Corpus
Pmc
Racine
Corpus
Checkpoint
Pmc
Racine
Pmc
Exploration
Accueil
Racine
Racine

Serveur d'exploration MERS

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV

Identifieur interne : 001214 ( Pmc/Corpus ); précédent : 001213; suivant : 001215

Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV

Auteurs : Yuting Jiang ; Junfeng Li ; Yue Teng ; Hong Sun ; Guang Tian ; Lei He ; Pei Li ; Yuehong Chen ; Yan Guo ; Jiangfan Li ; Guangyu Zhao ; Yusen Zhou ; Shihui Sun

Source :

RBID : PMC:6356766

Abstract

Middle East respiratory syndrome coronavirus (MERS-CoV) is a highly pathogenic virus with a crude mortality rate of ~35%. Previously, we established a human DPP4 transgenic (hDPP4-Tg) mouse model in which we studied complement overactivation-induced immunopathogenesis. Here, to better understand the pathogenesis of MERS-CoV, we studied the role of pyroptosis in THP-1 cells and hDPP4 Tg mice with MERS-CoV infection. We found that MERS-CoV infection induced pyroptosis and over-activation of complement in human macrophages. The hDPP4-Tg mice infected with MERS-CoV overexpressed caspase-1 in the spleen and showed high IL-1β levels in serum, suggesting that pyroptosis occurred after infection. However, when the C5a-C5aR1 axis was blocked by an anti-C5aR1 antibody (Ab), expression of caspase-1 and IL-1β fell. These data indicate that MERS-CoV infection induces overactivation of complement, which may contribute to pyroptosis and inflammation. Pyroptosis and inflammation were suppressed by inhibiting C5aR1. These results will further our understanding of the pathogenesis of MERS-CoV infection.


Url:
DOI: 10.3390/v11010039
PubMed: 30634407
PubMed Central: 6356766

Links to Exploration step

PMC:6356766

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV</title>
<author>
<name sortKey="Jiang, Yuting" sort="Jiang, Yuting" uniqKey="Jiang Y" first="Yuting" last="Jiang">Yuting Jiang</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Junfeng" sort="Li, Junfeng" uniqKey="Li J" first="Junfeng" last="Li">Junfeng Li</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Teng, Yue" sort="Teng, Yue" uniqKey="Teng Y" first="Yue" last="Teng">Yue Teng</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sun, Hong" sort="Sun, Hong" uniqKey="Sun H" first="Hong" last="Sun">Hong Sun</name>
<affiliation>
<nlm:aff id="af2-viruses-11-00039">Department of Basic Medical Sciences, North China University of Science and Technology, Tangshan 063210, China;
<email>xun1@hotmail.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tian, Guang" sort="Tian, Guang" uniqKey="Tian G" first="Guang" last="Tian">Guang Tian</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="He, Lei" sort="He, Lei" uniqKey="He L" first="Lei" last="He">Lei He</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Pei" sort="Li, Pei" uniqKey="Li P" first="Pei" last="Li">Pei Li</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chen, Yuehong" sort="Chen, Yuehong" uniqKey="Chen Y" first="Yuehong" last="Chen">Yuehong Chen</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Guo, Yan" sort="Guo, Yan" uniqKey="Guo Y" first="Yan" last="Guo">Yan Guo</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Jiangfan" sort="Li, Jiangfan" uniqKey="Li J" first="Jiangfan" last="Li">Jiangfan Li</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhao, Guangyu" sort="Zhao, Guangyu" uniqKey="Zhao G" first="Guangyu" last="Zhao">Guangyu Zhao</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhou, Yusen" sort="Zhou, Yusen" uniqKey="Zhou Y" first="Yusen" last="Zhou">Yusen Zhou</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af3-viruses-11-00039">Institute of Medical and Pharmaceutical Sciences, Zhengzhou University, Zhengzhou 450052, China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sun, Shihui" sort="Sun, Shihui" uniqKey="Sun S" first="Shihui" last="Sun">Shihui Sun</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">30634407</idno>
<idno type="pmc">6356766</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6356766</idno>
<idno type="RBID">PMC:6356766</idno>
<idno type="doi">10.3390/v11010039</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">001214</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">001214</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV</title>
<author>
<name sortKey="Jiang, Yuting" sort="Jiang, Yuting" uniqKey="Jiang Y" first="Yuting" last="Jiang">Yuting Jiang</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Junfeng" sort="Li, Junfeng" uniqKey="Li J" first="Junfeng" last="Li">Junfeng Li</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Teng, Yue" sort="Teng, Yue" uniqKey="Teng Y" first="Yue" last="Teng">Yue Teng</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sun, Hong" sort="Sun, Hong" uniqKey="Sun H" first="Hong" last="Sun">Hong Sun</name>
<affiliation>
<nlm:aff id="af2-viruses-11-00039">Department of Basic Medical Sciences, North China University of Science and Technology, Tangshan 063210, China;
<email>xun1@hotmail.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tian, Guang" sort="Tian, Guang" uniqKey="Tian G" first="Guang" last="Tian">Guang Tian</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="He, Lei" sort="He, Lei" uniqKey="He L" first="Lei" last="He">Lei He</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Pei" sort="Li, Pei" uniqKey="Li P" first="Pei" last="Li">Pei Li</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chen, Yuehong" sort="Chen, Yuehong" uniqKey="Chen Y" first="Yuehong" last="Chen">Yuehong Chen</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Guo, Yan" sort="Guo, Yan" uniqKey="Guo Y" first="Yan" last="Guo">Yan Guo</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Jiangfan" sort="Li, Jiangfan" uniqKey="Li J" first="Jiangfan" last="Li">Jiangfan Li</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhao, Guangyu" sort="Zhao, Guangyu" uniqKey="Zhao G" first="Guangyu" last="Zhao">Guangyu Zhao</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhou, Yusen" sort="Zhou, Yusen" uniqKey="Zhou Y" first="Yusen" last="Zhou">Yusen Zhou</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af3-viruses-11-00039">Institute of Medical and Pharmaceutical Sciences, Zhengzhou University, Zhengzhou 450052, China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sun, Shihui" sort="Sun, Shihui" uniqKey="Sun S" first="Shihui" last="Sun">Shihui Sun</name>
<affiliation>
<nlm:aff id="af1-viruses-11-00039">State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Viruses</title>
<idno type="eISSN">1999-4915</idno>
<imprint>
<date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Middle East respiratory syndrome coronavirus (MERS-CoV) is a highly pathogenic virus with a crude mortality rate of ~35%. Previously, we established a human DPP4 transgenic (hDPP4-Tg) mouse model in which we studied complement overactivation-induced immunopathogenesis. Here, to better understand the pathogenesis of MERS-CoV, we studied the role of pyroptosis in THP-1 cells and hDPP4 Tg mice with MERS-CoV infection. We found that MERS-CoV infection induced pyroptosis and over-activation of complement in human macrophages. The hDPP4-Tg mice infected with MERS-CoV overexpressed caspase-1 in the spleen and showed high IL-1β levels in serum, suggesting that pyroptosis occurred after infection. However, when the C5a-C5aR1 axis was blocked by an anti-C5aR1 antibody (Ab), expression of caspase-1 and IL-1β fell. These data indicate that MERS-CoV infection induces overactivation of complement, which may contribute to pyroptosis and inflammation. Pyroptosis and inflammation were suppressed by inhibiting C5aR1. These results will further our understanding of the pathogenesis of MERS-CoV infection.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Arabi, Y M" uniqKey="Arabi Y">Y.M. Arabi</name>
</author>
<author>
<name sortKey="Arifi, A A" uniqKey="Arifi A">A.A. Arifi</name>
</author>
<author>
<name sortKey="Balkhy, H H" uniqKey="Balkhy H">H.H. Balkhy</name>
</author>
<author>
<name sortKey="Najm, H" uniqKey="Najm H">H. Najm</name>
</author>
<author>
<name sortKey="Aldawood, A S" uniqKey="Aldawood A">A.S. Aldawood</name>
</author>
<author>
<name sortKey="Ghabashi, A" uniqKey="Ghabashi A">A. Ghabashi</name>
</author>
<author>
<name sortKey="Hawa, H" uniqKey="Hawa H">H. Hawa</name>
</author>
<author>
<name sortKey="Alothman, A" uniqKey="Alothman A">A. Alothman</name>
</author>
<author>
<name sortKey="Khaldi, A" uniqKey="Khaldi A">A. Khaldi</name>
</author>
<author>
<name sortKey="Al Raiy, B" uniqKey="Al Raiy B">B. Al Raiy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Assiri, A" uniqKey="Assiri A">A. Assiri</name>
</author>
<author>
<name sortKey="Al Tawfiq, J A" uniqKey="Al Tawfiq J">J.A. Al-Tawfiq</name>
</author>
<author>
<name sortKey="Al Rabeeah, A A" uniqKey="Al Rabeeah A">A.A. Al-Rabeeah</name>
</author>
<author>
<name sortKey="Al Rabiah, F A" uniqKey="Al Rabiah F">F.A. Al-Rabiah</name>
</author>
<author>
<name sortKey="Al Hajjar, S" uniqKey="Al Hajjar S">S. Al-Hajjar</name>
</author>
<author>
<name sortKey="Al Barrak, A" uniqKey="Al Barrak A">A. Al-Barrak</name>
</author>
<author>
<name sortKey="Flemban, H" uniqKey="Flemban H">H. Flemban</name>
</author>
<author>
<name sortKey="Al Nassir, W N" uniqKey="Al Nassir W">W.N. Al-Nassir</name>
</author>
<author>
<name sortKey="Balkhy, H H" uniqKey="Balkhy H">H.H. Balkhy</name>
</author>
<author>
<name sortKey="Al Hakeem, R F" uniqKey="Al Hakeem R">R.F. Al-Hakeem</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Al Abdallat, M M" uniqKey="Al Abdallat M">M.M. Al-Abdallat</name>
</author>
<author>
<name sortKey="Payne, D C" uniqKey="Payne D">D.C. Payne</name>
</author>
<author>
<name sortKey="Alqasrawi, S" uniqKey="Alqasrawi S">S. Alqasrawi</name>
</author>
<author>
<name sortKey="Rha, B" uniqKey="Rha B">B. Rha</name>
</author>
<author>
<name sortKey="Tohme, R A" uniqKey="Tohme R">R.A. Tohme</name>
</author>
<author>
<name sortKey="Abedi, G R" uniqKey="Abedi G">G.R. Abedi</name>
</author>
<author>
<name sortKey="Al Nsour, M" uniqKey="Al Nsour M">M. Al Nsour</name>
</author>
<author>
<name sortKey="Iblan, I" uniqKey="Iblan I">I. Iblan</name>
</author>
<author>
<name sortKey="Jarour, N" uniqKey="Jarour N">N. Jarour</name>
</author>
<author>
<name sortKey="Farag, N H" uniqKey="Farag N">N.H. Farag</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vande Walle, L" uniqKey="Vande Walle L">L. Vande Walle</name>
</author>
<author>
<name sortKey="Lamkanfi, M" uniqKey="Lamkanfi M">M. Lamkanfi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kanneganti, T D" uniqKey="Kanneganti T">T.D. Kanneganti</name>
</author>
<author>
<name sortKey="Body Malapel, M" uniqKey="Body Malapel M">M. Body-Malapel</name>
</author>
<author>
<name sortKey="Amer, A" uniqKey="Amer A">A. Amer</name>
</author>
<author>
<name sortKey="Park, J H" uniqKey="Park J">J.H. Park</name>
</author>
<author>
<name sortKey="Whitfield, J" uniqKey="Whitfield J">J. Whitfield</name>
</author>
<author>
<name sortKey="Franchi, L" uniqKey="Franchi L">L. Franchi</name>
</author>
<author>
<name sortKey="Taraporewala, Z F" uniqKey="Taraporewala Z">Z.F. Taraporewala</name>
</author>
<author>
<name sortKey="Miller, D" uniqKey="Miller D">D. Miller</name>
</author>
<author>
<name sortKey="Patton, J T" uniqKey="Patton J">J.T. Patton</name>
</author>
<author>
<name sortKey="Inohara, N" uniqKey="Inohara N">N. Inohara</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Joly, S" uniqKey="Joly S">S. Joly</name>
</author>
<author>
<name sortKey="Sutterwala, F S" uniqKey="Sutterwala F">F.S. Sutterwala</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mariathasan, S" uniqKey="Mariathasan S">S. Mariathasan</name>
</author>
<author>
<name sortKey="Weiss, D S" uniqKey="Weiss D">D.S. Weiss</name>
</author>
<author>
<name sortKey="Newton, K" uniqKey="Newton K">K. Newton</name>
</author>
<author>
<name sortKey="Mcbride, J" uniqKey="Mcbride J">J. McBride</name>
</author>
<author>
<name sortKey="O Ourke, K" uniqKey="O Ourke K">K. O’Rourke</name>
</author>
<author>
<name sortKey="Roose Girma, M" uniqKey="Roose Girma M">M. Roose-Girma</name>
</author>
<author>
<name sortKey="Lee, W P" uniqKey="Lee W">W.P. Lee</name>
</author>
<author>
<name sortKey="Weinrauch, Y" uniqKey="Weinrauch Y">Y. Weinrauch</name>
</author>
<author>
<name sortKey="Monack, D M" uniqKey="Monack D">D.M. Monack</name>
</author>
<author>
<name sortKey="Dixit, V M" uniqKey="Dixit V">V.M. Dixit</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shaw, O M" uniqKey="Shaw O">O.M. Shaw</name>
</author>
<author>
<name sortKey="Steiger, S" uniqKey="Steiger S">S. Steiger</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X. Liu</name>
</author>
<author>
<name sortKey="Hamilton, J A" uniqKey="Hamilton J">J.A. Hamilton</name>
</author>
<author>
<name sortKey="Harper, J L" uniqKey="Harper J">J.L. Harper</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dostert, C" uniqKey="Dostert C">C. Dostert</name>
</author>
<author>
<name sortKey="Petrilli, V" uniqKey="Petrilli V">V. Petrilli</name>
</author>
<author>
<name sortKey="Van Bruggen, R" uniqKey="Van Bruggen R">R. Van Bruggen</name>
</author>
<author>
<name sortKey="Steele, C" uniqKey="Steele C">C. Steele</name>
</author>
<author>
<name sortKey="Mossman, B T" uniqKey="Mossman B">B.T. Mossman</name>
</author>
<author>
<name sortKey="Tschopp, J" uniqKey="Tschopp J">J. Tschopp</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ding, J" uniqKey="Ding J">J. Ding</name>
</author>
<author>
<name sortKey="Wang, K" uniqKey="Wang K">K. Wang</name>
</author>
<author>
<name sortKey="Liu, W" uniqKey="Liu W">W. Liu</name>
</author>
<author>
<name sortKey="She, Y" uniqKey="She Y">Y. She</name>
</author>
<author>
<name sortKey="Sun, Q" uniqKey="Sun Q">Q. Sun</name>
</author>
<author>
<name sortKey="Shi, J" uniqKey="Shi J">J. Shi</name>
</author>
<author>
<name sortKey="Sun, H" uniqKey="Sun H">H. Sun</name>
</author>
<author>
<name sortKey="Wang, D C" uniqKey="Wang D">D.C. Wang</name>
</author>
<author>
<name sortKey="Shao, F" uniqKey="Shao F">F. Shao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schroder, K" uniqKey="Schroder K">K. Schroder</name>
</author>
<author>
<name sortKey="Tschopp, J" uniqKey="Tschopp J">J. Tschopp</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Al Sharif, W Z" uniqKey="Al Sharif W">W.Z. Al-Sharif</name>
</author>
<author>
<name sortKey="Sunyer, J O" uniqKey="Sunyer J">J.O. Sunyer</name>
</author>
<author>
<name sortKey="Lambris, J D" uniqKey="Lambris J">J.D. Lambris</name>
</author>
<author>
<name sortKey="Smith, L C" uniqKey="Smith L">L.C. Smith</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Levashina, E A" uniqKey="Levashina E">E.A. Levashina</name>
</author>
<author>
<name sortKey="Moita, L F" uniqKey="Moita L">L.F. Moita</name>
</author>
<author>
<name sortKey="Blandin, S" uniqKey="Blandin S">S. Blandin</name>
</author>
<author>
<name sortKey="Vriend, G" uniqKey="Vriend G">G. Vriend</name>
</author>
<author>
<name sortKey="Lagueux, M" uniqKey="Lagueux M">M. Lagueux</name>
</author>
<author>
<name sortKey="Kafatos, F C" uniqKey="Kafatos F">F.C. Kafatos</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Peng, Q" uniqKey="Peng Q">Q. Peng</name>
</author>
<author>
<name sortKey="Li, K" uniqKey="Li K">K. Li</name>
</author>
<author>
<name sortKey="Sacks, S H" uniqKey="Sacks S">S.H. Sacks</name>
</author>
<author>
<name sortKey="Zhou, W" uniqKey="Zhou W">W. Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Discipio, R G" uniqKey="Discipio R">R.G. DiScipio</name>
</author>
<author>
<name sortKey="Schraufstatter, I U" uniqKey="Schraufstatter I">I.U. Schraufstatter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jiang, Y" uniqKey="Jiang Y">Y. Jiang</name>
</author>
<author>
<name sortKey="Zhao, G" uniqKey="Zhao G">G. Zhao</name>
</author>
<author>
<name sortKey="Song, N" uniqKey="Song N">N. Song</name>
</author>
<author>
<name sortKey="Li, P" uniqKey="Li P">P. Li</name>
</author>
<author>
<name sortKey="Chen, Y" uniqKey="Chen Y">Y. Chen</name>
</author>
<author>
<name sortKey="Guo, Y" uniqKey="Guo Y">Y. Guo</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J. Li</name>
</author>
<author>
<name sortKey="Du, L" uniqKey="Du L">L. Du</name>
</author>
<author>
<name sortKey="Jiang, S" uniqKey="Jiang S">S. Jiang</name>
</author>
<author>
<name sortKey="Guo, R" uniqKey="Guo R">R. Guo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhao, G" uniqKey="Zhao G">G. Zhao</name>
</author>
<author>
<name sortKey="Jiang, Y" uniqKey="Jiang Y">Y. Jiang</name>
</author>
<author>
<name sortKey="Qiu, H" uniqKey="Qiu H">H. Qiu</name>
</author>
<author>
<name sortKey="Gao, T" uniqKey="Gao T">T. Gao</name>
</author>
<author>
<name sortKey="Zeng, Y" uniqKey="Zeng Y">Y. Zeng</name>
</author>
<author>
<name sortKey="Guo, Y" uniqKey="Guo Y">Y. Guo</name>
</author>
<author>
<name sortKey="Yu, H" uniqKey="Yu H">H. Yu</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J. Li</name>
</author>
<author>
<name sortKey="Kou, Z" uniqKey="Kou Z">Z. Kou</name>
</author>
<author>
<name sortKey="Du, L" uniqKey="Du L">L. Du</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhou, J" uniqKey="Zhou J">J. Zhou</name>
</author>
<author>
<name sortKey="Chu, H" uniqKey="Chu H">H. Chu</name>
</author>
<author>
<name sortKey="Li, C" uniqKey="Li C">C. Li</name>
</author>
<author>
<name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
<author>
<name sortKey="Cheng, Z S" uniqKey="Cheng Z">Z.S. Cheng</name>
</author>
<author>
<name sortKey="Poon, V K" uniqKey="Poon V">V.K. Poon</name>
</author>
<author>
<name sortKey="Sun, T" uniqKey="Sun T">T. Sun</name>
</author>
<author>
<name sortKey="Lau, C C" uniqKey="Lau C">C.C. Lau</name>
</author>
<author>
<name sortKey="Wong, K K" uniqKey="Wong K">K.K. Wong</name>
</author>
<author>
<name sortKey="Chan, J Y" uniqKey="Chan J">J.Y. Chan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W. Wang</name>
</author>
<author>
<name sortKey="Xiao, F" uniqKey="Xiao F">F. Xiao</name>
</author>
<author>
<name sortKey="Wan, P" uniqKey="Wan P">P. Wan</name>
</author>
<author>
<name sortKey="Pan, P" uniqKey="Pan P">P. Pan</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y. Zhang</name>
</author>
<author>
<name sortKey="Liu, F" uniqKey="Liu F">F. Liu</name>
</author>
<author>
<name sortKey="Wu, K" uniqKey="Wu K">K. Wu</name>
</author>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y. Liu</name>
</author>
<author>
<name sortKey="Wu, J" uniqKey="Wu J">J. Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Allen, I C" uniqKey="Allen I">I.C. Allen</name>
</author>
<author>
<name sortKey="Scull, M A" uniqKey="Scull M">M.A. Scull</name>
</author>
<author>
<name sortKey="Moore, C B" uniqKey="Moore C">C.B. Moore</name>
</author>
<author>
<name sortKey="Holl, E K" uniqKey="Holl E">E.K. Holl</name>
</author>
<author>
<name sortKey="Mcelvania Tekippe, E" uniqKey="Mcelvania Tekippe E">E. McElvania-TeKippe</name>
</author>
<author>
<name sortKey="Taxman, D J" uniqKey="Taxman D">D.J. Taxman</name>
</author>
<author>
<name sortKey="Guthrie, E H" uniqKey="Guthrie E">E.H. Guthrie</name>
</author>
<author>
<name sortKey="Pickles, R J" uniqKey="Pickles R">R.J. Pickles</name>
</author>
<author>
<name sortKey="Ting, J P" uniqKey="Ting J">J.P. Ting</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ren, R" uniqKey="Ren R">R. Ren</name>
</author>
<author>
<name sortKey="Wu, S" uniqKey="Wu S">S. Wu</name>
</author>
<author>
<name sortKey="Cai, J" uniqKey="Cai J">J. Cai</name>
</author>
<author>
<name sortKey="Yang, Y" uniqKey="Yang Y">Y. Yang</name>
</author>
<author>
<name sortKey="Ren, X" uniqKey="Ren X">X. Ren</name>
</author>
<author>
<name sortKey="Feng, Y" uniqKey="Feng Y">Y. Feng</name>
</author>
<author>
<name sortKey="Chen, L" uniqKey="Chen L">L. Chen</name>
</author>
<author>
<name sortKey="Qin, B" uniqKey="Qin B">B. Qin</name>
</author>
<author>
<name sortKey="Xu, C" uniqKey="Xu C">C. Xu</name>
</author>
<author>
<name sortKey="Yang, H" uniqKey="Yang H">H. Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W. Wang</name>
</author>
<author>
<name sortKey="Li, G" uniqKey="Li G">G. Li</name>
</author>
<author>
<name sortKey="De, W" uniqKey="De W">W. De</name>
</author>
<author>
<name sortKey="Luo, Z" uniqKey="Luo Z">Z. Luo</name>
</author>
<author>
<name sortKey="Pan, P" uniqKey="Pan P">P. Pan</name>
</author>
<author>
<name sortKey="Tian, M" uniqKey="Tian M">M. Tian</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y. Wang</name>
</author>
<author>
<name sortKey="Xiao, F" uniqKey="Xiao F">F. Xiao</name>
</author>
<author>
<name sortKey="Li, A" uniqKey="Li A">A. Li</name>
</author>
<author>
<name sortKey="Wu, K" uniqKey="Wu K">K. Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dinarello, C A" uniqKey="Dinarello C">C.A. Dinarello</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guery, B" uniqKey="Guery B">B. Guery</name>
</author>
<author>
<name sortKey="Poissy, J" uniqKey="Poissy J">J. Poissy</name>
</author>
<author>
<name sortKey="El Mansouf, L" uniqKey="El Mansouf L">L. el Mansouf</name>
</author>
<author>
<name sortKey="Sejourne, C" uniqKey="Sejourne C">C. Sejourne</name>
</author>
<author>
<name sortKey="Ettahar, N" uniqKey="Ettahar N">N. Ettahar</name>
</author>
<author>
<name sortKey="Lemaire, X" uniqKey="Lemaire X">X. Lemaire</name>
</author>
<author>
<name sortKey="Vuotto, F" uniqKey="Vuotto F">F. Vuotto</name>
</author>
<author>
<name sortKey="Goffard, A" uniqKey="Goffard A">A. Goffard</name>
</author>
<author>
<name sortKey="Behillil, S" uniqKey="Behillil S">S. Behillil</name>
</author>
<author>
<name sortKey="Enouf, V" uniqKey="Enouf V">V. Enouf</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hajishengallis, G" uniqKey="Hajishengallis G">G. Hajishengallis</name>
</author>
<author>
<name sortKey="Lambris, J D" uniqKey="Lambris J">J.D. Lambris</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Samstad, E O" uniqKey="Samstad E">E.O. Samstad</name>
</author>
<author>
<name sortKey="Niyonzima, N" uniqKey="Niyonzima N">N. Niyonzima</name>
</author>
<author>
<name sortKey="Nymo, S" uniqKey="Nymo S">S. Nymo</name>
</author>
<author>
<name sortKey="Aune, M H" uniqKey="Aune M">M.H. Aune</name>
</author>
<author>
<name sortKey="Ryan, L" uniqKey="Ryan L">L. Ryan</name>
</author>
<author>
<name sortKey="Bakke, S S" uniqKey="Bakke S">S.S. Bakke</name>
</author>
<author>
<name sortKey="Lappegard, K T" uniqKey="Lappegard K">K.T. Lappegard</name>
</author>
<author>
<name sortKey="Brekke, O L" uniqKey="Brekke O">O.L. Brekke</name>
</author>
<author>
<name sortKey="Lambris, J D" uniqKey="Lambris J">J.D. Lambris</name>
</author>
<author>
<name sortKey="Damas, J K" uniqKey="Damas J">J.K. Damas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liszewski, M K" uniqKey="Liszewski M">M.K. Liszewski</name>
</author>
<author>
<name sortKey="Kolev, M" uniqKey="Kolev M">M. Kolev</name>
</author>
<author>
<name sortKey="Le Friec, G" uniqKey="Le Friec G">G. Le Friec</name>
</author>
<author>
<name sortKey="Leung, M" uniqKey="Leung M">M. Leung</name>
</author>
<author>
<name sortKey="Bertram, P G" uniqKey="Bertram P">P.G. Bertram</name>
</author>
<author>
<name sortKey="Fara, A F" uniqKey="Fara A">A.F. Fara</name>
</author>
<author>
<name sortKey="Subias, M" uniqKey="Subias M">M. Subias</name>
</author>
<author>
<name sortKey="Pickering, M C" uniqKey="Pickering M">M.C. Pickering</name>
</author>
<author>
<name sortKey="Drouet, C" uniqKey="Drouet C">C. Drouet</name>
</author>
<author>
<name sortKey="Meri, S" uniqKey="Meri S">S. Meri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Asgari, E" uniqKey="Asgari E">E. Asgari</name>
</author>
<author>
<name sortKey="Le Friec, G" uniqKey="Le Friec G">G. Le Friec</name>
</author>
<author>
<name sortKey="Yamamoto, H" uniqKey="Yamamoto H">H. Yamamoto</name>
</author>
<author>
<name sortKey="Perucha, E" uniqKey="Perucha E">E. Perucha</name>
</author>
<author>
<name sortKey="Sacks, S S" uniqKey="Sacks S">S.S. Sacks</name>
</author>
<author>
<name sortKey="Kohl, J" uniqKey="Kohl J">J. Kohl</name>
</author>
<author>
<name sortKey="Cook, H T" uniqKey="Cook H">H.T. Cook</name>
</author>
<author>
<name sortKey="Kemper, C" uniqKey="Kemper C">C. Kemper</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gerard, N P" uniqKey="Gerard N">N.P. Gerard</name>
</author>
<author>
<name sortKey="Gerard, C" uniqKey="Gerard C">C. Gerard</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gao, H" uniqKey="Gao H">H. Gao</name>
</author>
<author>
<name sortKey="Neff, T A" uniqKey="Neff T">T.A. Neff</name>
</author>
<author>
<name sortKey="Guo, R F" uniqKey="Guo R">R.F. Guo</name>
</author>
<author>
<name sortKey="Speyer, C L" uniqKey="Speyer C">C.L. Speyer</name>
</author>
<author>
<name sortKey="Sarma, J V" uniqKey="Sarma J">J.V. Sarma</name>
</author>
<author>
<name sortKey="Tomlins, S" uniqKey="Tomlins S">S. Tomlins</name>
</author>
<author>
<name sortKey="Man, Y" uniqKey="Man Y">Y. Man</name>
</author>
<author>
<name sortKey="Riedemann, N C" uniqKey="Riedemann N">N.C. Riedemann</name>
</author>
<author>
<name sortKey="Hoesel, L M" uniqKey="Hoesel L">L.M. Hoesel</name>
</author>
<author>
<name sortKey="Younkin, E" uniqKey="Younkin E">E. Younkin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gerard, N P" uniqKey="Gerard N">N.P. Gerard</name>
</author>
<author>
<name sortKey="Lu, B" uniqKey="Lu B">B. Lu</name>
</author>
<author>
<name sortKey="Liu, P" uniqKey="Liu P">P. Liu</name>
</author>
<author>
<name sortKey="Craig, S" uniqKey="Craig S">S. Craig</name>
</author>
<author>
<name sortKey="Fujiwara, Y" uniqKey="Fujiwara Y">Y. Fujiwara</name>
</author>
<author>
<name sortKey="Okinaga, S" uniqKey="Okinaga S">S. Okinaga</name>
</author>
<author>
<name sortKey="Gerard, C" uniqKey="Gerard C">C. Gerard</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Morgan, B P" uniqKey="Morgan B">B.P. Morgan</name>
</author>
<author>
<name sortKey="Gasque, P" uniqKey="Gasque P">P. Gasque</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gu, J" uniqKey="Gu J">J. Gu</name>
</author>
<author>
<name sortKey="Gong, E" uniqKey="Gong E">E. Gong</name>
</author>
<author>
<name sortKey="Zhang, B" uniqKey="Zhang B">B. Zhang</name>
</author>
<author>
<name sortKey="Zheng, J" uniqKey="Zheng J">J. Zheng</name>
</author>
<author>
<name sortKey="Gao, Z" uniqKey="Gao Z">Z. Gao</name>
</author>
<author>
<name sortKey="Zhong, Y" uniqKey="Zhong Y">Y. Zhong</name>
</author>
<author>
<name sortKey="Zou, W" uniqKey="Zou W">W. Zou</name>
</author>
<author>
<name sortKey="Zhan, J" uniqKey="Zhan J">J. Zhan</name>
</author>
<author>
<name sortKey="Wang, S" uniqKey="Wang S">S. Wang</name>
</author>
<author>
<name sortKey="Xie, Z" uniqKey="Xie Z">Z. Xie</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Doitsh, G" uniqKey="Doitsh G">G. Doitsh</name>
</author>
<author>
<name sortKey="Galloway, N L" uniqKey="Galloway N">N.L. Galloway</name>
</author>
<author>
<name sortKey="Geng, X" uniqKey="Geng X">X. Geng</name>
</author>
<author>
<name sortKey="Yang, Z" uniqKey="Yang Z">Z. Yang</name>
</author>
<author>
<name sortKey="Monroe, K M" uniqKey="Monroe K">K.M. Monroe</name>
</author>
<author>
<name sortKey="Zepeda, O" uniqKey="Zepeda O">O. Zepeda</name>
</author>
<author>
<name sortKey="Hunt, P W" uniqKey="Hunt P">P.W. Hunt</name>
</author>
<author>
<name sortKey="Hatano, H" uniqKey="Hatano H">H. Hatano</name>
</author>
<author>
<name sortKey="Sowinski, S" uniqKey="Sowinski S">S. Sowinski</name>
</author>
<author>
<name sortKey="Munoz Arias, I" uniqKey="Munoz Arias I">I. Munoz-Arias</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mcauley, J L" uniqKey="Mcauley J">J.L. McAuley</name>
</author>
<author>
<name sortKey="Tate, M D" uniqKey="Tate M">M.D. Tate</name>
</author>
<author>
<name sortKey="Mackenzie Kludas, C J" uniqKey="Mackenzie Kludas C">C.J. MacKenzie-Kludas</name>
</author>
<author>
<name sortKey="Pinar, A" uniqKey="Pinar A">A. Pinar</name>
</author>
<author>
<name sortKey="Zeng, W" uniqKey="Zeng W">W. Zeng</name>
</author>
<author>
<name sortKey="Stutz, A" uniqKey="Stutz A">A. Stutz</name>
</author>
<author>
<name sortKey="Latz, E" uniqKey="Latz E">E. Latz</name>
</author>
<author>
<name sortKey="Brown, L E" uniqKey="Brown L">L.E. Brown</name>
</author>
<author>
<name sortKey="Mansell, A" uniqKey="Mansell A">A. Mansell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pinar, A" uniqKey="Pinar A">A. Pinar</name>
</author>
<author>
<name sortKey="Dowling, J K" uniqKey="Dowling J">J.K. Dowling</name>
</author>
<author>
<name sortKey="Bitto, N J" uniqKey="Bitto N">N.J. Bitto</name>
</author>
<author>
<name sortKey="Robertson, A A" uniqKey="Robertson A">A.A. Robertson</name>
</author>
<author>
<name sortKey="Latz, E" uniqKey="Latz E">E. Latz</name>
</author>
<author>
<name sortKey="Stewart, C R" uniqKey="Stewart C">C.R. Stewart</name>
</author>
<author>
<name sortKey="Drummond, G R" uniqKey="Drummond G">G.R. Drummond</name>
</author>
<author>
<name sortKey="Cooper, M A" uniqKey="Cooper M">M.A. Cooper</name>
</author>
<author>
<name sortKey="Mcauley, J L" uniqKey="Mcauley J">J.L. McAuley</name>
</author>
<author>
<name sortKey="Tate, M D" uniqKey="Tate M">M.D. Tate</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yao, S T" uniqKey="Yao S">S.T. Yao</name>
</author>
<author>
<name sortKey="Cao, F" uniqKey="Cao F">F. Cao</name>
</author>
<author>
<name sortKey="Chen, J L" uniqKey="Chen J">J.L. Chen</name>
</author>
<author>
<name sortKey="Chen, W" uniqKey="Chen W">W. Chen</name>
</author>
<author>
<name sortKey="Fan, R M" uniqKey="Fan R">R.M. Fan</name>
</author>
<author>
<name sortKey="Li, G" uniqKey="Li G">G. Li</name>
</author>
<author>
<name sortKey="Zeng, Y C" uniqKey="Zeng Y">Y.C. Zeng</name>
</author>
<author>
<name sortKey="Jiao, S" uniqKey="Jiao S">S. Jiao</name>
</author>
<author>
<name sortKey="Xia, X P" uniqKey="Xia X">X.P. Xia</name>
</author>
<author>
<name sortKey="Han, C" uniqKey="Han C">C. Han</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arbore, G" uniqKey="Arbore G">G. Arbore</name>
</author>
<author>
<name sortKey="West, E E" uniqKey="West E">E.E. West</name>
</author>
<author>
<name sortKey="Spolski, R" uniqKey="Spolski R">R. Spolski</name>
</author>
<author>
<name sortKey="Robertson, A A B" uniqKey="Robertson A">A.A.B. Robertson</name>
</author>
<author>
<name sortKey="Klos, A" uniqKey="Klos A">A. Klos</name>
</author>
<author>
<name sortKey="Rheinheimer, C" uniqKey="Rheinheimer C">C. Rheinheimer</name>
</author>
<author>
<name sortKey="Dutow, P" uniqKey="Dutow P">P. Dutow</name>
</author>
<author>
<name sortKey="Woodruff, T M" uniqKey="Woodruff T">T.M. Woodruff</name>
</author>
<author>
<name sortKey="Yu, Z X" uniqKey="Yu Z">Z.X. Yu</name>
</author>
<author>
<name sortKey="O Eill, L A" uniqKey="O Eill L">L.A. O’Neill</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Reichhardt, M P" uniqKey="Reichhardt M">M.P. Reichhardt</name>
</author>
<author>
<name sortKey="Meri, S" uniqKey="Meri S">S. Meri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y. Zhang</name>
</author>
<author>
<name sortKey="Liu, F" uniqKey="Liu F">F. Liu</name>
</author>
<author>
<name sortKey="Yuan, Y" uniqKey="Yuan Y">Y. Yuan</name>
</author>
<author>
<name sortKey="Jin, C" uniqKey="Jin C">C. Jin</name>
</author>
<author>
<name sortKey="Chang, C" uniqKey="Chang C">C. Chang</name>
</author>
<author>
<name sortKey="Zhu, Y" uniqKey="Zhu Y">Y. Zhu</name>
</author>
<author>
<name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author>
<name sortKey="Tian, C" uniqKey="Tian C">C. Tian</name>
</author>
<author>
<name sortKey="He, F" uniqKey="He F">F. He</name>
</author>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mebius, R E" uniqKey="Mebius R">R.E. Mebius</name>
</author>
<author>
<name sortKey="Kraal, G" uniqKey="Kraal G">G. Kraal</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Viruses</journal-id>
<journal-id journal-id-type="iso-abbrev">Viruses</journal-id>
<journal-id journal-id-type="publisher-id">viruses</journal-id>
<journal-title-group>
<journal-title>Viruses</journal-title>
</journal-title-group>
<issn pub-type="epub">1999-4915</issn>
<publisher>
<publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">30634407</article-id>
<article-id pub-id-type="pmc">6356766</article-id>
<article-id pub-id-type="doi">10.3390/v11010039</article-id>
<article-id pub-id-type="publisher-id">viruses-11-00039</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0001-7404-5250</contrib-id>
<name>
<surname>Jiang</surname>
<given-names>Yuting</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
<xref ref-type="author-notes" rid="fn1-viruses-11-00039">†</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Junfeng</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
<xref ref-type="author-notes" rid="fn1-viruses-11-00039">†</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Teng</surname>
<given-names>Yue</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
<xref ref-type="author-notes" rid="fn1-viruses-11-00039">†</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Hong</given-names>
</name>
<xref ref-type="aff" rid="af2-viruses-11-00039">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tian</surname>
<given-names>Guang</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>He</surname>
<given-names>Lei</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Pei</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Yuehong</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Guo</surname>
<given-names>Yan</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Jiangfan</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhao</surname>
<given-names>Guangyu</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhou</surname>
<given-names>Yusen</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
<xref ref-type="aff" rid="af3-viruses-11-00039">3</xref>
<xref rid="c1-viruses-11-00039" ref-type="corresp">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Shihui</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-11-00039">1</xref>
<xref rid="c1-viruses-11-00039" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<aff id="af1-viruses-11-00039">
<label>1</label>
State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China;
<email>captain99@126.com</email>
(Y.J.);
<email>lijunfeng2113@126.com</email>
(J.L.);
<email>yueteng@me.com</email>
(Y.T.);
<email>tglnx05@tom.com</email>
(G.T.);
<email>helei_happy@126.com</email>
(L.H.);
<email>lwhisperer@163.com</email>
(P.L.);
<email>chenyuehong.happy@163.com</email>
(Y.C.);
<email>muhan0425@126.com</email>
(Y.G.);
<email>anatee@163.com</email>
(J.L.)
<email>guangyu0525@163.com</email>
(G.Z.)</aff>
<aff id="af2-viruses-11-00039">
<label>2</label>
Department of Basic Medical Sciences, North China University of Science and Technology, Tangshan 063210, China;
<email>xun1@hotmail.com</email>
</aff>
<aff id="af3-viruses-11-00039">
<label>3</label>
Institute of Medical and Pharmaceutical Sciences, Zhengzhou University, Zhengzhou 450052, China</aff>
<author-notes>
<corresp id="c1-viruses-11-00039">
<label>*</label>
Correspondence:
<email>yszhou@bmi.ac.cn</email>
(Y.Z.);
<email>sunsh01@163.com</email>
(S.S.); Tel./Fax: +86-10-63858045 (Y.Z.)</corresp>
<fn id="fn1-viruses-11-00039">
<label>†</label>
<p>These authors contributed equally to this work.</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>09</day>
<month>1</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="collection">
<month>1</month>
<year>2019</year>
</pub-date>
<volume>11</volume>
<issue>1</issue>
<elocation-id>39</elocation-id>
<history>
<date date-type="received">
<day>28</day>
<month>11</month>
<year>2018</year>
</date>
<date date-type="accepted">
<day>02</day>
<month>1</month>
<year>2019</year>
</date>
</history>
<permissions>
<copyright-statement>© 2019 by the authors.</copyright-statement>
<copyright-year>2019</copyright-year>
<license license-type="open-access">
<license-p>Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<p>Middle East respiratory syndrome coronavirus (MERS-CoV) is a highly pathogenic virus with a crude mortality rate of ~35%. Previously, we established a human DPP4 transgenic (hDPP4-Tg) mouse model in which we studied complement overactivation-induced immunopathogenesis. Here, to better understand the pathogenesis of MERS-CoV, we studied the role of pyroptosis in THP-1 cells and hDPP4 Tg mice with MERS-CoV infection. We found that MERS-CoV infection induced pyroptosis and over-activation of complement in human macrophages. The hDPP4-Tg mice infected with MERS-CoV overexpressed caspase-1 in the spleen and showed high IL-1β levels in serum, suggesting that pyroptosis occurred after infection. However, when the C5a-C5aR1 axis was blocked by an anti-C5aR1 antibody (Ab), expression of caspase-1 and IL-1β fell. These data indicate that MERS-CoV infection induces overactivation of complement, which may contribute to pyroptosis and inflammation. Pyroptosis and inflammation were suppressed by inhibiting C5aR1. These results will further our understanding of the pathogenesis of MERS-CoV infection.</p>
</abstract>
<kwd-group>
<kwd>MERS-CoV</kwd>
<kwd>inflammation</kwd>
<kwd>pyroptosis</kwd>
<kwd>complement</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec id="sec1-viruses-11-00039">
<title>1. Introduction</title>
<p>Middle East respiratory syndrome coronavirus (MERS-CoV), the second highly pathogenic coronavirus to emerge after severe acute respiratory syndrome coronavirus (SARS-CoV), causes severe acute respiratory failure and extra-pulmonary multi-organ damage accompanied by severe systemic inflammation [
<xref rid="B1-viruses-11-00039" ref-type="bibr">1</xref>
,
<xref rid="B2-viruses-11-00039" ref-type="bibr">2</xref>
,
<xref rid="B3-viruses-11-00039" ref-type="bibr">3</xref>
]. However, the pathogenesis of MERS-CoV still needs to be explored. Complement activation and pyroptosis are two proteolytic cascades that defend the host against dangerous pathogens. They are important parts of the innate immune system and have some similar characteristics, including pore-formation and proinflammatory characteristics.</p>
<p>Pyroptosis is a lytic and inflammatory mode of regulated cell death catalyzed by the caspase family [
<xref rid="B4-viruses-11-00039" ref-type="bibr">4</xref>
]. Activation of caspase-1 relies on assembly of inflammasome complexes, which contain NLRP1b, NLRC4, NLRP3, and AIM2. Different inflammasomes are activated by different pathogen-associated molecular patterns (PAMPs) or danger-associated molecular patterns (DAMPs) via particular pattern recognition receptors (PRRs). The best-characterized inflammasome is the NLRP3 inflammasome, which responds to a variety of bacterial, viral, and fungal agents [
<xref rid="B5-viruses-11-00039" ref-type="bibr">5</xref>
,
<xref rid="B6-viruses-11-00039" ref-type="bibr">6</xref>
], DAMPs (e.g., ATP, monosodium urate crystals, and amyloid-β aggregates) [
<xref rid="B7-viruses-11-00039" ref-type="bibr">7</xref>
,
<xref rid="B8-viruses-11-00039" ref-type="bibr">8</xref>
], and even environmental and industrial particles such as silica and asbestos [
<xref rid="B9-viruses-11-00039" ref-type="bibr">9</xref>
]. The NLRP3 inflammasome comprises the NLRP3 scaffold, the ASC (PYCARD) adaptor, and pro-caspase-1. The activated NLRP3 inflammasome promotes transformation of pro-caspase-1 to its active form, which proteolytically cleaves gasdermin D, pro-IL-1β, and pro-IL-18 to yield their bioactive forms. The N-terminal domain of cleaved gasdermin D perforates the cell membrane, resulting in osmotic lysis [
<xref rid="B10-viruses-11-00039" ref-type="bibr">10</xref>
], whereas mature IL-1β and IL-18 act as proinflammatory cytokines [
<xref rid="B11-viruses-11-00039" ref-type="bibr">11</xref>
].</p>
<p>The complement system is an ancient molecular cascade; indeed, homologs have been found in sea urchin [
<xref rid="B12-viruses-11-00039" ref-type="bibr">12</xref>
] and mosquitoes [
<xref rid="B13-viruses-11-00039" ref-type="bibr">13</xref>
]. Complement is activated via three pathways: the classical, lectin, and alternative pathways. During the process of activation, an enzyme named C3 convertase cleaves C3 to C3a and C3b, which are recruited to the C3 convertase to form the C5 convertase. C5 convertase catalyzes cleavage of C5 to C5a and C5b to initiate the terminal complement pathway, resulting in formation of the membrane attack complex, which has pore-forming properties. During this process, two split products, C3a and C5a (known as anaphylatoxins), promote inflammation or serve as chemoattractants by engaging their cognate receptors [
<xref rid="B14-viruses-11-00039" ref-type="bibr">14</xref>
,
<xref rid="B15-viruses-11-00039" ref-type="bibr">15</xref>
].</p>
<p>In a previous study we demonstrated that aberrant complement activation contributes to severe outcomes in hDPP4 transgenic mice infected with MERS-CoV, and that preventing over-activation of the complement system may be an effective clinical therapy for MERS [
<xref rid="B16-viruses-11-00039" ref-type="bibr">16</xref>
]. Here, we examined the role of pyroptosis in the pathogenesis of MERS, along with the relationship between pyroptosis and complement. The results may help us to better understand the mechanism underlying severe outcomes after MERS-CoV infection.</p>
</sec>
<sec id="sec2-viruses-11-00039">
<title>2. Materials and Methods</title>
<sec id="sec2dot1-viruses-11-00039">
<title>2.1. Ethics Statement</title>
<p>All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the Beijing Institute of Microbiology and Epidemiology (IACUC Permit No: BIME 2017-0011; Permit Date: 8 March 2017). Animal studies were carried out in strict accordance with the recommendations set out in the Guide for the Care and Use of Laboratory Animals.</p>
</sec>
<sec id="sec2dot2-viruses-11-00039">
<title>2.2. Cells</title>
<p>Human monocytic cells (THP-1) were purchased from the American Type Culture Collection (Manassas, VA, USA, ATCC Number: TIB-202) and cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, 100 μg/mL streptomycin sulfate, 1× Glutamax-I (
<sc>l</sc>
-glutamine alternate), and 0.05 mM 2-mercaptoethanol. THP-1 (differentiated) macrophages were obtained by exposing the cells to 60 nM phorbol-12-myristate-13-acetate (PMA) for 12 h, followed by culture for a further 24 h in complete growth medium without PMA.</p>
</sec>
<sec id="sec2dot3-viruses-11-00039">
<title>2.3. Virus Infection</title>
<p>MERS-CoV (HCoV-EMC/2012 strain) was propagated and titrated on Vero cells in an approved biosafety level 3 laboratory. THP-1 differentiated macrophages cultured in 75-cm
<sup>2</sup>
flasks were infected with MERS-CoV at a multiplicity of infection of 0.1. The virus was adsorbed at 37 °C for 1 h and unbound virus was washed away.</p>
<p>HDPP4-Tg mice (6 weeks old, female) [
<xref rid="B17-viruses-11-00039" ref-type="bibr">17</xref>
] were maintained in a pathogen-free facility and housed in cages containing sterilized feed and drinking water. Following intraperitoneal anesthetization with sodium pentobarbital (5 mg/kg body weight), mice were inoculated intranasally with MERS-CoV (103.3 50% tissue culture infectious dose (TCID50)) in 20 μL Dulbecco’s modified Eagle’s medium (DMEM). Mice in the sham group received the same volume of DMEM. For the experiments of C5aR1 inhibition, mice were received an intravenous (i.v.) injection (600 μg/kg) of a monoclonal Ab (mAb) specific for mouse C5aR1 (Hycult Biotech, Uden, the Netherlands) to block the interaction of C5a to C5aR1 or an injection of phosphate-buffered saline (PBS) (sham treatment control) at the same time as MERS-CoV inoculation. All infectious experiments related to MERS-CoV were performed in an approved biosafety level 3 facility.</p>
</sec>
<sec id="sec2dot4-viruses-11-00039">
<title>2.4. Isolation of RNA and Proteins</title>
<p>THP-1 differentiated macrophages were lysed in TRIzol™ Reagent (Life Technologies, Carlsbad, CA, USA) at 24 h post-infection with MERS-CoV. Total RNA and proteins were isolated according to the reagent user guide.</p>
<p>Mice were euthanized by overdose inhalation of carbon dioxide at different time points after infection with MERS-CoV. Lungs were harvested and total RNA was extracted and purified using an RNeasy Extraction Kit (Qiagen, Hilden, Germany).</p>
</sec>
<sec id="sec2dot5-viruses-11-00039">
<title>2.5. Quantitative Reverse Transcription-PCR</title>
<p>To detect expression of inflammasomes and complement components in MERS-CoV-infected THP-1 differentiated macrophages and hDPP4-Tg mice, 2 μg of total RNA from cells or the lung of mice we used as template for first-strand cDNA synthesis. The resulting cDNA was subjected to quantitative PCR using Power SYBR
<sup>®</sup>
Green PCR Master Mix (Life Technologies, Carlsbad, CA, USA) to determine the relative abundance of inflammasome and complement components. The forward and reverse primers used for each component are listed in the
<xref rid="viruses-11-00039-t001" ref-type="table">Table 1</xref>
. The relative amount of each gene was obtained by normalization against an endogenous control gene (GAPDH) and calculated using the comparative 2
<sup>−ΔΔCT</sup>
method. Sham-infected monocytes and sham-infected hDPP4-Tg mice were used as respective calibrators. An identical amplification reaction comprising (i) polymerase activation and DNA denaturation at 95 °C for 10 min, (ii) 40 cycles each of the denaturation at 95 °C for 10 s, and (iii) an annealing/extension step at 60 °C for 30 s, was used for each gene analyzed.</p>
</sec>
<sec id="sec2dot6-viruses-11-00039">
<title>2.6. Western Blot Analysis</title>
<p>Proteins isolated from THP-1 monocytic cells and THP-1 differentiated macrophages were electrophoresed in a 12% SDS-PAGE gel and transferred to a PVDF membrane (GE Healthcare, Dassel, Germany). PVDF membranes were then blocked for 1 h at room temperature in 5% non-fat milk. Membranes were incubated overnight at 4 °C with primary antibodies, followed by secondary antibodies for 1 h at room temperature. The primary antibodies used for analysis were: mouse anti-caspase 1 (1:200; Santa Cruz Biotechnology, Cat: sc-392736, Santa Cruz, CA, USA), mouse anti-IL-1β (1:200; Santa Cruz Biotechnology, Cat: sc-32294), rabbit anti-cleaved IL-1β (1:2000; Cell Signaling, Cat: #83186, Danvers, MA, USA), rabbit anti-MERS-CoV Nucleocapsid Protein (1:2000; Sino Biological Inc., Cat: 40068-RP02, Beijing, China), and rabbit anti-β-actin (1:2000; Cell Signaling, Cat: #4970). The secondary antibody was anti-rabbit secondary (1:5000; TransGen, Cat: HS101-01, Beijing, China) or anti-mouse secondary (1:5000; TransGen Cat: HS201-01). Blots were developed using a Pierce ECL Western Blotting Substrate (Thermo Scientific, Waltham, MA, USA) and protein bands were detected using an Amersham Imager 600 (GE Healthcare, Chicago, IL, USA).</p>
</sec>
<sec id="sec2dot7-viruses-11-00039">
<title>2.7. Analysis of Inflammatory Cytokines</title>
<p>Cytokines in mouse serum were measured using a Milliplex Mouse Cytokine/Chemokine Magnetic Panel Kit (Merck Millipore, Burlington, MA, USA). A panel of inflammatory cytokines (IL-1β, IL-6, TNF-α, and IFN-γ) was detected according to the manufacturer’s protocol.</p>
</sec>
<sec id="sec2dot8-viruses-11-00039">
<title>2.8. Immunohistochemistry (IHC)</title>
<p>Sections of paraffin-embedded spleen and lung tissues (4 μm thick) were prepared and stained to detect antigen expression. Briefly, retrieved sections were incubated overnight at 4 °C with the following antibodies: mouse anti-caspase-1 mAb (AdipoGen, San Diego, CA, USA), polyclonal rabbit anti-CD68 (Abcam, Cambridge, MA, USA), and polyclonal anti-IFN-γRα (Santa Cruz Biotechnology). Biotinylated immunoglobulin G was then added, followed by an avidin–biotin–peroxidase conjugate (Beijing Zhongshan Biotechnology Co., Ltd., Beijing, China). Immunoreactivity was detected using 3,3′ diamino benzidine (DAB). Slides were counter-stained with hematoxylin.</p>
</sec>
<sec id="sec2dot9-viruses-11-00039">
<title>2.9. Statistical Analysis</title>
<p>Statistical analyses were performed using GraphPad Prism software, version 5.01 (GraphPad Software, San Diego, CA, USA). Student’s
<italic>t</italic>
test was used to compare two groups with respect to relative expression of mRNA and cytokine levels in serum.
<italic>p</italic>
values < 0.05 were considered significant.</p>
</sec>
</sec>
<sec id="sec3-viruses-11-00039">
<title>3. Results</title>
<sec id="sec3dot1-viruses-11-00039">
<title>3.1. MERS-CoV Infection Induced Pyroptosis in THP-1 Macrophages</title>
<p>Unlike abortive infection of SARS-CoV in human macrophages, MERS-CoV can establish a productive infection in macrophages and induce production of proinflammatory cytokines and chemokines [
<xref rid="B18-viruses-11-00039" ref-type="bibr">18</xref>
]. Many RNA viruses, such as EV71, H1N1, H7N9 influenza A virus, and Zika virus, can infect macrophages and trigger IL-1β secretion via the NLRP3 inflammasome [
<xref rid="B19-viruses-11-00039" ref-type="bibr">19</xref>
,
<xref rid="B20-viruses-11-00039" ref-type="bibr">20</xref>
,
<xref rid="B21-viruses-11-00039" ref-type="bibr">21</xref>
,
<xref rid="B22-viruses-11-00039" ref-type="bibr">22</xref>
]. To evaluate the response of macrophages to MERS-CoV infection, we inoculated THP-1 monocytic cells and THP-1 differentiated macrophages with MERS-CoV or RPMI 1640 medium (sham-infection). We then examined expression of NLRP3, pro-caspase-1, and pro-IL-1β 24 h later by RT-qPCR. As shown in
<xref ref-type="fig" rid="viruses-11-00039-f001">Figure 1</xref>
, MERS-CoV infection induced relatively higher expression of pro-caspase-1 (
<xref ref-type="fig" rid="viruses-11-00039-f001">Figure 1</xref>
A) and pro-IL-1β (
<xref ref-type="fig" rid="viruses-11-00039-f001">Figure 1</xref>
B), but not NLRP3 (
<xref ref-type="fig" rid="viruses-11-00039-f001">Figure 1</xref>
C), in both THP-1 monocytes and macrophages. Expression of pro-IL-1β in monocytes increased by 170-fold, whereas that in macrophages increased by 26-fold (on average).</p>
<p>We verified expression of caspase-1, IL-1β, and MERS nucleocapsid protein (NP) by Western blotting (
<xref ref-type="fig" rid="viruses-11-00039-f001">Figure 1</xref>
D). MERS-CoV-infected THP-1 macrophages expressed higher levels of pro-caspase-1, pro-IL-1β, and activated IL-1β (p17) than sham-infected THP-1 macrophages or MERS-CoV-infected THP-1 monocytes. MERS NP was detected in both MERS-CoV-infected THP-1 monocytes and macrophages. These results indicate that MERS-CoV infection induces high levels of proinflammatory IL-1β secretion and THP-1 macrophage pyroptosis.</p>
</sec>
<sec id="sec3dot2-viruses-11-00039">
<title>3.2. Pyroptosis in Mice Infected with MERS-CoV</title>
<p>To determine whether MERS-CoV infection induces pyroptosis in mice, we used RT-qPCR to detect mRNA encoding NLRP3, pro-caspase-1, and pro-IL-1β in lung tissue from hDPP4 transgenic mice at Day 3 post-MERS-CoV infection. Although there was no significant difference in expression of NLRP3 and pro-caspase-1 between the sham-infected and MERS-CoV-infected groups (
<xref ref-type="fig" rid="viruses-11-00039-f002">Figure 2</xref>
A,B), expression of pro-IL-1β mRNA was significantly higher after MERS-CoV infection (
<xref ref-type="fig" rid="viruses-11-00039-f002">Figure 2</xref>
C). In addition, we measured the concentration of IL-1β in serum. The results showed that MERS-CoV infection induced production of IL-1β (
<xref ref-type="fig" rid="viruses-11-00039-f002">Figure 2</xref>
D). Furthermore, we examined expression of caspase-1 in the lung and spleen at Day 7 post-MERS-CoV infection by IHC. In line with the mRNA results, there was no significant difference in expression of caspase-1 in the lung of sham-infected and MERS-CoV-infected mice. However, the spleens of mice infected with MERS-CoV showed higher expression of caspase-1 than those of mice in the sham group (
<xref ref-type="fig" rid="viruses-11-00039-f002">Figure 2</xref>
E). The results indicated that MERS-CoV infection could induce pyroptosis in mice.</p>
</sec>
<sec id="sec3dot3-viruses-11-00039">
<title>3.3. Inflammatory Responses in Mice Infected with MERS-CoV</title>
<p>IL-1β plays an important role in mediating autoinflammatory diseases and in generating inflammatory responses to infection [
<xref rid="B23-viruses-11-00039" ref-type="bibr">23</xref>
]. Therefore, to assess the inflammatory responses in mice, we measured TNF-α, IFN-γ, and IL-6 in serum at Day 3 post-MERS-CoV infection. As shown in
<xref ref-type="fig" rid="viruses-11-00039-f003">Figure 3</xref>
A–C, serum from mice in the MERS-CoV-infected group contained more TNF-α, IFN-γ, and IL-6 than that from sham-infected mice. IHC examination of CD68 and IFN-γ receptor expression also suggested greater macrophage infiltration and activation in the lung and spleen of mice at 7 days post-MERS-CoV infection (
<xref ref-type="fig" rid="viruses-11-00039-f003">Figure 3</xref>
D). These results indicate that MERS-CoV infection causes systemic inflammation, as reported in clinical MERS patients and MERS-CoV infected animal models [
<xref rid="B17-viruses-11-00039" ref-type="bibr">17</xref>
,
<xref rid="B24-viruses-11-00039" ref-type="bibr">24</xref>
].</p>
</sec>
<sec id="sec3dot4-viruses-11-00039">
<title>3.4. MERS-CoV Infection Alters Expression of Complement in THP-1 Monocytes and Macrophages</title>
<p>The complement system links activation of Toll-like receptors to transcription of IL-1β mRNA [
<xref rid="B25-viruses-11-00039" ref-type="bibr">25</xref>
,
<xref rid="B26-viruses-11-00039" ref-type="bibr">26</xref>
]. It has been studied that intracellular C3 is converted to biologically active C3a and C3b by the protease cathepsin L [
<xref rid="B27-viruses-11-00039" ref-type="bibr">27</xref>
], and C3a activates NLRP3 and triggers IL-1β production in human monocytes by regulating efflux of ATP [
<xref rid="B28-viruses-11-00039" ref-type="bibr">28</xref>
]. In addition, C5a is believed to induce a proinflammatory or anti-inflammatory response when ligated to C5aR1 or C5aR2 respectively [
<xref rid="B29-viruses-11-00039" ref-type="bibr">29</xref>
,
<xref rid="B30-viruses-11-00039" ref-type="bibr">30</xref>
,
<xref rid="B31-viruses-11-00039" ref-type="bibr">31</xref>
]. Thus, we used RT-qPCR to examine expression of complement components and their receptors C3aR, C5aR1, and C5aR2. As shown in
<xref ref-type="fig" rid="viruses-11-00039-f004">Figure 4</xref>
, C3 and C3aR expression by both THP-1 monocytes and macrophages was highly upregulated (by 5–20-fold) after MERS-CoV infection. C5aR1 was upregulated, whereas C5aR2 was downregulated, after MERS-CoV infection.</p>
</sec>
<sec id="sec3dot5-viruses-11-00039">
<title>3.5. Inhibiting C5aR1 Reduces Pyroptosis in Mice Infected with MERS-CoV</title>
<p>Our previous study demonstrated that MERS-CoV infection results in dysregulated host immune responses and severe tissue damage [
<xref rid="B17-viruses-11-00039" ref-type="bibr">17</xref>
] and inhibiting C5aR1 alleviates MERS-CoV infection-induced tissue damage by regulating host immune responses [
<xref rid="B16-viruses-11-00039" ref-type="bibr">16</xref>
]. Here, we used an anti-C5aR1 Ab to block the C5a-C5aR1 axis. The antibody was administered at the same time as MERS-CoV infection. We then measured expression of caspase-1 in the spleen and IL-1β in the lung and serum. Compared with the PBS-treated group, mice receiving the anti-C5aR1 Ab expressed less caspase-1 in the spleen at Day 7 post-MERS-CoV infection (
<xref ref-type="fig" rid="viruses-11-00039-f005">Figure 5</xref>
A). Although there was no significant difference between the two groups with respect to pro-IL-1β mRNA expression (
<xref ref-type="fig" rid="viruses-11-00039-f005">Figure 5</xref>
B), serum levels of IL-1β were lower in the anti-C5aR1 Ab-treated group than in the PBS-treated group at Day 1 (
<xref ref-type="fig" rid="viruses-11-00039-f005">Figure 5</xref>
C) and Day 3 [
<xref rid="B16-viruses-11-00039" ref-type="bibr">16</xref>
] post-MERS-CoV infection. These results suggest that complement inhibition decreased the expression of pyroptosis indicators, IL-1β and caspase-1, in mice infected with MERS-CoV.</p>
</sec>
<sec id="sec3dot6-viruses-11-00039">
<title>3.6. Inhibiting C5aR1 Reduces Inflammation in Mice Infected with MERS-CoV</title>
<p>At 1 day after MERS-CoV infection, we measured proinflammatory cytokines (IFN-γ, TNF-α, and IL-6) in serum. IFN-γ levels in mice treated with the anti-C5aR1 Ab were much lower than those in the PBS-treated group (
<xref ref-type="fig" rid="viruses-11-00039-f006">Figure 6</xref>
A). To further evaluate the effect of complement inhibition on the local inflammation at later time after MERS-CoV infection, we examined expression of CD68 and IFN-γ receptor in lung and spleen at 7 days post-MERS-CoV infection. IHC revealed that macrophage infiltration and activation were lower in the anti-C5aR1 Ab-treated group (
<xref ref-type="fig" rid="viruses-11-00039-f006">Figure 6</xref>
D). Taken together, these results suggest that inhibiting complement dampens the over-activated inflammatory response in mice infected with MERS-CoV.</p>
</sec>
</sec>
<sec id="sec4-viruses-11-00039">
<title>4. Discussion</title>
<p>Macrophages play important roles in host defense by clearing dead cells, ingesting and destroying microbes, and presenting antigens to T lymphocytes. In addition, macrophages produce the full array of complement components [
<xref rid="B32-viruses-11-00039" ref-type="bibr">32</xref>
] and PRRs, which are closely associated with inflammasome activation and pyroptosis. The accumulated studies indicate that macrophages play an important role in the pathogenesis of SARS and MERS [
<xref rid="B18-viruses-11-00039" ref-type="bibr">18</xref>
,
<xref rid="B33-viruses-11-00039" ref-type="bibr">33</xref>
]. Macrophages infected with MERS-CoV secrete proinflammatory cytokines and chemokines [
<xref rid="B18-viruses-11-00039" ref-type="bibr">18</xref>
]. Widespread distribution of these macrophages throughout many organs is one of the reasons underlying multi-organ damage and systemic inflammation after virus infection. Pyroptosis or inflammasome activation plays an important role in virus-mediated pathogenesis. For example, abortive HIV-1 infection in quiescent lymphoid CD4 T cells leads to CD4 T cell pyroptosis independent of the NLRP3 inflammasome [
<xref rid="B34-viruses-11-00039" ref-type="bibr">34</xref>
]. EV71 3D and ZIKV NS5 activate the NLRP3 inflammasome by interacting with NACHT and the LRR domain of NLRP3 [
<xref rid="B19-viruses-11-00039" ref-type="bibr">19</xref>
,
<xref rid="B22-viruses-11-00039" ref-type="bibr">22</xref>
]. The PB1-F2 protein of avian influenza A virus H1N1 or H7N9 induces inflammation by activating the NLRP3 inflammasome [
<xref rid="B35-viruses-11-00039" ref-type="bibr">35</xref>
,
<xref rid="B36-viruses-11-00039" ref-type="bibr">36</xref>
], and deficiency of NLRP3 or caspase-1 protects mice against H7N9 infection-associated morbidity and mortality [
<xref rid="B21-viruses-11-00039" ref-type="bibr">21</xref>
]. Here, we demonstrate that the dysregulated macrophage-mediated immune responses after MERS-CoV infection may contribute to a severe outcome.</p>
<p>Several studies demonstrate relationships between complement and inflammasomes. For example, C3-/- mice display reduced inflammasome activation in an intracerebral hemorrhage (ICH) model [
<xref rid="B37-viruses-11-00039" ref-type="bibr">37</xref>
]. Engagement of C5a and C5aR1 on CD4+ T cells generates reactive oxygen species, which are a classical DAMP, thereby triggering inflammasome assembly [
<xref rid="B38-viruses-11-00039" ref-type="bibr">38</xref>
]. In monocytes, C3a alters metabolic programming and increases ATP efflux, leading to NLRP3 activation and IL-1β generation via the receptor P2 × 7 [
<xref rid="B28-viruses-11-00039" ref-type="bibr">28</xref>
]. Thus, the complement system is considered to be an essential regulatory component of the cellular alarm system that controls inflammasome activation [
<xref rid="B39-viruses-11-00039" ref-type="bibr">39</xref>
]. Here, we inhibit MERS-CoV infection-induced inflammation and pyroptosis by blocking the C5a-C5aR1 axis with an anti-C5aR1 antibody.</p>
<p>In our study, we first demonstrated that virus infection leads to pyroptosis by measuring activation of caspase-1 and IL-1β in human macrophages infected with MERS-CoV (
<xref ref-type="fig" rid="viruses-11-00039-f001">Figure 1</xref>
). Next, we found that MERS-CoV infection induced transcription of pro-IL-1β in the lung and expression of caspase-1 in the spleen. Activated caspase-1 could be released into the extracellular space and delivered to the lung via exosomes [
<xref rid="B40-viruses-11-00039" ref-type="bibr">40</xref>
] or the systemic circulation; it then cleaves pro-IL-1β into its bio-activated form, which is secreted into the serum (
<xref ref-type="fig" rid="viruses-11-00039-f002">Figure 2</xref>
D). We cannot exclude the possibility that pyroptosis occurs in the spleen because we did not detect expression of pro-IL-1β. Meanwhile, examination of CD68 and IFN-γ receptor expression revealed macrophage infiltration and activation in the lungs and spleen (
<xref ref-type="fig" rid="viruses-11-00039-f003">Figure 3</xref>
D). Thus, pyroptosis could occur in both organs.</p>
<p>In our previous study, we showed that inhibiting C5aR1 increased splenic cell regeneration and decreased splenic cell apoptosis, thereby alleviating MERS-CoV infection-induced tissue damage [
<xref rid="B16-viruses-11-00039" ref-type="bibr">16</xref>
]. The spleen happens to be a large reservoir for myeloid lineage cells such as macrophages, dendritic cells and CD4+ T cells in which pyroptosis mainly occurred [
<xref rid="B4-viruses-11-00039" ref-type="bibr">4</xref>
,
<xref rid="B34-viruses-11-00039" ref-type="bibr">34</xref>
,
<xref rid="B41-viruses-11-00039" ref-type="bibr">41</xref>
]. Here, we studied and demonstrated that inhibiting C5aR1 suppressed caspase-1 activation (
<xref ref-type="fig" rid="viruses-11-00039-f005">Figure 5</xref>
A) and macrophage infiltration and activation in the spleen (
<xref ref-type="fig" rid="viruses-11-00039-f006">Figure 6</xref>
D), and thereby reduced the secretion of IL-1β into the serum (
<xref ref-type="fig" rid="viruses-11-00039-f005">Figure 5</xref>
C) and the systemic inflammation (
<xref ref-type="fig" rid="viruses-11-00039-f006">Figure 6</xref>
). However, in the lung tissue, there was no significant difference of pro-IL-1β transcription between the Ab and sham-treated groups (
<xref ref-type="fig" rid="viruses-11-00039-f005">Figure 5</xref>
B), which may due to the limited macrophages, the main cell type in which pyroptosis occurred, when compared to that in spleen. </p>
<p>Although many studies have focused on the link between complement and pyroptosis, the pathways that link them remain unclear. Here, our results showed that MERS-CoV infection induces pro-IL-1β transcription, and complement activation, which leads to pyroptosis in macrophages. Induction of pyroptosis was related with complement activation and may be promoted by ligation of C5a and C5aR1, which was confirmed by the blockade of anti-C5aR1 antibody (
<xref ref-type="fig" rid="viruses-11-00039-f007">Figure 7</xref>
).</p>
<p>In summary, these data indicate that MERS-CoV infection induces overactivation of complement, which may contribute to pyroptosis and inflammation. Pyroptosis and inflammation were suppressed by inhibiting C5aR1. These research will further our understanding of the pathogenesis of MERS-CoV infection.</p>
</sec>
</body>
<back>
<notes>
<title>Author Contributions</title>
<p>Y.J., J.L. (Junfeng Li), Y.T., H.S., G.Z., S.S., G.T. performed the experiments. L.H., P.L., Y.C., Y.G., J.L. (Jiangfan Li) contributed reagents/materials/analysis tools. Y.J., J.L. (Junfeng Li), H.S., S.S. analyzed the data. Y.J., S.S., Y.Z. wrote and revised the manuscript. Y.J., Y.Z., S.S. conceived and designed the experiments. All authors read and approved the final manuscript.</p>
</notes>
<notes>
<title>Funding</title>
<p>This study was supported by the National Key Plan for Scientific Research and Development of China (2016YFD0500306), the National Natural Science Foundation of China (81571983, 31570158), the National Key Research and Development Program of China (2016YFC1202903, 2016YFC1202402), the National Project of Infectious Diseases (2017ZX10304402-003), BWS14J058, and 16CXZ039.</p>
</notes>
<notes notes-type="COI-statement">
<title>Conflicts of Interest</title>
<p>The authors declare no conflict of interest.</p>
</notes>
<ref-list>
<title>References</title>
<ref id="B1-viruses-11-00039">
<label>1.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arabi</surname>
<given-names>Y.M.</given-names>
</name>
<name>
<surname>Arifi</surname>
<given-names>A.A.</given-names>
</name>
<name>
<surname>Balkhy</surname>
<given-names>H.H.</given-names>
</name>
<name>
<surname>Najm</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Aldawood</surname>
<given-names>A.S.</given-names>
</name>
<name>
<surname>Ghabashi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Hawa</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Alothman</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Khaldi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Al Raiy</surname>
<given-names>B.</given-names>
</name>
</person-group>
<article-title>Clinical course and outcomes of critically ill patients with Middle East respiratory syndrome coronavirus infection</article-title>
<source>Ann. Intern. Med.</source>
<year>2014</year>
<volume>160</volume>
<fpage>389</fpage>
<lpage>397</lpage>
<pub-id pub-id-type="doi">10.7326/M13-2486</pub-id>
<pub-id pub-id-type="pmid">24474051</pub-id>
</element-citation>
</ref>
<ref id="B2-viruses-11-00039">
<label>2.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Assiri</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Al-Tawfiq</surname>
<given-names>J.A.</given-names>
</name>
<name>
<surname>Al-Rabeeah</surname>
<given-names>A.A.</given-names>
</name>
<name>
<surname>Al-Rabiah</surname>
<given-names>F.A.</given-names>
</name>
<name>
<surname>Al-Hajjar</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Al-Barrak</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Flemban</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Al-Nassir</surname>
<given-names>W.N.</given-names>
</name>
<name>
<surname>Balkhy</surname>
<given-names>H.H.</given-names>
</name>
<name>
<surname>Al-Hakeem</surname>
<given-names>R.F.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Epidemiological, demographic, and clinical characteristics of 47 cases of Middle East respiratory syndrome coronavirus disease from Saudi Arabia: A descriptive study</article-title>
<source>Lancet. Infect. Dis.</source>
<year>2013</year>
<volume>13</volume>
<fpage>752</fpage>
<lpage>761</lpage>
<pub-id pub-id-type="doi">10.1016/S1473-3099(13)70204-4</pub-id>
<pub-id pub-id-type="pmid">23891402</pub-id>
</element-citation>
</ref>
<ref id="B3-viruses-11-00039">
<label>3.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Al-Abdallat</surname>
<given-names>M.M.</given-names>
</name>
<name>
<surname>Payne</surname>
<given-names>D.C.</given-names>
</name>
<name>
<surname>Alqasrawi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Rha</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Tohme</surname>
<given-names>R.A.</given-names>
</name>
<name>
<surname>Abedi</surname>
<given-names>G.R.</given-names>
</name>
<name>
<surname>Al Nsour</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Iblan</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Jarour</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Farag</surname>
<given-names>N.H.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Hospital-associated outbreak of Middle East respiratory syndrome coronavirus: A serologic, epidemiologic, and clinical description</article-title>
<source>Clin. Infect. Dis.</source>
<year>2014</year>
<volume>59</volume>
<fpage>1225</fpage>
<lpage>1233</lpage>
<pub-id pub-id-type="doi">10.1093/cid/ciu359</pub-id>
<pub-id pub-id-type="pmid">24829216</pub-id>
</element-citation>
</ref>
<ref id="B4-viruses-11-00039">
<label>4.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vande Walle</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Lamkanfi</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>Pyroptosis</article-title>
<source>Curr. Biol.</source>
<year>2016</year>
<volume>26</volume>
<fpage>R568</fpage>
<lpage>R572</lpage>
<pub-id pub-id-type="doi">10.1016/j.cub.2016.02.019</pub-id>
<pub-id pub-id-type="pmid">27404251</pub-id>
</element-citation>
</ref>
<ref id="B5-viruses-11-00039">
<label>5.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanneganti</surname>
<given-names>T.D.</given-names>
</name>
<name>
<surname>Body-Malapel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Amer</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>J.H.</given-names>
</name>
<name>
<surname>Whitfield</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Franchi</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Taraporewala</surname>
<given-names>Z.F.</given-names>
</name>
<name>
<surname>Miller</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Patton</surname>
<given-names>J.T.</given-names>
</name>
<name>
<surname>Inohara</surname>
<given-names>N.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Critical role for Cryopyrin/Nalp3 in activation of caspase-1 in response to viral infection and double-stranded RNA</article-title>
<source>J. Biol. Chem.</source>
<year>2006</year>
<volume>281</volume>
<fpage>36560</fpage>
<lpage>36568</lpage>
<pub-id pub-id-type="doi">10.1074/jbc.M607594200</pub-id>
<pub-id pub-id-type="pmid">17008311</pub-id>
</element-citation>
</ref>
<ref id="B6-viruses-11-00039">
<label>6.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Joly</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Sutterwala</surname>
<given-names>F.S.</given-names>
</name>
</person-group>
<article-title>Fungal pathogen recognition by the NLRP3 inflammasome</article-title>
<source>Virulence</source>
<year>2010</year>
<volume>1</volume>
<fpage>276</fpage>
<lpage>280</lpage>
<pub-id pub-id-type="doi">10.4161/viru.1.4.11482</pub-id>
<pub-id pub-id-type="pmid">21178453</pub-id>
</element-citation>
</ref>
<ref id="B7-viruses-11-00039">
<label>7.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mariathasan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Weiss</surname>
<given-names>D.S.</given-names>
</name>
<name>
<surname>Newton</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>McBride</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>O’Rourke</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Roose-Girma</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>W.P.</given-names>
</name>
<name>
<surname>Weinrauch</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Monack</surname>
<given-names>D.M.</given-names>
</name>
<name>
<surname>Dixit</surname>
<given-names>V.M.</given-names>
</name>
</person-group>
<article-title>Cryopyrin activates the inflammasome in response to toxins and ATP</article-title>
<source>Nature</source>
<year>2006</year>
<volume>440</volume>
<fpage>228</fpage>
<lpage>232</lpage>
<pub-id pub-id-type="doi">10.1038/nature04515</pub-id>
<pub-id pub-id-type="pmid">16407890</pub-id>
</element-citation>
</ref>
<ref id="B8-viruses-11-00039">
<label>8.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shaw</surname>
<given-names>O.M.</given-names>
</name>
<name>
<surname>Steiger</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Hamilton</surname>
<given-names>J.A.</given-names>
</name>
<name>
<surname>Harper</surname>
<given-names>J.L.</given-names>
</name>
</person-group>
<article-title>Brief report: Granulocyte-macrophage colony-stimulating factor drives monosodium urate monohydrate crystal-induced inflammatory macrophage differentiation and NLRP3 inflammasome up-regulation in an in vivo mouse model</article-title>
<source>Arthritis Rheumatol.</source>
<year>2014</year>
<volume>66</volume>
<fpage>2423</fpage>
<lpage>2428</lpage>
<pub-id pub-id-type="doi">10.1002/art.38730</pub-id>
<pub-id pub-id-type="pmid">24910235</pub-id>
</element-citation>
</ref>
<ref id="B9-viruses-11-00039">
<label>9.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dostert</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Petrilli</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Van Bruggen</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Steele</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Mossman</surname>
<given-names>B.T.</given-names>
</name>
<name>
<surname>Tschopp</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica</article-title>
<source>Science</source>
<year>2008</year>
<volume>320</volume>
<fpage>674</fpage>
<lpage>677</lpage>
<pub-id pub-id-type="doi">10.1126/science.1156995</pub-id>
<pub-id pub-id-type="pmid">18403674</pub-id>
</element-citation>
</ref>
<ref id="B10-viruses-11-00039">
<label>10.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ding</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>She</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>D.C.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>F.</given-names>
</name>
</person-group>
<article-title>Pore-forming activity and structural autoinhibition of the gasdermin family</article-title>
<source>Nature</source>
<year>2016</year>
<volume>535</volume>
<fpage>111</fpage>
<lpage>116</lpage>
<pub-id pub-id-type="doi">10.1038/nature18590</pub-id>
<pub-id pub-id-type="pmid">27281216</pub-id>
</element-citation>
</ref>
<ref id="B11-viruses-11-00039">
<label>11.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schroder</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Tschopp</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>The inflammasomes</article-title>
<source>Cell</source>
<year>2010</year>
<volume>140</volume>
<fpage>821</fpage>
<lpage>832</lpage>
<pub-id pub-id-type="doi">10.1016/j.cell.2010.01.040</pub-id>
<pub-id pub-id-type="pmid">20303873</pub-id>
</element-citation>
</ref>
<ref id="B12-viruses-11-00039">
<label>12.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Al-Sharif</surname>
<given-names>W.Z.</given-names>
</name>
<name>
<surname>Sunyer</surname>
<given-names>J.O.</given-names>
</name>
<name>
<surname>Lambris</surname>
<given-names>J.D.</given-names>
</name>
<name>
<surname>Smith</surname>
<given-names>L.C.</given-names>
</name>
</person-group>
<article-title>Sea urchin coelomocytes specifically express a homologue of the complement component C3</article-title>
<source>J. Immunol.</source>
<year>1998</year>
<volume>160</volume>
<fpage>2983</fpage>
<lpage>2997</lpage>
<pub-id pub-id-type="pmid">9510203</pub-id>
</element-citation>
</ref>
<ref id="B13-viruses-11-00039">
<label>13.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Levashina</surname>
<given-names>E.A.</given-names>
</name>
<name>
<surname>Moita</surname>
<given-names>L.F.</given-names>
</name>
<name>
<surname>Blandin</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Vriend</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Lagueux</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kafatos</surname>
<given-names>F.C.</given-names>
</name>
</person-group>
<article-title>Conserved role of a complement-like protein in phagocytosis revealed by dsRNA knockout in cultured cells of the mosquito, Anopheles gambiae</article-title>
<source>Cell</source>
<year>2001</year>
<volume>104</volume>
<fpage>709</fpage>
<lpage>718</lpage>
<pub-id pub-id-type="doi">10.1016/S0092-8674(01)00267-7</pub-id>
<pub-id pub-id-type="pmid">11257225</pub-id>
</element-citation>
</ref>
<ref id="B14-viruses-11-00039">
<label>14.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peng</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Sacks</surname>
<given-names>S.H.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>W.</given-names>
</name>
</person-group>
<article-title>The role of anaphylatoxins C3a and C5a in regulating innate and adaptive immune responses</article-title>
<source>Inflamm. Allergy Drug Targets</source>
<year>2009</year>
<volume>8</volume>
<fpage>236</fpage>
<lpage>246</lpage>
<pub-id pub-id-type="doi">10.2174/187152809788681038</pub-id>
<pub-id pub-id-type="pmid">19601884</pub-id>
</element-citation>
</ref>
<ref id="B15-viruses-11-00039">
<label>15.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>DiScipio</surname>
<given-names>R.G.</given-names>
</name>
<name>
<surname>Schraufstatter</surname>
<given-names>I.U.</given-names>
</name>
</person-group>
<article-title>The role of the complement anaphylatoxins in the recruitment of eosinophils</article-title>
<source>Int. Immunopharmacol.</source>
<year>2007</year>
<volume>7</volume>
<fpage>1909</fpage>
<lpage>1923</lpage>
<pub-id pub-id-type="doi">10.1016/j.intimp.2007.07.006</pub-id>
<pub-id pub-id-type="pmid">18039528</pub-id>
</element-citation>
</ref>
<ref id="B16-viruses-11-00039">
<label>16.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>R.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Blockade of the C5a-C5aR axis alleviates lung damage in hDPP4-transgenic mice infected with MERS-CoV</article-title>
<source>Emerg. Microbes Infect.</source>
<year>2018</year>
<volume>7</volume>
<fpage>77</fpage>
<pub-id pub-id-type="doi">10.1038/s41426-018-0063-8</pub-id>
<pub-id pub-id-type="pmid">29691378</pub-id>
</element-citation>
</ref>
<ref id="B17-viruses-11-00039">
<label>17.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Kou</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>L.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Multi-Organ Damage in Human Dipeptidyl Peptidase 4 Transgenic Mice Infected with Middle East Respiratory Syndrome-Coronavirus</article-title>
<source>PLoS ONE</source>
<year>2015</year>
<volume>10</volume>
<elocation-id>e0145561</elocation-id>
<pub-id pub-id-type="doi">10.1371/journal.pone.0145561</pub-id>
<pub-id pub-id-type="pmid">26701103</pub-id>
</element-citation>
</ref>
<ref id="B18-viruses-11-00039">
<label>18.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wong</surname>
<given-names>B.H.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>Z.S.</given-names>
</name>
<name>
<surname>Poon</surname>
<given-names>V.K.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Lau</surname>
<given-names>C.C.</given-names>
</name>
<name>
<surname>Wong</surname>
<given-names>K.K.</given-names>
</name>
<name>
<surname>Chan</surname>
<given-names>J.Y.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Active replication of Middle East respiratory syndrome coronavirus and aberrant induction of inflammatory cytokines and chemokines in human macrophages: Implications for pathogenesis</article-title>
<source>J. Infect. Dis.</source>
<year>2014</year>
<volume>209</volume>
<fpage>1331</fpage>
<lpage>1342</lpage>
<pub-id pub-id-type="doi">10.1093/infdis/jit504</pub-id>
<pub-id pub-id-type="pmid">24065148</pub-id>
</element-citation>
</ref>
<ref id="B19-viruses-11-00039">
<label>19.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Wan</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>EV71 3D Protein Binds with NLRP3 and Enhances the Assembly of Inflammasome Complex</article-title>
<source>PLoS Pathog.</source>
<year>2017</year>
<volume>13</volume>
<elocation-id>e1006123</elocation-id>
<pub-id pub-id-type="doi">10.1371/journal.ppat.1006123</pub-id>
<pub-id pub-id-type="pmid">28060938</pub-id>
</element-citation>
</ref>
<ref id="B20-viruses-11-00039">
<label>20.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Allen</surname>
<given-names>I.C.</given-names>
</name>
<name>
<surname>Scull</surname>
<given-names>M.A.</given-names>
</name>
<name>
<surname>Moore</surname>
<given-names>C.B.</given-names>
</name>
<name>
<surname>Holl</surname>
<given-names>E.K.</given-names>
</name>
<name>
<surname>McElvania-TeKippe</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Taxman</surname>
<given-names>D.J.</given-names>
</name>
<name>
<surname>Guthrie</surname>
<given-names>E.H.</given-names>
</name>
<name>
<surname>Pickles</surname>
<given-names>R.J.</given-names>
</name>
<name>
<surname>Ting</surname>
<given-names>J.P.</given-names>
</name>
</person-group>
<article-title>The NLRP3 inflammasome mediates in vivo innate immunity to influenza A virus through recognition of viral RNA</article-title>
<source>Immunity</source>
<year>2009</year>
<volume>30</volume>
<fpage>556</fpage>
<lpage>565</lpage>
<pub-id pub-id-type="doi">10.1016/j.immuni.2009.02.005</pub-id>
<pub-id pub-id-type="pmid">19362020</pub-id>
</element-citation>
</ref>
<ref id="B21-viruses-11-00039">
<label>21.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ren</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Qin</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>H.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>The H7N9 influenza A virus infection results in lethal inflammation in the mammalian host via the NLRP3-caspase-1 inflammasome</article-title>
<source>Sci. Rep.</source>
<year>2017</year>
<volume>7</volume>
<fpage>7625</fpage>
<pub-id pub-id-type="doi">10.1038/s41598-017-07384-5</pub-id>
<pub-id pub-id-type="pmid">28790324</pub-id>
</element-citation>
</ref>
<ref id="B22-viruses-11-00039">
<label>22.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>De</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>K.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Zika virus infection induces host inflammatory responses by facilitating NLRP3 inflammasome assembly and interleukin-1beta secretion</article-title>
<source>Nat. Commun.</source>
<year>2018</year>
<volume>9</volume>
<fpage>106</fpage>
<pub-id pub-id-type="doi">10.1038/s41467-017-02645-3</pub-id>
<pub-id pub-id-type="pmid">29317641</pub-id>
</element-citation>
</ref>
<ref id="B23-viruses-11-00039">
<label>23.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dinarello</surname>
<given-names>C.A.</given-names>
</name>
</person-group>
<article-title>Immunological and inflammatory functions of the interleukin-1 family</article-title>
<source>Annu. Rev. Immunol.</source>
<year>2009</year>
<volume>27</volume>
<fpage>519</fpage>
<lpage>550</lpage>
<pub-id pub-id-type="doi">10.1146/annurev.immunol.021908.132612</pub-id>
<pub-id pub-id-type="pmid">19302047</pub-id>
</element-citation>
</ref>
<ref id="B24-viruses-11-00039">
<label>24.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guery</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Poissy</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>el Mansouf</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Sejourne</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Ettahar</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Lemaire</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Vuotto</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Goffard</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Behillil</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Enouf</surname>
<given-names>V.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Clinical features and viral diagnosis of two cases of infection with Middle East Respiratory Syndrome coronavirus: A report of nosocomial transmission</article-title>
<source>Lancet</source>
<year>2013</year>
<volume>381</volume>
<fpage>2265</fpage>
<lpage>2272</lpage>
<pub-id pub-id-type="doi">10.1016/S0140-6736(13)60982-4</pub-id>
<pub-id pub-id-type="pmid">23727167</pub-id>
</element-citation>
</ref>
<ref id="B25-viruses-11-00039">
<label>25.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hajishengallis</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Lambris</surname>
<given-names>J.D.</given-names>
</name>
</person-group>
<article-title>Crosstalk pathways between Toll-like receptors and the complement system</article-title>
<source>Trends Immunol.</source>
<year>2010</year>
<volume>31</volume>
<fpage>154</fpage>
<lpage>163</lpage>
<pub-id pub-id-type="doi">10.1016/j.it.2010.01.002</pub-id>
<pub-id pub-id-type="pmid">20153254</pub-id>
</element-citation>
</ref>
<ref id="B26-viruses-11-00039">
<label>26.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Samstad</surname>
<given-names>E.O.</given-names>
</name>
<name>
<surname>Niyonzima</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Nymo</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Aune</surname>
<given-names>M.H.</given-names>
</name>
<name>
<surname>Ryan</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Bakke</surname>
<given-names>S.S.</given-names>
</name>
<name>
<surname>Lappegard</surname>
<given-names>K.T.</given-names>
</name>
<name>
<surname>Brekke</surname>
<given-names>O.L.</given-names>
</name>
<name>
<surname>Lambris</surname>
<given-names>J.D.</given-names>
</name>
<name>
<surname>Damas</surname>
<given-names>J.K.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Cholesterol crystals induce complement-dependent inflammasome activation and cytokine release</article-title>
<source>J. Immunol.</source>
<year>2014</year>
<volume>192</volume>
<fpage>2837</fpage>
<lpage>2845</lpage>
<pub-id pub-id-type="doi">10.4049/jimmunol.1302484</pub-id>
<pub-id pub-id-type="pmid">24554772</pub-id>
</element-citation>
</ref>
<ref id="B27-viruses-11-00039">
<label>27.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liszewski</surname>
<given-names>M.K.</given-names>
</name>
<name>
<surname>Kolev</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Le Friec</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Leung</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Bertram</surname>
<given-names>P.G.</given-names>
</name>
<name>
<surname>Fara</surname>
<given-names>A.F.</given-names>
</name>
<name>
<surname>Subias</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Pickering</surname>
<given-names>M.C.</given-names>
</name>
<name>
<surname>Drouet</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Meri</surname>
<given-names>S.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Intracellular complement activation sustains T cell homeostasis and mediates effector differentiation</article-title>
<source>Immunity</source>
<year>2013</year>
<volume>39</volume>
<fpage>1143</fpage>
<lpage>1157</lpage>
<pub-id pub-id-type="doi">10.1016/j.immuni.2013.10.018</pub-id>
<pub-id pub-id-type="pmid">24315997</pub-id>
</element-citation>
</ref>
<ref id="B28-viruses-11-00039">
<label>28.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Asgari</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Le Friec</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Yamamoto</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Perucha</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Sacks</surname>
<given-names>S.S.</given-names>
</name>
<name>
<surname>Kohl</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Cook</surname>
<given-names>H.T.</given-names>
</name>
<name>
<surname>Kemper</surname>
<given-names>C.</given-names>
</name>
</person-group>
<article-title>C3a modulates IL-1beta secretion in human monocytes by regulating ATP efflux and subsequent NLRP3 inflammasome activation</article-title>
<source>Blood</source>
<year>2013</year>
<volume>122</volume>
<fpage>3473</fpage>
<lpage>3481</lpage>
<pub-id pub-id-type="doi">10.1182/blood-2013-05-502229</pub-id>
<pub-id pub-id-type="pmid">23878142</pub-id>
</element-citation>
</ref>
<ref id="B29-viruses-11-00039">
<label>29.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gerard</surname>
<given-names>N.P.</given-names>
</name>
<name>
<surname>Gerard</surname>
<given-names>C.</given-names>
</name>
</person-group>
<article-title>The chemotactic receptor for human C5a anaphylatoxin</article-title>
<source>Nature</source>
<year>1991</year>
<volume>349</volume>
<fpage>614</fpage>
<lpage>617</lpage>
<pub-id pub-id-type="doi">10.1038/349614a0</pub-id>
<pub-id pub-id-type="pmid">1847994</pub-id>
</element-citation>
</ref>
<ref id="B30-viruses-11-00039">
<label>30.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Neff</surname>
<given-names>T.A.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>R.F.</given-names>
</name>
<name>
<surname>Speyer</surname>
<given-names>C.L.</given-names>
</name>
<name>
<surname>Sarma</surname>
<given-names>J.V.</given-names>
</name>
<name>
<surname>Tomlins</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Man</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Riedemann</surname>
<given-names>N.C.</given-names>
</name>
<name>
<surname>Hoesel</surname>
<given-names>L.M.</given-names>
</name>
<name>
<surname>Younkin</surname>
<given-names>E.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Evidence for a functional role of the second C5a receptor C5L2</article-title>
<source>FASEB J.</source>
<year>2005</year>
<volume>19</volume>
<fpage>1003</fpage>
<lpage>1005</lpage>
<pub-id pub-id-type="doi">10.1096/fj.04-3424fje</pub-id>
<pub-id pub-id-type="pmid">15784721</pub-id>
</element-citation>
</ref>
<ref id="B31-viruses-11-00039">
<label>31.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gerard</surname>
<given-names>N.P.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Fujiwara</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Okinaga</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Gerard</surname>
<given-names>C.</given-names>
</name>
</person-group>
<article-title>An anti-inflammatory function for the complement anaphylatoxin C5a-binding protein, C5L2</article-title>
<source>J. Biol. Chem.</source>
<year>2005</year>
<volume>280</volume>
<fpage>39677</fpage>
<lpage>39680</lpage>
<pub-id pub-id-type="doi">10.1074/jbc.C500287200</pub-id>
<pub-id pub-id-type="pmid">16204243</pub-id>
</element-citation>
</ref>
<ref id="B32-viruses-11-00039">
<label>32.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morgan</surname>
<given-names>B.P.</given-names>
</name>
<name>
<surname>Gasque</surname>
<given-names>P.</given-names>
</name>
</person-group>
<article-title>Extrahepatic complement biosynthesis: Where, when and why?</article-title>
<source>Clin. Exp. Immunol.</source>
<year>1997</year>
<volume>107</volume>
<fpage>1</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="doi">10.1046/j.1365-2249.1997.d01-890.x</pub-id>
<pub-id pub-id-type="pmid">9010248</pub-id>
</element-citation>
</ref>
<ref id="B33-viruses-11-00039">
<label>33.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Zhong</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zou</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Zhan</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>Z.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Multiple organ infection and the pathogenesis of SARS</article-title>
<source>J. Exp. Med.</source>
<year>2005</year>
<volume>202</volume>
<fpage>415</fpage>
<lpage>424</lpage>
<pub-id pub-id-type="doi">10.1084/jem.20050828</pub-id>
<pub-id pub-id-type="pmid">16043521</pub-id>
</element-citation>
</ref>
<ref id="B34-viruses-11-00039">
<label>34.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Doitsh</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Galloway</surname>
<given-names>N.L.</given-names>
</name>
<name>
<surname>Geng</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Monroe</surname>
<given-names>K.M.</given-names>
</name>
<name>
<surname>Zepeda</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Hunt</surname>
<given-names>P.W.</given-names>
</name>
<name>
<surname>Hatano</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Sowinski</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Munoz-Arias</surname>
<given-names>I.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Cell death by pyroptosis drives CD4 T-cell depletion in HIV-1 infection</article-title>
<source>Nature</source>
<year>2014</year>
<volume>505</volume>
<fpage>509</fpage>
<lpage>514</lpage>
<pub-id pub-id-type="doi">10.1038/nature12940</pub-id>
<pub-id pub-id-type="pmid">24356306</pub-id>
</element-citation>
</ref>
<ref id="B35-viruses-11-00039">
<label>35.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>McAuley</surname>
<given-names>J.L.</given-names>
</name>
<name>
<surname>Tate</surname>
<given-names>M.D.</given-names>
</name>
<name>
<surname>MacKenzie-Kludas</surname>
<given-names>C.J.</given-names>
</name>
<name>
<surname>Pinar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Stutz</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Latz</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Brown</surname>
<given-names>L.E.</given-names>
</name>
<name>
<surname>Mansell</surname>
<given-names>A.</given-names>
</name>
</person-group>
<article-title>Activation of the NLRP3 inflammasome by IAV virulence protein PB1-F2 contributes to severe pathophysiology and disease</article-title>
<source>PLoS Pathog.</source>
<year>2013</year>
<volume>9</volume>
<elocation-id>e1003392</elocation-id>
<pub-id pub-id-type="doi">10.1371/journal.ppat.1003392</pub-id>
<pub-id pub-id-type="pmid">23737748</pub-id>
</element-citation>
</ref>
<ref id="B36-viruses-11-00039">
<label>36.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pinar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Dowling</surname>
<given-names>J.K.</given-names>
</name>
<name>
<surname>Bitto</surname>
<given-names>N.J.</given-names>
</name>
<name>
<surname>Robertson</surname>
<given-names>A.A.</given-names>
</name>
<name>
<surname>Latz</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Stewart</surname>
<given-names>C.R.</given-names>
</name>
<name>
<surname>Drummond</surname>
<given-names>G.R.</given-names>
</name>
<name>
<surname>Cooper</surname>
<given-names>M.A.</given-names>
</name>
<name>
<surname>McAuley</surname>
<given-names>J.L.</given-names>
</name>
<name>
<surname>Tate</surname>
<given-names>M.D.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>PB1-F2 Peptide Derived from Avian Influenza A Virus H7N9 Induces Inflammation via Activation of the NLRP3 Inflammasome</article-title>
<source>J. Biol. Chem.</source>
<year>2017</year>
<volume>292</volume>
<fpage>826</fpage>
<lpage>836</lpage>
<pub-id pub-id-type="doi">10.1074/jbc.M116.756379</pub-id>
<pub-id pub-id-type="pmid">27913620</pub-id>
</element-citation>
</ref>
<ref id="B37-viruses-11-00039">
<label>37.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yao</surname>
<given-names>S.T.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J.L.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Fan</surname>
<given-names>R.M.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>Y.C.</given-names>
</name>
<name>
<surname>Jiao</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>X.P.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>C.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>NLRP3 is Required for Complement-Mediated Caspase-1 and IL-1beta Activation in ICH</article-title>
<source>J. Mol. Neurosci.</source>
<year>2017</year>
<volume>61</volume>
<fpage>385</fpage>
<lpage>395</lpage>
<pub-id pub-id-type="doi">10.1007/s12031-016-0874-9</pub-id>
<pub-id pub-id-type="pmid">27933491</pub-id>
</element-citation>
</ref>
<ref id="B38-viruses-11-00039">
<label>38.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arbore</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>West</surname>
<given-names>E.E.</given-names>
</name>
<name>
<surname>Spolski</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Robertson</surname>
<given-names>A.A.B.</given-names>
</name>
<name>
<surname>Klos</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Rheinheimer</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Dutow</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Woodruff</surname>
<given-names>T.M.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>Z.X.</given-names>
</name>
<name>
<surname>O’Neill</surname>
<given-names>L.A.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>T helper 1 immunity requires complement-driven NLRP3 inflammasome activity in CD4(+) T cells</article-title>
<source>Science</source>
<year>2016</year>
<volume>352</volume>
<pub-id pub-id-type="doi">10.1126/science.aad1210</pub-id>
</element-citation>
</ref>
<ref id="B39-viruses-11-00039">
<label>39.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reichhardt</surname>
<given-names>M.P.</given-names>
</name>
<name>
<surname>Meri</surname>
<given-names>S.</given-names>
</name>
</person-group>
<article-title>Intracellular complement activation-An alarm raising mechanism?</article-title>
<source>Semin. Immunol.</source>
<year>2018</year>
<pub-id pub-id-type="doi">10.1016/j.smim.2018.03.003</pub-id>
</element-citation>
</ref>
<ref id="B40-viruses-11-00039">
<label>40.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>Inflammasome-Derived Exosomes Activate NF-kappaB Signaling in Macrophages</article-title>
<source>J. Proteome Res.</source>
<year>2017</year>
<volume>16</volume>
<fpage>170</fpage>
<lpage>178</lpage>
<pub-id pub-id-type="doi">10.1021/acs.jproteome.6b00599</pub-id>
<pub-id pub-id-type="pmid">27684284</pub-id>
</element-citation>
</ref>
<ref id="B41-viruses-11-00039">
<label>41.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mebius</surname>
<given-names>R.E.</given-names>
</name>
<name>
<surname>Kraal</surname>
<given-names>G.</given-names>
</name>
</person-group>
<article-title>Structure and function of the spleen</article-title>
<source>Nat. Rev. Immunol.</source>
<year>2005</year>
<volume>5</volume>
<fpage>606</fpage>
<lpage>616</lpage>
<pub-id pub-id-type="doi">10.1038/nri1669</pub-id>
<pub-id pub-id-type="pmid">16056254</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
<floats-group>
<fig id="viruses-11-00039-f001" orientation="portrait" position="float">
<label>Figure 1</label>
<caption>
<p>MERS-CoV infection induces pyroptosis in THP-1 macrophages. THP-1 monocytes and macrophages were infected with MERS-CoV for 24 h. Total RNA and protein was then extracted from the cells using TRIzol Reagent. (
<bold>A</bold>
–
<bold>C</bold>
) Total RNA was used for RT-qPCR to detect transcription of pro-caspase-1, pro-IL-1β, and NLRP3. Data are expressed as means ± SEM (
<italic>n</italic>
= 2 per group). (
<bold>D</bold>
) Samples of total protein were subjected to Western blotting to detect pro-caspase-1, pro-IL-1β, activated IL-1β, and MERS NP.</p>
</caption>
<graphic xlink:href="viruses-11-00039-g001"></graphic>
</fig>
<fig id="viruses-11-00039-f002" orientation="portrait" position="float">
<label>Figure 2</label>
<caption>
<p>MERS-CoV infection induces pyroptosis in hDPP4-transgenic mice. (
<bold>A</bold>
–
<bold>C</bold>
) Transcription of NLRP3, pro-caspase-1, and pro-IL-1β in lung tissue at Day 3 post-MERS-CoV infection (
<italic>n</italic>
= 5–6 per group). (
<bold>D</bold>
) Concentration of IL-1β in serum at Day 3 post-MERS-CoV infection. Data are expressed as means ± SEM (
<italic>n</italic>
= 5–6 per group). *
<italic>p</italic>
< 0.05, **
<italic>p</italic>
< 0.01 (Student’s
<italic>t</italic>
test with Welch’s correction). (
<bold>E</bold>
) Representative images of immunohistochemical staining of caspase-1 in lung tissue on Day 7 post-challenge of sham-infected and MERS-CoV-infected mice (scale bars = 100 μm).</p>
</caption>
<graphic xlink:href="viruses-11-00039-g002"></graphic>
</fig>
<fig id="viruses-11-00039-f003" orientation="portrait" position="float">
<label>Figure 3</label>
<caption>
<p>MERS-CoV infection induces systemic inflammation in hDPP4-transgenic mice. (
<bold>A</bold>
–
<bold>C</bold>
) Concentration of TNF-α, IFN-γ, and IL-6 in serum at Day 3 post-MERS-CoV infection. Data are expressed as means ± SEM (
<italic>n</italic>
= 5–6 per group). *
<italic>p</italic>
< 0.05, **
<italic>p</italic>
< 0.01 (Student’s
<italic>t</italic>
test with Welch’s correction). (
<bold>D</bold>
) Macrophage infiltration and expression of IFN-γ receptor were assessed by immunohistochemical staining of lung and spleen at 7 days post-challenge (scale bars = 100 μm).</p>
</caption>
<graphic xlink:href="viruses-11-00039-g003"></graphic>
</fig>
<fig id="viruses-11-00039-f004" orientation="portrait" position="float">
<label>Figure 4</label>
<caption>
<p>MERS-CoV infection alters complement expression in monocytes and macrophages. (
<bold>A</bold>
–
<bold>D</bold>
) Transcription of C3, C3aR, C5aR1, and C5aR2 in THP-1 monocytes and macrophages at 24 h post-MERS-CoV infection. Data are expressed as means ± SEM (
<italic>n</italic>
= 2 per group).</p>
</caption>
<graphic xlink:href="viruses-11-00039-g004"></graphic>
</fig>
<fig id="viruses-11-00039-f005" orientation="portrait" position="float">
<label>Figure 5</label>
<caption>
<p>Blocking the C5a-C5aR1 axis reduces pyroptosis in hDPP4-transgenic mice. (
<bold>A</bold>
) Representative images of immunohistochemical staining of caspase-1 in lungs from PBS-treated and anti-C5aR1 Ab-treated groups on Day 7 post-challenge (scale bars = 100 μm). (
<bold>B</bold>
) Transcription of pro-IL-1β in lung tissues from PBS-treated and anti-C5aR1 Ab-treated groups at Day 7 post-infection (
<italic>n</italic>
= 4–5 per group). (
<bold>C</bold>
) Concentration of IL-1β in serum at Day 1 post-MERS-CoV infection. Data are expressed as means ± SEM (
<italic>n</italic>
= 4–5 per group). **
<italic>p</italic>
< 0.01 (Student’s
<italic>t</italic>
test with Welch’s correction).</p>
</caption>
<graphic xlink:href="viruses-11-00039-g005"></graphic>
</fig>
<fig id="viruses-11-00039-f006" orientation="portrait" position="float">
<label>Figure 6</label>
<caption>
<p>Blockade of the C5a-C5aR1 axis reduces pyroptosis in hDPP4-transgenic mice. (
<bold>A</bold>
–
<bold>C</bold>
) Concentration of IFN-γ, TNF-α, and IL-6 in serum at Day 1 post-MERS-CoV infection. Data are expressed as means ± SEM (
<italic>n</italic>
= 4–5 per group). *
<italic>p</italic>
< 0.05 (Student’s
<italic>t</italic>
test with Welch’s correction). (
<bold>D</bold>
) Infiltration of the lungs and spleen by macrophages and expression of IFN-γ receptor were assessed by immunohistochemical staining 7 days after challenge (scale bars = 100 μm).</p>
</caption>
<graphic xlink:href="viruses-11-00039-g006"></graphic>
</fig>
<fig id="viruses-11-00039-f007" orientation="portrait" position="float">
<label>Figure 7</label>
<caption>
<p>Diagram illustrating the relationship between complement and pyroptosis during MERS-CoV infection. MERS-CoV infection induces activation of complement and transcription of pro-IL-1β. Activated complement component C5a is released into the extracellular space where it interacts with C5aR1, which triggers assembly of the NLRP3 inflammasome. Activated caspase-1 cleaves pro-IL-1β into its active form thereby triggering pyroptosis. An anti-C5aR1 antibody prevents interaction between C5a and C5aR1, thereby ameliorating pyroptosis.</p>
</caption>
<graphic xlink:href="viruses-11-00039-g007"></graphic>
</fig>
<table-wrap id="viruses-11-00039-t001" orientation="portrait" position="float">
<object-id pub-id-type="pii">viruses-11-00039-t001_Table 1</object-id>
<label>Table 1</label>
<caption>
<p>Primers used to amplify inflammasome and complement components.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Primer</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Species</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Gene</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Orientation</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Sequence (5′-3′)</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">1</td>
<td rowspan="14" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">Human</td>
<td rowspan="2" align="center" valign="middle" colspan="1">NLRP3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ATTCGGAGATTGTGGTTGGG</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">R</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGGGCGTTGTCACTCAGGTC</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">2</td>
<td rowspan="2" align="center" valign="middle" colspan="1">pro-caspase-1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CTCAGGCTCAGAAGGGAATGTC</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">R</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TGTGCGGCTTGACTTGTCC</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">3</td>
<td rowspan="2" align="center" valign="middle" colspan="1">pro-IL-1b</td>
<td align="center" valign="middle" rowspan="1" colspan="1">F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GCTCGCCAGTGAAATGATGG</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">R</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CAGAGGGCAGAGGTCCAGG</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">4</td>
<td rowspan="2" align="center" valign="middle" colspan="1">C3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CACTATGATCCTTGAGATCTGTACCA</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">R</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GGAGCAAAGCCAGTCATCA</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">5</td>
<td rowspan="2" align="center" valign="middle" colspan="1">C3aR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GACATCCAGGTGCTGAAGCC</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">R</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ACTGGGGGCTCATTCCATG</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">6</td>
<td rowspan="2" align="center" valign="middle" colspan="1">C5aR1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GCTGACCATACCCTCCTTCCT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">R</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CCGTTTGTCGTGGCTGTAGTC</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">7</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">C5aR2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TGCTGTTTGTCTCTGCCCATC</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">R</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">GTCAGCAGGATGATGGAGGG</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">8</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">Mouse</td>
<td rowspan="2" align="center" valign="middle" colspan="1">pro-caspase-1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AATGAAGTTGCTGCTGGAGGA</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">R</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CAGAAGTCTTGTGCTCTGGGC</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">9</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">pro-IL-1b</td>
<td align="center" valign="middle" rowspan="1" colspan="1">F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TGGACCTTCCAGGATGAGGACA</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">R</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">GTTCATCTCGGAGCCTGTAGTG</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/MersV1/Data/Pmc/Corpus

HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 001214 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 001214 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    MersV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     PMC:6356766
   |texte=   Complement Receptor C5aR1 Inhibition Reduces Pyroptosis in hDPP4-Transgenic Mice Infected with MERS-CoV
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i   -Sk "pubmed:30634407" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd   \
       | NlmPubMed2Wicri -a MersV1
Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Mon Apr 20 23:26:43 2020. Site generation: Sat Mar 27 09:06:09 2021