Links to Exploration step
Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP)</title>
<author><name sortKey="Shirato, Kazuya" sort="Shirato, Kazuya" uniqKey="Shirato K" first="Kazuya" last="Shirato">Kazuya Shirato</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.410795.e</institution-id>
<institution-id institution-id-type="ISNI">0000000122201880</institution-id>
<institution>Laboratory of Acute Respiratory Viral Diseases and Cytokines,Department of Virology III, , 4-7-1 Gakuen,</institution>
<institution>National Institute of Infectious Disease, Laboratory of Acute Respiratory Viral Diseases and Cytokines,</institution>
</institution-wrap>
Musashimurayama,Tokyo, 208-0011 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yano, Takuya" sort="Yano, Takuya" uniqKey="Yano T" first="Takuya" last="Yano">Takuya Yano</name>
<affiliation><nlm:aff id="Aff2">Mie Prefecture Health and Environment Research Institute, Yokkaichi, 3684-11 Sakura-cho, Mie 512-1211 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Senba, Syouhei" sort="Senba, Syouhei" uniqKey="Senba S" first="Syouhei" last="Senba">Syouhei Senba</name>
<affiliation><nlm:aff id="Aff3">Eiken Chemical Co. Ltd, 4-19-9 Taito, Tokyo, 110-8408 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Akachi, Shigehiro" sort="Akachi, Shigehiro" uniqKey="Akachi S" first="Shigehiro" last="Akachi">Shigehiro Akachi</name>
<affiliation><nlm:aff id="Aff2">Mie Prefecture Health and Environment Research Institute, Yokkaichi, 3684-11 Sakura-cho, Mie 512-1211 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kobayashi, Takashi" sort="Kobayashi, Takashi" uniqKey="Kobayashi T" first="Takashi" last="Kobayashi">Takashi Kobayashi</name>
<affiliation><nlm:aff id="Aff2">Mie Prefecture Health and Environment Research Institute, Yokkaichi, 3684-11 Sakura-cho, Mie 512-1211 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nishinaka, Takamichi" sort="Nishinaka, Takamichi" uniqKey="Nishinaka T" first="Takamichi" last="Nishinaka">Takamichi Nishinaka</name>
<affiliation><nlm:aff id="Aff2">Mie Prefecture Health and Environment Research Institute, Yokkaichi, 3684-11 Sakura-cho, Mie 512-1211 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Notomi, Tsugunori" sort="Notomi, Tsugunori" uniqKey="Notomi T" first="Tsugunori" last="Notomi">Tsugunori Notomi</name>
<affiliation><nlm:aff id="Aff3">Eiken Chemical Co. Ltd, 4-19-9 Taito, Tokyo, 110-8408 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Matsuyama, Shutoku" sort="Matsuyama, Shutoku" uniqKey="Matsuyama S" first="Shutoku" last="Matsuyama">Shutoku Matsuyama</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.410795.e</institution-id>
<institution-id institution-id-type="ISNI">0000000122201880</institution-id>
<institution>Laboratory of Acute Respiratory Viral Diseases and Cytokines,Department of Virology III, , 4-7-1 Gakuen,</institution>
<institution>National Institute of Infectious Disease, Laboratory of Acute Respiratory Viral Diseases and Cytokines,</institution>
</institution-wrap>
Musashimurayama,Tokyo, 208-0011 Japan</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">25103205</idno>
<idno type="pmc">4132226</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4132226</idno>
<idno type="RBID">PMC:4132226</idno>
<idno type="doi">10.1186/1743-422X-11-139</idno>
<date when="2014">2014</date>
<idno type="wicri:Area/Pmc/Corpus">000474</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000474</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP)</title>
<author><name sortKey="Shirato, Kazuya" sort="Shirato, Kazuya" uniqKey="Shirato K" first="Kazuya" last="Shirato">Kazuya Shirato</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.410795.e</institution-id>
<institution-id institution-id-type="ISNI">0000000122201880</institution-id>
<institution>Laboratory of Acute Respiratory Viral Diseases and Cytokines,Department of Virology III, , 4-7-1 Gakuen,</institution>
<institution>National Institute of Infectious Disease, Laboratory of Acute Respiratory Viral Diseases and Cytokines,</institution>
</institution-wrap>
Musashimurayama,Tokyo, 208-0011 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yano, Takuya" sort="Yano, Takuya" uniqKey="Yano T" first="Takuya" last="Yano">Takuya Yano</name>
<affiliation><nlm:aff id="Aff2">Mie Prefecture Health and Environment Research Institute, Yokkaichi, 3684-11 Sakura-cho, Mie 512-1211 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Senba, Syouhei" sort="Senba, Syouhei" uniqKey="Senba S" first="Syouhei" last="Senba">Syouhei Senba</name>
<affiliation><nlm:aff id="Aff3">Eiken Chemical Co. Ltd, 4-19-9 Taito, Tokyo, 110-8408 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Akachi, Shigehiro" sort="Akachi, Shigehiro" uniqKey="Akachi S" first="Shigehiro" last="Akachi">Shigehiro Akachi</name>
<affiliation><nlm:aff id="Aff2">Mie Prefecture Health and Environment Research Institute, Yokkaichi, 3684-11 Sakura-cho, Mie 512-1211 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kobayashi, Takashi" sort="Kobayashi, Takashi" uniqKey="Kobayashi T" first="Takashi" last="Kobayashi">Takashi Kobayashi</name>
<affiliation><nlm:aff id="Aff2">Mie Prefecture Health and Environment Research Institute, Yokkaichi, 3684-11 Sakura-cho, Mie 512-1211 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nishinaka, Takamichi" sort="Nishinaka, Takamichi" uniqKey="Nishinaka T" first="Takamichi" last="Nishinaka">Takamichi Nishinaka</name>
<affiliation><nlm:aff id="Aff2">Mie Prefecture Health and Environment Research Institute, Yokkaichi, 3684-11 Sakura-cho, Mie 512-1211 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Notomi, Tsugunori" sort="Notomi, Tsugunori" uniqKey="Notomi T" first="Tsugunori" last="Notomi">Tsugunori Notomi</name>
<affiliation><nlm:aff id="Aff3">Eiken Chemical Co. Ltd, 4-19-9 Taito, Tokyo, 110-8408 Japan</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Matsuyama, Shutoku" sort="Matsuyama, Shutoku" uniqKey="Matsuyama S" first="Shutoku" last="Matsuyama">Shutoku Matsuyama</name>
<affiliation><nlm:aff id="Aff1"><institution-wrap><institution-id institution-id-type="GRID">grid.410795.e</institution-id>
<institution-id institution-id-type="ISNI">0000000122201880</institution-id>
<institution>Laboratory of Acute Respiratory Viral Diseases and Cytokines,Department of Virology III, , 4-7-1 Gakuen,</institution>
<institution>National Institute of Infectious Disease, Laboratory of Acute Respiratory Viral Diseases and Cytokines,</institution>
</institution-wrap>
Musashimurayama,Tokyo, 208-0011 Japan</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">Virology Journal</title>
<idno type="eISSN">1743-422X</idno>
<imprint><date when="2014">2014</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><sec><title>Background</title>
<p>The first documented case of Middle East Respiratory Syndrome coronavirus (MERS-CoV) occurred in 2012, and outbreaks have continued ever since, mainly in Saudi Arabia. MERS-CoV is primarily diagnosed using a real-time RT-PCR assay, with at least two different genomic targets required for a positive diagnosis according to the case definition of The World Health Organization (WHO) as of 3 July 2013. Therefore, it is urgently necessary to develop as many specific genetic diagnostic methods as possible to allow stable diagnosis of MERS-CoV infections.</p>
</sec>
<sec><title>Methods</title>
<p>Reverse transcription-loop-mediated isothermal amplification (RT-LAMP) is a genetic diagnostic method used widely for the detection of viral pathogens, which requires only a single temperature for amplification, and can be completed in less than 1 h. This study developed a novel RT-LAMP assay for detecting MERS-CoV using primer sets targeting a conserved nucleocapsid protein region.</p>
</sec>
<sec><title>Results</title>
<p>The RT-LAMP assay was capable of detecting as few as 3.4 copies of MERS-CoV RNA, and was highly specific, with no cross-reaction to other respiratory viruses. Pilot experiments to detect MERS-CoV from medium containing pharyngeal swabs inoculated with pre-titrated viruses were also performed. The RT-LAMP assay exhibited sensitivity similar to that of MERS-CoV real-time RT-PCR.</p>
</sec>
<sec><title>Conclusions</title>
<p>These results suggest that the RT-LAMP assay described here is a useful tool for the diagnosis and epidemiologic surveillance of human MERS-CoV infections.</p>
</sec>
<sec><title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/1743-422X-11-139) contains supplementary material, which is available to authorized users.</p>
</sec>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Danielsson, N" uniqKey="Danielsson N">N Danielsson</name>
</author>
<author><name sortKey="Catchpole, M" uniqKey="Catchpole M">M Catchpole</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zaki, Am" uniqKey="Zaki A">AM Zaki</name>
</author>
<author><name sortKey="Van Boheemen, S" uniqKey="Van Boheemen S">S van Boheemen</name>
</author>
<author><name sortKey="Bestebroer, Tm" uniqKey="Bestebroer T">TM Bestebroer</name>
</author>
<author><name sortKey="Osterhaus, Ad" uniqKey="Osterhaus A">AD Osterhaus</name>
</author>
<author><name sortKey="Fouchier, Ra" uniqKey="Fouchier R">RA Fouchier</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="De Groot, Rj" uniqKey="De Groot R">RJ de Groot</name>
</author>
<author><name sortKey="Baker, Sc" uniqKey="Baker S">SC Baker</name>
</author>
<author><name sortKey="Baric, Rs" uniqKey="Baric R">RS Baric</name>
</author>
<author><name sortKey="Brown, Cs" uniqKey="Brown C">CS Brown</name>
</author>
<author><name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
<author><name sortKey="Enjuanes, L" uniqKey="Enjuanes L">L Enjuanes</name>
</author>
<author><name sortKey="Fouchier, Ra" uniqKey="Fouchier R">RA Fouchier</name>
</author>
<author><name sortKey="Galiano, M" uniqKey="Galiano M">M Galiano</name>
</author>
<author><name sortKey="Gorbalenya, Ae" uniqKey="Gorbalenya A">AE Gorbalenya</name>
</author>
<author><name sortKey="Memish, Za" uniqKey="Memish Z">ZA Memish</name>
</author>
<author><name sortKey="Perlman, S" uniqKey="Perlman S">S Perlman</name>
</author>
<author><name sortKey="Poon, Ll" uniqKey="Poon L">LL Poon</name>
</author>
<author><name sortKey="Snijder, Ej" uniqKey="Snijder E">EJ Snijder</name>
</author>
<author><name sortKey="Stephens, Gm" uniqKey="Stephens G">GM Stephens</name>
</author>
<author><name sortKey="Woo, Pc" uniqKey="Woo P">PC Woo</name>
</author>
<author><name sortKey="Zaki, Am" uniqKey="Zaki A">AM Zaki</name>
</author>
<author><name sortKey="Zambon, M" uniqKey="Zambon M">M Zambon</name>
</author>
<author><name sortKey="Ziebuhr, J" uniqKey="Ziebuhr J">J Ziebuhr</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Van Boheemen, S" uniqKey="Van Boheemen S">S van Boheemen</name>
</author>
<author><name sortKey="De Graaf, M" uniqKey="De Graaf M">M de Graaf</name>
</author>
<author><name sortKey="Lauber, C" uniqKey="Lauber C">C Lauber</name>
</author>
<author><name sortKey="Bestebroer, Tm" uniqKey="Bestebroer T">TM Bestebroer</name>
</author>
<author><name sortKey="Raj, Vs" uniqKey="Raj V">VS Raj</name>
</author>
<author><name sortKey="Zaki, Am" uniqKey="Zaki A">AM Zaki</name>
</author>
<author><name sortKey="Osterhaus, Ad" uniqKey="Osterhaus A">AD Osterhaus</name>
</author>
<author><name sortKey="Haagmans, Bl" uniqKey="Haagmans B">BL Haagmans</name>
</author>
<author><name sortKey="Gorbalenya, Ae" uniqKey="Gorbalenya A">AE Gorbalenya</name>
</author>
<author><name sortKey="Snijder, Ej" uniqKey="Snijder E">EJ Snijder</name>
</author>
<author><name sortKey="Fouchier, Ra" uniqKey="Fouchier R">RA Fouchier</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Peiris, Js" uniqKey="Peiris J">JS Peiris</name>
</author>
<author><name sortKey="Guan, Y" uniqKey="Guan Y">Y Guan</name>
</author>
<author><name sortKey="Yuen, Ky" uniqKey="Yuen K">KY Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, W" uniqKey="Li W">W Li</name>
</author>
<author><name sortKey="Shi, Z" uniqKey="Shi Z">Z Shi</name>
</author>
<author><name sortKey="Yu, M" uniqKey="Yu M">M Yu</name>
</author>
<author><name sortKey="Ren, W" uniqKey="Ren W">W Ren</name>
</author>
<author><name sortKey="Smith, C" uniqKey="Smith C">C Smith</name>
</author>
<author><name sortKey="Epstein, Jh" uniqKey="Epstein J">JH Epstein</name>
</author>
<author><name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author><name sortKey="Crameri, G" uniqKey="Crameri G">G Crameri</name>
</author>
<author><name sortKey="Hu, Z" uniqKey="Hu Z">Z Hu</name>
</author>
<author><name sortKey="Zhang, H" uniqKey="Zhang H">H Zhang</name>
</author>
<author><name sortKey="Zhang, J" uniqKey="Zhang J">J Zhang</name>
</author>
<author><name sortKey="Mceachern, J" uniqKey="Mceachern J">J McEachern</name>
</author>
<author><name sortKey="Field, H" uniqKey="Field H">H Field</name>
</author>
<author><name sortKey="Daszak, P" uniqKey="Daszak P">P Daszak</name>
</author>
<author><name sortKey="Eaton, Bt" uniqKey="Eaton B">BT Eaton</name>
</author>
<author><name sortKey="Zhang, S" uniqKey="Zhang S">S Zhang</name>
</author>
<author><name sortKey="Wang, Lf" uniqKey="Wang L">LF Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lau, Sk" uniqKey="Lau S">SK Lau</name>
</author>
<author><name sortKey="Li, Ks" uniqKey="Li K">KS Li</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y Huang</name>
</author>
<author><name sortKey="Shek, Ct" uniqKey="Shek C">CT Shek</name>
</author>
<author><name sortKey="Tse, H" uniqKey="Tse H">H Tse</name>
</author>
<author><name sortKey="Wang, M" uniqKey="Wang M">M Wang</name>
</author>
<author><name sortKey="Choi, Gk" uniqKey="Choi G">GK Choi</name>
</author>
<author><name sortKey="Xu, H" uniqKey="Xu H">H Xu</name>
</author>
<author><name sortKey="Lam, Cs" uniqKey="Lam C">CS Lam</name>
</author>
<author><name sortKey="Guo, R" uniqKey="Guo R">R Guo</name>
</author>
<author><name sortKey="Chan, Kh" uniqKey="Chan K">KH Chan</name>
</author>
<author><name sortKey="Zheng, Bj" uniqKey="Zheng B">BJ Zheng</name>
</author>
<author><name sortKey="Woo, Pc" uniqKey="Woo P">PC Woo</name>
</author>
<author><name sortKey="Yuen, Ky" uniqKey="Yuen K">KY Yuen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hemida, Mg" uniqKey="Hemida M">MG Hemida</name>
</author>
<author><name sortKey="Perera, Ra" uniqKey="Perera R">RA Perera</name>
</author>
<author><name sortKey="Wang, P" uniqKey="Wang P">P Wang</name>
</author>
<author><name sortKey="Alhammadi, Ma" uniqKey="Alhammadi M">MA Alhammadi</name>
</author>
<author><name sortKey="Siu, Ly" uniqKey="Siu L">LY Siu</name>
</author>
<author><name sortKey="Li, M" uniqKey="Li M">M Li</name>
</author>
<author><name sortKey="Poon, Ll" uniqKey="Poon L">LL Poon</name>
</author>
<author><name sortKey="Saif, L" uniqKey="Saif L">L Saif</name>
</author>
<author><name sortKey="Alnaeem, A" uniqKey="Alnaeem A">A Alnaeem</name>
</author>
<author><name sortKey="Peiris, M" uniqKey="Peiris M">M Peiris</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kupferschmidt, K" uniqKey="Kupferschmidt K">K Kupferschmidt</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Reusken, C" uniqKey="Reusken C">C Reusken</name>
</author>
<author><name sortKey="Ababneh, M" uniqKey="Ababneh M">M Ababneh</name>
</author>
<author><name sortKey="Raj, V" uniqKey="Raj V">V Raj</name>
</author>
<author><name sortKey="Meyer, B" uniqKey="Meyer B">B Meyer</name>
</author>
<author><name sortKey="Eljarah, A" uniqKey="Eljarah A">A Eljarah</name>
</author>
<author><name sortKey="Abutarbush, S" uniqKey="Abutarbush S">S Abutarbush</name>
</author>
<author><name sortKey="Godeke, G" uniqKey="Godeke G">G Godeke</name>
</author>
<author><name sortKey="Bestebroer, T" uniqKey="Bestebroer T">T Bestebroer</name>
</author>
<author><name sortKey="Zutt, I" uniqKey="Zutt I">I Zutt</name>
</author>
<author><name sortKey="Muller, M" uniqKey="Muller M">M Muller</name>
</author>
<author><name sortKey="Bosch, B" uniqKey="Bosch B">B Bosch</name>
</author>
<author><name sortKey="Rottier, P" uniqKey="Rottier P">P Rottier</name>
</author>
<author><name sortKey="Osterhaus, A" uniqKey="Osterhaus A">A Osterhaus</name>
</author>
<author><name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
<author><name sortKey="Haagmans, B" uniqKey="Haagmans B">B Haagmans</name>
</author>
<author><name sortKey="Koopmans, M" uniqKey="Koopmans M">M Koopmans</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Reusken, Cb" uniqKey="Reusken C">CB Reusken</name>
</author>
<author><name sortKey="Haagmans, Bl" uniqKey="Haagmans B">BL Haagmans</name>
</author>
<author><name sortKey="Muller, Ma" uniqKey="Muller M">MA Muller</name>
</author>
<author><name sortKey="Gutierrez, C" uniqKey="Gutierrez C">C Gutierrez</name>
</author>
<author><name sortKey="Godeke, Gj" uniqKey="Godeke G">GJ Godeke</name>
</author>
<author><name sortKey="Meyer, B" uniqKey="Meyer B">B Meyer</name>
</author>
<author><name sortKey="Muth, D" uniqKey="Muth D">D Muth</name>
</author>
<author><name sortKey="Raj, Vs" uniqKey="Raj V">VS Raj</name>
</author>
<author><name sortKey="Smits De Vries, L" uniqKey="Smits De Vries L">L Smits-De Vries</name>
</author>
<author><name sortKey="Corman, Vm" uniqKey="Corman V">VM Corman</name>
</author>
<author><name sortKey="Drexler, Jf" uniqKey="Drexler J">JF Drexler</name>
</author>
<author><name sortKey="Smits, Sl" uniqKey="Smits S">SL Smits</name>
</author>
<author><name sortKey="El Tahir, Ye" uniqKey="El Tahir Y">YE El Tahir</name>
</author>
<author><name sortKey="De Sousa, R" uniqKey="De Sousa R">R De Sousa</name>
</author>
<author><name sortKey="Van Beek, J" uniqKey="Van Beek J">J van Beek</name>
</author>
<author><name sortKey="Nowotny, N" uniqKey="Nowotny N">N Nowotny</name>
</author>
<author><name sortKey="Van Maanen, K" uniqKey="Van Maanen K">K van Maanen</name>
</author>
<author><name sortKey="Hidalgo Hermoso, E" uniqKey="Hidalgo Hermoso E">E Hidalgo-Hermoso</name>
</author>
<author><name sortKey="Bosch, Bj" uniqKey="Bosch B">BJ Bosch</name>
</author>
<author><name sortKey="Rottier, P" uniqKey="Rottier P">P Rottier</name>
</author>
<author><name sortKey="Osterhaus, A" uniqKey="Osterhaus A">A Osterhaus</name>
</author>
<author><name sortKey="Gortazar Schmidt, C" uniqKey="Gortazar Schmidt C">C Gortazar-Schmidt</name>
</author>
<author><name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
<author><name sortKey="Koopmans, Mp" uniqKey="Koopmans M">MP Koopmans</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Alagaili, An" uniqKey="Alagaili A">AN Alagaili</name>
</author>
<author><name sortKey="Briese, T" uniqKey="Briese T">T Briese</name>
</author>
<author><name sortKey="Mishra, N" uniqKey="Mishra N">N Mishra</name>
</author>
<author><name sortKey="Kapoor, V" uniqKey="Kapoor V">V Kapoor</name>
</author>
<author><name sortKey="Sameroff, Sc" uniqKey="Sameroff S">SC Sameroff</name>
</author>
<author><name sortKey="Burbelo, Pd" uniqKey="Burbelo P">PD Burbelo</name>
</author>
<author><name sortKey="De Wit, E" uniqKey="De Wit E">E de Wit</name>
</author>
<author><name sortKey="Munster, Vj" uniqKey="Munster V">VJ Munster</name>
</author>
<author><name sortKey="Hensley, Le" uniqKey="Hensley L">LE Hensley</name>
</author>
<author><name sortKey="Zalmout, Is" uniqKey="Zalmout I">IS Zalmout</name>
</author>
<author><name sortKey="Kapoor, A" uniqKey="Kapoor A">A Kapoor</name>
</author>
<author><name sortKey="Epstein, Jh" uniqKey="Epstein J">JH Epstein</name>
</author>
<author><name sortKey="Karesh, Wb" uniqKey="Karesh W">WB Karesh</name>
</author>
<author><name sortKey="Daszak, P" uniqKey="Daszak P">P Daszak</name>
</author>
<author><name sortKey="Mohammed, Ob" uniqKey="Mohammed O">OB Mohammed</name>
</author>
<author><name sortKey="Lipkin, Wi" uniqKey="Lipkin W">WI Lipkin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Haagmans, Bl" uniqKey="Haagmans B">BL Haagmans</name>
</author>
<author><name sortKey="Al Dhahiry, Sh" uniqKey="Al Dhahiry S">SH Al Dhahiry</name>
</author>
<author><name sortKey="Reusken, Cb" uniqKey="Reusken C">CB Reusken</name>
</author>
<author><name sortKey="Raj, Vs" uniqKey="Raj V">VS Raj</name>
</author>
<author><name sortKey="Galiano, M" uniqKey="Galiano M">M Galiano</name>
</author>
<author><name sortKey="Myers, R" uniqKey="Myers R">R Myers</name>
</author>
<author><name sortKey="Godeke, Gj" uniqKey="Godeke G">GJ Godeke</name>
</author>
<author><name sortKey="Jonges, M" uniqKey="Jonges M">M Jonges</name>
</author>
<author><name sortKey="Farag, E" uniqKey="Farag E">E Farag</name>
</author>
<author><name sortKey="Diab, A" uniqKey="Diab A">A Diab</name>
</author>
<author><name sortKey="Ghobashy, H" uniqKey="Ghobashy H">H Ghobashy</name>
</author>
<author><name sortKey="Alhajri, F" uniqKey="Alhajri F">F Alhajri</name>
</author>
<author><name sortKey="Al Thani, M" uniqKey="Al Thani M">M Al-Thani</name>
</author>
<author><name sortKey="Al Marri, Sa" uniqKey="Al Marri S">SA Al-Marri</name>
</author>
<author><name sortKey="Al Romaihi, He" uniqKey="Al Romaihi H">HE Al Romaihi</name>
</author>
<author><name sortKey="Al Khal, A" uniqKey="Al Khal A">A Al Khal</name>
</author>
<author><name sortKey="Bermingham, A" uniqKey="Bermingham A">A Bermingham</name>
</author>
<author><name sortKey="Osterhaus, Ad" uniqKey="Osterhaus A">AD Osterhaus</name>
</author>
<author><name sortKey="Alhajri, Mm" uniqKey="Alhajri M">MM AlHajri</name>
</author>
<author><name sortKey="Koopmans, Mp" uniqKey="Koopmans M">MP Koopmans</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Corman, V" uniqKey="Corman V">V Corman</name>
</author>
<author><name sortKey="Eckerle, I" uniqKey="Eckerle I">I Eckerle</name>
</author>
<author><name sortKey="Bleicker, T" uniqKey="Bleicker T">T Bleicker</name>
</author>
<author><name sortKey="Zaki, A" uniqKey="Zaki A">A Zaki</name>
</author>
<author><name sortKey="Landt, O" uniqKey="Landt O">O Landt</name>
</author>
<author><name sortKey="Eschbach Bludau, M" uniqKey="Eschbach Bludau M">M Eschbach-Bludau</name>
</author>
<author><name sortKey="Van Boheemen, S" uniqKey="Van Boheemen S">S van Boheemen</name>
</author>
<author><name sortKey="Gopal, R" uniqKey="Gopal R">R Gopal</name>
</author>
<author><name sortKey="Ballhause, M" uniqKey="Ballhause M">M Ballhause</name>
</author>
<author><name sortKey="Bestebroer, T" uniqKey="Bestebroer T">T Bestebroer</name>
</author>
<author><name sortKey="Muth, D" uniqKey="Muth D">D Muth</name>
</author>
<author><name sortKey="Muller, M" uniqKey="Muller M">M Muller</name>
</author>
<author><name sortKey="Drexler, J" uniqKey="Drexler J">J Drexler</name>
</author>
<author><name sortKey="Zambon, M" uniqKey="Zambon M">M Zambon</name>
</author>
<author><name sortKey="Osterhaus, A" uniqKey="Osterhaus A">A Osterhaus</name>
</author>
<author><name sortKey="Fouchier, R" uniqKey="Fouchier R">R Fouchier</name>
</author>
<author><name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Corman, Vm" uniqKey="Corman V">VM Corman</name>
</author>
<author><name sortKey="Muller, Ma" uniqKey="Muller M">MA Muller</name>
</author>
<author><name sortKey="Costabel, U" uniqKey="Costabel U">U Costabel</name>
</author>
<author><name sortKey="Timm, J" uniqKey="Timm J">J Timm</name>
</author>
<author><name sortKey="Binger, T" uniqKey="Binger T">T Binger</name>
</author>
<author><name sortKey="Meyer, B" uniqKey="Meyer B">B Meyer</name>
</author>
<author><name sortKey="Kreher, P" uniqKey="Kreher P">P Kreher</name>
</author>
<author><name sortKey="Lattwein, E" uniqKey="Lattwein E">E Lattwein</name>
</author>
<author><name sortKey="Eschbach Bludau, M" uniqKey="Eschbach Bludau M">M Eschbach-Bludau</name>
</author>
<author><name sortKey="Nitsche, A" uniqKey="Nitsche A">A Nitsche</name>
</author>
<author><name sortKey="Bleicker, T" uniqKey="Bleicker T">T Bleicker</name>
</author>
<author><name sortKey="Landt, O" uniqKey="Landt O">O Landt</name>
</author>
<author><name sortKey="Schweiger, B" uniqKey="Schweiger B">B Schweiger</name>
</author>
<author><name sortKey="Drexler, Jf" uniqKey="Drexler J">JF Drexler</name>
</author>
<author><name sortKey="Osterhaus, Ad" uniqKey="Osterhaus A">AD Osterhaus</name>
</author>
<author><name sortKey="Haagmans, Bl" uniqKey="Haagmans B">BL Haagmans</name>
</author>
<author><name sortKey="Dittmer, U" uniqKey="Dittmer U">U Dittmer</name>
</author>
<author><name sortKey="Bonin, F" uniqKey="Bonin F">F Bonin</name>
</author>
<author><name sortKey="Wolff, T" uniqKey="Wolff T">T Wolff</name>
</author>
<author><name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chen, W" uniqKey="Chen W">W Chen</name>
</author>
<author><name sortKey="He, B" uniqKey="He B">B He</name>
</author>
<author><name sortKey="Li, C" uniqKey="Li C">C Li</name>
</author>
<author><name sortKey="Zhang, X" uniqKey="Zhang X">X Zhang</name>
</author>
<author><name sortKey="Wu, W" uniqKey="Wu W">W Wu</name>
</author>
<author><name sortKey="Yin, X" uniqKey="Yin X">X Yin</name>
</author>
<author><name sortKey="Fan, B" uniqKey="Fan B">B Fan</name>
</author>
<author><name sortKey="Fan, X" uniqKey="Fan X">X Fan</name>
</author>
<author><name sortKey="Wang, J" uniqKey="Wang J">J Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pang, X" uniqKey="Pang X">X Pang</name>
</author>
<author><name sortKey="Lee, B" uniqKey="Lee B">B Lee</name>
</author>
<author><name sortKey="Chui, L" uniqKey="Chui L">L Chui</name>
</author>
<author><name sortKey="Preiksaitis, Jk" uniqKey="Preiksaitis J">JK Preiksaitis</name>
</author>
<author><name sortKey="Monroe, Ss" uniqKey="Monroe S">SS Monroe</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ke, Gm" uniqKey="Ke G">GM Ke</name>
</author>
<author><name sortKey="Cheng, Hl" uniqKey="Cheng H">HL Cheng</name>
</author>
<author><name sortKey="Ke, Ly" uniqKey="Ke L">LY Ke</name>
</author>
<author><name sortKey="Ji, Wt" uniqKey="Ji W">WT Ji</name>
</author>
<author><name sortKey="Chulu, Jl" uniqKey="Chulu J">JL Chulu</name>
</author>
<author><name sortKey="Liao, Mh" uniqKey="Liao M">MH Liao</name>
</author>
<author><name sortKey="Chang, Tj" uniqKey="Chang T">TJ Chang</name>
</author>
<author><name sortKey="Liu, Hj" uniqKey="Liu H">HJ Liu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yan, L" uniqKey="Yan L">L Yan</name>
</author>
<author><name sortKey="Yan, P" uniqKey="Yan P">P Yan</name>
</author>
<author><name sortKey="Zhou, J" uniqKey="Zhou J">J Zhou</name>
</author>
<author><name sortKey="Teng, Q" uniqKey="Teng Q">Q Teng</name>
</author>
<author><name sortKey="Li, Z" uniqKey="Li Z">Z Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Parida, Mm" uniqKey="Parida M">MM Parida</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Notomi, T" uniqKey="Notomi T">T Notomi</name>
</author>
<author><name sortKey="Okayama, H" uniqKey="Okayama H">H Okayama</name>
</author>
<author><name sortKey="Masubuchi, H" uniqKey="Masubuchi H">H Masubuchi</name>
</author>
<author><name sortKey="Yonekawa, T" uniqKey="Yonekawa T">T Yonekawa</name>
</author>
<author><name sortKey="Watanabe, K" uniqKey="Watanabe K">K Watanabe</name>
</author>
<author><name sortKey="Amino, N" uniqKey="Amino N">N Amino</name>
</author>
<author><name sortKey="Hase, T" uniqKey="Hase T">T Hase</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Nagamine, K" uniqKey="Nagamine K">K Nagamine</name>
</author>
<author><name sortKey="Hase, T" uniqKey="Hase T">T Hase</name>
</author>
<author><name sortKey="Notomi, T" uniqKey="Notomi T">T Notomi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mori, Y" uniqKey="Mori Y">Y Mori</name>
</author>
<author><name sortKey="Nagamine, K" uniqKey="Nagamine K">K Nagamine</name>
</author>
<author><name sortKey="Tomita, N" uniqKey="Tomita N">N Tomita</name>
</author>
<author><name sortKey="Notomi, T" uniqKey="Notomi T">T Notomi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hong, Tc" uniqKey="Hong T">TC Hong</name>
</author>
<author><name sortKey="Mai, Ql" uniqKey="Mai Q">QL Mai</name>
</author>
<author><name sortKey="Cuong, Dv" uniqKey="Cuong D">DV Cuong</name>
</author>
<author><name sortKey="Parida, M" uniqKey="Parida M">M Parida</name>
</author>
<author><name sortKey="Minekawa, H" uniqKey="Minekawa H">H Minekawa</name>
</author>
<author><name sortKey="Notomi, T" uniqKey="Notomi T">T Notomi</name>
</author>
<author><name sortKey="Hasebe, F" uniqKey="Hasebe F">F Hasebe</name>
</author>
<author><name sortKey="Morita, K" uniqKey="Morita K">K Morita</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shirato, K" uniqKey="Shirato K">K Shirato</name>
</author>
<author><name sortKey="Nishimura, H" uniqKey="Nishimura H">H Nishimura</name>
</author>
<author><name sortKey="Saijo, M" uniqKey="Saijo M">M Saijo</name>
</author>
<author><name sortKey="Okamoto, M" uniqKey="Okamoto M">M Okamoto</name>
</author>
<author><name sortKey="Noda, M" uniqKey="Noda M">M Noda</name>
</author>
<author><name sortKey="Tashiro, M" uniqKey="Tashiro M">M Tashiro</name>
</author>
<author><name sortKey="Taguchi, F" uniqKey="Taguchi F">F Taguchi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ushio, M" uniqKey="Ushio M">M Ushio</name>
</author>
<author><name sortKey="Yui, I" uniqKey="Yui I">I Yui</name>
</author>
<author><name sortKey="Yoshida, N" uniqKey="Yoshida N">N Yoshida</name>
</author>
<author><name sortKey="Fujino, M" uniqKey="Fujino M">M Fujino</name>
</author>
<author><name sortKey="Yonekawa, T" uniqKey="Yonekawa T">T Yonekawa</name>
</author>
<author><name sortKey="Ota, Y" uniqKey="Ota Y">Y Ota</name>
</author>
<author><name sortKey="Notomi, T" uniqKey="Notomi T">T Notomi</name>
</author>
<author><name sortKey="Nakayama, T" uniqKey="Nakayama T">T Nakayama</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Imai, M" uniqKey="Imai M">M Imai</name>
</author>
<author><name sortKey="Ninomiya, A" uniqKey="Ninomiya A">A Ninomiya</name>
</author>
<author><name sortKey="Minekawa, H" uniqKey="Minekawa H">H Minekawa</name>
</author>
<author><name sortKey="Notomi, T" uniqKey="Notomi T">T Notomi</name>
</author>
<author><name sortKey="Ishizaki, T" uniqKey="Ishizaki T">T Ishizaki</name>
</author>
<author><name sortKey="Tashiro, M" uniqKey="Tashiro M">M Tashiro</name>
</author>
<author><name sortKey="Odagiri, T" uniqKey="Odagiri T">T Odagiri</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mahony, J" uniqKey="Mahony J">J Mahony</name>
</author>
<author><name sortKey="Chong, S" uniqKey="Chong S">S Chong</name>
</author>
<author><name sortKey="Bulir, D" uniqKey="Bulir D">D Bulir</name>
</author>
<author><name sortKey="Ruyter, A" uniqKey="Ruyter A">A Ruyter</name>
</author>
<author><name sortKey="Mwawasi, K" uniqKey="Mwawasi K">K Mwawasi</name>
</author>
<author><name sortKey="Waltho, D" uniqKey="Waltho D">D Waltho</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shirato, K" uniqKey="Shirato K">K Shirato</name>
</author>
<author><name sortKey="Kawase, M" uniqKey="Kawase M">M Kawase</name>
</author>
<author><name sortKey="Watanabe, O" uniqKey="Watanabe O">O Watanabe</name>
</author>
<author><name sortKey="Hirokawa, C" uniqKey="Hirokawa C">C Hirokawa</name>
</author>
<author><name sortKey="Matsuyama, S" uniqKey="Matsuyama S">S Matsuyama</name>
</author>
<author><name sortKey="Nishimura, H" uniqKey="Nishimura H">H Nishimura</name>
</author>
<author><name sortKey="Taguchi, F" uniqKey="Taguchi F">F Taguchi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shirogane, Y" uniqKey="Shirogane Y">Y Shirogane</name>
</author>
<author><name sortKey="Takeda, M" uniqKey="Takeda M">M Takeda</name>
</author>
<author><name sortKey="Iwasaki, M" uniqKey="Iwasaki M">M Iwasaki</name>
</author>
<author><name sortKey="Ishiguro, N" uniqKey="Ishiguro N">N Ishiguro</name>
</author>
<author><name sortKey="Takeuchi, H" uniqKey="Takeuchi H">H Takeuchi</name>
</author>
<author><name sortKey="Nakatsu, Y" uniqKey="Nakatsu Y">Y Nakatsu</name>
</author>
<author><name sortKey="Tahara, M" uniqKey="Tahara M">M Tahara</name>
</author>
<author><name sortKey="Kikuta, H" uniqKey="Kikuta H">H Kikuta</name>
</author>
<author><name sortKey="Yanagi, Y" uniqKey="Yanagi Y">Y Yanagi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gierer, S" uniqKey="Gierer S">S Gierer</name>
</author>
<author><name sortKey="Bertram, S" uniqKey="Bertram S">S Bertram</name>
</author>
<author><name sortKey="Kaup, F" uniqKey="Kaup F">F Kaup</name>
</author>
<author><name sortKey="Wrensch, F" uniqKey="Wrensch F">F Wrensch</name>
</author>
<author><name sortKey="Heurich, A" uniqKey="Heurich A">A Heurich</name>
</author>
<author><name sortKey="Kramer Kuhl, A" uniqKey="Kramer Kuhl A">A Kramer-Kuhl</name>
</author>
<author><name sortKey="Welsch, K" uniqKey="Welsch K">K Welsch</name>
</author>
<author><name sortKey="Winkler, M" uniqKey="Winkler M">M Winkler</name>
</author>
<author><name sortKey="Meyer, B" uniqKey="Meyer B">B Meyer</name>
</author>
<author><name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
<author><name sortKey="Dittmer, U" uniqKey="Dittmer U">U Dittmer</name>
</author>
<author><name sortKey="Von Hahn, T" uniqKey="Von Hahn T">T von Hahn</name>
</author>
<author><name sortKey="Simmons, G" uniqKey="Simmons G">G Simmons</name>
</author>
<author><name sortKey="Hofmann, H" uniqKey="Hofmann H">H Hofmann</name>
</author>
<author><name sortKey="Pohlmann, S" uniqKey="Pohlmann S">S Pohlmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shirato, K" uniqKey="Shirato K">K Shirato</name>
</author>
<author><name sortKey="Kawase, M" uniqKey="Kawase M">M Kawase</name>
</author>
<author><name sortKey="Matsuyama, S" uniqKey="Matsuyama S">S Matsuyama</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ueda, S" uniqKey="Ueda S">S Ueda</name>
</author>
<author><name sortKey="Kuwabara, Y" uniqKey="Kuwabara Y">Y Kuwabara</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Geojith, G" uniqKey="Geojith G">G Geojith</name>
</author>
<author><name sortKey="Dhanasekaran, S" uniqKey="Dhanasekaran S">S Dhanasekaran</name>
</author>
<author><name sortKey="Chandran, Sp" uniqKey="Chandran S">SP Chandran</name>
</author>
<author><name sortKey="Kenneth, J" uniqKey="Kenneth J">J Kenneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gotoh, K" uniqKey="Gotoh K">K Gotoh</name>
</author>
<author><name sortKey="Nishimura, N" uniqKey="Nishimura N">N Nishimura</name>
</author>
<author><name sortKey="Ohshima, Y" uniqKey="Ohshima Y">Y Ohshima</name>
</author>
<author><name sortKey="Arakawa, Y" uniqKey="Arakawa Y">Y Arakawa</name>
</author>
<author><name sortKey="Hosono, H" uniqKey="Hosono H">H Hosono</name>
</author>
<author><name sortKey="Yamamoto, Y" uniqKey="Yamamoto Y">Y Yamamoto</name>
</author>
<author><name sortKey="Iwata, Y" uniqKey="Iwata Y">Y Iwata</name>
</author>
<author><name sortKey="Nakane, K" uniqKey="Nakane K">K Nakane</name>
</author>
<author><name sortKey="Funahashi, K" uniqKey="Funahashi K">K Funahashi</name>
</author>
<author><name sortKey="Ozaki, T" uniqKey="Ozaki T">T Ozaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Plutzer, J" uniqKey="Plutzer J">J Plutzer</name>
</author>
<author><name sortKey="Karanis, P" uniqKey="Karanis P">P Karanis</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="He, L" uniqKey="He L">L He</name>
</author>
<author><name sortKey="Zhou, Yq" uniqKey="Zhou Y">YQ Zhou</name>
</author>
<author><name sortKey="Oosthuizen, Mc" uniqKey="Oosthuizen M">MC Oosthuizen</name>
</author>
<author><name sortKey="Zhao, Jl" uniqKey="Zhao J">JL Zhao</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, Lx" uniqKey="Wang L">LX Wang</name>
</author>
<author><name sortKey="He, L" uniqKey="He L">L He</name>
</author>
<author><name sortKey="Fang, R" uniqKey="Fang R">R Fang</name>
</author>
<author><name sortKey="Song, Qq" uniqKey="Song Q">QQ Song</name>
</author>
<author><name sortKey="Tu, P" uniqKey="Tu P">P Tu</name>
</author>
<author><name sortKey="Jenkins, A" uniqKey="Jenkins A">A Jenkins</name>
</author>
<author><name sortKey="Zhou, Yq" uniqKey="Zhou Y">YQ Zhou</name>
</author>
<author><name sortKey="Zhao, Jl" uniqKey="Zhao J">JL Zhao</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Nakao, R" uniqKey="Nakao R">R Nakao</name>
</author>
<author><name sortKey="Stromdahl, Ey" uniqKey="Stromdahl E">EY Stromdahl</name>
</author>
<author><name sortKey="Magona, Jw" uniqKey="Magona J">JW Magona</name>
</author>
<author><name sortKey="Faburay, B" uniqKey="Faburay B">B Faburay</name>
</author>
<author><name sortKey="Namangala, B" uniqKey="Namangala B">B Namangala</name>
</author>
<author><name sortKey="Malele, I" uniqKey="Malele I">I Malele</name>
</author>
<author><name sortKey="Inoue, N" uniqKey="Inoue N">N Inoue</name>
</author>
<author><name sortKey="Geysen, D" uniqKey="Geysen D">D Geysen</name>
</author>
<author><name sortKey="Kajino, K" uniqKey="Kajino K">K Kajino</name>
</author>
<author><name sortKey="Jongejan, F" uniqKey="Jongejan F">F Jongejan</name>
</author>
<author><name sortKey="Sugimoto, C" uniqKey="Sugimoto C">C Sugimoto</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Arimatsu, Y" uniqKey="Arimatsu Y">Y Arimatsu</name>
</author>
<author><name sortKey="Kaewkes, S" uniqKey="Kaewkes S">S Kaewkes</name>
</author>
<author><name sortKey="Laha, T" uniqKey="Laha T">T Laha</name>
</author>
<author><name sortKey="Hong, Sj" uniqKey="Hong S">SJ Hong</name>
</author>
<author><name sortKey="Sripa, B" uniqKey="Sripa B">B Sripa</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Cotten, M" uniqKey="Cotten M">M Cotten</name>
</author>
<author><name sortKey="Watson, Sj" uniqKey="Watson S">SJ Watson</name>
</author>
<author><name sortKey="Zumla, Ai" uniqKey="Zumla A">AI Zumla</name>
</author>
<author><name sortKey="Makhdoom, Hq" uniqKey="Makhdoom H">HQ Makhdoom</name>
</author>
<author><name sortKey="Palser, Al" uniqKey="Palser A">AL Palser</name>
</author>
<author><name sortKey="Ong, Sh" uniqKey="Ong S">SH Ong</name>
</author>
<author><name sortKey="Al Rabeeah, Aa" uniqKey="Al Rabeeah A">AA Al Rabeeah</name>
</author>
<author><name sortKey="Alhakeem, Rf" uniqKey="Alhakeem R">RF Alhakeem</name>
</author>
<author><name sortKey="Assiri, A" uniqKey="Assiri A">A Assiri</name>
</author>
<author><name sortKey="Al Tawfiq, Ja" uniqKey="Al Tawfiq J">JA Al-Tawfiq</name>
</author>
<author><name sortKey="Albarrak, A" uniqKey="Albarrak A">A Albarrak</name>
</author>
<author><name sortKey="Barry, M" uniqKey="Barry M">M Barry</name>
</author>
<author><name sortKey="Shibl, A" uniqKey="Shibl A">A Shibl</name>
</author>
<author><name sortKey="Alrabiah, Fa" uniqKey="Alrabiah F">FA Alrabiah</name>
</author>
<author><name sortKey="Hajjar, S" uniqKey="Hajjar S">S Hajjar</name>
</author>
<author><name sortKey="Balkhy, Hh" uniqKey="Balkhy H">HH Balkhy</name>
</author>
<author><name sortKey="Flemban, H" uniqKey="Flemban H">H Flemban</name>
</author>
<author><name sortKey="Rambaut, A" uniqKey="Rambaut A">A Rambaut</name>
</author>
<author><name sortKey="Kellam, P" uniqKey="Kellam P">P Kellam</name>
</author>
<author><name sortKey="Memish, Za" uniqKey="Memish Z">ZA Memish</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Azhar, Ei" uniqKey="Azhar E">EI Azhar</name>
</author>
<author><name sortKey="El Kafrawy, Sa" uniqKey="El Kafrawy S">SA El-Kafrawy</name>
</author>
<author><name sortKey="Farraj, Sa" uniqKey="Farraj S">SA Farraj</name>
</author>
<author><name sortKey="Hassan, Am" uniqKey="Hassan A">AM Hassan</name>
</author>
<author><name sortKey="Al Saeed, Ms" uniqKey="Al Saeed M">MS Al-Saeed</name>
</author>
<author><name sortKey="Hashem, Am" uniqKey="Hashem A">AM Hashem</name>
</author>
<author><name sortKey="Madani, Ta" uniqKey="Madani T">TA Madani</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Memish, Za" uniqKey="Memish Z">ZA Memish</name>
</author>
<author><name sortKey="Cotten, M" uniqKey="Cotten M">M Cotten</name>
</author>
<author><name sortKey="Meyer, B" uniqKey="Meyer B">B Meyer</name>
</author>
<author><name sortKey="Watson, Sj" uniqKey="Watson S">SJ Watson</name>
</author>
<author><name sortKey="Alsahafi, Aj" uniqKey="Alsahafi A">AJ Alsahafi</name>
</author>
<author><name sortKey="Al Rabeeah, Aa" uniqKey="Al Rabeeah A">AA Al Rabeeah</name>
</author>
<author><name sortKey="Corman, Vm" uniqKey="Corman V">VM Corman</name>
</author>
<author><name sortKey="Sieberg, A" uniqKey="Sieberg A">A Sieberg</name>
</author>
<author><name sortKey="Makhdoom, Hq" uniqKey="Makhdoom H">HQ Makhdoom</name>
</author>
<author><name sortKey="Assiri, A" uniqKey="Assiri A">A Assiri</name>
</author>
<author><name sortKey="Al Masri, M" uniqKey="Al Masri M">M Al Masri</name>
</author>
<author><name sortKey="Aldabbagh, S" uniqKey="Aldabbagh S">S Aldabbagh</name>
</author>
<author><name sortKey="Bosch, Bj" uniqKey="Bosch B">BJ Bosch</name>
</author>
<author><name sortKey="Beer, M" uniqKey="Beer M">M Beer</name>
</author>
<author><name sortKey="Muller, Ma" uniqKey="Muller M">MA Muller</name>
</author>
<author><name sortKey="Kellam, P" uniqKey="Kellam P">P Kellam</name>
</author>
<author><name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
<author><name sortKey="Seilmaier, M" uniqKey="Seilmaier M">M Seilmaier</name>
</author>
<author><name sortKey="Corman, Vm" uniqKey="Corman V">VM Corman</name>
</author>
<author><name sortKey="Hartmann, W" uniqKey="Hartmann W">W Hartmann</name>
</author>
<author><name sortKey="Scheible, G" uniqKey="Scheible G">G Scheible</name>
</author>
<author><name sortKey="Sack, S" uniqKey="Sack S">S Sack</name>
</author>
<author><name sortKey="Guggemos, W" uniqKey="Guggemos W">W Guggemos</name>
</author>
<author><name sortKey="Kallies, R" uniqKey="Kallies R">R Kallies</name>
</author>
<author><name sortKey="Muth, D" uniqKey="Muth D">D Muth</name>
</author>
<author><name sortKey="Junglen, S" uniqKey="Junglen S">S Junglen</name>
</author>
<author><name sortKey="Muller, Ma" uniqKey="Muller M">MA Muller</name>
</author>
<author><name sortKey="Haas, W" uniqKey="Haas W">W Haas</name>
</author>
<author><name sortKey="Guberina, H" uniqKey="Guberina H">H Guberina</name>
</author>
<author><name sortKey="Rohnisch, T" uniqKey="Rohnisch T">T Rohnisch</name>
</author>
<author><name sortKey="Schmid Wendtner, M" uniqKey="Schmid Wendtner M">M Schmid-Wendtner</name>
</author>
<author><name sortKey="Aldabbagh, S" uniqKey="Aldabbagh S">S Aldabbagh</name>
</author>
<author><name sortKey="Dittmer, U" uniqKey="Dittmer U">U Dittmer</name>
</author>
<author><name sortKey="Gold, H" uniqKey="Gold H">H Gold</name>
</author>
<author><name sortKey="Graf, P" uniqKey="Graf P">P Graf</name>
</author>
<author><name sortKey="Bonin, F" uniqKey="Bonin F">F Bonin</name>
</author>
<author><name sortKey="Rambaut, A" uniqKey="Rambaut A">A Rambaut</name>
</author>
<author><name sortKey="Wendtner, Cm" uniqKey="Wendtner C">CM Wendtner</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Baric, Rs" uniqKey="Baric R">RS Baric</name>
</author>
<author><name sortKey="Stohlman, Sa" uniqKey="Stohlman S">SA Stohlman</name>
</author>
<author><name sortKey="Lai, Mm" uniqKey="Lai M">MM Lai</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lai, Mm" uniqKey="Lai M">MM Lai</name>
</author>
<author><name sortKey="Patton, Cd" uniqKey="Patton C">CD Patton</name>
</author>
<author><name sortKey="Baric, Rs" uniqKey="Baric R">RS Baric</name>
</author>
<author><name sortKey="Stohlman, Sa" uniqKey="Stohlman S">SA Stohlman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Spaan, Wj" uniqKey="Spaan W">WJ Spaan</name>
</author>
<author><name sortKey="Rottier, Pj" uniqKey="Rottier P">PJ Rottier</name>
</author>
<author><name sortKey="Horzinek, Mc" uniqKey="Horzinek M">MC Horzinek</name>
</author>
<author><name sortKey="Van Der Zeijst, Ba" uniqKey="Van Der Zeijst B">BA van der Zeijst</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">Virol J</journal-id>
<journal-id journal-id-type="iso-abbrev">Virol. J</journal-id>
<journal-title-group><journal-title>Virology Journal</journal-title>
</journal-title-group>
<issn pub-type="epub">1743-422X</issn>
<publisher><publisher-name>BioMed Central</publisher-name>
<publisher-loc>London</publisher-loc>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">25103205</article-id>
<article-id pub-id-type="pmc">4132226</article-id>
<article-id pub-id-type="publisher-id">2467</article-id>
<article-id pub-id-type="doi">10.1186/1743-422X-11-139</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Research</subject>
</subj-group>
</article-categories>
<title-group><article-title>Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP)</article-title>
</title-group>
<contrib-group><contrib contrib-type="author" corresp="yes"><name><surname>Shirato</surname>
<given-names>Kazuya</given-names>
</name>
<address><email>shirato@nih.go.jp</email>
</address>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Yano</surname>
<given-names>Takuya</given-names>
</name>
<address><email>yanot01@pref.mie.jp</email>
</address>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Senba</surname>
<given-names>Syouhei</given-names>
</name>
<address><email>Syouhei_Senba@eiken.co.jp</email>
</address>
<xref ref-type="aff" rid="Aff3">3</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Akachi</surname>
<given-names>Shigehiro</given-names>
</name>
<address><email>akachs00@pref.mie.jp</email>
</address>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Kobayashi</surname>
<given-names>Takashi</given-names>
</name>
<address><email>kobayt05@pref.mie.jp</email>
</address>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Nishinaka</surname>
<given-names>Takamichi</given-names>
</name>
<address><email>nishit10@pref.mie.jp</email>
</address>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Notomi</surname>
<given-names>Tsugunori</given-names>
</name>
<address><email>Tsugunori_Notomi@eiken.co.jp</email>
</address>
<xref ref-type="aff" rid="Aff3">3</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Matsuyama</surname>
<given-names>Shutoku</given-names>
</name>
<address><email>matuyama@nih.go.jp</email>
</address>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<aff id="Aff1"><label>1</label>
<institution-wrap><institution-id institution-id-type="GRID">grid.410795.e</institution-id>
<institution-id institution-id-type="ISNI">0000000122201880</institution-id>
<institution>Laboratory of Acute Respiratory Viral Diseases and Cytokines,Department of Virology III, , 4-7-1 Gakuen,</institution>
<institution>National Institute of Infectious Disease, Laboratory of Acute Respiratory Viral Diseases and Cytokines,</institution>
</institution-wrap>
Musashimurayama,Tokyo, 208-0011 Japan</aff>
<aff id="Aff2"><label>2</label>
Mie Prefecture Health and Environment Research Institute, Yokkaichi, 3684-11 Sakura-cho, Mie 512-1211 Japan</aff>
<aff id="Aff3"><label>3</label>
Eiken Chemical Co. Ltd, 4-19-9 Taito, Tokyo, 110-8408 Japan</aff>
</contrib-group>
<pub-date pub-type="epub"><day>8</day>
<month>8</month>
<year>2014</year>
</pub-date>
<pub-date pub-type="pmc-release"><day>8</day>
<month>8</month>
<year>2014</year>
</pub-date>
<pub-date pub-type="collection"><year>2014</year>
</pub-date>
<volume>11</volume>
<elocation-id>139</elocation-id>
<history><date date-type="received"><day>25</day>
<month>4</month>
<year>2014</year>
</date>
<date date-type="accepted"><day>4</day>
<month>8</month>
<year>2014</year>
</date>
</history>
<permissions><copyright-statement>© Shirato et al.; licensee BioMed Central Ltd. 2014</copyright-statement>
<license license-type="OpenAccess"><license-p>This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0">http://creativecommons.org/licenses/by/4.0</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<abstract id="Abs1"><sec><title>Background</title>
<p>The first documented case of Middle East Respiratory Syndrome coronavirus (MERS-CoV) occurred in 2012, and outbreaks have continued ever since, mainly in Saudi Arabia. MERS-CoV is primarily diagnosed using a real-time RT-PCR assay, with at least two different genomic targets required for a positive diagnosis according to the case definition of The World Health Organization (WHO) as of 3 July 2013. Therefore, it is urgently necessary to develop as many specific genetic diagnostic methods as possible to allow stable diagnosis of MERS-CoV infections.</p>
</sec>
<sec><title>Methods</title>
<p>Reverse transcription-loop-mediated isothermal amplification (RT-LAMP) is a genetic diagnostic method used widely for the detection of viral pathogens, which requires only a single temperature for amplification, and can be completed in less than 1 h. This study developed a novel RT-LAMP assay for detecting MERS-CoV using primer sets targeting a conserved nucleocapsid protein region.</p>
</sec>
<sec><title>Results</title>
<p>The RT-LAMP assay was capable of detecting as few as 3.4 copies of MERS-CoV RNA, and was highly specific, with no cross-reaction to other respiratory viruses. Pilot experiments to detect MERS-CoV from medium containing pharyngeal swabs inoculated with pre-titrated viruses were also performed. The RT-LAMP assay exhibited sensitivity similar to that of MERS-CoV real-time RT-PCR.</p>
</sec>
<sec><title>Conclusions</title>
<p>These results suggest that the RT-LAMP assay described here is a useful tool for the diagnosis and epidemiologic surveillance of human MERS-CoV infections.</p>
</sec>
<sec><title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/1743-422X-11-139) contains supplementary material, which is available to authorized users.</p>
</sec>
</abstract>
<kwd-group xml:lang="en"><title>Keywords</title>
<kwd>Meddle East respiratory syndrome (MERS)</kwd>
<kwd>MERS coronavirus (MERS-CoV)</kwd>
<kwd>RT-LAMP</kwd>
<kwd>Genetic diagnostic method</kwd>
</kwd-group>
<custom-meta-group><custom-meta><meta-name>issue-copyright-statement</meta-name>
<meta-value>© The Author(s) 2014</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body><sec id="Sec1"><title>Background</title>
<p>On 22 September 2012, a novel coronavirus sequence was detected from a 49-year-old patient presenting with severe pneumonia who was initially treated in an intensive care unit in Qatar and then moved to London [<xref ref-type="bibr" rid="CR1">1</xref>
]. The sequence of the PCR amplicon of this isolate was a close match with that of a coronavirus isolated from a 60-year-old patient who had died of severe pneumonia in Jeddah, Saudi Arabia in June 2012 [<xref ref-type="bibr" rid="CR1">1</xref>
, <xref ref-type="bibr" rid="CR2">2</xref>
]. Together, these two cases marked the beginning of an outbreak of severe respiratory infections caused by a newly identified coronavirus, designated the Middle East Respiratory Syndrome coronavirus (MERS-CoV) [<xref ref-type="bibr" rid="CR3">3</xref>
]. This outbreak is ongoing, with 836 confirmed cases to date that have resulted in 288 deaths in 19 countries (Jordan, Qatar, Saudi Arabia, the United Arab Emirates, Oman, Kuwait, Yemen, Lebanon, Iran, Algeria, Tunisia, France, the Netherlands, Germany, the United Kingdom, Greece, Malaysia, Philippines and the United States of America) as of 14 July, 2014 [The World Health Organization (WHO), Global Alert and Response (GAR), Coronavirus infections, updated on 14 July 2014, <ext-link ext-link-type="uri" xlink:href="http://www.who.int/csr/disease/coronavirus_infections/en/index.html">http://www.who.int/csr/disease/coronavirus_infections/en/index.html</ext-link>
].</p>
<p>Sequence analyses show that MERS-CoV clusters with the group 2c betacoronavirus, and is closely related to the bat coronaviruses HKU4 and HKU5 [<xref ref-type="bibr" rid="CR4">4</xref>
]. Severe acute respiratory syndrome coronavirus (SARS-CoV), which caused severe pneumonia resulting in 8,098 reported infections and 774 deaths between 2002 and 2003 [<xref ref-type="bibr" rid="CR5">5</xref>
], was also derived from bat coronaviruses [<xref ref-type="bibr" rid="CR6">6</xref>
, <xref ref-type="bibr" rid="CR7">7</xref>
]. MERS-CoV, with its similar symptoms and phylogeny, is therefore considered a cousin of SARS-CoV. The reservoir for MERS-CoV remains unclear, but recent reports suggest that camels are the most likely candidate, as a form of the virus has been circulating in camels in Saudi Arabia since at least 1992 [<xref ref-type="bibr" rid="CR8">8</xref>
–<xref ref-type="bibr" rid="CR13">13</xref>
].</p>
<p>MERS-CoV is primarily diagnosed using a real-time RT-PCR assay, and at least two different genomic targets are required for a positive diagnosis. The first probe and primer sets for MERS-CoV detection by real-time PT-PCR were developed by Corman <italic>et al</italic>
. shortly following the first reports of the disease [<xref ref-type="bibr" rid="CR14">14</xref>
, <xref ref-type="bibr" rid="CR15">15</xref>
]. Among them, the probe and primer sets targeting upE and ORF1a exhibit the highest sensitivities, and remain the most widely used targets for MERS-CoV detection. At least two different specific genomic targets are required for a positive diagnosis according to the case definition announced by the WHO as of 3 July 2013 [WHO, GAR, Revised interim case definition for reporting to WHO – Middle East respiratory syndrome coronavirus (MERS-CoV), updated on 3 July 2013, <ext-link ext-link-type="uri" xlink:href="http://www.who.int/csr/disease/coronavirus_infections/case_definition/en/index.html">http://www.who.int/csr/disease/coronavirus_infections/case_definition/en/index.html</ext-link>
]. A single positive target followed by gene sequencing is also considered positive; however, the current gene sequencing technique requires PCR amplicons, and the ability of conventional RT-PCR to produce a sequencing-quality template is generally lower than that of real-time RT-PCR [<xref ref-type="bibr" rid="CR16">16</xref>
–<xref ref-type="bibr" rid="CR20">20</xref>
]. Therefore, it is urgently necessary to develop as many specific genetic diagnostic methods as possible to allow reliable diagnosis of MERS-CoV infections.</p>
<p>The loop-mediated isothermal amplification (LAMP) method amplifies specific nucleic acid sequences using a set of four or six unique primers [<xref ref-type="bibr" rid="CR21">21</xref>
, <xref ref-type="bibr" rid="CR22">22</xref>
]. The LAMP procedure is user-friendly, since the reaction mixture is incubated at a single temperature for less than 1 h. Amplification can be detected as the precipitation of magnesium pyrophosphate or by fluorescence under ultra-violet light, and also can be detected in real time by monitoring the turbidity of the pyrophosphate [<xref ref-type="bibr" rid="CR23">23</xref>
]. The LAMP assay can also be used for the detection of RNA by combining reverse transcription with LAMP (RT-LAMP) [<xref ref-type="bibr" rid="CR21">21</xref>
]; RT-LAMP assays have been developed for a variety of respiratory RNA viruses, including SARS [<xref ref-type="bibr" rid="CR24">24</xref>
], respiratory syncytial virus [<xref ref-type="bibr" rid="CR25">25</xref>
, <xref ref-type="bibr" rid="CR26">26</xref>
], and influenza viruses [<xref ref-type="bibr" rid="CR27">27</xref>
, <xref ref-type="bibr" rid="CR28">28</xref>
]. In this study, a novel RT-LAMP method for the detection of MERS-CoV was developed, with a sensitivity similar to that of real-time RT-PCR targeting upE and ORF1a.</p>
</sec>
<sec id="Sec2"><title>Materials and methods</title>
<sec id="Sec3"><title>Viruses</title>
<p>The MERS-CoV EMC isolate was kindly provided by Ron A. M. Fouchier, Erasmus Medical Center, Rotterdam, The Netherlands. MERS-CoV was propagated and titrated using Vero cells. Human respiratory syncytial viruses (RSV; Long, A2, B WV/14617/85 and 18537) were obtained from the American Tissue Culture Collection (ATCC). Human metapneumovirus (HMPV; Sendai-H/2404/2003) was obtained from the Virus Research Center, Sendai Medical Center, Japan. Human coronavirus (HCoV)-229E isolates ATCC VR-740 and Sendai-H/1121/04 [<xref ref-type="bibr" rid="CR29">29</xref>
] were used. HCoV-NL63 was supplied by Dr. Hoek, University of Amsterdam, Netherlands. Isolate HCoV-OC43 was obtained from ATCC. SARS coronavirus (Frankfurt strain) was supplied by Dr. J. Ziebuhr, University of Würzburg, Germany. Human parainfluenza viruses (PIV) 1 (strain C35) and 3 (strain C243) were obtained from ATCC. Adenoviruses (ADV) (serotype 3, strain G.B.; serotype 4, strain RI-67; and serotype 7, strain Gomen) were obtained from ATCC. Viruses were propagated and titrated using HEp-2, HeLa, RD, Vero cells, or LLC-Mk2 cells [<xref ref-type="bibr" rid="CR30">30</xref>
]. Influenza viruses [Flu; A/California/7/2009 (H1N1pdm), A/Victoria/210/2009 (H3N2), and B/Brisbane/60/2008] were provided by the Influenza Virus Research Center of the National Institute of Infectious Diseases in Japan, and were propagated and titrated using MDCK cells.</p>
</sec>
<sec id="Sec4"><title>Design of primer sets for RT-LAMP</title>
<p>Primer sets for the RT-LAMP assay were designed using the online LAMP primer design software (PrimerExplorer V4; <ext-link ext-link-type="uri" xlink:href="http://primerexplorer.jp/e/">http://primerexplorer.jp/e/</ext-link>
) based on the nucleocapsid protein sequence of the EMC isolate of MERS-CoV (GenBank JX869059.2).</p>
</sec>
<sec id="Sec5"><title>Extraction of nucleic acids</title>
<p>RNA was extracted from viral stocks using TRIzol LS or TRIzol reagent (Invitrogen), according to the manufacturer’s instructions. Viral DNA was extracted using Qiagen Genomic-tip (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Total RNA and genomic DNA were quantitated using standard methods to measure the OD value. The MERS-CoV RNA copy number was calculated based upon the standard curve obtained using a TaqMan assay, as described by Corman <italic>et al</italic>
. [<xref ref-type="bibr" rid="CR14">14</xref>
] (upE probe set and the positive control template). Total RNA was then diluted with ribonuclease-free water containing 10 μg/mL of Ribonucleic Acid from Baker’s Yeast (R6750; Sigma-Aldrich, St. Louis, MO, USA) as carrier RNA.</p>
</sec>
<sec id="Sec6"><title>RT-LAMP assay</title>
<p>The RT-LAMP assay was performed using the Loopamp RNA Amplification Kit (RT-LAMP; Eiken, Tokyo, Japan) under the following conditions: 5-μL sample (RNA or DNA) was mixed with 40 pmol each of FIP and BIP primers, 20 pmol each of LF and LB primers, 5 pmol each of F3 and B3 primers, 1-μL Enzyme Mix, and 12.5-μL Reaction Mix; distilled water was added to obtain a final volume of 25 μL. For real-time monitoring of RT-LAMP amplification, the reaction mixture was incubated at 65°C for 30 min in a Loopamp real-time turbidimeter (LA-320C, Eiken). For fluorescence detection, 1-μL Fluorescent Detection Reagent (Eiken) was added to the reaction mixture described above before the start of amplification, and then, fluorescence was detected under ultraviolet light after 30 min of amplification. Negative controls containing only yeast RNA were included in each assay.</p>
<p>To synthesize control RNA for RT-LAMP, the nucleocapsid protein sequence of the EMC strain (28566–29807) was amplified and cloned into the pGEM-T easy vector (Promega, Fitchburg, WI, USA). Point mutations were inserted using a site-direct mutagenesis technique to generate variations of the nucleoprotein sequence. The nucleocapsid protein sequence was amplified by PCR using forward (5′-TAATACGACTCACTATAGGGATGGCATCCCCTGCTGCACC-3′) and reverse (5′-CTAATCAGTGTTAACATCAA-3′) primers with PrimeSTAR Max DNA polymerase (Takara-Bio, Shiga, Japan). The amplicons were gel-purified and were used as templates for RNA transcription using a MEGAscript T7 Transcription Kit (Life Technologies, Carlsbad, CA, USA). The transcribed RNA was quantified using the OD value, the copies number was calculated, and the RNA was diluted with ribonuclease-free water containing 10 μg/mL of yeast RNA.</p>
</sec>
<sec id="Sec7"><title>Real-time RT-PCR assays</title>
<p>Real-time RT-PCR assays using upE and ORF1a sets [<xref ref-type="bibr" rid="CR14">14</xref>
, <xref ref-type="bibr" rid="CR15">15</xref>
] were also performed for virus detection using a QuantiTect Probe RT-PCR kit (QIAGEN) and LightCycler 480 Instrument (Roche, Basel, Switzerland) following the manufacturers’ protocols. The amplification conditions followed Corman <italic>et al</italic>
. [<xref ref-type="bibr" rid="CR14">14</xref>
, <xref ref-type="bibr" rid="CR15">15</xref>
].</p>
</sec>
<sec id="Sec8"><title>Virus preparation for spiked samples</title>
<p>For sensitivity assays, Vero cells were infected with MERS-CoV, and incubated for 4 days. Cell supernatants were then collected and centrifuged at 1,500 × g for 30 min at 4°C, and the supernatants were treated with RNaseA (Nippongene, Tokyo Japan) at a concentration of 10 μg/mL for 30 min at 37°C to exclude miscellaneous RNA other than viral RNA.</p>
</sec>
<sec id="Sec9"><title>Pilot experiment</title>
<p>MERS-CoV RNA was obtained from pre-titrated viral stocks diluted with medium containing pharyngeal swabs obtained from healthy adults using the Universal Viral Transport for Viruses, Chlamydiae, Mycoplasmas and Ureaplasmas (Becton Dickinson and Company, Sparks, MD, USA). Viral isolation was also performed on Vero and Vero/TMPRSS2 cells constitutively expressing type II transmembrane serine protease (TMPRSS2) [<xref ref-type="bibr" rid="CR30">30</xref>
], which enhances cell entry and fusion formation of MERS-CoV [<xref ref-type="bibr" rid="CR31">31</xref>
, <xref ref-type="bibr" rid="CR32">32</xref>
]. Diluted viruses were inoculated on Vero and Vero/TMPRSS2 cells, and incubated for 60 min. Cells were then washed with PBS, and incubated in Dulbecco’s modified Eagle’s medium supplemented with 5% fetal calf serum at 37°C. The cytopathic effect was evaluated 5 days after inoculation. Clinical specimens (nasopharyngeal swabs) diagnosed as other respiratory pathogens by RT-PCR assays were used as negative controls. Informed, written consent was obtained at the time of sample collection from all patients. For the specimen diagnosed as human bocavirus, a LAMP assay was performed without the RT reaction.</p>
</sec>
</sec>
<sec id="Sec10"><title>Results</title>
<sec id="Sec11"><title>RT-LAMP primer design</title>
<p>The primer sets used in this study are listed in Table <xref rid="Tab1" ref-type="table">1</xref>
. RT-LAMP requires at least six specific sequences (F1, F2, F3, B3, B2, and B1), targeted by a minimum of four distinct primer sets. Two loop primers (LF and LB) are used to enhance amplification [<xref ref-type="bibr" rid="CR22">22</xref>
]; these primers target the regions between F1 & F2, and B1 & B2 regions, respectively. Generally, the reaction of RT-LAMP is performed for 1 h. However, the primers described here tend to generate products of self-construction because these were constructed to enhance the sensitivity of amplification. Therefore, the reaction was performed within 30 min to exclude non-specific reactions. It was confirmed that non-specific amplification did not take place within 30 min using negative control samples (data not shown).<table-wrap id="Tab1"><label>Table 1</label>
<caption><p><bold>The primer set for MERS-CoV RT-LAMP assay</bold>
</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Primers</th>
<th>Position (EMC, JX869059.2)</th>
<th>Sequence (5′ – 3′)</th>
<th align="center">Number of matched MERS sequences*</th>
</tr>
</thead>
<tbody><tr><td>F3</td>
<td>28848–28866</td>
<td>GCTCCCAGGTGGTACTTCT</td>
<td align="char">86/88</td>
</tr>
<tr><td>B3</td>
<td>29061–29042</td>
<td>cagtcccctcaatgtggaag</td>
<td align="char">88/88</td>
</tr>
<tr><td rowspan="2">FIP (F1c + F2)</td>
<td>28939–28918</td>
<td rowspan="2">tcatggacccaaacgatgccatACTGGAACTGGACCCGAAG</td>
<td align="char">77/88</td>
</tr>
<tr><td>+ 28872–28890</td>
<td align="char">88/88</td>
</tr>
<tr><td rowspan="2">BIP (B1c + B2)</td>
<td>28956–28977</td>
<td rowspan="2">GCTCCTTCAACTTTTGGGACGCtagtaccgggcgcgaatt</td>
<td align="char">87/88</td>
</tr>
<tr><td>+ 29028–29011</td>
<td align="char">83-88</td>
</tr>
<tr><td>LF</td>
<td>28906–28891</td>
<td>cggaatgggagtgctg</td>
<td align="char">88/88</td>
</tr>
<tr><td>LB</td>
<td>28978–29000</td>
<td>GGAACCCTAACAATGATTCAGCT</td>
<td align="char">85/88</td>
</tr>
</tbody>
</table>
<table-wrap-foot><p>Capital letters indicate the sense strand; lowercase letters indicate the antisense strand.</p>
<p>*Eighty-one sequences were obtained from GenBank (JX869059, KJ829365, KJ813439, KJ713299, KJ713298, KJ713297, KJ713296, KJ713295, KJ650297, KJ650296, KJ650295, KJ650098, KJ556336, KJ477102, KJ156953, KJ156952, KJ156949, KJ156944, KJ156942, KJ156939, KJ156934, KJ156932, KJ156927, KJ156917, KJ156916, KJ156913, KJ156911, KJ156910, KJ156909, KJ156907, KJ156906, KJ156905, KJ156902, KJ156901, KJ156883, KJ156881, KJ156876, KJ156874, KJ156873, KJ156872, KJ156871, KJ156869, KJ156866, KJ156865, KJ156862, KJ156861, KF961222, KF961221, KF958702, KF917527, KF811035, KF745068, KF600652, KF600651, KF600647, KF600645, KF600644, KF600643, KF600639, KF600636, KF600635, KF600634, KF600632, KF600630, KF600628, KF600627, KF600623, KF600621, KF600620, KF600613, KF600612, KF192507, KF186567, KF186566, KF186565, KF186564, KC875821, KC776174, KC667074, KC164505, and KJ782550) and seven sequences were obtained online (England2-HPA, <ext-link ext-link-type="uri" xlink:href="http://www.hpa.org.uk/webc/HPAwebFile/HPAweb_C/1317138176202">http://www.hpa.org.uk/webc/HPAwebFile/HPAweb_C/1317138176202</ext-link>
: Jeddah_2014_C7149, C7569, C7770, C8826, C9055, and C9355, <ext-link ext-link-type="uri" xlink:href="http://www.virology-bonn.de/index.php?id=46">http://www.virology-bonn.de/index.php?id=46</ext-link>
).</p>
</table-wrap-foot>
</table-wrap>
</p>
</sec>
<sec id="Sec12"><title>Sensitivity and specificity of the RT-LAMP assay</title>
<p>The detection limit of the RT-LAMP assay was determined using serially diluted MERS-CoV, and compared with those of real-time RT-PCR using upE and ORF1a assays [<xref ref-type="bibr" rid="CR14">14</xref>
, <xref ref-type="bibr" rid="CR15">15</xref>
] (Table <xref rid="Tab2" ref-type="table">2</xref>
). upE and ORF1a assays were able to detect 1.6 to 3.4 copies of MERS-CoV RNA, consistent with previous reports. The threshold for RT-LAMP within 30 min was also 3.4 copies, indicating a sensitivity equivalent to that of real-time RT-PCR [<xref ref-type="bibr" rid="CR14">14</xref>
, <xref ref-type="bibr" rid="CR15">15</xref>
].RT-LAMP amplification can be monitored in three DNA contamination-free manners. First is a real-time method that monitors the turbidity of the pyrophosphate precipitation using a turbidimeter (LA-320C) (Figure <xref rid="Fig1" ref-type="fig">1</xref>
a). The differentiated value of each signal is calculated automatically at the same time during amplification, with values > 0.1 considered positive. RT-LAMP can also detect MERS-CoV without any specific instruments by detecting visible signals at the same level as real-time monitoring. Amplification can be determined through visual detection of magnesium pyrophosphate precipitation following completion of the reaction (Figure <xref rid="Fig1" ref-type="fig">1</xref>
b). Furthermore, amplicons can be detected by means of green fluorescence under ultraviolet light by adding a fluorescence detection reagent to the mixture before the start of amplification (Figure <xref rid="Fig1" ref-type="fig">1</xref>
c).<table-wrap id="Tab2"><label>Table 2</label>
<caption><p><bold>Sensitivity of the RT-LAMP assay</bold>
</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Copies/reaction</th>
<th align="center">500,000</th>
<th align="center">50,000</th>
<th align="center">5000</th>
<th align="center">500</th>
<th align="center">50</th>
<th align="center">5</th>
<th align="center">0.5</th>
<th align="center">Negative control</th>
<th align="center">Sensitivity (copies)</th>
</tr>
</thead>
<tbody><tr><td colspan="3">Real-time RT-PCR*</td>
<td></td>
<td></td>
<td></td>
<td></td>
<td></td>
<td align="center"></td>
<td align="center"></td>
</tr>
<tr><td>upE</td>
<td align="center">21.2</td>
<td align="center">24.4</td>
<td align="center">27.9</td>
<td align="center">31.3</td>
<td align="center">34.2</td>
<td align="center">36.6</td>
<td align="center">> 40</td>
<td align="center">> 40</td>
<td align="center">1.6</td>
</tr>
<tr><td>ORF1a</td>
<td align="center">21.6</td>
<td align="center">24.4</td>
<td align="center">27.6</td>
<td align="center">30.4</td>
<td align="center">32</td>
<td align="center">31.8</td>
<td align="center">> 40</td>
<td align="center">> 40</td>
<td align="center">3.4</td>
</tr>
<tr><td>RT-LAMP**</td>
<td align="center">11.33</td>
<td align="center">12.13</td>
<td align="center">13.07</td>
<td align="center">15.44</td>
<td align="center">21.44</td>
<td align="center">22.33</td>
<td align="center">> 30</td>
<td align="center">> 30</td>
<td align="center">3.4</td>
</tr>
</tbody>
</table>
<table-wrap-foot><p>*Threshold cycle.</p>
<p>**Time (min. s).</p>
</table-wrap-foot>
</table-wrap>
<fig id="Fig1"><label>Figure 1</label>
<caption><p><bold>Sensitivity of the MERS-CoV RT-LAMP assay. a)</bold>
Real-time amplification of MERS-CoV by RT-LAMP. Amplification of serially diluted MERS-CoV RNA was measured in real-time using a Loopamp real-time turbidimeter (LA-320C). The differentiated value at each dilution was calculated automatically, with values > 0.1 within 30 min (red line) considered positive. <bold>b, c)</bold>
Detection of RT-LAMP amplicon by <bold>b)</bold>
precipitation of magnesium pyrophosphate and <bold>c)</bold>
fluorescence under ultra violet light. For fluorescence detection, 1-μL Fluorescence Detection Reagent was added to each reaction mixture. Fluorescent signals were detected under ultraviolet following completion of the amplification reaction. Successful amplification could be detected as green fluorescent light.</p>
</caption>
<graphic xlink:href="12985_2014_Article_2467_Fig1_HTML" id="d29e906"></graphic>
</fig>
</p>
<p>In addition to MERS-CoV, specific amplification via RT-LAMP was also tested using various respiratory viruses (Table <xref rid="Tab3" ref-type="table">3</xref>
). RT-LAMP was performed using pre-titrated viral stocks, as well as clinical specimens previously validated by PCR. MERS-CoV RT-LAMP was specific for MERS-CoV; other respiratory viruses, such as HCoV, SARS-CoV, RSV, influenza, PIV, ADV, and HMPV could not be amplified using the MERS-CoV primers.<table-wrap id="Tab3"><label>Table 3</label>
<caption><p><bold>Specificity of the RT-LAMP assay</bold>
</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Virus</th>
<th align="center">Titer/reaction</th>
<th align="center">Results (min)</th>
</tr>
</thead>
<tbody><tr><td>Coronaviruses</td>
<td align="center"></td>
<td align="center"></td>
</tr>
<tr><td>MERS-CoV (EMC)</td>
<td align="center">4 × 10<sup>1</sup>
TCID<sub>50</sub>
</td>
<td align="center">14.24</td>
</tr>
<tr><td>HCoV 229E (VR-740)</td>
<td align="center">3 × 10<sup>3</sup>
PFU</td>
<td align="center">> 30</td>
</tr>
<tr><td>HCoV 229E (Sendai-H/1121/04)</td>
<td align="center">5 × 10<sup>3</sup>
PFU</td>
<td align="center">> 30</td>
</tr>
<tr><td>HCoV NL63</td>
<td align="center">2.5 × 10<sup>2</sup>
FFU</td>
<td align="center">> 30</td>
</tr>
<tr><td>HCoV OC43 (VR-1558)</td>
<td align="center">1.3 × 10<sup>3</sup>
TCID<sub>50</sub>
</td>
<td align="center">> 30</td>
</tr>
<tr><td>SARS-CoV (Frankfurt)</td>
<td align="center">1 × 10<sup>5</sup>
PFU</td>
<td align="center">> 30</td>
</tr>
<tr><td>Other Respiratory Viruses</td>
<td align="center"></td>
<td align="center"></td>
</tr>
<tr><td>RSV A (Long)</td>
<td align="center">1 × 10<sup>1</sup>
PFU</td>
<td align="center">> 30</td>
</tr>
<tr><td>RSV A (A2)</td>
<td align="center">1 × 10<sup>2</sup>
PFU</td>
<td align="center">> 30</td>
</tr>
<tr><td>RSV B (18537)</td>
<td align="center">1 × 10<sup>2</sup>
PFU</td>
<td align="center">> 30</td>
</tr>
<tr><td>RSV B (WV/14617/85)</td>
<td align="center">—*</td>
<td align="center">> 30</td>
</tr>
<tr><td>HMPV (Sendai-H/2404/2003)</td>
<td align="center">—*</td>
<td align="center">> 30</td>
</tr>
<tr><td>PIV 1 (C-35)</td>
<td align="center">3 × 10<sup>4</sup>
PFU</td>
<td align="center">> 30</td>
</tr>
<tr><td>PIV 3 (C-243)</td>
<td align="center">5 × 10<sup>3</sup>
PFU</td>
<td align="center">> 30</td>
</tr>
<tr><td>ADV 3 (G.B.)</td>
<td align="center">2.5 × 10<sup>2</sup>
TCID<sub>50</sub>
</td>
<td align="center">> 30</td>
</tr>
<tr><td>ADV 4 (RI-67)</td>
<td align="center">1 × 10<sup>2</sup>
TCID<sub>50</sub>
</td>
<td align="center">> 30</td>
</tr>
<tr><td>ADV 7 (Gomen)</td>
<td align="center">2.5 × 10<sup>2</sup>
TCID<sub>50</sub>
</td>
<td align="center">> 30</td>
</tr>
<tr><td>Flu A/California/7/2009 (H1N1pdm)</td>
<td align="center">8 × 10<sup>3</sup>
TCID<sub>50</sub>
</td>
<td align="center">> 30</td>
</tr>
<tr><td>Flu A/Victoria/210/2009 (H3N2)</td>
<td align="center">2.5 × 10<sup>6</sup>
TCID<sub>50</sub>
</td>
<td align="center">> 30</td>
</tr>
<tr><td>Flu B/Brisbane/60/2008</td>
<td align="center">2.5 × 10<sup>4</sup>
TCID<sub>50</sub>
</td>
<td align="center">> 30</td>
</tr>
</tbody>
</table>
<table-wrap-foot><p>*Titer unknown, but was confirmed by PCR.</p>
<p>PFU: plaque forming unit.</p>
<p>FFU: focus forming unit.</p>
<p>TCID50: 50% tissue culture infectious dose.</p>
</table-wrap-foot>
</table-wrap>
</p>
</sec>
<sec id="Sec13"><title>Pilot experiments</title>
<p>As MERS-CoV clinical isolates are not available in Japan, a pilot study was performed using MERS-CoV laboratory isolates diluted with medium containing pharyngeal swabs obtained from healthy adults. Viral detection was carried out using both RT-LAMP and real-time RT-PCR assays, and with virus isolation using Vero and Vero/TMPRSSS2 cells (Table <xref rid="Tab4" ref-type="table">4</xref>
). Viral isolation from Vero cells required at least 500 copies of MERS-CoV, followed by incubation at 37°C for 5 days. It contrast, although it has been reported that TMPRSS2 enhances the entry and fusion formation of MERS-CoV [<xref ref-type="bibr" rid="CR31">31</xref>
, <xref ref-type="bibr" rid="CR32">32</xref>
], Vero/TMPRSS2 cells exhibited syncytium formation with 23.2 copies of MERS-CoV within 2 days of incubation.<table-wrap id="Tab4"><label>Table 4</label>
<caption><p><bold>Detection of MERS-CoV diluted with medium containing pharyngeal swabs</bold>
</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Copies/50 μL</th>
<th align="right">500,000</th>
<th align="right">50,000</th>
<th align="right">5000</th>
<th align="center">500</th>
<th align="center">50</th>
<th align="center">5</th>
<th align="center">0.5</th>
<th align="center">Negative control</th>
<th align="center">Sensitivity (copies)</th>
<th align="center">Time required</th>
</tr>
</thead>
<tbody><tr><td>Virus isolation*</td>
<td></td>
<td></td>
<td></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
</tr>
<tr><td>Vero</td>
<td align="center">6/6</td>
<td align="center">6/6</td>
<td align="center">6/6</td>
<td align="center">3/6</td>
<td align="center">0/6</td>
<td align="center">0/6</td>
<td align="center">0/6</td>
<td align="center">0/6</td>
<td align="center">500</td>
<td align="center">5 d</td>
</tr>
<tr><td>Vero/TMPRSS2</td>
<td align="center">6/6</td>
<td align="center">6/6</td>
<td align="center">6/6</td>
<td align="center">6/6</td>
<td align="center">5/6</td>
<td align="center">0/6</td>
<td align="center">0/6</td>
<td align="center">0/6</td>
<td align="center">23.2</td>
<td align="center">2 d</td>
</tr>
<tr><td><bold>Copies/reaction</bold>
</td>
<td align="right"><bold>50,000</bold>
</td>
<td align="right"><bold>5000</bold>
</td>
<td align="center"><bold>500</bold>
</td>
<td align="center"><bold>50</bold>
</td>
<td align="center"><bold>5</bold>
</td>
<td align="center"><bold>0.5</bold>
</td>
<td align="center"><bold>0.05</bold>
</td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
</tr>
<tr><td colspan="2">Real-time RT-PCR**</td>
<td></td>
<td></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
<td align="center"></td>
</tr>
<tr><td>upE</td>
<td align="center">22.0</td>
<td align="center">25.3</td>
<td align="center">28.7</td>
<td align="center">32.3</td>
<td align="center">33.2</td>
<td align="center">> 40</td>
<td align="center">> 40</td>
<td align="center">> 40</td>
<td align="center">1.6</td>
<td align="center">2 hr</td>
</tr>
<tr><td>ORF1a</td>
<td align="center">21.9</td>
<td align="center">25.2</td>
<td align="center">28.5</td>
<td align="center">32.2</td>
<td align="center">32.5</td>
<td align="center">> 40</td>
<td align="center">> 40</td>
<td align="center">> 40</td>
<td align="center">1.6</td>
<td align="center">2 hr</td>
</tr>
<tr><td>RT-LAMP***</td>
<td align="center">11.00</td>
<td align="center">11.16</td>
<td align="center">12.18</td>
<td align="center">13.48</td>
<td align="center">18.04</td>
<td align="center">23.12</td>
<td align="center">> 30</td>
<td align="center">> 30</td>
<td align="center">0.7</td>
<td align="center">30 min</td>
</tr>
</tbody>
</table>
<table-wrap-foot><p>*Positive number/tested number.</p>
<p>**Threshold cycle.</p>
<p>***Time (min. s).</p>
</table-wrap-foot>
</table-wrap>
</p>
<p>The real-time RT-PCR was highly sensitive for MERS-CoV, with upE and ORF1a assays capable of detecting as few as 1.6 copies of MERS-CoV RNA. The RT-LAMP was also able to detect viral RNA at levels as low as 0.7 copies, showing equivalence with the RT-PCR assay. Viral isolation using Vero/TMPRSS2 cells was more sensitive than that of Vero cells; however, genetic diagnostic assays were consistently more sensitive than culture-based methods. These data suggest that the RT-LAMP assay is capable of detecting MERS-CoV with a sensitivity similar to that of real-time-RT-PCR, even in clinical specimens.</p>
<p>Next, clinical specimens previously diagnosed as other respiratory pathogens were tested using the RT-LAMP assay (Table <xref rid="Tab5" ref-type="table">5</xref>
). All reactions were negative, with no cross reactivity for other respiratory viruses, indicating a high degree of specificity for the RT-LAMP assay. Collectively, these results suggest that the MERS-CoV RT-LAMP assay is useful for epidemiological surveillance in suspected clinical cases.<table-wrap id="Tab5"><label>Table 5</label>
<caption><p><bold>Detection of MERS-CoV using clinical specimens diagnosed as other respiratory viral infections</bold>
</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Diagnosed pathogen</th>
<th align="center">Results (min)</th>
</tr>
</thead>
<tbody><tr><td>Positive control</td>
<td align="center"></td>
</tr>
<tr><td>*MERS-CoV (10<sup>4</sup>
copies)</td>
<td align="center">9.00</td>
</tr>
<tr><td>Coronaviruses</td>
<td align="center"></td>
</tr>
<tr><td>HCoV OC43</td>
<td align="center">> 30</td>
</tr>
<tr><td>HCoV NL63</td>
<td align="center">> 30</td>
</tr>
<tr><td>HCoV HKU1</td>
<td align="center">> 30</td>
</tr>
<tr><td>Other Respiratory viruses</td>
<td align="center"></td>
</tr>
<tr><td>RSV A</td>
<td align="center">> 30</td>
</tr>
<tr><td>RSV B</td>
<td align="center">> 30</td>
</tr>
<tr><td>HMPV</td>
<td align="center">> 30</td>
</tr>
<tr><td>PIV 1</td>
<td align="center">> 30</td>
</tr>
<tr><td>PIV 2</td>
<td align="center">> 30</td>
</tr>
<tr><td>PIV 3</td>
<td align="center">> 30</td>
</tr>
<tr><td>PIV 4</td>
<td align="center">> 30</td>
</tr>
<tr><td>Rhinovirus</td>
<td align="center">> 30</td>
</tr>
<tr><td>Bocavirus</td>
<td align="center">> 30</td>
</tr>
<tr><td>Flu A H1 (Russian)</td>
<td align="center">> 30</td>
</tr>
<tr><td>Flu A H1 (2009 pdm)</td>
<td align="center">> 30</td>
</tr>
<tr><td>Flu A H3</td>
<td align="center">> 30</td>
</tr>
<tr><td>Flu B (Yamagata)</td>
<td align="center">> 30</td>
</tr>
<tr><td>Flu B (Victoria)</td>
<td align="center">> 30</td>
</tr>
<tr><td>Flu C</td>
<td align="center">> 30</td>
</tr>
<tr><td>Measles virus</td>
<td align="center">> 30</td>
</tr>
<tr><td>Rubella virus</td>
<td align="center">> 30</td>
</tr>
</tbody>
</table>
<table-wrap-foot><p>*Synthesized RNA obtained from N protein region.</p>
</table-wrap-foot>
</table-wrap>
</p>
</sec>
<sec id="Sec14"><title>RT-LAMP validation for mismatched sequences</title>
<p>The primer set was constructed based on the conserved region of the nucleocapsid protein sequence of the EMC isolate of MERS-CoV (GenBank accession no JX869059.2). The number of sequences deposited in GenBank is increasing, and this region of MERS-CoV exhibits several sequences variation. Therefore, the primer sequences were checked against the available MERS-CoV sequences. Eighty-one MERS-CoV nucleocapsid sequences were collected from GenBank, along with seven other sequences reported online (England2-HPA, Jeddah_2014_C7149, C7569, C7770, C8826, C9055, and C9355]. An alignment was constructed using the EMC isolate and mismatched sequences (Figure <xref rid="Fig2" ref-type="fig">2</xref>
). The RT-LAMP primers matched most of the 88 sequences. Primers B3 and LF matched them completely. Primer F3 had one nucleotide mismatch for two sequences. Primer LB had one nucleotide mismatch for one sequence and had another mismatch for two sequences. Primer BIP had one nucleotide mismatch in B1 region of one sequence and had another mismatch in the B2 region of five sequences. Primer FIP had a one-nucleotide mismatch in the F1 region of 11 sequences (Table <xref rid="Tab1" ref-type="table">1</xref>
). The efficiency of RT-LAMP for these mismatched sequences was evaluated using an RNA template transcribed from a 1242-bp of PCR amplicon from the nucleocapsid gene sequence of MERS-CoV (Table <xref rid="Tab6" ref-type="table">6</xref>
). The sensitivity of RT-LAMP using the RNA control template of the EMC isolate was 15.8 copies and tended to be lower than that using viral RNA as the template. This might be caused by a difference in RT efficiency or the secondary structure of RNA due to the difference in length. The mismatches in the F3, F2, B1, and LB region did not markedly affect the amplification efficiency, and the sensitivity was equal to or twice that of the EMC isolate. The mismatch in the B2 region affected amplification slightly, and showed a fivefold decrease in the sensitivity (73.4 copies). This mismatch in B2 was seen in 5 sequences (KJ156883, KJ156944, KF556336, KF958702, and KF917527) of the 88 MERS-CoV sequences checked in this study. Nevertheless, these results suggest that the RT-LAMP primer set facilitates amplification of the remaining 83 sequences to the same level as the EMC isolate.<fig id="Fig2"><label>Figure 2</label>
<caption><p><bold>Nucleotide mismatches in the MERS-CoV sequences.</bold>
The MERS-CoV sequences that have mismatches with the RT-LAMP primer sets were identified in an alignment based on the sequence of the EMC isolate (JX869059.2). The positions of six essential regions (F3, F2, F1, B3, B2, and B1) and loop primers (LF and LB) are indicated. The accession numbers of the MERS-CoV sequences used in the alignment were as follows: JX869059, KJ782550, KJ650098, KJ713295, KJ713296, KJ829365, KJ156905, KJ156883, KJ156944, KJ556336, KF958702, KF917527, KJ477102, KJ813439 and KF961221. Seven MERS-CoV sequences available online (England2, Jeddah_2014_C7149, C7569, C7770, C8826, C9055 and C9355) were also used. The alignment was performed using GeneDoc ver. 2.7 (<ext-link ext-link-type="uri" xlink:href="http://www.nrbsc.org/gfx/genedoc/">http://www.nrbsc.org/gfx/genedoc/</ext-link>
).</p>
</caption>
<graphic xlink:href="12985_2014_Article_2467_Fig2_HTML" id="d29e1774"></graphic>
</fig>
</p>
<table-wrap id="Tab6"><label>Table 6</label>
<caption><p><bold>Evaluation of RT-LAMP amplification using mismatched sequences</bold>
</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Accession</th>
<th align="center">Name</th>
<th align="center"></th>
<th align="center"></th>
<th align="center"></th>
<th align="center">Sensitivity (copies)</th>
</tr>
<tr><th>JX869059</th>
<th align="center">EMC</th>
<th colspan="3"></th>
<th align="center">15.8</th>
</tr>
<tr><th colspan="2">Representative sequence</th>
<th align="center">Nucleotide position<sup>*</sup>
</th>
<th align="center">Substitution</th>
<th align="center">Region in primer</th>
<th align="center">Sensitivity (copies)</th>
</tr>
</thead>
<tbody><tr><td></td>
<td align="center">England2</td>
<td align="center">28862</td>
<td align="center">C to T</td>
<td align="center">F3</td>
<td align="center">7.3</td>
</tr>
<tr><td>KJ782550</td>
<td align="center">Greece-Saudi Arabia_2014</td>
<td align="center">28862</td>
<td align="center">C to T</td>
<td align="center">F3</td>
<td align="center">15.8</td>
</tr>
<tr><td></td>
<td align="center"></td>
<td align="center">28880</td>
<td align="center">T to C</td>
<td align="center">FIP (F2)</td>
<td align="center"></td>
</tr>
<tr><td>KJ650098</td>
<td align="center">Camel/Qatar_2_2014</td>
<td align="center">28880</td>
<td align="center">T to C</td>
<td align="center">FIP (F2)</td>
<td align="center">34.1</td>
</tr>
<tr><td>KJ156905</td>
<td align="center">Riyadh_7b_2013</td>
<td align="center">28958</td>
<td align="center">T to C</td>
<td align="center">BIP (B1)</td>
<td align="center">15.8</td>
</tr>
<tr><td>KF917527</td>
<td align="center">Jeddah-Camel-1</td>
<td align="center">29018</td>
<td align="center">G to T</td>
<td align="center">BIP (B2)</td>
<td align="center">73.4</td>
</tr>
<tr><td>KJ477102</td>
<td align="center">NRCE-HKU205</td>
<td align="center">28982</td>
<td align="center">C to T</td>
<td align="center">LB</td>
<td align="center">39.7</td>
</tr>
<tr><td>KF961221</td>
<td align="center">Qatar3</td>
<td align="center">28996</td>
<td align="center">C to T</td>
<td align="center">LB</td>
<td align="center">7.3</td>
</tr>
</tbody>
</table>
<table-wrap-foot><p>*Based on EMC isolate (JX869059.2).</p>
</table-wrap-foot>
</table-wrap>
</sec>
</sec>
<sec id="Sec15"><title>Discussion</title>
<p>As described above, definitive MERS-CoV diagnosis requires amplification of at least two different virus-specific genomic targets according to the case definition reported on 3 July 2013 by the WHO. However, only two real-time RT-PCR targets, upE and ORF1a, are currently available for MERS-CoV detection with high specificity and sensitivity [<xref ref-type="bibr" rid="CR14">14</xref>
, <xref ref-type="bibr" rid="CR15">15</xref>
]. Indeed, two previous cases reported by the Italian government had to be reclassified as probable MERS-CoV infections, as they were unable to fulfill these criteria (WHO, GAR, MERS-CoV summary and literature update – as of 20 September 2013, <ext-link ext-link-type="uri" xlink:href="http://www.who.int/csr/disease/coronavirus_infections/update_20130920/en/index.html">http://www.who.int/csr/disease/coronavirus_infections/update_20130920/en/index.html</ext-link>
). Additional sensitive and specific genetic diagnostic methods are therefore needed to provide reliable MERS-CoV diagnoses.</p>
<p>This study describes a novel genetic diagnostic method for MERS-CoV based on the RT-LAMP assay, with a sensitivity and specificity equal to that of the upE and ORF1a RT-PCR assays. This assay was also able to detect MERS-CoV RNA in experimentally obtained nasopharyngeal swabs, and never showed cross reactivity to other respiratory viruses, even in the case of clinical specimens.</p>
<p>The RT-LAMP method requires only a single temperature for amplification, with results usually available in less than 1 h by observing magnesium pyrophosphate precipitate or fluorescence signals by the naked eye [<xref ref-type="bibr" rid="CR21">21</xref>
, <xref ref-type="bibr" rid="CR22">22</xref>
]. Although RT-LAMP amplification can be monitored in real-time using a turbidimeter [<xref ref-type="bibr" rid="CR23">23</xref>
], the assay can also be performed using basic laboratory equipment, such as a heat block and water bath. The method has been validated using various respiratory viruses, as well as more diverse pathogens, such as bacteria [<xref ref-type="bibr" rid="CR33">33</xref>
–<xref ref-type="bibr" rid="CR35">35</xref>
], protozoa [<xref ref-type="bibr" rid="CR36">36</xref>
–<xref ref-type="bibr" rid="CR38">38</xref>
], and parasites [<xref ref-type="bibr" rid="CR39">39</xref>
, <xref ref-type="bibr" rid="CR40">40</xref>
]. Furthermore, the reagents necessary to perform RT-LAMP are commercially available. Recently, Abd El Wahed et al., reported a genetic diagnostic method for MERS-CoV based on reverse transcription isothermal recombinase polymerase amplification (RT-PPA) assay. The method is highly sensitive and can detect 10 copies of virus RNA within 3 to 7 minutes. Therefore, it is useful for the diagnosis of MERS-CoV as well. However, RT-RPA requires a specific tubescanner for detection. By contrast, the RT-LAMP assay enables detection of amplicons by observing a magnesium pyrophosphate precipitate or fluorescence signals with the naked eye with no requirement for any specialized instruments. Taken together, the specificity and sensitivity of the RT-LAMP assay described here, in combination with its accessibility and ease of use, make this assay a valuable tool for the diagnosis and epidemiologic surveillance of human MERS-CoV infection, especially for field use.</p>
<p>The primer sets described in this study matched to most of the available sequences. However, several sequences had mismatches with the primers. The effect of these mismatches on the RT-LAMP efficiency was evaluated using a synthesized control RNA template: most of the mismatches did not affect the amplification efficiency of RT-LAMP. However, the substitution in B2 region of the primer, namely, a G to T substitution at position 29018 in the nucleocapsid gene sequence of the EMC isolate, was present in five MERS-CoV sequences and caused a slight decrease in sensitivity. Of the five sequences, KJ156883 (Asir_1_2013) belongs to the Buraidah_1 clade, and is the only sequence in this clade with such a substitution [<xref ref-type="bibr" rid="CR41">41</xref>
]. The other sequences (KJ156944, Riyadh_5_2013; KJ556336, Jeddah_1_2013; KF958702, Jeddah_human1; KF917527, Jeddah_Camel1) belong to the Riyadh_3 clade [<xref ref-type="bibr" rid="CR42">42</xref>
, <xref ref-type="bibr" rid="CR43">43</xref>
]; none of the other sequences in this clade have a substitution according to the alignment analysis. Therefore, the substitution does not represent a major population in this clade. Although it is important to improve the primers to increase their sensitivity for sequences in the Riyadh_3 clade by using mixed bases, the results of this study suggest that the RT-LAMP primer is useful for detecting the majority of the prevalent MERS-CoV strains.</p>
<p>The success rate of MERS-CoV detection is dependent on the collection of clinical specimens. Drosten <italic>et al</italic>
., reported that up to 10<sup>6</sup>
copies/mL of MERS-CoV RNA are present in lower respiratory tract specimens, such as tracheobronchial secretions, and bronchoalveolar lavage. In contrast, only small amounts of viral RNAs were detected in upper respiratory tract specimens and other tissue [<xref ref-type="bibr" rid="CR44">44</xref>
]. The RT-LAMP primers described here were designed based upon the nucleocapsid protein sequence of MERS-CoV, due to the unique coronaviral replication system. Although coronaviruses generate subgenomic mRNAs to produce each viral protein, all subgenomic mRNAs contain nucleoprotein sequences, as they are located on the 3′end of the coronavirus genome [<xref ref-type="bibr" rid="CR45">45</xref>
–<xref ref-type="bibr" rid="CR47">47</xref>
]. This implies that the RT-LAMP procedure described here will exhibit a high degree of sensitivity for specimens containing cellular components.</p>
</sec>
<sec id="Sec16"><title>Conclusions</title>
<p>This study developed a RT-LAMP assay for the MERS-CoV, which was capable of detecting as few as 3.4 copies of MERS-CoV RNA, and was highly specific, with no cross-reaction with other respiratory viruses. These results suggest that the RT-LAMP assay described here is a useful tool for the diagnosis and epidemiologic surveillance of human MERS-CoV infections.</p>
</sec>
</body>
<back><app-group><app id="App1"><sec id="Sec17"><title>Authors’ original submitted files for images</title>
<p>Below are the links to the authors’ original submitted files for images.<media position="anchor" xlink:href="12985_2014_2467_MOESM1_ESM.pdf" id="MOESM1"><caption><p>Authors’ original file for figure 1</p>
</caption>
</media>
<media position="anchor" xlink:href="12985_2014_2467_MOESM2_ESM.tiff" id="MOESM2"><caption><p>Authors’ original file for figure 2</p>
</caption>
</media>
</p>
</sec>
</app>
</app-group>
<glossary><title>Abbreviations</title>
<def-list><def-item><term>CoV</term>
<def><p>Coronavirus</p>
</def>
</def-item>
<def-item><term>FFU</term>
<def><p>Focus forming unit</p>
</def>
</def-item>
<def-item><term>MERS</term>
<def><p>Middle East respiratory syndrome</p>
</def>
</def-item>
<def-item><term>ORF</term>
<def><p>Open reading frame</p>
</def>
</def-item>
<def-item><term>PBS</term>
<def><p>Phosphate-buffered saline</p>
</def>
</def-item>
<def-item><term>PFU</term>
<def><p>Plaque forming unit</p>
</def>
</def-item>
<def-item><term>RT-LAMP</term>
<def><p>Reverse transcription-loop-mediated isothermal amplification</p>
</def>
</def-item>
<def-item><term>TCID50</term>
<def><p>50% tissue culture infectious dose</p>
</def>
</def-item>
<def-item><term>TMPRSS2</term>
<def><p>Transmembrane protease, serine 2</p>
</def>
</def-item>
<def-item><term>upE</term>
<def><p>Upstream E.</p>
</def>
</def-item>
</def-list>
</glossary>
<fn-group><fn><p><bold>Competing interests</bold>
</p>
<p>The authors declare that they have no competing interests.</p>
</fn>
<fn><p><bold>Authors’ contributions</bold>
</p>
<p>All authors participating in the planning of the project. SS and TsuN constructed the RT-LAMP primer set and evaluated the sensitivity. TY, SA, TK, and TaN participated in the pilot experiments. KS participated in all experiments and wrote manuscript. SM is the leader of the project. All authors read and approved the final manuscript.</p>
</fn>
</fn-group>
<ack><title>Acknowledgements</title>
<p>We thank Dr. Ron A. M. Fouchier, Erasmus Medical Center, Rotterdam, The Netherlands for providing MERS-CoV EMC isolate. We also thank the staff of Mie Prefecture Health and Environment Research Institute, Mie, Japan. This work was supported by a grant-in-aid from the Ministry of Health, Labor, and Welfare, Japan. We thank Dr. Aiko Fukuma and Dr. Shuetsu Fukushi, Department of Virology I, National Institute of Infectious Diseases, Japan, for cloning of the nucleocapsid sequence of MERS-CoV.</p>
</ack>
<ref-list id="Bib1"><title>References</title>
<ref id="CR1"><label>1.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Danielsson</surname>
<given-names>N</given-names>
</name>
<name><surname>Catchpole</surname>
<given-names>M</given-names>
</name>
<collab>On Behalf Of The Ecdc Internal Response Team C</collab>
</person-group>
<article-title>Novel coronavirus associated with severe respiratory disease: case definition and public health measures</article-title>
<source>Euro Surveill</source>
<year>2012</year>
<volume>17</volume>
<fpage>20282</fpage>
<pub-id pub-id-type="pmid">23041021</pub-id>
</element-citation>
</ref>
<ref id="CR2"><label>2.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zaki</surname>
<given-names>AM</given-names>
</name>
<name><surname>van Boheemen</surname>
<given-names>S</given-names>
</name>
<name><surname>Bestebroer</surname>
<given-names>TM</given-names>
</name>
<name><surname>Osterhaus</surname>
<given-names>AD</given-names>
</name>
<name><surname>Fouchier</surname>
<given-names>RA</given-names>
</name>
</person-group>
<article-title>Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia</article-title>
<source>N Engl J Med</source>
<year>2012</year>
<volume>367</volume>
<fpage>1814</fpage>
<lpage>1820</lpage>
<pub-id pub-id-type="doi">10.1056/NEJMoa1211721</pub-id>
<pub-id pub-id-type="pmid">23075143</pub-id>
</element-citation>
</ref>
<ref id="CR3"><label>3.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>de Groot</surname>
<given-names>RJ</given-names>
</name>
<name><surname>Baker</surname>
<given-names>SC</given-names>
</name>
<name><surname>Baric</surname>
<given-names>RS</given-names>
</name>
<name><surname>Brown</surname>
<given-names>CS</given-names>
</name>
<name><surname>Drosten</surname>
<given-names>C</given-names>
</name>
<name><surname>Enjuanes</surname>
<given-names>L</given-names>
</name>
<name><surname>Fouchier</surname>
<given-names>RA</given-names>
</name>
<name><surname>Galiano</surname>
<given-names>M</given-names>
</name>
<name><surname>Gorbalenya</surname>
<given-names>AE</given-names>
</name>
<name><surname>Memish</surname>
<given-names>ZA</given-names>
</name>
<name><surname>Perlman</surname>
<given-names>S</given-names>
</name>
<name><surname>Poon</surname>
<given-names>LL</given-names>
</name>
<name><surname>Snijder</surname>
<given-names>EJ</given-names>
</name>
<name><surname>Stephens</surname>
<given-names>GM</given-names>
</name>
<name><surname>Woo</surname>
<given-names>PC</given-names>
</name>
<name><surname>Zaki</surname>
<given-names>AM</given-names>
</name>
<name><surname>Zambon</surname>
<given-names>M</given-names>
</name>
<name><surname>Ziebuhr</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Middle East respiratory syndrome coronavirus (MERS-CoV): announcement of the coronavirus study group</article-title>
<source>J Virol</source>
<year>2013</year>
<volume>87</volume>
<fpage>7790</fpage>
<lpage>7792</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.01244-13</pub-id>
<pub-id pub-id-type="pmid">23678167</pub-id>
</element-citation>
</ref>
<ref id="CR4"><label>4.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van Boheemen</surname>
<given-names>S</given-names>
</name>
<name><surname>de Graaf</surname>
<given-names>M</given-names>
</name>
<name><surname>Lauber</surname>
<given-names>C</given-names>
</name>
<name><surname>Bestebroer</surname>
<given-names>TM</given-names>
</name>
<name><surname>Raj</surname>
<given-names>VS</given-names>
</name>
<name><surname>Zaki</surname>
<given-names>AM</given-names>
</name>
<name><surname>Osterhaus</surname>
<given-names>AD</given-names>
</name>
<name><surname>Haagmans</surname>
<given-names>BL</given-names>
</name>
<name><surname>Gorbalenya</surname>
<given-names>AE</given-names>
</name>
<name><surname>Snijder</surname>
<given-names>EJ</given-names>
</name>
<name><surname>Fouchier</surname>
<given-names>RA</given-names>
</name>
</person-group>
<article-title>Genomic characterization of a newly discovered coronavirus associated with acute respiratory distress syndrome in humans</article-title>
<source>MBio</source>
<year>2012</year>
<volume>3</volume>
<fpage>e00473</fpage>
<lpage>00412</lpage>
<pub-id pub-id-type="doi">10.1128/mBio.00473-12</pub-id>
<pub-id pub-id-type="pmid">23170002</pub-id>
</element-citation>
</ref>
<ref id="CR5"><label>5.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peiris</surname>
<given-names>JS</given-names>
</name>
<name><surname>Guan</surname>
<given-names>Y</given-names>
</name>
<name><surname>Yuen</surname>
<given-names>KY</given-names>
</name>
</person-group>
<article-title>Severe acute respiratory syndrome</article-title>
<source>Nat Med</source>
<year>2004</year>
<volume>10</volume>
<fpage>S88</fpage>
<lpage>97</lpage>
<pub-id pub-id-type="doi">10.1038/nm1143</pub-id>
<pub-id pub-id-type="pmid">15577937</pub-id>
</element-citation>
</ref>
<ref id="CR6"><label>6.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname>
<given-names>W</given-names>
</name>
<name><surname>Shi</surname>
<given-names>Z</given-names>
</name>
<name><surname>Yu</surname>
<given-names>M</given-names>
</name>
<name><surname>Ren</surname>
<given-names>W</given-names>
</name>
<name><surname>Smith</surname>
<given-names>C</given-names>
</name>
<name><surname>Epstein</surname>
<given-names>JH</given-names>
</name>
<name><surname>Wang</surname>
<given-names>H</given-names>
</name>
<name><surname>Crameri</surname>
<given-names>G</given-names>
</name>
<name><surname>Hu</surname>
<given-names>Z</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>H</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>J</given-names>
</name>
<name><surname>McEachern</surname>
<given-names>J</given-names>
</name>
<name><surname>Field</surname>
<given-names>H</given-names>
</name>
<name><surname>Daszak</surname>
<given-names>P</given-names>
</name>
<name><surname>Eaton</surname>
<given-names>BT</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>S</given-names>
</name>
<name><surname>Wang</surname>
<given-names>LF</given-names>
</name>
</person-group>
<article-title>Bats are natural reservoirs of SARS-like coronaviruses</article-title>
<source>Science</source>
<year>2005</year>
<volume>310</volume>
<fpage>676</fpage>
<lpage>679</lpage>
<pub-id pub-id-type="doi">10.1126/science.1118391</pub-id>
<pub-id pub-id-type="pmid">16195424</pub-id>
</element-citation>
</ref>
<ref id="CR7"><label>7.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lau</surname>
<given-names>SK</given-names>
</name>
<name><surname>Li</surname>
<given-names>KS</given-names>
</name>
<name><surname>Huang</surname>
<given-names>Y</given-names>
</name>
<name><surname>Shek</surname>
<given-names>CT</given-names>
</name>
<name><surname>Tse</surname>
<given-names>H</given-names>
</name>
<name><surname>Wang</surname>
<given-names>M</given-names>
</name>
<name><surname>Choi</surname>
<given-names>GK</given-names>
</name>
<name><surname>Xu</surname>
<given-names>H</given-names>
</name>
<name><surname>Lam</surname>
<given-names>CS</given-names>
</name>
<name><surname>Guo</surname>
<given-names>R</given-names>
</name>
<name><surname>Chan</surname>
<given-names>KH</given-names>
</name>
<name><surname>Zheng</surname>
<given-names>BJ</given-names>
</name>
<name><surname>Woo</surname>
<given-names>PC</given-names>
</name>
<name><surname>Yuen</surname>
<given-names>KY</given-names>
</name>
</person-group>
<article-title>Ecoepidemiology and complete genome comparison of different strains of severe acute respiratory syndrome-related rhinolophus bat coronavirus in China reveal bats as a reservoir for acute, self-limiting infection that allows recombination events</article-title>
<source>J Virol</source>
<year>2010</year>
<volume>84</volume>
<fpage>2808</fpage>
<lpage>2819</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.02219-09</pub-id>
<pub-id pub-id-type="pmid">20071579</pub-id>
</element-citation>
</ref>
<ref id="CR8"><label>8.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hemida</surname>
<given-names>MG</given-names>
</name>
<name><surname>Perera</surname>
<given-names>RA</given-names>
</name>
<name><surname>Wang</surname>
<given-names>P</given-names>
</name>
<name><surname>Alhammadi</surname>
<given-names>MA</given-names>
</name>
<name><surname>Siu</surname>
<given-names>LY</given-names>
</name>
<name><surname>Li</surname>
<given-names>M</given-names>
</name>
<name><surname>Poon</surname>
<given-names>LL</given-names>
</name>
<name><surname>Saif</surname>
<given-names>L</given-names>
</name>
<name><surname>Alnaeem</surname>
<given-names>A</given-names>
</name>
<name><surname>Peiris</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Middle East respiratory syndrome (MERS) coronavirus seroprevalence in domestic livestock in Saudi Arabia, 2010 to 2013</article-title>
<source>Euro Surveill</source>
<year>2013</year>
<volume>18</volume>
<fpage>20659</fpage>
<pub-id pub-id-type="doi">10.2807/1560-7917.ES2013.18.50.20659</pub-id>
<pub-id pub-id-type="pmid">24342517</pub-id>
</element-citation>
</ref>
<ref id="CR9"><label>9.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kupferschmidt</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Emerging diseases: researchers scramble to understand camel connection to MERS</article-title>
<source>Science</source>
<year>2013</year>
<volume>341</volume>
<fpage>702</fpage>
<pub-id pub-id-type="doi">10.1126/science.341.6147.702</pub-id>
<pub-id pub-id-type="pmid">23950504</pub-id>
</element-citation>
</ref>
<ref id="CR10"><label>10.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Reusken</surname>
<given-names>C</given-names>
</name>
<name><surname>Ababneh</surname>
<given-names>M</given-names>
</name>
<name><surname>Raj</surname>
<given-names>V</given-names>
</name>
<name><surname>Meyer</surname>
<given-names>B</given-names>
</name>
<name><surname>Eljarah</surname>
<given-names>A</given-names>
</name>
<name><surname>Abutarbush</surname>
<given-names>S</given-names>
</name>
<name><surname>Godeke</surname>
<given-names>G</given-names>
</name>
<name><surname>Bestebroer</surname>
<given-names>T</given-names>
</name>
<name><surname>Zutt</surname>
<given-names>I</given-names>
</name>
<name><surname>Muller</surname>
<given-names>M</given-names>
</name>
<name><surname>Bosch</surname>
<given-names>B</given-names>
</name>
<name><surname>Rottier</surname>
<given-names>P</given-names>
</name>
<name><surname>Osterhaus</surname>
<given-names>A</given-names>
</name>
<name><surname>Drosten</surname>
<given-names>C</given-names>
</name>
<name><surname>Haagmans</surname>
<given-names>B</given-names>
</name>
<name><surname>Koopmans</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Middle East respiratory syndrome coronavirus (MERS-CoV) serology in major livestock species in an affected region in Jordan, June to September 2013</article-title>
<source>Euro Surveill</source>
<year>2013</year>
<volume>18</volume>
<fpage>20662</fpage>
<pub-id pub-id-type="doi">10.2807/1560-7917.ES2013.18.50.20662</pub-id>
<pub-id pub-id-type="pmid">24342516</pub-id>
</element-citation>
</ref>
<ref id="CR11"><label>11.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Reusken</surname>
<given-names>CB</given-names>
</name>
<name><surname>Haagmans</surname>
<given-names>BL</given-names>
</name>
<name><surname>Muller</surname>
<given-names>MA</given-names>
</name>
<name><surname>Gutierrez</surname>
<given-names>C</given-names>
</name>
<name><surname>Godeke</surname>
<given-names>GJ</given-names>
</name>
<name><surname>Meyer</surname>
<given-names>B</given-names>
</name>
<name><surname>Muth</surname>
<given-names>D</given-names>
</name>
<name><surname>Raj</surname>
<given-names>VS</given-names>
</name>
<name><surname>Smits-De Vries</surname>
<given-names>L</given-names>
</name>
<name><surname>Corman</surname>
<given-names>VM</given-names>
</name>
<name><surname>Drexler</surname>
<given-names>JF</given-names>
</name>
<name><surname>Smits</surname>
<given-names>SL</given-names>
</name>
<name><surname>El Tahir</surname>
<given-names>YE</given-names>
</name>
<name><surname>De Sousa</surname>
<given-names>R</given-names>
</name>
<name><surname>van Beek</surname>
<given-names>J</given-names>
</name>
<name><surname>Nowotny</surname>
<given-names>N</given-names>
</name>
<name><surname>van Maanen</surname>
<given-names>K</given-names>
</name>
<name><surname>Hidalgo-Hermoso</surname>
<given-names>E</given-names>
</name>
<name><surname>Bosch</surname>
<given-names>BJ</given-names>
</name>
<name><surname>Rottier</surname>
<given-names>P</given-names>
</name>
<name><surname>Osterhaus</surname>
<given-names>A</given-names>
</name>
<name><surname>Gortazar-Schmidt</surname>
<given-names>C</given-names>
</name>
<name><surname>Drosten</surname>
<given-names>C</given-names>
</name>
<name><surname>Koopmans</surname>
<given-names>MP</given-names>
</name>
</person-group>
<article-title>Middle East respiratory syndrome coronavirus neutralising serum antibodies in dromedary camels: a comparative serological study</article-title>
<source>Lancet Infect Dis</source>
<year>2013</year>
<volume>13</volume>
<fpage>859</fpage>
<lpage>866</lpage>
<pub-id pub-id-type="doi">10.1016/S1473-3099(13)70164-6</pub-id>
<pub-id pub-id-type="pmid">23933067</pub-id>
</element-citation>
</ref>
<ref id="CR12"><label>12.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Alagaili</surname>
<given-names>AN</given-names>
</name>
<name><surname>Briese</surname>
<given-names>T</given-names>
</name>
<name><surname>Mishra</surname>
<given-names>N</given-names>
</name>
<name><surname>Kapoor</surname>
<given-names>V</given-names>
</name>
<name><surname>Sameroff</surname>
<given-names>SC</given-names>
</name>
<name><surname>Burbelo</surname>
<given-names>PD</given-names>
</name>
<name><surname>de Wit</surname>
<given-names>E</given-names>
</name>
<name><surname>Munster</surname>
<given-names>VJ</given-names>
</name>
<name><surname>Hensley</surname>
<given-names>LE</given-names>
</name>
<name><surname>Zalmout</surname>
<given-names>IS</given-names>
</name>
<name><surname>Kapoor</surname>
<given-names>A</given-names>
</name>
<name><surname>Epstein</surname>
<given-names>JH</given-names>
</name>
<name><surname>Karesh</surname>
<given-names>WB</given-names>
</name>
<name><surname>Daszak</surname>
<given-names>P</given-names>
</name>
<name><surname>Mohammed</surname>
<given-names>OB</given-names>
</name>
<name><surname>Lipkin</surname>
<given-names>WI</given-names>
</name>
</person-group>
<article-title>Middle East respiratory syndrome coronavirus infection in dromedary camels in Saudi Arabia</article-title>
<source>MBio</source>
<year>2014</year>
<volume>5</volume>
<fpage>e00884</fpage>
<lpage>00814</lpage>
<pub-id pub-id-type="pmid">24570370</pub-id>
</element-citation>
</ref>
<ref id="CR13"><label>13.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Haagmans</surname>
<given-names>BL</given-names>
</name>
<name><surname>Al Dhahiry</surname>
<given-names>SH</given-names>
</name>
<name><surname>Reusken</surname>
<given-names>CB</given-names>
</name>
<name><surname>Raj</surname>
<given-names>VS</given-names>
</name>
<name><surname>Galiano</surname>
<given-names>M</given-names>
</name>
<name><surname>Myers</surname>
<given-names>R</given-names>
</name>
<name><surname>Godeke</surname>
<given-names>GJ</given-names>
</name>
<name><surname>Jonges</surname>
<given-names>M</given-names>
</name>
<name><surname>Farag</surname>
<given-names>E</given-names>
</name>
<name><surname>Diab</surname>
<given-names>A</given-names>
</name>
<name><surname>Ghobashy</surname>
<given-names>H</given-names>
</name>
<name><surname>Alhajri</surname>
<given-names>F</given-names>
</name>
<name><surname>Al-Thani</surname>
<given-names>M</given-names>
</name>
<name><surname>Al-Marri</surname>
<given-names>SA</given-names>
</name>
<name><surname>Al Romaihi</surname>
<given-names>HE</given-names>
</name>
<name><surname>Al Khal</surname>
<given-names>A</given-names>
</name>
<name><surname>Bermingham</surname>
<given-names>A</given-names>
</name>
<name><surname>Osterhaus</surname>
<given-names>AD</given-names>
</name>
<name><surname>AlHajri</surname>
<given-names>MM</given-names>
</name>
<name><surname>Koopmans</surname>
<given-names>MP</given-names>
</name>
</person-group>
<article-title>Middle East respiratory syndrome coronavirus in dromedary camels: an outbreak investigation</article-title>
<source>Lancet Infect Dis</source>
<year>2014</year>
<volume>14</volume>
<fpage>140</fpage>
<lpage>145</lpage>
<pub-id pub-id-type="doi">10.1016/S1473-3099(13)70690-X</pub-id>
<pub-id pub-id-type="pmid">24355866</pub-id>
</element-citation>
</ref>
<ref id="CR14"><label>14.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Corman</surname>
<given-names>V</given-names>
</name>
<name><surname>Eckerle</surname>
<given-names>I</given-names>
</name>
<name><surname>Bleicker</surname>
<given-names>T</given-names>
</name>
<name><surname>Zaki</surname>
<given-names>A</given-names>
</name>
<name><surname>Landt</surname>
<given-names>O</given-names>
</name>
<name><surname>Eschbach-Bludau</surname>
<given-names>M</given-names>
</name>
<name><surname>van Boheemen</surname>
<given-names>S</given-names>
</name>
<name><surname>Gopal</surname>
<given-names>R</given-names>
</name>
<name><surname>Ballhause</surname>
<given-names>M</given-names>
</name>
<name><surname>Bestebroer</surname>
<given-names>T</given-names>
</name>
<name><surname>Muth</surname>
<given-names>D</given-names>
</name>
<name><surname>Muller</surname>
<given-names>M</given-names>
</name>
<name><surname>Drexler</surname>
<given-names>J</given-names>
</name>
<name><surname>Zambon</surname>
<given-names>M</given-names>
</name>
<name><surname>Osterhaus</surname>
<given-names>A</given-names>
</name>
<name><surname>Fouchier</surname>
<given-names>R</given-names>
</name>
<name><surname>Drosten</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction</article-title>
<source>Euro Surveill</source>
<year>2012</year>
<volume>17</volume>
<fpage>20285</fpage>
<pub-id pub-id-type="pmid">23041020</pub-id>
</element-citation>
</ref>
<ref id="CR15"><label>15.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Corman</surname>
<given-names>VM</given-names>
</name>
<name><surname>Muller</surname>
<given-names>MA</given-names>
</name>
<name><surname>Costabel</surname>
<given-names>U</given-names>
</name>
<name><surname>Timm</surname>
<given-names>J</given-names>
</name>
<name><surname>Binger</surname>
<given-names>T</given-names>
</name>
<name><surname>Meyer</surname>
<given-names>B</given-names>
</name>
<name><surname>Kreher</surname>
<given-names>P</given-names>
</name>
<name><surname>Lattwein</surname>
<given-names>E</given-names>
</name>
<name><surname>Eschbach-Bludau</surname>
<given-names>M</given-names>
</name>
<name><surname>Nitsche</surname>
<given-names>A</given-names>
</name>
<name><surname>Bleicker</surname>
<given-names>T</given-names>
</name>
<name><surname>Landt</surname>
<given-names>O</given-names>
</name>
<name><surname>Schweiger</surname>
<given-names>B</given-names>
</name>
<name><surname>Drexler</surname>
<given-names>JF</given-names>
</name>
<name><surname>Osterhaus</surname>
<given-names>AD</given-names>
</name>
<name><surname>Haagmans</surname>
<given-names>BL</given-names>
</name>
<name><surname>Dittmer</surname>
<given-names>U</given-names>
</name>
<name><surname>Bonin</surname>
<given-names>F</given-names>
</name>
<name><surname>Wolff</surname>
<given-names>T</given-names>
</name>
<name><surname>Drosten</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Assays for laboratory confirmation of novel human coronavirus (hCoV-EMC) infections</article-title>
<source>Euro Surveill</source>
<year>2012</year>
<volume>17</volume>
<fpage>20334</fpage>
<pub-id pub-id-type="pmid">23231891</pub-id>
</element-citation>
</ref>
<ref id="CR16"><label>16.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname>
<given-names>W</given-names>
</name>
<name><surname>He</surname>
<given-names>B</given-names>
</name>
<name><surname>Li</surname>
<given-names>C</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>X</given-names>
</name>
<name><surname>Wu</surname>
<given-names>W</given-names>
</name>
<name><surname>Yin</surname>
<given-names>X</given-names>
</name>
<name><surname>Fan</surname>
<given-names>B</given-names>
</name>
<name><surname>Fan</surname>
<given-names>X</given-names>
</name>
<name><surname>Wang</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Real-time RT-PCR for H5N1 avian influenza A virus detection</article-title>
<source>J Med Microbiol</source>
<year>2007</year>
<volume>56</volume>
<fpage>603</fpage>
<lpage>607</lpage>
<pub-id pub-id-type="doi">10.1099/jmm.0.47014-0</pub-id>
<pub-id pub-id-type="pmid">17446281</pub-id>
</element-citation>
</ref>
<ref id="CR17"><label>17.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pang</surname>
<given-names>X</given-names>
</name>
<name><surname>Lee</surname>
<given-names>B</given-names>
</name>
<name><surname>Chui</surname>
<given-names>L</given-names>
</name>
<name><surname>Preiksaitis</surname>
<given-names>JK</given-names>
</name>
<name><surname>Monroe</surname>
<given-names>SS</given-names>
</name>
</person-group>
<article-title>Evaluation and validation of real-time reverse transcription-pcr assay using the LightCycler system for detection and quantitation of norovirus</article-title>
<source>J Clin Microbiol</source>
<year>2004</year>
<volume>42</volume>
<fpage>4679</fpage>
<lpage>4685</lpage>
<pub-id pub-id-type="doi">10.1128/JCM.42.10.4679-4685.2004</pub-id>
<pub-id pub-id-type="pmid">15472327</pub-id>
</element-citation>
</ref>
<ref id="CR18"><label>18.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ke</surname>
<given-names>GM</given-names>
</name>
<name><surname>Cheng</surname>
<given-names>HL</given-names>
</name>
<name><surname>Ke</surname>
<given-names>LY</given-names>
</name>
<name><surname>Ji</surname>
<given-names>WT</given-names>
</name>
<name><surname>Chulu</surname>
<given-names>JL</given-names>
</name>
<name><surname>Liao</surname>
<given-names>MH</given-names>
</name>
<name><surname>Chang</surname>
<given-names>TJ</given-names>
</name>
<name><surname>Liu</surname>
<given-names>HJ</given-names>
</name>
</person-group>
<article-title>Development of a quantitative light cycler real-time RT-PCR for detection of avian reovirus</article-title>
<source>J Virol Methods</source>
<year>2006</year>
<volume>133</volume>
<fpage>6</fpage>
<lpage>13</lpage>
<pub-id pub-id-type="doi">10.1016/j.jviromet.2005.09.011</pub-id>
<pub-id pub-id-type="pmid">16300834</pub-id>
</element-citation>
</ref>
<ref id="CR19"><label>19.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yan</surname>
<given-names>L</given-names>
</name>
<name><surname>Yan</surname>
<given-names>P</given-names>
</name>
<name><surname>Zhou</surname>
<given-names>J</given-names>
</name>
<name><surname>Teng</surname>
<given-names>Q</given-names>
</name>
<name><surname>Li</surname>
<given-names>Z</given-names>
</name>
</person-group>
<article-title>Establishing a TaqMan-based real-time PCR assay for the rapid detection and quantification of the newly emerged duck Tembusu virus</article-title>
<source>Virol J</source>
<year>2011</year>
<volume>8</volume>
<fpage>464</fpage>
<pub-id pub-id-type="doi">10.1186/1743-422X-8-464</pub-id>
<pub-id pub-id-type="pmid">21978536</pub-id>
</element-citation>
</ref>
<ref id="CR20"><label>20.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Parida</surname>
<given-names>MM</given-names>
</name>
</person-group>
<article-title>Rapid and real-time detection technologies for emerging viruses of biomedical importance</article-title>
<source>J Biosci</source>
<year>2008</year>
<volume>33</volume>
<fpage>617</fpage>
<lpage>628</lpage>
<pub-id pub-id-type="doi">10.1007/s12038-008-0079-7</pub-id>
<pub-id pub-id-type="pmid">19208986</pub-id>
</element-citation>
</ref>
<ref id="CR21"><label>21.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Notomi</surname>
<given-names>T</given-names>
</name>
<name><surname>Okayama</surname>
<given-names>H</given-names>
</name>
<name><surname>Masubuchi</surname>
<given-names>H</given-names>
</name>
<name><surname>Yonekawa</surname>
<given-names>T</given-names>
</name>
<name><surname>Watanabe</surname>
<given-names>K</given-names>
</name>
<name><surname>Amino</surname>
<given-names>N</given-names>
</name>
<name><surname>Hase</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Loop-mediated isothermal amplification of DNA</article-title>
<source>Nucleic Acids Res</source>
<year>2000</year>
<volume>28</volume>
<fpage>E63</fpage>
<pub-id pub-id-type="doi">10.1093/nar/28.12.e63</pub-id>
<pub-id pub-id-type="pmid">10871386</pub-id>
</element-citation>
</ref>
<ref id="CR22"><label>22.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nagamine</surname>
<given-names>K</given-names>
</name>
<name><surname>Hase</surname>
<given-names>T</given-names>
</name>
<name><surname>Notomi</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Accelerated reaction by loop-mediated isothermal amplification using loop primers</article-title>
<source>Mol Cell Probes</source>
<year>2002</year>
<volume>16</volume>
<fpage>223</fpage>
<lpage>229</lpage>
<pub-id pub-id-type="doi">10.1006/mcpr.2002.0415</pub-id>
<pub-id pub-id-type="pmid">12144774</pub-id>
</element-citation>
</ref>
<ref id="CR23"><label>23.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mori</surname>
<given-names>Y</given-names>
</name>
<name><surname>Nagamine</surname>
<given-names>K</given-names>
</name>
<name><surname>Tomita</surname>
<given-names>N</given-names>
</name>
<name><surname>Notomi</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation</article-title>
<source>Biochem Biophys Res Commun</source>
<year>2001</year>
<volume>289</volume>
<fpage>150</fpage>
<lpage>154</lpage>
<pub-id pub-id-type="doi">10.1006/bbrc.2001.5921</pub-id>
<pub-id pub-id-type="pmid">11708792</pub-id>
</element-citation>
</ref>
<ref id="CR24"><label>24.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hong</surname>
<given-names>TC</given-names>
</name>
<name><surname>Mai</surname>
<given-names>QL</given-names>
</name>
<name><surname>Cuong</surname>
<given-names>DV</given-names>
</name>
<name><surname>Parida</surname>
<given-names>M</given-names>
</name>
<name><surname>Minekawa</surname>
<given-names>H</given-names>
</name>
<name><surname>Notomi</surname>
<given-names>T</given-names>
</name>
<name><surname>Hasebe</surname>
<given-names>F</given-names>
</name>
<name><surname>Morita</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Development and evaluation of a novel loop-mediated isothermal amplification method for rapid detection of severe acute respiratory syndrome coronavirus</article-title>
<source>J Clin Microbiol</source>
<year>2004</year>
<volume>42</volume>
<fpage>1956</fpage>
<lpage>1961</lpage>
<pub-id pub-id-type="doi">10.1128/JCM.42.5.1956-1961.2004</pub-id>
<pub-id pub-id-type="pmid">15131154</pub-id>
</element-citation>
</ref>
<ref id="CR25"><label>25.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shirato</surname>
<given-names>K</given-names>
</name>
<name><surname>Nishimura</surname>
<given-names>H</given-names>
</name>
<name><surname>Saijo</surname>
<given-names>M</given-names>
</name>
<name><surname>Okamoto</surname>
<given-names>M</given-names>
</name>
<name><surname>Noda</surname>
<given-names>M</given-names>
</name>
<name><surname>Tashiro</surname>
<given-names>M</given-names>
</name>
<name><surname>Taguchi</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Diagnosis of human respiratory syncytial virus infection using reverse transcription loop-mediated isothermal amplification</article-title>
<source>J Virol Methods</source>
<year>2007</year>
<volume>139</volume>
<fpage>78</fpage>
<lpage>84</lpage>
<pub-id pub-id-type="doi">10.1016/j.jviromet.2006.09.014</pub-id>
<pub-id pub-id-type="pmid">17052763</pub-id>
</element-citation>
</ref>
<ref id="CR26"><label>26.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ushio</surname>
<given-names>M</given-names>
</name>
<name><surname>Yui</surname>
<given-names>I</given-names>
</name>
<name><surname>Yoshida</surname>
<given-names>N</given-names>
</name>
<name><surname>Fujino</surname>
<given-names>M</given-names>
</name>
<name><surname>Yonekawa</surname>
<given-names>T</given-names>
</name>
<name><surname>Ota</surname>
<given-names>Y</given-names>
</name>
<name><surname>Notomi</surname>
<given-names>T</given-names>
</name>
<name><surname>Nakayama</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Detection of respiratory syncytial virus genome by subgroups-A, B specific reverse transcription loop-mediated isothermal amplification (RT-LAMP)</article-title>
<source>J Med Virol</source>
<year>2005</year>
<volume>77</volume>
<fpage>121</fpage>
<lpage>127</lpage>
<pub-id pub-id-type="doi">10.1002/jmv.20424</pub-id>
<pub-id pub-id-type="pmid">16032744</pub-id>
</element-citation>
</ref>
<ref id="CR27"><label>27.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Imai</surname>
<given-names>M</given-names>
</name>
<name><surname>Ninomiya</surname>
<given-names>A</given-names>
</name>
<name><surname>Minekawa</surname>
<given-names>H</given-names>
</name>
<name><surname>Notomi</surname>
<given-names>T</given-names>
</name>
<name><surname>Ishizaki</surname>
<given-names>T</given-names>
</name>
<name><surname>Tashiro</surname>
<given-names>M</given-names>
</name>
<name><surname>Odagiri</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Development of H5-RT-LAMP (loop-mediated isothermal amplification) system for rapid diagnosis of H5 avian influenza virus infection</article-title>
<source>Vaccine</source>
<year>2006</year>
<volume>24</volume>
<fpage>6679</fpage>
<lpage>6682</lpage>
<pub-id pub-id-type="doi">10.1016/j.vaccine.2006.05.046</pub-id>
<pub-id pub-id-type="pmid">16797110</pub-id>
</element-citation>
</ref>
<ref id="CR28"><label>28.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mahony</surname>
<given-names>J</given-names>
</name>
<name><surname>Chong</surname>
<given-names>S</given-names>
</name>
<name><surname>Bulir</surname>
<given-names>D</given-names>
</name>
<name><surname>Ruyter</surname>
<given-names>A</given-names>
</name>
<name><surname>Mwawasi</surname>
<given-names>K</given-names>
</name>
<name><surname>Waltho</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Multiplex loop-mediated isothermal amplification (M-LAMP) assay for the detection of influenza A/H1, A/H3 and influenza B can provide a specimen-to-result diagnosis in 40 min with single genome copy sensitivity</article-title>
<source>J Clin Virol</source>
<year>2013</year>
<volume>58</volume>
<fpage>127</fpage>
<lpage>131</lpage>
<pub-id pub-id-type="doi">10.1016/j.jcv.2013.06.006</pub-id>
<pub-id pub-id-type="pmid">23827787</pub-id>
</element-citation>
</ref>
<ref id="CR29"><label>29.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shirato</surname>
<given-names>K</given-names>
</name>
<name><surname>Kawase</surname>
<given-names>M</given-names>
</name>
<name><surname>Watanabe</surname>
<given-names>O</given-names>
</name>
<name><surname>Hirokawa</surname>
<given-names>C</given-names>
</name>
<name><surname>Matsuyama</surname>
<given-names>S</given-names>
</name>
<name><surname>Nishimura</surname>
<given-names>H</given-names>
</name>
<name><surname>Taguchi</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Differences in neutralizing antigenicity between laboratory and clinical isolates of HCoV-229E isolated in Japan in 2004–2008 depend on the S1 region sequence of the spike protein</article-title>
<source>J Gen Virol</source>
<year>2012</year>
<volume>93</volume>
<fpage>1908</fpage>
<lpage>1917</lpage>
<pub-id pub-id-type="doi">10.1099/vir.0.043117-0</pub-id>
<pub-id pub-id-type="pmid">22673931</pub-id>
</element-citation>
</ref>
<ref id="CR30"><label>30.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shirogane</surname>
<given-names>Y</given-names>
</name>
<name><surname>Takeda</surname>
<given-names>M</given-names>
</name>
<name><surname>Iwasaki</surname>
<given-names>M</given-names>
</name>
<name><surname>Ishiguro</surname>
<given-names>N</given-names>
</name>
<name><surname>Takeuchi</surname>
<given-names>H</given-names>
</name>
<name><surname>Nakatsu</surname>
<given-names>Y</given-names>
</name>
<name><surname>Tahara</surname>
<given-names>M</given-names>
</name>
<name><surname>Kikuta</surname>
<given-names>H</given-names>
</name>
<name><surname>Yanagi</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Efficient multiplication of human metapneumovirus in Vero cells expressing the transmembrane serine protease TMPRSS2</article-title>
<source>J Virol</source>
<year>2008</year>
<volume>82</volume>
<fpage>8942</fpage>
<lpage>8946</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.00676-08</pub-id>
<pub-id pub-id-type="pmid">18562527</pub-id>
</element-citation>
</ref>
<ref id="CR31"><label>31.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gierer</surname>
<given-names>S</given-names>
</name>
<name><surname>Bertram</surname>
<given-names>S</given-names>
</name>
<name><surname>Kaup</surname>
<given-names>F</given-names>
</name>
<name><surname>Wrensch</surname>
<given-names>F</given-names>
</name>
<name><surname>Heurich</surname>
<given-names>A</given-names>
</name>
<name><surname>Kramer-Kuhl</surname>
<given-names>A</given-names>
</name>
<name><surname>Welsch</surname>
<given-names>K</given-names>
</name>
<name><surname>Winkler</surname>
<given-names>M</given-names>
</name>
<name><surname>Meyer</surname>
<given-names>B</given-names>
</name>
<name><surname>Drosten</surname>
<given-names>C</given-names>
</name>
<name><surname>Dittmer</surname>
<given-names>U</given-names>
</name>
<name><surname>von Hahn</surname>
<given-names>T</given-names>
</name>
<name><surname>Simmons</surname>
<given-names>G</given-names>
</name>
<name><surname>Hofmann</surname>
<given-names>H</given-names>
</name>
<name><surname>Pohlmann</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>The spike protein of the emerging betacoronavirus EMC uses a novel coronavirus receptor for entry, can be activated by TMPRSS2, and is targeted by neutralizing antibodies</article-title>
<source>J Virol</source>
<year>2013</year>
<volume>87</volume>
<fpage>5502</fpage>
<lpage>5511</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.00128-13</pub-id>
<pub-id pub-id-type="pmid">23468491</pub-id>
</element-citation>
</ref>
<ref id="CR32"><label>32.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shirato</surname>
<given-names>K</given-names>
</name>
<name><surname>Kawase</surname>
<given-names>M</given-names>
</name>
<name><surname>Matsuyama</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Middle East respiratory syndrome coronavirus infection mediated by the transmembrane serine protease TMPRSS2</article-title>
<source>J Virol</source>
<year>2013</year>
<volume>87</volume>
<fpage>12552</fpage>
<lpage>12561</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.01890-13</pub-id>
<pub-id pub-id-type="pmid">24027332</pub-id>
</element-citation>
</ref>
<ref id="CR33"><label>33.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ueda</surname>
<given-names>S</given-names>
</name>
<name><surname>Kuwabara</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>The rapid detection of Salmonella from food samples by loop-mediated isothermal amplification (LAMP)</article-title>
<source>Biocontrol Sci</source>
<year>2009</year>
<volume>14</volume>
<fpage>73</fpage>
<lpage>76</lpage>
<pub-id pub-id-type="doi">10.4265/bio.14.73</pub-id>
<pub-id pub-id-type="pmid">19579659</pub-id>
</element-citation>
</ref>
<ref id="CR34"><label>34.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Geojith</surname>
<given-names>G</given-names>
</name>
<name><surname>Dhanasekaran</surname>
<given-names>S</given-names>
</name>
<name><surname>Chandran</surname>
<given-names>SP</given-names>
</name>
<name><surname>Kenneth</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Efficacy of loop mediated isothermal amplification (LAMP) assay for the laboratory identification of Mycobacterium tuberculosis isolates in a resource limited setting</article-title>
<source>J Microbiol Methods</source>
<year>2011</year>
<volume>84</volume>
<fpage>71</fpage>
<lpage>73</lpage>
<pub-id pub-id-type="doi">10.1016/j.mimet.2010.10.015</pub-id>
<pub-id pub-id-type="pmid">21047534</pub-id>
</element-citation>
</ref>
<ref id="CR35"><label>35.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gotoh</surname>
<given-names>K</given-names>
</name>
<name><surname>Nishimura</surname>
<given-names>N</given-names>
</name>
<name><surname>Ohshima</surname>
<given-names>Y</given-names>
</name>
<name><surname>Arakawa</surname>
<given-names>Y</given-names>
</name>
<name><surname>Hosono</surname>
<given-names>H</given-names>
</name>
<name><surname>Yamamoto</surname>
<given-names>Y</given-names>
</name>
<name><surname>Iwata</surname>
<given-names>Y</given-names>
</name>
<name><surname>Nakane</surname>
<given-names>K</given-names>
</name>
<name><surname>Funahashi</surname>
<given-names>K</given-names>
</name>
<name><surname>Ozaki</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Detection of Mycoplasma pneumoniae by loop-mediated isothermal amplification (LAMP) assay and serology in pediatric community-acquired pneumonia</article-title>
<source>J Infect Chemother</source>
<year>2012</year>
<volume>18</volume>
<fpage>662</fpage>
<lpage>667</lpage>
<pub-id pub-id-type="doi">10.1007/s10156-012-0388-5</pub-id>
<pub-id pub-id-type="pmid">22370920</pub-id>
</element-citation>
</ref>
<ref id="CR36"><label>36.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Plutzer</surname>
<given-names>J</given-names>
</name>
<name><surname>Karanis</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Rapid identification of Giardia duodenalis by loop-mediated isothermal amplification (LAMP) from faecal and environmental samples and comparative findings by PCR and real-time PCR methods</article-title>
<source>Parasitol Res</source>
<year>2009</year>
<volume>104</volume>
<fpage>1527</fpage>
<lpage>1533</lpage>
<pub-id pub-id-type="doi">10.1007/s00436-009-1391-3</pub-id>
<pub-id pub-id-type="pmid">19288133</pub-id>
</element-citation>
</ref>
<ref id="CR37"><label>37.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>He</surname>
<given-names>L</given-names>
</name>
<name><surname>Zhou</surname>
<given-names>YQ</given-names>
</name>
<name><surname>Oosthuizen</surname>
<given-names>MC</given-names>
</name>
<name><surname>Zhao</surname>
<given-names>JL</given-names>
</name>
</person-group>
<article-title>Loop-mediated isothermal amplification (LAMP) detection of Babesia orientalis in water buffalo (Bubalus babalis, Linnaeus, 1758) in China</article-title>
<source>Vet Parasitol</source>
<year>2009</year>
<volume>165</volume>
<fpage>36</fpage>
<lpage>40</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2009.06.036</pub-id>
<pub-id pub-id-type="pmid">19665847</pub-id>
</element-citation>
</ref>
<ref id="CR38"><label>38.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname>
<given-names>LX</given-names>
</name>
<name><surname>He</surname>
<given-names>L</given-names>
</name>
<name><surname>Fang</surname>
<given-names>R</given-names>
</name>
<name><surname>Song</surname>
<given-names>QQ</given-names>
</name>
<name><surname>Tu</surname>
<given-names>P</given-names>
</name>
<name><surname>Jenkins</surname>
<given-names>A</given-names>
</name>
<name><surname>Zhou</surname>
<given-names>YQ</given-names>
</name>
<name><surname>Zhao</surname>
<given-names>JL</given-names>
</name>
</person-group>
<article-title>Loop-mediated isothermal amplification (LAMP) assay for detection of Theileria sergenti infection targeting the p33 gene</article-title>
<source>Vet Parasitol</source>
<year>2010</year>
<volume>171</volume>
<fpage>159</fpage>
<lpage>162</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2010.02.046</pub-id>
<pub-id pub-id-type="pmid">20334978</pub-id>
</element-citation>
</ref>
<ref id="CR39"><label>39.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nakao</surname>
<given-names>R</given-names>
</name>
<name><surname>Stromdahl</surname>
<given-names>EY</given-names>
</name>
<name><surname>Magona</surname>
<given-names>JW</given-names>
</name>
<name><surname>Faburay</surname>
<given-names>B</given-names>
</name>
<name><surname>Namangala</surname>
<given-names>B</given-names>
</name>
<name><surname>Malele</surname>
<given-names>I</given-names>
</name>
<name><surname>Inoue</surname>
<given-names>N</given-names>
</name>
<name><surname>Geysen</surname>
<given-names>D</given-names>
</name>
<name><surname>Kajino</surname>
<given-names>K</given-names>
</name>
<name><surname>Jongejan</surname>
<given-names>F</given-names>
</name>
<name><surname>Sugimoto</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Development of loop-mediated isothermal amplification (LAMP) assays for rapid detection of Ehrlichia ruminantium</article-title>
<source>BMC Microbiol</source>
<year>2010</year>
<volume>10</volume>
<fpage>296</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2180-10-296</pub-id>
<pub-id pub-id-type="pmid">21087521</pub-id>
</element-citation>
</ref>
<ref id="CR40"><label>40.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Arimatsu</surname>
<given-names>Y</given-names>
</name>
<name><surname>Kaewkes</surname>
<given-names>S</given-names>
</name>
<name><surname>Laha</surname>
<given-names>T</given-names>
</name>
<name><surname>Hong</surname>
<given-names>SJ</given-names>
</name>
<name><surname>Sripa</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>Rapid detection of Opisthorchis viverrini copro-DNA using loop-mediated isothermal amplification (LAMP)</article-title>
<source>Parasitol Int</source>
<year>2012</year>
<volume>61</volume>
<fpage>178</fpage>
<lpage>182</lpage>
<pub-id pub-id-type="doi">10.1016/j.parint.2011.08.009</pub-id>
<pub-id pub-id-type="pmid">21871581</pub-id>
</element-citation>
</ref>
<ref id="CR41"><label>41.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cotten</surname>
<given-names>M</given-names>
</name>
<name><surname>Watson</surname>
<given-names>SJ</given-names>
</name>
<name><surname>Zumla</surname>
<given-names>AI</given-names>
</name>
<name><surname>Makhdoom</surname>
<given-names>HQ</given-names>
</name>
<name><surname>Palser</surname>
<given-names>AL</given-names>
</name>
<name><surname>Ong</surname>
<given-names>SH</given-names>
</name>
<name><surname>Al Rabeeah</surname>
<given-names>AA</given-names>
</name>
<name><surname>Alhakeem</surname>
<given-names>RF</given-names>
</name>
<name><surname>Assiri</surname>
<given-names>A</given-names>
</name>
<name><surname>Al-Tawfiq</surname>
<given-names>JA</given-names>
</name>
<name><surname>Albarrak</surname>
<given-names>A</given-names>
</name>
<name><surname>Barry</surname>
<given-names>M</given-names>
</name>
<name><surname>Shibl</surname>
<given-names>A</given-names>
</name>
<name><surname>Alrabiah</surname>
<given-names>FA</given-names>
</name>
<name><surname>Hajjar</surname>
<given-names>S</given-names>
</name>
<name><surname>Balkhy</surname>
<given-names>HH</given-names>
</name>
<name><surname>Flemban</surname>
<given-names>H</given-names>
</name>
<name><surname>Rambaut</surname>
<given-names>A</given-names>
</name>
<name><surname>Kellam</surname>
<given-names>P</given-names>
</name>
<name><surname>Memish</surname>
<given-names>ZA</given-names>
</name>
</person-group>
<article-title>Spread, circulation, and evolution of the Middle East respiratory syndrome coronavirus</article-title>
<source>MBio</source>
<year>2014</year>
<volume>5</volume>
<fpage>e01062-01013</fpage>
<pub-id pub-id-type="doi">10.1128/mBio.01062-13</pub-id>
<pub-id pub-id-type="pmid">24549846</pub-id>
</element-citation>
</ref>
<ref id="CR42"><label>42.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Azhar</surname>
<given-names>EI</given-names>
</name>
<name><surname>El-Kafrawy</surname>
<given-names>SA</given-names>
</name>
<name><surname>Farraj</surname>
<given-names>SA</given-names>
</name>
<name><surname>Hassan</surname>
<given-names>AM</given-names>
</name>
<name><surname>Al-Saeed</surname>
<given-names>MS</given-names>
</name>
<name><surname>Hashem</surname>
<given-names>AM</given-names>
</name>
<name><surname>Madani</surname>
<given-names>TA</given-names>
</name>
</person-group>
<article-title>Evidence for camel-to-human transmission of MERS coronavirus</article-title>
<source>N Engl J Med</source>
<year>2014</year>
<volume>370</volume>
<fpage>2499</fpage>
<lpage>2505</lpage>
<pub-id pub-id-type="doi">10.1056/NEJMoa1401505</pub-id>
<pub-id pub-id-type="pmid">24896817</pub-id>
</element-citation>
</ref>
<ref id="CR43"><label>43.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Memish</surname>
<given-names>ZA</given-names>
</name>
<name><surname>Cotten</surname>
<given-names>M</given-names>
</name>
<name><surname>Meyer</surname>
<given-names>B</given-names>
</name>
<name><surname>Watson</surname>
<given-names>SJ</given-names>
</name>
<name><surname>Alsahafi</surname>
<given-names>AJ</given-names>
</name>
<name><surname>Al Rabeeah</surname>
<given-names>AA</given-names>
</name>
<name><surname>Corman</surname>
<given-names>VM</given-names>
</name>
<name><surname>Sieberg</surname>
<given-names>A</given-names>
</name>
<name><surname>Makhdoom</surname>
<given-names>HQ</given-names>
</name>
<name><surname>Assiri</surname>
<given-names>A</given-names>
</name>
<name><surname>Al Masri</surname>
<given-names>M</given-names>
</name>
<name><surname>Aldabbagh</surname>
<given-names>S</given-names>
</name>
<name><surname>Bosch</surname>
<given-names>BJ</given-names>
</name>
<name><surname>Beer</surname>
<given-names>M</given-names>
</name>
<name><surname>Muller</surname>
<given-names>MA</given-names>
</name>
<name><surname>Kellam</surname>
<given-names>P</given-names>
</name>
<name><surname>Drosten</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Human infection with MERS coronavirus after exposure to infected camels, Saudi Arabia, 2013</article-title>
<source>Emerg Infect Dis</source>
<year>2014</year>
<volume>20</volume>
<fpage>1012</fpage>
<lpage>1015</lpage>
<pub-id pub-id-type="doi">10.3201/eid2006.140402</pub-id>
<pub-id pub-id-type="pmid">24857749</pub-id>
</element-citation>
</ref>
<ref id="CR44"><label>44.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Drosten</surname>
<given-names>C</given-names>
</name>
<name><surname>Seilmaier</surname>
<given-names>M</given-names>
</name>
<name><surname>Corman</surname>
<given-names>VM</given-names>
</name>
<name><surname>Hartmann</surname>
<given-names>W</given-names>
</name>
<name><surname>Scheible</surname>
<given-names>G</given-names>
</name>
<name><surname>Sack</surname>
<given-names>S</given-names>
</name>
<name><surname>Guggemos</surname>
<given-names>W</given-names>
</name>
<name><surname>Kallies</surname>
<given-names>R</given-names>
</name>
<name><surname>Muth</surname>
<given-names>D</given-names>
</name>
<name><surname>Junglen</surname>
<given-names>S</given-names>
</name>
<name><surname>Muller</surname>
<given-names>MA</given-names>
</name>
<name><surname>Haas</surname>
<given-names>W</given-names>
</name>
<name><surname>Guberina</surname>
<given-names>H</given-names>
</name>
<name><surname>Rohnisch</surname>
<given-names>T</given-names>
</name>
<name><surname>Schmid-Wendtner</surname>
<given-names>M</given-names>
</name>
<name><surname>Aldabbagh</surname>
<given-names>S</given-names>
</name>
<name><surname>Dittmer</surname>
<given-names>U</given-names>
</name>
<name><surname>Gold</surname>
<given-names>H</given-names>
</name>
<name><surname>Graf</surname>
<given-names>P</given-names>
</name>
<name><surname>Bonin</surname>
<given-names>F</given-names>
</name>
<name><surname>Rambaut</surname>
<given-names>A</given-names>
</name>
<name><surname>Wendtner</surname>
<given-names>CM</given-names>
</name>
</person-group>
<article-title>Clinical features and virological analysis of a case of Middle East respiratory syndrome coronavirus infection</article-title>
<source>Lancet Infect Dis</source>
<year>2013</year>
<volume>13</volume>
<fpage>745</fpage>
<lpage>751</lpage>
<pub-id pub-id-type="doi">10.1016/S1473-3099(13)70154-3</pub-id>
<pub-id pub-id-type="pmid">23782859</pub-id>
</element-citation>
</ref>
<ref id="CR45"><label>45.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Baric</surname>
<given-names>RS</given-names>
</name>
<name><surname>Stohlman</surname>
<given-names>SA</given-names>
</name>
<name><surname>Lai</surname>
<given-names>MM</given-names>
</name>
</person-group>
<article-title>Characterization of replicative intermediate RNA of mouse hepatitis virus: presence of leader RNA sequences on nascent chains</article-title>
<source>J Virol</source>
<year>1983</year>
<volume>48</volume>
<fpage>633</fpage>
<lpage>640</lpage>
<pub-id pub-id-type="pmid">6313963</pub-id>
</element-citation>
</ref>
<ref id="CR46"><label>46.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lai</surname>
<given-names>MM</given-names>
</name>
<name><surname>Patton</surname>
<given-names>CD</given-names>
</name>
<name><surname>Baric</surname>
<given-names>RS</given-names>
</name>
<name><surname>Stohlman</surname>
<given-names>SA</given-names>
</name>
</person-group>
<article-title>Presence of leader sequences in the mRNA of mouse hepatitis virus</article-title>
<source>J Virol</source>
<year>1983</year>
<volume>46</volume>
<fpage>1027</fpage>
<lpage>1033</lpage>
<pub-id pub-id-type="pmid">6304334</pub-id>
</element-citation>
</ref>
<ref id="CR47"><label>47.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Spaan</surname>
<given-names>WJ</given-names>
</name>
<name><surname>Rottier</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Horzinek</surname>
<given-names>MC</given-names>
</name>
<name><surname>van der Zeijst</surname>
<given-names>BA</given-names>
</name>
</person-group>
<article-title>Sequence relationships between the genome and the intracellular RNA species 1, 3, 6, and 7 of mouse hepatitis virus strain A59</article-title>
<source>J Virol</source>
<year>1982</year>
<volume>42</volume>
<fpage>432</fpage>
<lpage>439</lpage>
<pub-id pub-id-type="pmid">6283166</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Sante/explor/MersV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000474 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000474 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Sante |area= MersV1 |flux= Pmc |étape= Corpus |type= RBID |clé= |texte= }}
This area was generated with Dilib version V0.6.33. |