</xref>
,
<xref ref-type="supplementary-material" rid="pone.0003426.s006">S5</xref>
). After treatment with pyrenebutyric acid (PBA) these fractions produced PBA-PFB mycolates, which, after reverse phase HPLC, gave profiles closely similar to those produced by the
<italic>M. tuberculosis</italic>
complex, as indicated by a standard
<italic>M. tuberculosis</italic>
strain (
<xref ref-type="fig" rid="pone-0003426-g003">Figure 3</xref>
). Further normal and reverse phase HPLC gave detailed profiles for each sample, reinforcing the close identity with
<italic>M. tuberculosis</italic>
(Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s008">Figure S2 C and D</xref>
).</p>
<fig id="pone-0003426-g003" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0003426.g003</object-id>
<label>Figure 3</label>
<caption>
<title>Detection of
<italic>Mycobacterium tuberculosis</italic>
mycolic acid pyrenebutyric acid-pentafluorobenzyl (PBA-PFB) derivatives by reverse phase fluorescence high performance liquid chromatography (HPLC), from the Neolithic woman and infant.</title>
<p>The characteristic tight envelopes of peaks are the total mixture of homologues for the different α-, methoxy- and ketomycolates. The Y-axis in the profiles represents absorbance; absolute values of the mycolates detected are shown in Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s006">Table 5</xref>
.</p>
</caption>
<graphic xlink:href="pone.0003426.g003"></graphic>
</fig>
</sec>
</sec>
<sec id="s4">
<title>Discussion</title>
<p>It is believed that inundation of the Atlit-Yam site occurred shortly after abandonment
<xref ref-type="bibr" rid="pone.0003426-Hershkovitz1">[24]</xref>
and thereafter the environment remained unchanged for 9,000 years. The Atlit-Yam site was located within marshland; the graves were encased in clay, eventually covered by thick layer of sand and later by salt water, thus providing anaerobic conditions that retard degradation. The excellent preservation of the skeletal remains is consistent with the excellent physical state of the organic artifacts (wooden bowls, reed mats) that were found on the site. The paleopathogical lesions of SES in the infant cranium and HOA in the infant long bones and possibly also the tibia of the woman buried with the infant, presumed to be the mother, suggest that both suffered from, and died of, tuberculosis.</p>
<p>Anaerobic conditions are also conducive for DNA preservation
<xref ref-type="bibr" rid="pone.0003426-Drancourt1">[37]</xref>
and DNA analysis supports the paleopathological diagnosis of tuberculosis. Overall, the PCR data provide strong evidence of the
<italic>M. tuberculosis</italic>
complex as specific DNA was detected in five different genetic loci, including the TbD1 locus with a deletion that is specific for a broadly-defined modern lineage of
<italic>M. tuberculosis</italic>
. Failure to detect human DNA (data not included) may reflect the greater stability of the GC-rich mycobacterial DNA, which additionally benefits from the robust hydrophobic bacterial cell wall
<xref ref-type="bibr" rid="pone.0003426-Gernaey1">[28]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Minnikin2">[38]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Spigelman1">[39]</xref>
.</p>
<p>Direct detection of cell wall mycolic acids specific for the
<italic>Mycobacterium tuberculosis</italic>
complex, without any amplification step, provides independent, robust confirmation of the presence of tuberculosis. The quantity of mycolic acids appeared lower in the infant sample (Supporting
<xref ref-type="supplementary-material" rid="pone.0003426.s006">Table S5</xref>
), in contrast to the DNA studies where the infant gave better results. However, the mycolate analyses were carried out on three combined rib samples from the baby, not all of which had been tested for MTB DNA. These extremely hydrophobic high molecular weight molecules are more stable than DNA and have been used previously to confirm diagnoses of ancient tuberculosis
<xref ref-type="bibr" rid="pone.0003426-Donoghue1">[27]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Gernaey1">[28]</xref>
.</p>
<p>We conclude that both individuals in our study were infected with
<italic>M. tuberculosis</italic>
, and that our findings are supported when we consider the nature of the site, the stringent precautions taken to prevent cross-contamination and verification by the specific lipid biomarkers. Furthermore, we believe that this is the earliest report of the disease in humans that has been confirmed by molecular means. The infant is likely to have had disseminated primary tuberculosis: - the only DNA sequences for single copy loci were obtained from the infant material, which suggests a higher bacterial load during life. In infants less than a year old the present risk of developing active disease on infection with
<italic>M. tuberculosis</italic>
is as high as 43%
<xref ref-type="bibr" rid="pone.0003426-Walls1">[40]</xref>
due to the inadequacy of their immune system. This compares with 5–10% in adults, 15% in adolescents, and 24% in children aged 1–5 years.</p>
<p>The size of the infant's bones, and the extent of the bony changes, suggest a case of acquired neonatal tuberculosis, in which an adult suffering from contagious pulmonary tuberculosis infects an infant shortly after birth. Childhood tuberculosis is closely linked to adult disease and is usually a sentinel event in the community, demonstrating recent transmission. Infant and maternal mortality rates from untreated tuberculosis in recent times was between 30% and 40%
<xref ref-type="bibr" rid="pone.0003426-Starke1">[41]</xref>
, so it is unsurprising for both mother and child to succumb and be buried together.</p>
<p>Spoligotyping should be a useful method of examining DNA from archaeological material as even fragmented DNA gives results, due to the increased sensitivity from the combination of amplification and hybridization
<xref ref-type="bibr" rid="pone.0003426-Donoghue2">[42]</xref>
.
<italic>M. tuberculosis</italic>
complex DNA from the lesion of a 17,000-old extinct Pleistocene bison
<xref ref-type="bibr" rid="pone.0003426-Rothschild2">[11]</xref>
yielded spoligotyping patterns most similar to
<italic>Mycobacterium africanum</italic>
or
<italic>M. tuberculosis</italic>
<xref ref-type="bibr" rid="pone.0003426-Huard1">[43]</xref>
, and distinct from present day
<italic>M. bovis</italic>
. Zink
<italic>et al.</italic>
<xref ref-type="bibr" rid="pone.0003426-Zink2">[44]</xref>
obtained spoligotypes from ancient Egyptian human bone and soft tissue samples, dating back to about 4000 years. Of their 12 positive samples, spoligotyping indicated
<italic>M. tuberculosis</italic>
or, in some older Middle Kingdom samples,
<italic>M. africanum</italic>
patterns, but not those of
<italic>M. bovis</italic>
.</p>
<p>We carried out spoligotyping on specimens from the woman and infant but replicated typing gave inconsistent results, which suggests there may be poor DNA preservation of some of the single-copy spacer regions. The observed patterns do not match any in the International Data Base spoldb4:
<ext-link ext-link-type="uri" xlink:href="http://www.pasteur-guadeloupe.fr/tb/spoldb4">www.pasteur-guadeloupe.fr/tb/spoldb4</ext-link>
but appear similar to an ancestral pattern. Results need to be interpreted with caution, as spoldb4 is based on data obtained from cultured organisms and spoligotyping has not been validated for application to DNA extracts prepared from degraded or archival specimens. The spoligotyping technique is based on modern
<italic>M. tuberculosis</italic>
strains from around the world. As the main variation in types is caused by unidirectional deletions, all ancestral strains are likely to produce a near-complete profile of the DR region and therefore to resemble each other. This may explain why the spoligotypes from the Atlit Yam skeletons resemble those of the Pleistocene bison
<xref ref-type="bibr" rid="pone.0003426-Rothschild2">[11]</xref>
.</p>
<p>Deletion analysis is a more robust method of examining ancient material
<xref ref-type="bibr" rid="pone.0003426-Brosch1">[16]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Taylor3">[45]</xref>
, and based on the TbD1 deletion, the genetic lineage resembles modern lineages of
<italic>M. tuberculosis</italic>
<xref ref-type="bibr" rid="pone.0003426-Brosch1">[16]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Huard1">[43]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Wirth1">[51]</xref>
.</p>
<p>Suggestions that human tuberculosis arose from
<italic>M. bovis</italic>
in hunted or domesticated animals have been revised since comparative genomic studies demonstrate that
<italic>M. bovis</italic>
represents a later lineage
<xref ref-type="bibr" rid="pone.0003426-Brosch1">[16]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Mostowy1">[17]</xref>
. Members of the
<italic>M. tuberculosis</italic>
complex are genetically very similar and were believed to be the result of a clonal expansion following an evolutionary bottleneck 20,000–35,000 years ago
<xref ref-type="bibr" rid="pone.0003426-Brosch1">[16]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Sreevatsan1">[46]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Hughes1">[47]</xref>
. However, further genomic studies of the
<italic>M. tuberculosis</italic>
complex indicate a more ancient origin of this group of closely related species than had previously been believed, and that possibly an early progenitor, perhaps similar to
<italic>M. canettii</italic>
, was present in East Africa as early as 3 million years ago
<xref ref-type="bibr" rid="pone.0003426-Gutierrez1">[48]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Daniel1">[49]</xref>
. The observation of non-specific lesions consistent with tuberculosis found in a 500,000 year-old skeleton of
<italic>Homo erectus</italic>
<xref ref-type="bibr" rid="pone.0003426-Kappelman1">[18]</xref>
may also indicate the long-term co-existence of host and pathogen, although the diagnosis in this particular case has been questioned. However,
<italic>M. tuberculosis</italic>
appears to have undergone long-term co-evolution with its human host prior to the evolutionary bottleneck and well before the development of agriculture and domestication, comparable to other long-term human pathogens such as
<italic>Helicobacter pylori</italic>
<xref ref-type="bibr" rid="pone.0003426-PearceDuvet1">[50]</xref>
,
<xref ref-type="bibr" rid="pone.0003426-Wirth1">[51]</xref>
.</p>
<p>The present study of a population from 9250-8160 years ago, around the time of the first great transition from hunter-gatherers to a settled agriculture-based lifestyle
<xref ref-type="bibr" rid="pone.0003426-McMichael1">[19]</xref>
, helps us to understand the nature of tuberculosis within the Middle East. Could the presence of cattle be pertinent? Atlit-Yam is among the very few Pre-Pottery Neolithic sites where domesticated cattle have been found. Furthermore, it is the only Neolithic site where there were quantities of bovine bones, indicating that cattle were a major dietary component
<xref ref-type="bibr" rid="pone.0003426-Galili2">[23]</xref>
. We suggest that in the absence of detectable
<italic>M. bovis</italic>
, the cattle may be important by supporting a larger and denser human population, thus indirectly encouraging the conditions for the long-term maintenance and transmission of
<italic>M. tuberculosis</italic>
<xref ref-type="bibr" rid="pone.0003426-Weiss1">[21]</xref>
.</p>
</sec>
<sec sec-type="supplementary-material" id="s5">
<title>Supporting Information</title>
<supplementary-material content-type="local-data" id="pone.0003426.s001">
<label>Materials and Methods S1</label>
<caption>
<p>Text</p>
<p>(0.05 MB DOC)</p>
</caption>
<media xlink:href="pone.0003426.s001.doc" mimetype="application" mime-subtype="msword">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0003426.s002">
<label>Table S1</label>
<caption>
<p>The solvent sequence used for the silica gel normal phase cartridge fractionation of long-chain compounds</p>
<p>(0.03 MB DOC)</p>
</caption>
<media xlink:href="pone.0003426.s002.doc" mimetype="application" mime-subtype="msword">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0003426.s003">
<label>Table S2</label>
<caption>
<p>The solvent sequence used for the reverse phase cartridge purification of PBA-PFB mycolates</p>
<p>(0.02 MB DOC)</p>
</caption>
<media xlink:href="pone.0003426.s003.doc" mimetype="application" mime-subtype="msword">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0003426.s004">
<label>Table S3</label>
<caption>
<p>Conditions for HPLC analysis of PBA-PFB mycolates</p>
<p>(0.02 MB DOC)</p>
</caption>
<media xlink:href="pone.0003426.s004.doc" mimetype="application" mime-subtype="msword">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0003426.s005">
<label>Table S4</label>
<caption>
<p>Percentage ratios of alpha-, methoxy- and ketomycolates in archaeological samples and
<italic>M. tuberculosis</italic>
standard determined in normal phase HPLC</p>
<p>(0.02 MB DOC)</p>
</caption>
<media xlink:href="pone.0003426.s005.doc" mimetype="application" mime-subtype="msword">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0003426.s006">
<label>Table S5</label>
<caption>
<p>Absolute amounts of mycolic acids extracted from bone samples</p>
<p>(0.02 MB DOC)</p>
</caption>
<media xlink:href="pone.0003426.s006.doc" mimetype="application" mime-subtype="msword">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0003426.s007">
<label>Figure S1</label>
<caption>
<p>Atlit-Yam burials. A. An example of human remains with excellent preservation. B. Partial excavation of the burial site with the adult female and infant skeleton (arrow).</p>
<p>(2.46 MB TIF)</p>
</caption>
<media xlink:href="pone.0003426.s007.tif" mimetype="image" mime-subtype="tiff">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0003426.s008">
<label>Figure S2</label>
<caption>
<p>High Performance Liquid Chromatography (HPLC) methodology. A. Representative structures of the mycolic acids from
<italic>M. tuberculosis</italic>
. Natural mixtures of mycolates express a range of homologous components with varying chain lengths. B. Strategy for the release and derivatization of mycolic acids for fluorescence HPLC. (a) Hydrolysis with KOH/ methanol/toluene to release mycolic acids. (b) Phase-transfer catalyzed esterification of mycolic acids with pentafluorobenzyl bromide (PFB) to give PFB mycolates. (c) Esterification of PFB mycolates, by reaction with pyrenebutyric acid (PBA), to produce PBA-PFB mycolates, catalyzed by dicyclohexylcarbodiimide and pyrrolidinopyridine. R- represents the remainder of the mycolate molecule. C. Normal phase HPLC of PBA-PFB mycolates from bone samples and standard
<italic>M. tuberculosis</italic>
. D. Reverse phase HPLC of individual α -, methoxy- and ketomycolic acid PBA-PFB derivatives from bone samples and standard
<italic>M. tuberculosis</italic>
. The number of carbons in the individual underivatized mycolic acids is shown.</p>
<p>(0.83 MB TIF)</p>
</caption>
<media xlink:href="pone.0003426.s008.tif" mimetype="image" mime-subtype="tiff">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0003426.s009">
<label>Figure S3</label>
<caption>
<p>DNA sequence data. A.
<italic>M. tuberculosis</italic>
TbD1 flanking region (128 bp), obtained from the infant sample (5′-3′ strand). B.
<italic>M. tuberculosis</italic>
TbD1 flanking region (128 bp), obtained from the infant sample (3′-5′ strand). C.
<italic>M. tuberculosis</italic>
conserved membrane protein (CMP) region, obtained from the infant sample (5′-3′ strand only).</p>
<p>(12.09 MB TIF)</p>
</caption>
<media xlink:href="pone.0003426.s009.tif" mimetype="image" mime-subtype="tiff">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0003426.s010">
<label>Figure S4</label>
<caption>
<p>Repeated spoligotypes from the Atlit-Yam samples and controls. Each set of spoligotyping data (A–C) represents, from top to bottom,
<italic>M. tuberculosis</italic>
,
<italic>M. bovis</italic>
(BCG) controls, Atlit Yam female and Atlit Yam infant. D. Diagram of spoligotyping data, including
<italic>M. africanum</italic>
spoligotypes (Donoghue et al 2004), and a consensus pattern based on one or more positive results.</p>
<p>(5.61 MB TIF)</p>
</caption>
<media xlink:href="pone.0003426.s010.tif" mimetype="image" mime-subtype="tiff">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
</sec>
</body>
<back>
<ack>
<p>We thank Kim Vernon for laboratory assistance in Jerusalem. G. Michael Taylor (UCL) supplied primers for the RD2 and CMP regions, and kindly prepared the PCR products for sequencing. He and Professor Robin Weiss, Wohl Virion Centre, Division of Infection and Immunity, UCL are thanked for their constructive criticism.</p>
</ack>
<ref-list>
<title>References</title>
<ref id="pone.0003426-World1">
<label>1</label>
<citation citation-type="other">
<collab>World Health Organisation</collab>
<year>2008</year>
<article-title>Tuberculosis. Fact sheet 104.</article-title>
<comment>Revised April 2008. Available:
<ext-link ext-link-type="uri" xlink:href="http://www.who.int/tb/publications/2008/factsheet_april08.pdf">http://www.who.int/tb/publications/2008/factsheet_april08.pdf</ext-link>
Accessed 2008 Jun 2</comment>
</citation>
</ref>
<ref id="pone.0003426-Hirsh1">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hirsh</surname>
<given-names>AE</given-names>
</name>
<name>
<surname>Tsolaki</surname>
<given-names>AG</given-names>
</name>
<name>
<surname>DeRiemer</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Feldman</surname>
<given-names>MW</given-names>
</name>
<name>
<surname>Small</surname>
<given-names>PM</given-names>
</name>
</person-group>
<year>2004</year>
<article-title>Stable association between strains of
<italic>Mycobacterium tuberculosis</italic>
and their human host populations.</article-title>
<source>Proc Natl Acad Sci USA</source>
<volume>101</volume>
<fpage>4871</fpage>
<lpage>4876</lpage>
<pub-id pub-id-type="pmid">15041743</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Hardie1">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hardie</surname>
<given-names>RM</given-names>
</name>
<name>
<surname>Watson</surname>
<given-names>JM</given-names>
</name>
</person-group>
<year>1992</year>
<article-title>
<italic>Mycobacterium bovis</italic>
in England and Wales: past, present and future.</article-title>
<source>Epidemiol Infect</source>
<volume>109</volume>
<fpage>23</fpage>
<lpage>33</lpage>
<pub-id pub-id-type="pmid">1499671</pub-id>
</citation>
</ref>
<ref id="pone.0003426-OReilly1">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>O'Reilly</surname>
<given-names>LM</given-names>
</name>
<name>
<surname>Daborn</surname>
<given-names>CJ</given-names>
</name>
</person-group>
<year>1995</year>
<article-title>The epidemiology of
<italic>Mycobacterium bovis</italic>
infections in animals and man: a review.</article-title>
<source>Tuber Lung Dis 76 Suppl</source>
<volume>1</volume>
<fpage>1</fpage>
<lpage>46</lpage>
</citation>
</ref>
<ref id="pone.0003426-Ortner1">
<label>5</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Ortner</surname>
<given-names>DJ</given-names>
</name>
<name>
<surname>Putschar</surname>
<given-names>WG</given-names>
</name>
</person-group>
<year>1981</year>
<source>Identification of pathological conditions on human skeletal remains</source>
<publisher-loc>Washington DC</publisher-loc>
<publisher-name>Smithsonian Institution Press</publisher-name>
</citation>
</ref>
<ref id="pone.0003426-Zink1">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zink</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Haas</surname>
<given-names>CJ</given-names>
</name>
<name>
<surname>Reischl</surname>
<given-names>U</given-names>
</name>
<name>
<surname>Szeimies</surname>
<given-names>U</given-names>
</name>
<name>
<surname>Nerlich</surname>
<given-names>AG</given-names>
</name>
</person-group>
<year>2001</year>
<article-title>Molecular analysis of skeletal tuberculosis in an ancient Egyptian population.</article-title>
<source>J Med Microbiol</source>
<volume>50</volume>
<fpage>355</fpage>
<lpage>366</lpage>
<pub-id pub-id-type="pmid">11289521</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Nuorala1">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nuorala</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Götherström</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Ahlström</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Donoghue</surname>
<given-names>HD</given-names>
</name>
<name>
<surname>Spigelman</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<year>2004</year>
<article-title>MTB complex DNA in a Scandinavian Neolithic passage grave (Theses and Papers in Scientific Archaeology 6, Archaeological Research Laboratory, Stockholm University), paper I</article-title>
</citation>
</ref>
<ref id="pone.0003426-Formicola1">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Formicola</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Milanesi</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Scarsini</surname>
<given-names>C</given-names>
</name>
</person-group>
<year>1987</year>
<article-title>Evidence of spinal tuberculosis at the beginning of the fourth millennium BC from Arene Candide cave (Liguria, Italy).</article-title>
<source>Am J Phys Anthropol</source>
<volume>72</volume>
<fpage>1</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="pmid">3826326</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Canci1">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Canci</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Minozzi</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Borgognini Tarli</surname>
<given-names>SM</given-names>
</name>
</person-group>
<year>1996</year>
<article-title>New evidence of tuberculous spondylitis from Neolithic Liguria (Italy).</article-title>
<source>Int J Osteoarchaeol</source>
<volume>6</volume>
<fpage>497</fpage>
<lpage>501</lpage>
</citation>
</ref>
<ref id="pone.0003426-Rothschild1">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rothschild</surname>
<given-names>BM</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>LD</given-names>
</name>
</person-group>
<year>2003</year>
<article-title>Frequency of pathology in a large natural sample from Natural Trap Cave with special remarks on erosive disease in the Pleistocene.</article-title>
<source>Reumatismo</source>
<volume>55</volume>
<fpage>58</fpage>
<lpage>65</lpage>
<pub-id pub-id-type="pmid">12649703</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Rothschild2">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rothschild</surname>
<given-names>BM</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>LD</given-names>
</name>
<name>
<surname>Lev</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Bercovier</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Bar-Gal</surname>
<given-names>GK</given-names>
</name>
<etal></etal>
</person-group>
<year>2001</year>
<article-title>
<italic>Mycobacterium tuberculosis</italic>
complex DNA from an extinct bison dated 17,000 years before the present.</article-title>
<source>Clin Infect Dis</source>
<volume>33</volume>
<fpage>305</fpage>
<lpage>311</lpage>
<pub-id pub-id-type="pmid">11438894</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Steinbock1">
<label>12</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Steinbock</surname>
<given-names>RT</given-names>
</name>
</person-group>
<year>1976</year>
<source>Paleopathological diagnosis and interpretation: Bone disease in ancient human populations</source>
<publisher-loc>Springfield, Illinois</publisher-loc>
<publisher-name>Charles Thomas</publisher-name>
</citation>
</ref>
<ref id="pone.0003426-Manchester1">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Manchester</surname>
<given-names>K</given-names>
</name>
</person-group>
<year>1984</year>
<article-title>Tuberculosis and leprosy in antiquity: an interpretation.</article-title>
<source>Med History</source>
<volume>28</volume>
<fpage>162</fpage>
<lpage>173</lpage>
</citation>
</ref>
<ref id="pone.0003426-Clark1">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Clark</surname>
<given-names>GA</given-names>
</name>
<name>
<surname>Kelley</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Grange</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Hill</surname>
<given-names>MC</given-names>
</name>
</person-group>
<year>1987</year>
<article-title>The evolution of mycobacterial disease in human populations. A reevaluation.</article-title>
<source>Curr Anthropol</source>
<volume>28</volume>
<fpage>45</fpage>
<lpage>62</lpage>
<pub-id pub-id-type="pmid">11618572</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Parsons1">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parsons</surname>
<given-names>LM</given-names>
</name>
<name>
<surname>Brosch</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Cole</surname>
<given-names>ST</given-names>
</name>
<name>
<surname>Somoskövi</surname>
<given-names>Á</given-names>
</name>
<name>
<surname>Loder</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<year>2002</year>
<article-title>Rapid and simple approach for identification of
<italic>Mycobacterium tuberculosis</italic>
complex isolates by PCR-based genomic deletion analysis.</article-title>
<source>J Clin Microbiol</source>
<volume>40</volume>
<fpage>2339</fpage>
<lpage>2345</lpage>
<pub-id pub-id-type="pmid">12089245</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Brosch1">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brosch</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Gordon</surname>
<given-names>SV</given-names>
</name>
<name>
<surname>Marmiesse</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Brodin</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Buchreiser</surname>
<given-names>C</given-names>
</name>
<etal></etal>
</person-group>
<year>2002</year>
<article-title>A new evolutionary scenario for the
<italic>Mycobacterium tuberculosis</italic>
complex.</article-title>
<source>Proc Natl Acad Sci USA</source>
<volume>99</volume>
<fpage>3684</fpage>
<lpage>3689</lpage>
<pub-id pub-id-type="pmid">11891304</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Mostowy1">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mostowy</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Cousins</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Brinkman</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Aranaz</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Behr</surname>
<given-names>MA</given-names>
</name>
</person-group>
<year>2002</year>
<article-title>Genomic deletions suggest a phylogeny for the
<italic>Mycobacterium tuberculosis</italic>
complex.</article-title>
<source>J Infect Dis</source>
<volume>186</volume>
<fpage>74</fpage>
<lpage>80</lpage>
<pub-id pub-id-type="pmid">12089664</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Kappelman1">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kappelman</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Alçiçek</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Kazanci</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Schultz</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ozkul</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<year>2008</year>
<article-title>First
<italic>Homo erectus</italic>
from Turkey and implications for migrations into temperate Eurasia.</article-title>
<source>Am J Phys Anthropol</source>
<volume>135</volume>
<fpage>110</fpage>
<lpage>116</lpage>
<pub-id pub-id-type="pmid">18067194</pub-id>
</citation>
</ref>
<ref id="pone.0003426-McMichael1">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McMichael</surname>
<given-names>AJ</given-names>
</name>
</person-group>
<year>2004</year>
<article-title>Environmental and social influences on emerging infectious diseases: past, present and future.</article-title>
<source>Phil Trans R Soc Lond B</source>
<volume>359</volume>
<fpage>1049</fpage>
<lpage>1058</lpage>
<pub-id pub-id-type="pmid">15306389</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Cohen1">
<label>20</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Cohen</surname>
<given-names>MN</given-names>
</name>
<name>
<surname>Armelagos</surname>
<given-names>GJ</given-names>
</name>
</person-group>
<year>1984</year>
<article-title>Paleopathology at the origins of agriculture: editors' summation.</article-title>
<person-group person-group-type="editor">
<name>
<surname>Cohen</surname>
<given-names>MN</given-names>
</name>
<name>
<surname>Armelagos</surname>
<given-names>GJ</given-names>
</name>
</person-group>
<source>Paleopathology at the origins of agriculture</source>
<publisher-loc>New York</publisher-loc>
<publisher-name>Academic Press</publisher-name>
<fpage>585</fpage>
<lpage>601</lpage>
</citation>
</ref>
<ref id="pone.0003426-Weiss1">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weiss</surname>
<given-names>RA</given-names>
</name>
<name>
<surname>McMichael</surname>
<given-names>AJ</given-names>
</name>
</person-group>
<year>2004</year>
<article-title>Social and environmental risk factors in the emergence of infectious diseases.</article-title>
<source>Nature Med</source>
<volume>10</volume>
<issue>Suppl</issue>
<fpage>S70</fpage>
<lpage>S76</lpage>
<pub-id pub-id-type="pmid">15577934</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Galili1">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Galili</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Weinstein-Evron</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hershkovitz</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Gopher</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Kislev</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<year>1993</year>
<article-title>Atlit-Yam: A prehistoric site on the sea floor off the Israeli coast.</article-title>
<source>J Field Archaeol</source>
<volume>20</volume>
<fpage>133</fpage>
<lpage>157</lpage>
</citation>
</ref>
<ref id="pone.0003426-Galili2">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Galili</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Rosen</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Gopher</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Horwitz</surname>
<given-names>LK</given-names>
</name>
</person-group>
<year>2002</year>
<article-title>The emergence and dispersion of the Eastern Mediterranean fishing village: evidence from submerged Neolithic settlements off the Carmel coast, Israel.</article-title>
<source>J Medit Archaeol</source>
<volume>15</volume>
<fpage>167</fpage>
<lpage>198</lpage>
</citation>
</ref>
<ref id="pone.0003426-Hershkovitz1">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hershkovitz</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Galili</surname>
<given-names>E</given-names>
</name>
</person-group>
<year>1990</year>
<article-title>8000 year-old human remains on the sea floor near Atlit, Israel.</article-title>
<source>Hum Evol</source>
<volume>5</volume>
<fpage>319</fpage>
<lpage>358</lpage>
</citation>
</ref>
<ref id="pone.0003426-Galili3">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Galili</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Eshed</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Gopher</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Hershkovitz</surname>
<given-names>I</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Burial practices at the submerged pre-pottery Neolithic C site of Atlit-Yam, Northern Coast of Israel.</article-title>
<source>BASOR</source>
<volume>339</volume>
<fpage>1</fpage>
<lpage>19</lpage>
</citation>
</ref>
<ref id="pone.0003426-Kamerbeek1">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kamerbeek</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Schouls</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Kolk</surname>
<given-names>A</given-names>
</name>
<name>
<surname>van Agterveld</surname>
<given-names>M</given-names>
</name>
<name>
<surname>van Soolingen</surname>
<given-names>D</given-names>
</name>
<etal></etal>
</person-group>
<year>1997</year>
<article-title>Simultaneous detection and strain identification of
<italic>Mycobacterium tuberculosis</italic>
for diagnosis and epidemiology.</article-title>
<source>J Clin Microbiol</source>
<volume>35</volume>
<fpage>907</fpage>
<lpage>914</lpage>
<pub-id pub-id-type="pmid">9157152</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Donoghue1">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Donoghue</surname>
<given-names>HD</given-names>
</name>
<name>
<surname>Spigelman</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Zias</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Gernaey-Child</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Minnikin</surname>
<given-names>DE</given-names>
</name>
</person-group>
<year>1998</year>
<article-title>
<italic>Mycobacterium tuberculosis</italic>
complex DNA in calcified pleura from remains 1400 years old.</article-title>
<source>Lett Appl Microbiol</source>
<volume>27</volume>
<fpage>265</fpage>
<lpage>269</lpage>
<pub-id pub-id-type="pmid">9830142</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Gernaey1">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gernaey</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Minnikin</surname>
<given-names>DE</given-names>
</name>
<name>
<surname>Copley</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>Dixon</surname>
<given-names>RA</given-names>
</name>
<name>
<surname>Middleton</surname>
<given-names>JC</given-names>
</name>
<etal></etal>
</person-group>
<year>2001</year>
<article-title>Mycolic acids and ancient DNA confirm an osteological diagnosis of tuberculosis.</article-title>
<source>Tuberculosis (Edinb)</source>
<volume>81</volume>
<fpage>259</fpage>
<lpage>265</lpage>
<pub-id pub-id-type="pmid">11584593</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Hershkovitz2">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hershkovitz</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Greenwald</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Latimer</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Jellema</surname>
<given-names>LM</given-names>
</name>
<name>
<surname>Wish-Baratz</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2002</year>
<article-title>Serpens endocrania symmetrica (SES): a new term and a possible clue for identifying intrathoracic disease in skeletal populations.</article-title>
<source>Am J Phys Anthropol</source>
<volume>118</volume>
<fpage>201</fpage>
<lpage>216</lpage>
<pub-id pub-id-type="pmid">12115277</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Mensforth1">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mensforth</surname>
<given-names>RP</given-names>
</name>
<name>
<surname>Lovejoy</surname>
<given-names>CO</given-names>
</name>
<name>
<surname>Lallo</surname>
<given-names>JW</given-names>
</name>
<name>
<surname>Armelagos</surname>
<given-names>GJ</given-names>
</name>
</person-group>
<year>1978</year>
<article-title>The role of constitutional factors, diet, and infectious disease in the etiology of porotic hyperostosis and periosteal reactions in prehistoric infants and children.</article-title>
<source>Med Anthropol</source>
<volume>2</volume>
<fpage>1</fpage>
<lpage>59</lpage>
</citation>
</ref>
<ref id="pone.0003426-Rothschild3">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rothschild</surname>
<given-names>BM</given-names>
</name>
<name>
<surname>Rothschild</surname>
<given-names>C</given-names>
</name>
</person-group>
<year>1998</year>
<article-title>Recognition of hypertrophic osteoarthropathy in skeletal remains.</article-title>
<source>J Rheumatol</source>
<volume>25</volume>
<fpage>2221</fpage>
<lpage>2227</lpage>
<pub-id pub-id-type="pmid">9818668</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Mays1">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mays</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>GM</given-names>
</name>
</person-group>
<year>2002</year>
<article-title>Osteological and biomolecular study of two possible cases of Hypertrophic Osteoarthropathy from Mediaeval England.</article-title>
<source>Am J Phys Anthropol</source>
<volume>29</volume>
<fpage>1267</fpage>
<lpage>1276</lpage>
</citation>
</ref>
<ref id="pone.0003426-Eisenach1">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eisenach</surname>
<given-names>KD</given-names>
</name>
<name>
<surname>Cave</surname>
<given-names>MD</given-names>
</name>
<name>
<surname>Bates</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Crawford</surname>
<given-names>JT</given-names>
</name>
</person-group>
<year>1990</year>
<article-title>Polymerase chain reaction amplification of a repetitive DNA sequence specific for
<italic>Mycobacterium tuberculosis</italic>
.</article-title>
<source>J Infect Dis</source>
<volume>161</volume>
<fpage>977</fpage>
<lpage>981</lpage>
<pub-id pub-id-type="pmid">2109022</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Taylor1">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taylor</surname>
<given-names>GM</given-names>
</name>
<name>
<surname>Crossey</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Saldanha</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Waldron</surname>
<given-names>T</given-names>
</name>
</person-group>
<year>1996</year>
<article-title>
<italic>Mycobacterium tuberculosis</italic>
identified in mediaeval human skeletal remains using polymerase chain reaction.</article-title>
<source>J Archaeol Sci</source>
<volume>23</volume>
<fpage>789</fpage>
<lpage>798</lpage>
</citation>
</ref>
<ref id="pone.0003426-Taylor2">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taylor</surname>
<given-names>GM</given-names>
</name>
<name>
<surname>Stewart</surname>
<given-names>GR</given-names>
</name>
<name>
<surname>Cooke</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Chaplin</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Ladva</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<year>2003</year>
<article-title>Koch's Bacillus – a look at the first isolate of
<italic>Mycobacterium tuberculosis</italic>
from a modern perspective.</article-title>
<source>Microbiology</source>
<volume>149</volume>
<fpage>3213</fpage>
<lpage>3220</lpage>
<pub-id pub-id-type="pmid">14600233</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Minnikin1">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Minnikin</surname>
<given-names>DE</given-names>
</name>
<name>
<surname>Bolton</surname>
<given-names>DE</given-names>
</name>
<name>
<surname>Dobson</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Mallet</surname>
<given-names>AI</given-names>
</name>
</person-group>
<year>1987</year>
<article-title>Mass spectrometric analysis of multimethyl branched fatty acids and phthiocerols from clinically-significant mycobacteria.</article-title>
<source>Proc Jap Soc Med Mass Spectrom</source>
<volume>12</volume>
<fpage>23</fpage>
<lpage>32</lpage>
</citation>
</ref>
<ref id="pone.0003426-Drancourt1">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Drancourt</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Palaeomicrobiology: current issues and perspectives.</article-title>
<source>Nat Rev Microbiol</source>
<volume>3</volume>
<fpage>23</fpage>
<lpage>35</lpage>
<pub-id pub-id-type="pmid">15608697</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Minnikin2">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Minnikin</surname>
<given-names>DE</given-names>
</name>
<name>
<surname>Kremer</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Dover</surname>
<given-names>LG</given-names>
</name>
<name>
<surname>Besra</surname>
<given-names>GS</given-names>
</name>
</person-group>
<year>2002</year>
<article-title>The methyl-branched fortifications of
<italic>Mycobacterium tuberculosis</italic>
.</article-title>
<source>Chem Biol</source>
<volume>9</volume>
<fpage>545</fpage>
<lpage>553</lpage>
<pub-id pub-id-type="pmid">12031661</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Spigelman1">
<label>39</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Spigelman</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Donoghue</surname>
<given-names>HD</given-names>
</name>
</person-group>
<year>2003</year>
<article-title>Palaeobacteriology with special reference to pathogenic mycobacteria.</article-title>
<person-group person-group-type="editor">
<name>
<surname>Greenblatt</surname>
<given-names>CL</given-names>
</name>
<name>
<surname>Spigelman</surname>
<given-names>M</given-names>
</name>
</person-group>
<source>Emerging pathogens: archaeology, ecology and evolution of infectious disease</source>
<publisher-loc>Oxford</publisher-loc>
<publisher-name>Oxford University Press</publisher-name>
<fpage>175</fpage>
<lpage>188</lpage>
</citation>
</ref>
<ref id="pone.0003426-Walls1">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Walls</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Shingadia</surname>
<given-names>D</given-names>
</name>
</person-group>
<year>2004</year>
<article-title>Global epidemiology of pediatric tuberculosis.</article-title>
<source>J Infection</source>
<volume>48</volume>
<fpage>13</fpage>
<lpage>22</lpage>
</citation>
</ref>
<ref id="pone.0003426-Starke1">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Starke</surname>
<given-names>JR</given-names>
</name>
</person-group>
<year>2003</year>
<article-title>Pediatric tuberculosis: time for a new approach.</article-title>
<source>Tuberculosis (Edinb)</source>
<volume>83</volume>
<fpage>208</fpage>
<lpage>212</lpage>
<pub-id pub-id-type="pmid">12758213</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Donoghue2">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Donoghue</surname>
<given-names>HD</given-names>
</name>
<name>
<surname>Spigelman</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Greenblatt</surname>
<given-names>CL</given-names>
</name>
<name>
<surname>Lev-Maor</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Kahila Bar-Gal</surname>
<given-names>G</given-names>
</name>
<etal></etal>
</person-group>
<year>2004</year>
<article-title>Tuberculosis: from prehistory to Robert Koch, as revealed by ancient DNA.</article-title>
<source>Lancet Infect Dis</source>
<volume>4</volume>
<fpage>584</fpage>
<lpage>592</lpage>
<pub-id pub-id-type="pmid">15336226</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Huard1">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huard</surname>
<given-names>RC</given-names>
</name>
<name>
<surname>Fabre</surname>
<given-names>M</given-names>
</name>
<name>
<surname>de Haas</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Lazzarini</surname>
<given-names>LC</given-names>
</name>
<name>
<surname>van Soolingen</surname>
<given-names>D</given-names>
</name>
<etal></etal>
</person-group>
<year>2006</year>
<article-title>Novel genetic polymorphisms that further delineate the phylogeny of the
<italic>Mycobacterium tuberculosis</italic>
complex.</article-title>
<source>J Bacteriol</source>
<volume>188</volume>
<fpage>4271</fpage>
<lpage>4287</lpage>
<pub-id pub-id-type="pmid">16740934</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Zink2">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zink</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Sola</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Reischl</surname>
<given-names>U</given-names>
</name>
<name>
<surname>Grabner</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Rastogi</surname>
<given-names>N</given-names>
</name>
<etal></etal>
</person-group>
<year>2003</year>
<article-title>Characterization of
<italic>Mycobacterium tuberculosis</italic>
complex DNAs from Egyptian mummies by spoligotyping.</article-title>
<source>J Clin Microbiol</source>
<volume>41</volume>
<fpage>359</fpage>
<lpage>367</lpage>
<pub-id pub-id-type="pmid">12517873</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Taylor3">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taylor</surname>
<given-names>GM</given-names>
</name>
<name>
<surname>Young</surname>
<given-names>DB</given-names>
</name>
<name>
<surname>Mays</surname>
<given-names>SA</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Genotypic analysis of the earliest known prehistoric case of tuberculosis in Britain.</article-title>
<source>J Clin Microbiol</source>
<volume>43</volume>
<fpage>2236</fpage>
<lpage>2240</lpage>
<pub-id pub-id-type="pmid">15872248</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Sreevatsan1">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sreevatsan</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Stockbauer</surname>
<given-names>KE</given-names>
</name>
<name>
<surname>Connell</surname>
<given-names>ND</given-names>
</name>
<name>
<surname>Kreiswirth</surname>
<given-names>BN</given-names>
</name>
<etal></etal>
</person-group>
<year>1997</year>
<article-title>Restricted structural gene polymorphism in the
<italic>Mycobacterium tuberculosis</italic>
complex indicates evolutionarily recent global dissemination.</article-title>
<source>Proc Natl Acad Sci U S A</source>
<volume>94</volume>
<fpage>9869</fpage>
<lpage>9874</lpage>
<pub-id pub-id-type="pmid">9275218</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Hughes1">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hughes</surname>
<given-names>AL</given-names>
</name>
<name>
<surname>Friedman</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Murray</surname>
<given-names>M</given-names>
</name>
</person-group>
<year>2002</year>
<article-title>Genomewide pattern of synonymous nucleotide substitution in two complete genomes of
<italic>Mycobacterium tuberculosis</italic>
.</article-title>
<source>Emerg Infect Dis</source>
<volume>8</volume>
<fpage>1342</fpage>
<lpage>1346</lpage>
<pub-id pub-id-type="pmid">12453367</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Gutierrez1">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gutierrez</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Brisse</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Brosch</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Fabre</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Omaïs</surname>
<given-names>B</given-names>
</name>
<etal></etal>
</person-group>
<year>2005</year>
<article-title>Ancient origin and gene mosaicism of the progenitor of
<italic>Mycobacterium tuberculosis</italic>
.</article-title>
<source>PLoS Pathog</source>
<volume>1</volume>
<fpage>55</fpage>
<lpage>61</lpage>
</citation>
</ref>
<ref id="pone.0003426-Daniel1">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Daniel</surname>
<given-names>TM</given-names>
</name>
</person-group>
<year>2006</year>
<article-title>The history of tuberculosis.</article-title>
<source>Resp Med</source>
<volume>100</volume>
<fpage>1862</fpage>
<lpage>1870</lpage>
</citation>
</ref>
<ref id="pone.0003426-PearceDuvet1">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pearce-Duvet</surname>
<given-names>JMC</given-names>
</name>
</person-group>
<year>2006</year>
<article-title>The origin of human pathogens: evaluating the role of agriculture and domestic animals in the evolution of human disease.</article-title>
<source>Biol Rev Camb Philos Soc</source>
<volume>81</volume>
<fpage>369</fpage>
<lpage>382</lpage>
<pub-id pub-id-type="pmid">16672105</pub-id>
</citation>
</ref>
<ref id="pone.0003426-Wirth1">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wirth</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Hildebrand</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Allix-Béguec</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Wölbeling</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Kubica</surname>
<given-names>T</given-names>
</name>
<etal></etal>
</person-group>
<year>2008</year>
<article-title>Origin, Spread and Demography of the
<italic>Mycobacterium tuberculosis</italic>
Complex.</article-title>
<source>PLoS Pathogens</source>
<comment>4(9): e1000160 doi:10.1371/journal.ppat.1000160</comment>
</citation>
</ref>
</ref-list>
<fn-group>
<fn fn-type="conflict">
<p>
<bold>Competing Interests: </bold>
The authors have declared that no competing interests exist.</p>
</fn>
<fn fn-type="financial-disclosure">
<p>
<bold>Funding: </bold>
The CARE, MAFCAF and Dan David Foundation supported the archaeological and anthropological work. A grant from The Leverhulme Trust (F/125/AK) to AMG and DEM is acknowledged; DEM is a Leverhulme Emeritus Fellow. MS is funded by the Deutsche Forschungsgemeinschaft (DFG) for a trilateral project between German, Israeli and Palestinian researchers. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</p>
</fn>
</fn-group>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Archeologie/explor/PaleopathV1/Data/Pmc/Corpus

HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000272 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000272 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Archeologie
   |area=    PaleopathV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     PMC:2565837
   |texte=   Detection and Molecular Characterization of 9000-Year-Old Mycobacterium tuberculosis from a Neolithic Settlement in the Eastern Mediterranean
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i   -Sk "pubmed:18923677" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd   \
       | NlmPubMed2Wicri -a PaleopathV1
Wicri

This area was generated with Dilib version V0.6.27.
Data generation: Mon Mar 20 13:15:48 2017. Site generation: Sun Mar 10 11:28:25 2024