Serveur d'exploration MERS

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 000388 ( Pmc/Corpus ); précédent : 0003879; suivant : 0003890 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus</title>
<author>
<name sortKey="Hsin, Wei Chen" sort="Hsin, Wei Chen" uniqKey="Hsin W" first="Wei-Chen" last="Hsin">Wei-Chen Hsin</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Microbiology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Chan Hua" sort="Chang, Chan Hua" uniqKey="Chang C" first="Chan-Hua" last="Chang">Chan-Hua Chang</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Microbiology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Chi You" sort="Chang, Chi You" uniqKey="Chang C" first="Chi-You" last="Chang">Chi-You Chang</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Microbiology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Peng, Wei Hao" sort="Peng, Wei Hao" uniqKey="Peng W" first="Wei-Hao" last="Peng">Wei-Hao Peng</name>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Anatomy and Cell Biology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chien, Chung Liang" sort="Chien, Chung Liang" uniqKey="Chien C" first="Chung-Liang" last="Chien">Chung-Liang Chien</name>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Anatomy and Cell Biology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Ming Fu" sort="Chang, Ming Fu" uniqKey="Chang M" first="Ming-Fu" last="Chang">Ming-Fu Chang</name>
<affiliation>
<nlm:aff id="Aff3">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Biochemistry and Molecular Biology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Shin C" sort="Chang, Shin C" uniqKey="Chang S" first="Shin C." last="Chang">Shin C. Chang</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Microbiology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">29793506</idno>
<idno type="pmc">5966903</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5966903</idno>
<idno type="RBID">PMC:5966903</idno>
<idno type="doi">10.1186/s12929-018-0449-x</idno>
<date when="2018">2018</date>
<idno type="wicri:Area/Pmc/Corpus">000388</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000388</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus</title>
<author>
<name sortKey="Hsin, Wei Chen" sort="Hsin, Wei Chen" uniqKey="Hsin W" first="Wei-Chen" last="Hsin">Wei-Chen Hsin</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Microbiology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Chan Hua" sort="Chang, Chan Hua" uniqKey="Chang C" first="Chan-Hua" last="Chang">Chan-Hua Chang</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Microbiology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Chi You" sort="Chang, Chi You" uniqKey="Chang C" first="Chi-You" last="Chang">Chi-You Chang</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Microbiology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Peng, Wei Hao" sort="Peng, Wei Hao" uniqKey="Peng W" first="Wei-Hao" last="Peng">Wei-Hao Peng</name>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Anatomy and Cell Biology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chien, Chung Liang" sort="Chien, Chung Liang" uniqKey="Chien C" first="Chung-Liang" last="Chien">Chung-Liang Chien</name>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Anatomy and Cell Biology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Ming Fu" sort="Chang, Ming Fu" uniqKey="Chang M" first="Ming-Fu" last="Chang">Ming-Fu Chang</name>
<affiliation>
<nlm:aff id="Aff3">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Biochemistry and Molecular Biology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Shin C" sort="Chang, Shin C" uniqKey="Chang S" first="Shin C." last="Chang">Shin C. Chang</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Microbiology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Journal of Biomedical Science</title>
<idno type="ISSN">1021-7770</idno>
<idno type="eISSN">1423-0127</idno>
<imprint>
<date when="2018">2018</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p id="Par1">Middle East respiratory syndrome coronavirus (MERS-CoV) consists of a positive-sense, single-stranded RNA genome and four structural proteins: the spike, envelope, membrane, and nucleocapsid protein. The assembly of the viral genome into virus particles involves viral structural proteins and is believed to be mediated through recognition of specific sequences and RNA structures of the viral genome.</p>
</sec>
<sec>
<title>Methods and Results</title>
<p id="Par2">A culture system for the production of MERS coronavirus-like particles (MERS VLPs) was determined and established by electron microscopy and the detection of coexpressed viral structural proteins. Using the VLP system, a 258-nucleotide RNA fragment, which spans nucleotides 19,712 to 19,969 of the MERS-CoV genome (designated PS258(19712–19969)
<sub>ME</sub>
), was identified to function as a packaging signal. Assembly of the RNA packaging signal into MERS VLPs is dependent on the viral nucleocapsid protein. In addition, a 45-nucleotide stable stem-loop substructure of the PS258(19712–19969)
<sub>ME</sub>
interacted with both the N-terminal domain and the C-terminal domain of the viral nucleocapsid protein. Furthermore, a functional SARS-CoV RNA packaging signal failed to assemble into the MERS VLPs, which indicated virus-specific assembly of the RNA genome.</p>
</sec>
<sec>
<title>Conclusions</title>
<p id="Par3">A MERS-oV RNA packaging signal was identified by the detection of GFP expression following an incubation of MERS VLPs carrying the heterologous mRNA GFP-PS258(19712–19969)
<sub>ME</sub>
with virus permissive Huh7 cells. The MERS VLP system could help us in understanding virus infection and morphogenesis.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Zaki, Am" uniqKey="Zaki A">AM Zaki</name>
</author>
<author>
<name sortKey="Van Boheemen, S" uniqKey="Van Boheemen S">S van Boheemen</name>
</author>
<author>
<name sortKey="Bestebroer, Tm" uniqKey="Bestebroer T">TM Bestebroer</name>
</author>
<author>
<name sortKey="Osterhaus, Ad" uniqKey="Osterhaus A">AD Osterhaus</name>
</author>
<author>
<name sortKey="Fouchier, Ra" uniqKey="Fouchier R">RA Fouchier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Raj, Vs" uniqKey="Raj V">VS Raj</name>
</author>
<author>
<name sortKey="Mou, H" uniqKey="Mou H">H Mou</name>
</author>
<author>
<name sortKey="Smits, Sl" uniqKey="Smits S">SL Smits</name>
</author>
<author>
<name sortKey="Dekkers, Dh" uniqKey="Dekkers D">DH Dekkers</name>
</author>
<author>
<name sortKey="Muller, Ma" uniqKey="Muller M">MA Muller</name>
</author>
<author>
<name sortKey="Dijkman, R" uniqKey="Dijkman R">R Dijkman</name>
</author>
<author>
<name sortKey="Muth, D" uniqKey="Muth D">D Muth</name>
</author>
<author>
<name sortKey="Demmers, Ja" uniqKey="Demmers J">JA Demmers</name>
</author>
<author>
<name sortKey="Zaki, A" uniqKey="Zaki A">A Zaki</name>
</author>
<author>
<name sortKey="Fouchier, Ra" uniqKey="Fouchier R">RA Fouchier</name>
</author>
<author>
<name sortKey="Thiel, V" uniqKey="Thiel V">V Thiel</name>
</author>
<author>
<name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
<author>
<name sortKey="Rottier, Pj" uniqKey="Rottier P">PJ Rottier</name>
</author>
<author>
<name sortKey="Osterhaus, Ad" uniqKey="Osterhaus A">AD Osterhaus</name>
</author>
<author>
<name sortKey="Bosch, Bj" uniqKey="Bosch B">BJ Bosch</name>
</author>
<author>
<name sortKey="Haagmans, Bl" uniqKey="Haagmans B">BL Haagmans</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lu, G" uniqKey="Lu G">G Lu</name>
</author>
<author>
<name sortKey="Hu, Y" uniqKey="Hu Y">Y Hu</name>
</author>
<author>
<name sortKey="Wang, Q" uniqKey="Wang Q">Q Wang</name>
</author>
<author>
<name sortKey="Qi, J" uniqKey="Qi J">J Qi</name>
</author>
<author>
<name sortKey="Gao, F" uniqKey="Gao F">F Gao</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author>
<name sortKey="Zhang, W" uniqKey="Zhang W">W Zhang</name>
</author>
<author>
<name sortKey="Yuan, Y" uniqKey="Yuan Y">Y Yuan</name>
</author>
<author>
<name sortKey="Bao, J" uniqKey="Bao J">J Bao</name>
</author>
<author>
<name sortKey="Zhang, B" uniqKey="Zhang B">B Zhang</name>
</author>
<author>
<name sortKey="Shi, Y" uniqKey="Shi Y">Y Shi</name>
</author>
<author>
<name sortKey="Yan, J" uniqKey="Yan J">J Yan</name>
</author>
<author>
<name sortKey="Gao, Gf" uniqKey="Gao G">GF Gao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pasternak, Ao" uniqKey="Pasternak A">AO Pasternak</name>
</author>
<author>
<name sortKey="Spaan, Wj" uniqKey="Spaan W">WJ Spaan</name>
</author>
<author>
<name sortKey="Snijder, Ej" uniqKey="Snijder E">EJ Snijder</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stadler, K" uniqKey="Stadler K">K Stadler</name>
</author>
<author>
<name sortKey="Masignani, V" uniqKey="Masignani V">V Masignani</name>
</author>
<author>
<name sortKey="Eickmann, M" uniqKey="Eickmann M">M Eickmann</name>
</author>
<author>
<name sortKey="Becker, S" uniqKey="Becker S">S Becker</name>
</author>
<author>
<name sortKey="Abrignani, S" uniqKey="Abrignani S">S Abrignani</name>
</author>
<author>
<name sortKey="Klenk, Hd" uniqKey="Klenk H">HD Klenk</name>
</author>
<author>
<name sortKey="Rappuoli, R" uniqKey="Rappuoli R">R Rappuoli</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dires, B" uniqKey="Dires B">B Dires</name>
</author>
<author>
<name sortKey="Dawo, F" uniqKey="Dawo F">F Dawo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Boscarino, J" uniqKey="Boscarino J">J Boscarino</name>
</author>
<author>
<name sortKey="Logan, H" uniqKey="Logan H">H Logan</name>
</author>
<author>
<name sortKey="Lacny, J" uniqKey="Lacny J">J Lacny</name>
</author>
<author>
<name sortKey="Gallagher, T" uniqKey="Gallagher T">T Gallagher</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="De Haan, Ca" uniqKey="De Haan C">CA de Haan</name>
</author>
<author>
<name sortKey="Vennema, H" uniqKey="Vennema H">H Vennema</name>
</author>
<author>
<name sortKey="Rottier, Pj" uniqKey="Rottier P">PJ Rottier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vennema, H" uniqKey="Vennema H">H Vennema</name>
</author>
<author>
<name sortKey="Godeke, Gj" uniqKey="Godeke G">GJ Godeke</name>
</author>
<author>
<name sortKey="Rossen, Jw" uniqKey="Rossen J">JW Rossen</name>
</author>
<author>
<name sortKey="Voorhout, Wf" uniqKey="Voorhout W">WF Voorhout</name>
</author>
<author>
<name sortKey="Horzinek, Mc" uniqKey="Horzinek M">MC Horzinek</name>
</author>
<author>
<name sortKey="Opstelten, Dj" uniqKey="Opstelten D">DJ Opstelten</name>
</author>
<author>
<name sortKey="Rottier, Pj" uniqKey="Rottier P">PJ Rottier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chang, Ck" uniqKey="Chang C">CK Chang</name>
</author>
<author>
<name sortKey="Lo, Sc" uniqKey="Lo S">SC Lo</name>
</author>
<author>
<name sortKey="Wang, Ys" uniqKey="Wang Y">YS Wang</name>
</author>
<author>
<name sortKey="Hou, Mh" uniqKey="Hou M">MH Hou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kuo, L" uniqKey="Kuo L">L Kuo</name>
</author>
<author>
<name sortKey="Koetzner, Ca" uniqKey="Koetzner C">CA Koetzner</name>
</author>
<author>
<name sortKey="Hurst, Kr" uniqKey="Hurst K">KR Hurst</name>
</author>
<author>
<name sortKey="Masters, Ps" uniqKey="Masters P">PS Masters</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Molenkamp, R" uniqKey="Molenkamp R">R Molenkamp</name>
</author>
<author>
<name sortKey="Spaan, Wjm" uniqKey="Spaan W">WJM Spaan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fosmire, Ja" uniqKey="Fosmire J">JA Fosmire</name>
</author>
<author>
<name sortKey="Hwang, K" uniqKey="Hwang K">K Hwang</name>
</author>
<author>
<name sortKey="Makino, S" uniqKey="Makino S">S Makino</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kuo, L" uniqKey="Kuo L">L Kuo</name>
</author>
<author>
<name sortKey="Masters, Ps" uniqKey="Masters P">PS Masters</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Woo, K" uniqKey="Woo K">K Woo</name>
</author>
<author>
<name sortKey="Joo, M" uniqKey="Joo M">M Joo</name>
</author>
<author>
<name sortKey="Narayanan, K" uniqKey="Narayanan K">K Narayanan</name>
</author>
<author>
<name sortKey="Kim, Kh" uniqKey="Kim K">KH Kim</name>
</author>
<author>
<name sortKey="Makino, S" uniqKey="Makino S">S Makino</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cologna, R" uniqKey="Cologna R">R Cologna</name>
</author>
<author>
<name sortKey="Hogue, Bg" uniqKey="Hogue B">BG Hogue</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, Sc" uniqKey="Chen S">SC Chen</name>
</author>
<author>
<name sortKey="Van Den Born, E" uniqKey="Van Den Born E">E van den Born</name>
</author>
<author>
<name sortKey="Van Den Worm, Sh" uniqKey="Van Den Worm S">SH van den Worm</name>
</author>
<author>
<name sortKey="Pleij, Cw" uniqKey="Pleij C">CW Pleij</name>
</author>
<author>
<name sortKey="Snijder, Ej" uniqKey="Snijder E">EJ Snijder</name>
</author>
<author>
<name sortKey="Olsthoorn, Rc" uniqKey="Olsthoorn R">RC Olsthoorn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, Sc" uniqKey="Chen S">SC Chen</name>
</author>
<author>
<name sortKey="Olsthoorn, Rc" uniqKey="Olsthoorn R">RC Olsthoorn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hsieh, Pk" uniqKey="Hsieh P">PK Hsieh</name>
</author>
<author>
<name sortKey="Chang, Sc" uniqKey="Chang S">SC Chang</name>
</author>
<author>
<name sortKey="Huang, Cc" uniqKey="Huang C">CC Huang</name>
</author>
<author>
<name sortKey="Lee, Tt" uniqKey="Lee T">TT Lee</name>
</author>
<author>
<name sortKey="Hsiao, Cw" uniqKey="Hsiao C">CW Hsiao</name>
</author>
<author>
<name sortKey="Kou, Yh" uniqKey="Kou Y">YH Kou</name>
</author>
<author>
<name sortKey="Chen, Iy" uniqKey="Chen I">IY Chen</name>
</author>
<author>
<name sortKey="Chang, Ck" uniqKey="Chang C">CK Chang</name>
</author>
<author>
<name sortKey="Huang, Th" uniqKey="Huang T">TH Huang</name>
</author>
<author>
<name sortKey="Chang, Mf" uniqKey="Chang M">MF Chang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Escors, D" uniqKey="Escors D">D Escors</name>
</author>
<author>
<name sortKey="Izeta, A" uniqKey="Izeta A">A Izeta</name>
</author>
<author>
<name sortKey="Capiscol, C" uniqKey="Capiscol C">C Capiscol</name>
</author>
<author>
<name sortKey="Enjuanes, L" uniqKey="Enjuanes L">L Enjuanes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Morales, L" uniqKey="Morales L">L Morales</name>
</author>
<author>
<name sortKey="Mateos Gomez, Pa" uniqKey="Mateos Gomez P">PA Mateos-Gomez</name>
</author>
<author>
<name sortKey="Capiscol, C" uniqKey="Capiscol C">C Capiscol</name>
</author>
<author>
<name sortKey="Del Palacio, L" uniqKey="Del Palacio L">L del Palacio</name>
</author>
<author>
<name sortKey="Enjuanes, L" uniqKey="Enjuanes L">L Enjuanes</name>
</author>
<author>
<name sortKey="Sola, I" uniqKey="Sola I">I Sola</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Penzes, Z" uniqKey="Penzes Z">Z Penzes</name>
</author>
<author>
<name sortKey="Tibbles, K" uniqKey="Tibbles K">K Tibbles</name>
</author>
<author>
<name sortKey="Shaw, K" uniqKey="Shaw K">K Shaw</name>
</author>
<author>
<name sortKey="Britton, P" uniqKey="Britton P">P Britton</name>
</author>
<author>
<name sortKey="Brown, Td" uniqKey="Brown T">TD Brown</name>
</author>
<author>
<name sortKey="Cavanagh, D" uniqKey="Cavanagh D">D Cavanagh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dalton, K" uniqKey="Dalton K">K Dalton</name>
</author>
<author>
<name sortKey="Casais, R" uniqKey="Casais R">R Casais</name>
</author>
<author>
<name sortKey="Shaw, K" uniqKey="Shaw K">K Shaw</name>
</author>
<author>
<name sortKey="Stirrups, K" uniqKey="Stirrups K">K Stirrups</name>
</author>
<author>
<name sortKey="Evans, S" uniqKey="Evans S">S Evans</name>
</author>
<author>
<name sortKey="Britton, P" uniqKey="Britton P">P Britton</name>
</author>
<author>
<name sortKey="Brown, Td" uniqKey="Brown T">TD Brown</name>
</author>
<author>
<name sortKey="Cavanagh, D" uniqKey="Cavanagh D">D Cavanagh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Narayanan, K" uniqKey="Narayanan K">K Narayanan</name>
</author>
<author>
<name sortKey="Chen, Cj" uniqKey="Chen C">CJ Chen</name>
</author>
<author>
<name sortKey="Maeda, J" uniqKey="Maeda J">J Maeda</name>
</author>
<author>
<name sortKey="Makino, S" uniqKey="Makino S">S Makino</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Narayanan, K" uniqKey="Narayanan K">K Narayanan</name>
</author>
<author>
<name sortKey="Makino, S" uniqKey="Makino S">S Makino</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kuo, L" uniqKey="Kuo L">L Kuo</name>
</author>
<author>
<name sortKey="Koetzner, C" uniqKey="Koetzner C">C Koetzner</name>
</author>
<author>
<name sortKey="Masters, Ps" uniqKey="Masters P">PS Masters</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chang, Mf" uniqKey="Chang M">MF Chang</name>
</author>
<author>
<name sortKey="Sun, Cy" uniqKey="Sun C">CY Sun</name>
</author>
<author>
<name sortKey="Chen, Cj" uniqKey="Chen C">CJ Chen</name>
</author>
<author>
<name sortKey="Chang, Sc" uniqKey="Chang S">SC Chang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chang, Ck" uniqKey="Chang C">CK Chang</name>
</author>
<author>
<name sortKey="Hou, Mh" uniqKey="Hou M">MH Hou</name>
</author>
<author>
<name sortKey="Chang, Cf" uniqKey="Chang C">CF Chang</name>
</author>
<author>
<name sortKey="Hsiao, Cd" uniqKey="Hsiao C">CD Hsiao</name>
</author>
<author>
<name sortKey="Huang, Th" uniqKey="Huang T">TH Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Papageorgiou, N" uniqKey="Papageorgiou N">N Papageorgiou</name>
</author>
<author>
<name sortKey="Lichiere, J" uniqKey="Lichiere J">J Lichière</name>
</author>
<author>
<name sortKey="Baklouti, A" uniqKey="Baklouti A">A Baklouti</name>
</author>
<author>
<name sortKey="Ferron, F" uniqKey="Ferron F">F Ferron</name>
</author>
<author>
<name sortKey="Sevajol, M" uniqKey="Sevajol M">M Sévajol</name>
</author>
<author>
<name sortKey="Canard, B" uniqKey="Canard B">B Canard</name>
</author>
<author>
<name sortKey="Coutard, B" uniqKey="Coutard B">B Coutard</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Saikatendu, Ks" uniqKey="Saikatendu K">KS Saikatendu</name>
</author>
<author>
<name sortKey="Joseph, Js" uniqKey="Joseph J">JS Joseph</name>
</author>
<author>
<name sortKey="Subramanian, V" uniqKey="Subramanian V">V Subramanian</name>
</author>
<author>
<name sortKey="Neuman, Bw" uniqKey="Neuman B">BW Neuman</name>
</author>
<author>
<name sortKey="Buchmeier, Mj" uniqKey="Buchmeier M">MJ Buchmeier</name>
</author>
<author>
<name sortKey="Stevens, Rc" uniqKey="Stevens R">RC Stevens</name>
</author>
<author>
<name sortKey="Kuhn, P" uniqKey="Kuhn P">P Kuhn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, Cy" uniqKey="Chen C">CY Chen</name>
</author>
<author>
<name sortKey="Chang, Ck" uniqKey="Chang C">CK Chang</name>
</author>
<author>
<name sortKey="Chang, Yw" uniqKey="Chang Y">YW Chang</name>
</author>
<author>
<name sortKey="Sue, Sc" uniqKey="Sue S">SC Sue</name>
</author>
<author>
<name sortKey="Bai, Hi" uniqKey="Bai H">HI Bai</name>
</author>
<author>
<name sortKey="Riang, L" uniqKey="Riang L">L Riang</name>
</author>
<author>
<name sortKey="Hsiao, Cd" uniqKey="Hsiao C">CD Hsiao</name>
</author>
<author>
<name sortKey="Huang, Th" uniqKey="Huang T">TH Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Luo, H" uniqKey="Luo H">H Luo</name>
</author>
<author>
<name sortKey="Chen, J" uniqKey="Chen J">J Chen</name>
</author>
<author>
<name sortKey="Chen, K" uniqKey="Chen K">K Chen</name>
</author>
<author>
<name sortKey="Shen, X" uniqKey="Shen X">X Shen</name>
</author>
<author>
<name sortKey="Jiang, H" uniqKey="Jiang H">H Jiang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Takeda, M" uniqKey="Takeda M">M Takeda</name>
</author>
<author>
<name sortKey="Chang, Ck" uniqKey="Chang C">CK Chang</name>
</author>
<author>
<name sortKey="Ikeya, T" uniqKey="Ikeya T">T Ikeya</name>
</author>
<author>
<name sortKey="Guntert, P" uniqKey="Guntert P">P Güntert</name>
</author>
<author>
<name sortKey="Chang, Yh" uniqKey="Chang Y">YH Chang</name>
</author>
<author>
<name sortKey="Hsu, Yl" uniqKey="Hsu Y">YL Hsu</name>
</author>
<author>
<name sortKey="Huang, Th" uniqKey="Huang T">TH Huang</name>
</author>
<author>
<name sortKey="Kainosho, M" uniqKey="Kainosho M">M Kainosho</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yu, Im" uniqKey="Yu I">IM Yu</name>
</author>
<author>
<name sortKey="Gustafson, Cl" uniqKey="Gustafson C">CL Gustafson</name>
</author>
<author>
<name sortKey="Diao, J" uniqKey="Diao J">J Diao</name>
</author>
<author>
<name sortKey="Burgner, Jw" uniqKey="Burgner J">JW Burgner</name>
</author>
<author>
<name sortKey="Li, Z" uniqKey="Li Z">Z Li</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J Zhang</name>
</author>
<author>
<name sortKey="Chen, J" uniqKey="Chen J">J Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chang, Ck" uniqKey="Chang C">CK Chang</name>
</author>
<author>
<name sortKey="Hsu, Yl" uniqKey="Hsu Y">YL Hsu</name>
</author>
<author>
<name sortKey="Chang, Yh" uniqKey="Chang Y">YH Chang</name>
</author>
<author>
<name sortKey="Chao, Fa" uniqKey="Chao F">FA Chao</name>
</author>
<author>
<name sortKey="Wu, Mc" uniqKey="Wu M">MC Wu</name>
</author>
<author>
<name sortKey="Huang, Ys" uniqKey="Huang Y">YS Huang</name>
</author>
<author>
<name sortKey="Hu, Ck" uniqKey="Hu C">CK Hu</name>
</author>
<author>
<name sortKey="Huang, Th" uniqKey="Huang T">TH Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chang, Ck" uniqKey="Chang C">CK Chang</name>
</author>
<author>
<name sortKey="Sue, Sc" uniqKey="Sue S">SC Sue</name>
</author>
<author>
<name sortKey="Yu, Th" uniqKey="Yu T">TH Yu</name>
</author>
<author>
<name sortKey="Hsieh, Cm" uniqKey="Hsieh C">CM Hsieh</name>
</author>
<author>
<name sortKey="Tsai, Ck" uniqKey="Tsai C">CK Tsai</name>
</author>
<author>
<name sortKey="Chiang, Yc" uniqKey="Chiang Y">YC Chiang</name>
</author>
<author>
<name sortKey="Lee, Sj" uniqKey="Lee S">SJ Lee</name>
</author>
<author>
<name sortKey="Hsiao, Hh" uniqKey="Hsiao H">HH Hsiao</name>
</author>
<author>
<name sortKey="Wu, Wj" uniqKey="Wu W">WJ Wu</name>
</author>
<author>
<name sortKey="Chang, Wl" uniqKey="Chang W">WL Chang</name>
</author>
<author>
<name sortKey="Lin, Ch" uniqKey="Lin C">CH Lin</name>
</author>
<author>
<name sortKey="Huang, Th" uniqKey="Huang T">TH Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hurst, K" uniqKey="Hurst K">K Hurst</name>
</author>
<author>
<name sortKey="Koetzner, C" uniqKey="Koetzner C">C Koetzner</name>
</author>
<author>
<name sortKey="Masters, P" uniqKey="Masters P">P Masters</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ma, Y" uniqKey="Ma Y">Y Ma</name>
</author>
<author>
<name sortKey="Tong, X" uniqKey="Tong X">X Tong</name>
</author>
<author>
<name sortKey="Xu, X" uniqKey="Xu X">X Xu</name>
</author>
<author>
<name sortKey="Li, X" uniqKey="Li X">X Li</name>
</author>
<author>
<name sortKey="Lou, Z" uniqKey="Lou Z">Z Lou</name>
</author>
<author>
<name sortKey="Rao, Z" uniqKey="Rao Z">Z Rao</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">J Biomed Sci</journal-id>
<journal-id journal-id-type="iso-abbrev">J. Biomed. Sci</journal-id>
<journal-title-group>
<journal-title>Journal of Biomedical Science</journal-title>
</journal-title-group>
<issn pub-type="ppub">1021-7770</issn>
<issn pub-type="epub">1423-0127</issn>
<publisher>
<publisher-name>BioMed Central</publisher-name>
<publisher-loc>London</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">29793506</article-id>
<article-id pub-id-type="pmc">5966903</article-id>
<article-id pub-id-type="publisher-id">449</article-id>
<article-id pub-id-type="doi">10.1186/s12929-018-0449-x</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Hsin</surname>
<given-names>Wei-Chen</given-names>
</name>
<address>
<email>rabbit6350903@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chang</surname>
<given-names>Chan-Hua</given-names>
</name>
<address>
<email>dikefither@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chang</surname>
<given-names>Chi-You</given-names>
</name>
<address>
<email>r02445124@ntu.edu.tw</email>
</address>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Peng</surname>
<given-names>Wei-Hao</given-names>
</name>
<address>
<email>pengweihao@ntu.edu.tw</email>
</address>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chien</surname>
<given-names>Chung-Liang</given-names>
</name>
<address>
<email>Chien@ntu.edu.tw</email>
</address>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Chang</surname>
<given-names>Ming-Fu</given-names>
</name>
<address>
<phone>886-2-23123456 ext. 88217</phone>
<email>mfchang@ntu.edu.tw</email>
</address>
<xref ref-type="aff" rid="Aff3">3</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<contrib-id contrib-id-type="orcid">http://orcid.org/0000-0002-0365-8364</contrib-id>
<name>
<surname>Chang</surname>
<given-names>Shin C.</given-names>
</name>
<address>
<phone>886-2-23123456 ext. 88290</phone>
<email>scchang093@ntu.edu.tw</email>
</address>
<xref ref-type="aff" rid="Aff1">1</xref>
</contrib>
<aff id="Aff1">
<label>1</label>
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Microbiology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</aff>
<aff id="Aff2">
<label>2</label>
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Anatomy and Cell Biology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</aff>
<aff id="Aff3">
<label>3</label>
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0004 0546 0241</institution-id>
<institution-id institution-id-type="GRID">grid.19188.39</institution-id>
<institution>Institute of Biochemistry and Molecular Biology, College of Medicine,</institution>
<institution>National Taiwan University,</institution>
</institution-wrap>
No. 1, Jen-Ai Road, First Section, Taipei, 100 Taiwan</aff>
</contrib-group>
<pub-date pub-type="epub">
<day>24</day>
<month>5</month>
<year>2018</year>
</pub-date>
<pub-date pub-type="pmc-release">
<day>24</day>
<month>5</month>
<year>2018</year>
</pub-date>
<pub-date pub-type="collection">
<year>2018</year>
</pub-date>
<volume>25</volume>
<elocation-id>47</elocation-id>
<history>
<date date-type="received">
<day>1</day>
<month>12</month>
<year>2017</year>
</date>
<date date-type="accepted">
<day>15</day>
<month>5</month>
<year>2018</year>
</date>
</history>
<permissions>
<copyright-statement>© The Author(s). 2018</copyright-statement>
<license license-type="OpenAccess">
<license-p>
<bold>Open Access</bold>
This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<abstract id="Abs1">
<sec>
<title>Background</title>
<p id="Par1">Middle East respiratory syndrome coronavirus (MERS-CoV) consists of a positive-sense, single-stranded RNA genome and four structural proteins: the spike, envelope, membrane, and nucleocapsid protein. The assembly of the viral genome into virus particles involves viral structural proteins and is believed to be mediated through recognition of specific sequences and RNA structures of the viral genome.</p>
</sec>
<sec>
<title>Methods and Results</title>
<p id="Par2">A culture system for the production of MERS coronavirus-like particles (MERS VLPs) was determined and established by electron microscopy and the detection of coexpressed viral structural proteins. Using the VLP system, a 258-nucleotide RNA fragment, which spans nucleotides 19,712 to 19,969 of the MERS-CoV genome (designated PS258(19712–19969)
<sub>ME</sub>
), was identified to function as a packaging signal. Assembly of the RNA packaging signal into MERS VLPs is dependent on the viral nucleocapsid protein. In addition, a 45-nucleotide stable stem-loop substructure of the PS258(19712–19969)
<sub>ME</sub>
interacted with both the N-terminal domain and the C-terminal domain of the viral nucleocapsid protein. Furthermore, a functional SARS-CoV RNA packaging signal failed to assemble into the MERS VLPs, which indicated virus-specific assembly of the RNA genome.</p>
</sec>
<sec>
<title>Conclusions</title>
<p id="Par3">A MERS-oV RNA packaging signal was identified by the detection of GFP expression following an incubation of MERS VLPs carrying the heterologous mRNA GFP-PS258(19712–19969)
<sub>ME</sub>
with virus permissive Huh7 cells. The MERS VLP system could help us in understanding virus infection and morphogenesis.</p>
</sec>
</abstract>
<kwd-group xml:lang="en">
<title>Keywords</title>
<kwd>MERS-CoV</kwd>
<kwd>RNA packaging signal</kwd>
<kwd>Nucleocapsid protein</kwd>
</kwd-group>
<funding-group>
<award-group>
<funding-source>
<institution-wrap>
<institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100004663</institution-id>
<institution>Ministry of Science and Technology, Taiwan</institution>
</institution-wrap>
</funding-source>
<award-id>102-2321-B-002-028</award-id>
<award-id>107-2321-B-002-023</award-id>
<principal-award-recipient>
<name>
<surname>Chang</surname>
<given-names>Ming-Fu</given-names>
</name>
</principal-award-recipient>
</award-group>
</funding-group>
<custom-meta-group>
<custom-meta>
<meta-name>issue-copyright-statement</meta-name>
<meta-value>© The Author(s) 2018</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="Sec1">
<title>Background</title>
<p id="Par4">Middle East respiratory syndrome coronavirus (MERS-CoV) is a novel coronavirus that causes acute respiratory syndrome with a high mortality rate in human [
<xref ref-type="bibr" rid="CR1">1</xref>
]. The first case of MERS-CoV was identified in September 2012 in Saudi Arabia. From the initial outbreak to April 2018, MERS-CoV spread through 27 countries and caused approximately 2144 cases and 750 deaths (
<ext-link ext-link-type="uri" xlink:href="http://www.who.int/emergencies/mers-cov/en">http://www.who.int/emergencies/mers-cov/en/</ext-link>
). Dipeptidyl peptidase 4, which is also known as CD26, was identified as a functional receptor for MERS-CoV [
<xref ref-type="bibr" rid="CR2">2</xref>
,
<xref ref-type="bibr" rid="CR3">3</xref>
]. Coronaviruses are enveloped, positive-sense, single-stranded RNA viruses with approximately 26–32 kb genomic RNA [
<xref ref-type="bibr" rid="CR4">4</xref>
<xref ref-type="bibr" rid="CR6">6</xref>
]. The 5′ two-thirds of the viral genome consists of open reading frames (ORF) 1a and 1b that encode the viral nonstructural proteins (nsps), whereas the 3′ one-third consists of ORFs that encode the viral structural proteins, including the spike (S), membrane (M), envelope (E) and nucleocapsid (N), and accessory proteins. The S, M and E proteins form the viral envelope [
<xref ref-type="bibr" rid="CR7">7</xref>
<xref ref-type="bibr" rid="CR9">9</xref>
], whereas the N protein is considered the most important protein that interacts with the viral genomic RNA and packages the RNA into virus particles by recognizing a specific sequence, which is termed the packaging signal [
<xref ref-type="bibr" rid="CR10">10</xref>
<xref ref-type="bibr" rid="CR12">12</xref>
].</p>
<p id="Par5">Studies on mouse hepatitis virus (MHV), which is a lineage A betacoronavirus, localized the packaging signal to the 3’-end of ORF 1b of the viral genome in the gene that encodes the nsp15 endoribonuclease [
<xref ref-type="bibr" rid="CR13">13</xref>
<xref ref-type="bibr" rid="CR15">15</xref>
]. A stable stem-loop of 69-nucleotides (nt) was identified as sufficient for RNA packaging. Computer analysis further revealed conservation of the packaging signal in both the sequence and RNA secondary structure between MHV and bovine coronavirus (BCoV) and among other lineage A betacoronaviruses [
<xref ref-type="bibr" rid="CR16">16</xref>
<xref ref-type="bibr" rid="CR18">18</xref>
]. Our previous studies on severe acute respiratory syndrome coronavirus (SARS-CoV), which is a lineage B betacoronavirus, identified a 580-nt RNA fragment with a stable stem-loop structure as a functional signal to drive packaging of coexpressed RNA of a green fluorescent protein (GFP) into virus-like particles (VLPs) [
<xref ref-type="bibr" rid="CR19">19</xref>
]. This SARS-CoV packaging signal spanned the viral genome from nt 19,715 to 20,294 and was localized to a subdomain of the nsp15 gene different from the packaging signal of lineage A betacoronaviruses. However, studies on alphacoronavirus transmissible gastroenteritis virus (TGEV) localized the RNA packaging signal to the 5′-end of the viral genome [
<xref ref-type="bibr" rid="CR20">20</xref>
,
<xref ref-type="bibr" rid="CR21">21</xref>
], and sequences in the 5’-UTR and/or 3’-UTR may be required for the RNA packaging of gammacoronavirus infectious bronchitis virus (IBV) [
<xref ref-type="bibr" rid="CR22">22</xref>
,
<xref ref-type="bibr" rid="CR23">23</xref>
].</p>
<p id="Par6">In addition to the packaging signal, the viral structural proteins may also play roles in the assembly of the viral genome. Studies on MHV indicated that M and E proteins are sufficient for the assembly of VLPs [
<xref ref-type="bibr" rid="CR9">9</xref>
]. Through a specific interaction between the viral M protein and the packaging signal, a coexpressed RNA fragment carrying the viral packaging signal can be packaged into VLPs in the absence of N protein [
<xref ref-type="bibr" rid="CR24">24</xref>
,
<xref ref-type="bibr" rid="CR25">25</xref>
]. Nevertheless, studies argue for the involvement of the N protein in RNA genome packaging. The carboxy-terminal domain (CTD) of the N protein was demonstrated to be the major determinant of MHV packaging signal recognition [
<xref ref-type="bibr" rid="CR11">11</xref>
]; and the further downstream carboxy-terminal tail coordinates the selectivity of genome packaging and couples genome encapsidation to the virion assembly [
<xref ref-type="bibr" rid="CR26">26</xref>
]. In addition, our earlier study on SARS-CoV indicated N protein-dependent assembly of the viral RNA packaging signal [
<xref ref-type="bibr" rid="CR19">19</xref>
]. To date, the RNA packaging signal of MERS-CoV has not been determined, and it is unclear whether the N protein is essential for the MERS-CoV RNA package.</p>
<p id="Par7">In this study, a putative RNA packaging signal of the MERS-CoV genome was predicted by bioinformatics analysis. MERS VLPs carrying RNA sequences of GFP fused to a 258-nt RNA fragment consisting of the putative RNA packaging signal and its flanking sequences were generated and incubated with MERS-CoV-permissive Huh7 cells for functional analysis. The results indicate that the RNA fragment spanning nt 19,712 to 19,969 of the viral genome is sufficient to function as a packaging signal and assemble into the MERS VLPs. In addition, packaging of the MERS-CoV RNA depends on the viral N protein.</p>
</sec>
<sec id="Sec2">
<title>Methods</title>
<sec id="Sec3">
<title>Cell lines and culture condition</title>
<p id="Par8">Human embryonic kidney cells 293 T and hepatocellular carcinoma Huh7 cells were maintained in Dulbecco’s modified Eagle medium (GIBCO) supplemented with 10% heat-inactivated fetal bovine serum, 1% 100X nonessential amino acids plus 100 U of penicillin and 100 μg of streptomycin per ml in a humidified 5% CO
<sub>2</sub>
atmosphere at 37 °C.</p>
</sec>
<sec id="Sec4">
<title>Plasmids</title>
<p id="Par9">(i) Plasmids pcDNA-ctrl-V5HisTopo, pcDNA-MERS-E, pcDNA-MERS-M, and pcDNA-MERS-N. Plasmid pcDNA-ctrl-V5HisTopo was generated by inserting a DNA fragment containing multiple cloning sites derived from annealing of two oligonucleotides, CACCATGGAATTCATCGATCTAGATCCGCGGCCGCACTCGAGT and its complementary sequences, into pcDNA3.1D/V5-His-TOPO (Invitrogen). Plasmids pcDNA-MERS-E, pcDNA-MERS-M, and pcDNA-MERS-N encode the V5- and His-tagged E, M, and N protein, respectively, of MERS-CoV and were generated by inserting their corresponding cDNA fragments into pcDNA-ctrl-V5HisTopo. The MERS-CoV cDNA fragments were chemically synthesized (Invitrogen) according to GenBank (HCoV-EMC strain; accession number NC_019843.3) and used as templates for PCR amplification with the following primer sets: CS-ME-E1 (GGAATTCATGTTACCCTTTG) and CS-ME-E2 (ATCAACCCACTCGTCAGG) for the E gene, CS-ME-M1 (GGAATTCATGTCTAATATGACGC) and CS-ME-M2 (ATCAGCTCGAAGCAATGCAAG) for the M gene, and CS-ME-N-f(RI) (GGAATTCATGGCATCCCCT) and CS-ME-N-r(RI) (GGAATTCATCAGTGTTAACATC) for the N gene. The PCR products of E and M gene were treated with EcoRI and EcoRV restriction endonucleases, and inserted into the EcoRI and EcoRV sites of pcDNA-ctrl-V5HisTopo to generate plasmids pcDNA-MERS-E and pcDNA-MERS-M, respectively. The PCR product of N gene was treated with EcoRI restriction endonuclease, and inserted into the EcoRI site of pcDNA-ctrl-V5HisTopo to generate plasmid pcDNA-MERS-N.</p>
<p id="Par10">(ii) Plasmid pcDNA-MERS-S. For construction of plasmid pcDNA-MERS-S, pcDNA-MERS-S1 was first generated following a treatment of plasmid pCR4-MERS-S1-Topo (kindly provided by Haagmans BL and Osterhaus AD, Department of Viroscience, Erasmus Medical Center, Rotterdam, Netherlands) with EcoRI restriction endonuclease and insertion of the resultant DNA fragment containing the MERS-CoV S protein coding sequences from nt 1 to 2238 into the EcoRI site of pcDNA-ctrl-V5HisTopo. A DNA fragment representing the MERS-CoV S protein coding sequences from nt 2230 to 4062 with ScaI site at the 5′ end and EcoRV at the 3′ end was then generated by PCR amplification from a chemically synthesized template (Invitrogen) and inserted into the ScaI site of the plasmid pcDNA-MERS-S1 located at nt 2229 of the MERS-CoV S coding sequences to generate plasmid pcDNA-MERS-S.</p>
<p id="Par11">(iii) Plasmids pET-MERS-N, pET-MERS-N(1–156), and pET-MERS-N(1–263). Plasmids pET-MERS-N, pET-MERS-N(1–156), and pET-MERS-N(1–263) encode the His-tagged full-length MERS-CoV N protein, the N-terminal domain from amino acid residues 1 to 156, and 1 to 263, respectively. For construction of pET-MERS-N, plasmid pcDNA-MERS-N was treated with EcoRI restriction endonuclease and the resultant DNA fragment of the N gene was inserted into the EcoRI site of pET-28a (Novagen). Plasmid pET-MERS-N(1–156) was derived from pET-MERS-N following a digestion with HindIII restriction endonuclease and self-ligation of the resultant 5.8-kb DNA fragment. For construction of plasmid pET-MERS-N(1–263), a 321-bp HindIII fragment was obtained from pET-MERS-N and inserted into the HindIII site of pET-MERS-N(1–156).</p>
<p id="Par12">(iv) Plasmids pET
<strike>-</strike>
MERS-N(239–413) and pET
<strike>-</strike>
MERS-N(264–413). Plasmids pET-MERS-N(239–413) and pET-MERS-N(264–413) encode the His-tagged MERS-CoV N protein from amino acid residues 239 to 413 and 264 to 413, respectively. For generation of plasmid pET-MERS-N(239–413), pET-MERS-N was used as the template for PCR amplification with the primer set CS-ME-N715(NheI)-f (GGGGCTAGCACTAAGAAAGATGCTGC) and CS-ME-N-r(RI) (GGAATTCATCAGTGTTAACATC). The resultant PCR product representing the DNA fragment of N(239–413) was treated with NheI and EcoRI restriction endonucleases and then inserted into the NheI and EcoRI sites of pET-28a. For generation of plasmid pET-MERS-N(264–413), a 468-bp DNA fragment obtained from the treatment of pET-MERS-N with HindIII restriction endonuclease was inserted into the HindIII site of pET-28a.</p>
<p id="Par13">(v) Plasmids pEGFP-PS258(19712–19969)ME and pEGFP-N1-PS580. Plasmid pEGFP-PS258(19712–19969)ME represents the cDNA of the putative packaging signal of MERS-CoV genomic RNA inserted into the 3′ noncoding region of the GFP gene. For construction of the plasmid pEGFP-PS258(19712–19969)ME, a DNA fragment representing MERS-CoV genomic RNA from nt 19,712 to 19,969 with NotI site on both ends was first obtained following PCR amplification from a chemically synthesized template (Invitrogen) and a treatment of the PCR product with NotI restriction endonuclease. The DNA fragment was then inserted into the NotI site of pEGFP-N1 to generate plasmid pEGFP-PS258(19712–19969)ME. Plasmid pEGFP-N1-PS580 has been previously described [
<xref ref-type="bibr" rid="CR19">19</xref>
]. It represents the cDNA of the packaging signal of SARS-CoV genomic RNA from nt 19,715 to 20,294 inserted into the 3′ noncoding region of the GFP gene.</p>
</sec>
<sec id="Sec5">
<title>Transient transfection and harvest of cell lysates</title>
<p id="Par14">Transient transfection was performed with T-Pro Non-liposome transfection Reagent II (Genestar Biotech) according to the manufacturer’s protocol. Briefly, the expression plasmid was diluted into Opti-MEM (GIBCO) and mixed with T-Pro Non-liposome transfection Reagent II at the ratio of 1 μg DNA to 2 μl transfection Reagent. Two days posttransfection, cells were lysed using a RIPA buffer consisting of 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5% sodium deoxycholate, 1% NP-40, 0.1% SDS, and 1% complete EDTA-free protease inhibitor (Roche).</p>
</sec>
<sec id="Sec6">
<title>Production and harvest of virus like particles (VLPs)</title>
<p id="Par15">For production of MERS VLPs, cotransfection was performed with plasmids encoding the MERS-CoV structural proteins E, M, and S, in the presence or absence of the N-expressing plasmid and the MERS-CoV packaging signal plasmid pEGFP-PS258(19712–19969)ME, the SARS-CoV packaging signal plasmid pEGFP-N1-PS580, or the vector control pEGFP-N1. Production of MERS VLPs in the transfected cells was examined by electron microscopy three days posttransfection. For the collection of supernatant VLPs, culture medium was clarified by centrifugation at 1000 rpm in an RS-240 rotor (Kubota 2010) for 5 min, passed through a 0.45 μm filter, and subjected to ultracentrifugation at 36000 rpm in an SW41 rotor (Beckman) for 3 h at 4 °C. The VLP pellet was resuspended in PBS and stored at − 80 °C. For collecting cellular VLPs, the transfected cells were resuspended in PBS containing 1% complete EDTA-free protease inhibitor and subjected to three cycles of freeze (− 80 °C) and thaw (37 °C) prior to the centrifugation at 1000 rpm. In addition, for separation of supernatant VLPs with different structure compositions, the VLP suspension was further loaded on a discontinuous sucrose gradient consisting of 20, 30, 50, and 60% sucrose in 20 mM HEPES (pH 7.4) and 0.1% BSA and centrifuged at 36000 rpm for 15 h at 4 °C. The density of VLPs was determined by a refractometer (ATAGO). Expression of MERS-CoV structural proteins in the VLPs were examined by Western blot analysis.</p>
</sec>
<sec id="Sec7">
<title>Electron microscopic analysis of MERS VLPs</title>
<p id="Par16">Three days following cotransfection of the plasmids encoding the MERS-CoV structural proteins, cells were fixed with 4% glutaraldehyde in 0.1 M phosphate buffer for 24 h at 4 °C and post-fixed 1% aqueous osmium tetroxide diluted in the same phosphate buffer at room temperature for 1 h. After washing, the fixed cells were dehydrated in a graded ethanol series and embedded in a Polybed 812-Araldite mixture (EMS, Hatfield, PA). Semi-thin sections of 1 μm were obtained using an ultramicrotome (Ultracut E, Leica-Reichert Jung, Wetzlar, Germany) and stained with toluidine blue for correlative light microscopy. Ultrathin sections were cut at 70 nm, collected on copper grids (200 meshes) and stained with uranyl acetate and lead citrate. Images were examined in a Hitachi H-7100 electron microscope equipped with a Gatan 832 digital camera (Gatan, Inc.).</p>
</sec>
<sec id="Sec8">
<title>Western blot analysis</title>
<p id="Par17">Protein lysates were resolved by polyacrylamide gel electrophoresis (PAGE) and electrotransferred onto an Immobilon-P membrane (Millipore) as described previously [
<xref ref-type="bibr" rid="CR27">27</xref>
]. Mouse monoclonal antibody against V5 epitope (Invitrogen) was used as the primary antibody to detect expression of the V5-tagged recombinant proteins. Following incubation with horseradish peroxidase-conjugated secondary antibodies, specific interactions between antigens and antibodies were detected by the enhanced chemiluminescence system (Advansta).</p>
</sec>
<sec id="Sec9">
<title>Immunofluorescence assay</title>
<p id="Par18">Cells cultured on glass coverslips were fixed with 4% paraformaldehyde for 30 min at room temperature. The fixed cells were permeabilized with 0.5% Triton X-100 and washed with PBS. Following a blocking with 3% BSA for 1 h at room temperature, the cells were incubated with rabbit polyclonal antibodies against GFP for 1 h at room temperature, washed with PBS, and then incubated with secondary antibodies conjugated with Alexa Fluor® 488 (Invitrogen) for 1 h at room temperature. Cell nuclei were stained with Hoechst. The coverslips were mounted on glass slides. Zeiss Axioskop 40 microscope was used to capture the images.</p>
</sec>
<sec id="Sec10">
<title>Expression and purification of MERS-CoV N protein and its subdomains</title>
<p id="Par19">For expression of recombinant MERS-CoV N protein and its subdomains, plasmids pET-MERS-N and its derivatives were individually transformed into
<italic>E. coli</italic>
BL21(DE3) cells. Protein expression was induced with 0.1 mM isopropyl-β-D-thiogalactopyranoside for 18 h at 16 °C, and purified as previously described [
<xref ref-type="bibr" rid="CR19">19</xref>
] with modifications. In brief, cell pellets were subjected to sonication and centrifugation at 6000 rpm in an RA-200 J rotor (Kubota) for 10 min at 4 °C. The supernatants were collected and loaded onto a nickel affinity column. The His-tagged MERS-CoV N proteins were eluted with elution buffers consisting of 50 mM sodium phosphate, pH 8.0, 300 mM NaCl, 6 M urea and a stepwise gradient of imidazole at 10, 50 and 200 mM. The fractions that contain proteins of interest, identified by Coomassie blue staining and Western blot analysis following SDS-PAGE, were pooled together and dialyzed against a dialysis buffer containing 50 mM sodium phosphate, pH 7.4, 150 mM NaCl, 1 mM EDTA, and 0.01% NaN
<sub>3</sub>
. The purified proteins were concentrated with Amicon Ultra-15 concentrator (Millipore) and kept in 50% glycerol at − 80 °C for filter binding assay.</p>
</sec>
<sec id="Sec11">
<title>Filter binding assay</title>
<p id="Par20">Filter binding assay was carried out as previously described [
<xref ref-type="bibr" rid="CR19">19</xref>
] with modifications. In brief, biotinylated RNA fragments were biochemically synthesized (Thermo Fisher; Integrated DNA Technologies) and used as the probes. The probes were heated at 80 °C for 10 min and then incubated at 37 °C for 15 min. Purified proteins pre-incubated independently at 37 °C for 15 min were then mixed with the RNA probe in a filter binding buffer consisting of 20 mM HEPES, pH 7.3, 40 mM KCl, 2 mM MgCl
<sub>2</sub>
, and 2 mM DTT. After an additional incubation for 10 min, the reaction mixture was passed through Immobilon-P membrane that had been activated with methanol and soaked in the filter binding buffer. The membrane was washed three times with the binding buffer. Specific interactions between biotin-labeled RNA probes and purified proteins were detected by the enhanced chemiluminescence system following pre-incubation with streptavidin horseradish peroxidase conjugate. In addition, a biotin-labeled RNA fragment 5′–UCCUGCUUCAACAGUGCUUGGACGGAAC–3′ (Thermo Fisher) was used as the negative control.</p>
</sec>
</sec>
<sec id="Sec12">
<title>Results</title>
<sec id="Sec13">
<title>Bioinformatics analysis of the MERS-CoV RNA genome</title>
<p id="Par21">Bioinformatics and functional analysis have previously identified the minimum size packaging signal (approximately 60 to 95 nt) for various coronaviruses. However, the packaging signal of lineage C betacoronavirus MERS-CoV has not been determined. Based on the observations that a stable stem–loop structure is often a prerequisite for an RNA fragment to be a packaging signal and that unique sequences may determine the packaging specificity of different coronavirus lineages, we proposed the analysis of the genome sequence and the structure of different lineage betacoronaviruses for the prediction of the potential packaging signal of MERS-CoV. The whole genome sequence of MERS-CoV was first compared with lineage B betacoronavirus SARS-CoV by alignment with NCBI blastn. This revealed a highly variable region from nt 19,757 to 20,434 of the MERS-CoV genome located at the 3′ end of ORF 1b and between two regions that have the highest conservation (the alignment score was higher than 200; Fig. 
<xref rid="Fig1" ref-type="fig">1a</xref>
, top). Interestingly, this variable region overlaps the PS580 RNA fragment spanning nt 19,715 to 20,294 of the SARS-CoV genome, which has been identified as a functional packaging signal [
<xref ref-type="bibr" rid="CR19">19</xref>
]. In addition, when the MERS-CoV RNA sequence was compared with that of the lineage A betacoronavirus MHV, the divergent sequence was localized to a similar but shorter fragment spanning nt 19,756 to 20,182 of the MERS-CoV genome (Fig.
<xref rid="Fig1" ref-type="fig">1a</xref>
, bottom). These results located a highly variable region of the genome sequences among the different lineage betacoronaviruses. Secondary structures of the MERS-CoV RNA(19757–20434) and RNA(19756–20182) were then analyzed (Fig.
<xref rid="Fig1" ref-type="fig">1b</xref>
). Two RNA subdomains of 94-nt (nt 19,801 to 19,894) and 152-nt (nt 20,022 to 20,173) that form stable structures in both RNA fragments were identified as potential packaging signals of MERS-CoV.
<fig id="Fig1">
<label>Fig. 1</label>
<caption>
<p>Sequence similarity among the coronavirus genomic RNAs and secondary structure prediction.
<bold>a</bold>
Alignment of the whole genome sequence of MERS-CoV (accession number NC_019843.3) with that of SARS-CoV (accession number AY291451.1) and MHV (accession number NC_001846.1) by NCBI blastn. Regions with the highest conservation (alignment score ≧ 200) are indicated by open boxes followed by alignment scores 80–200, 50–80, 40–50, and < 40 as indicated. MERS-CoV RNA fragments spanning nt 19,757 to 20,434 [RNA(19757–20434)] and nt 19,756 to 20,182 [RNA(19756–20182)] with sequence diversity were subjected to secondary structure prediction.
<bold>b</bold>
Secondary structure prediction. Secondary structure of MERS-CoV RNA(19757–20434) and RNA(19756–20182) were analyzed by Mfold. Two subdomains of 94-nt (nt 19,801 to 19,894) and 152-nt (nt 20,022 to 20,173) that form stable substructures in both RNA fragments were colored yellow</p>
</caption>
<graphic xlink:href="12929_2018_449_Fig1_HTML" id="MO1"></graphic>
</fig>
</p>
</sec>
<sec id="Sec14">
<title>Identification of PS258(19712–19969)
<sub>ME</sub>
as a putative N protein-dependent RNA packaging signal of MERS-CoV</title>
<p id="Par22">For examination of the RNA packaging of MERS-CoV, a culture system that expresses viral structural proteins and produces MERS VLPs was established. As shown in Fig. 
<xref rid="Fig2" ref-type="fig">2a</xref>
, expression of MERS-CoV structural proteins was detected following cotransfection of plasmids encoding the viral proteins M, E, S, and N as indicated. Successful production of MERS VLPs in transfected cells in the absence (VLPdN) or presence of N protein (VLP) was confirmed by electron microscopy (Fig.
<xref rid="Fig2" ref-type="fig">2b</xref>
). In addition, VLPs that were released into the culture medium (supernatant VLPs) were subjected to a discontinuous sucrose gradient centrifugation. Western blot analysis demonstrated that fractions 6 and 7 likely represent VLPs that contain four structural proteins with densities of 1.151 and 1.207, respectively (Fig.
<xref rid="Fig2" ref-type="fig">2c</xref>
).
<fig id="Fig2">
<label>Fig. 2</label>
<caption>
<p>Production of MERS VLPs in cultured cells.
<bold>a</bold>
Expression of MERS-CoV structural proteins. Plasmids encoding MERS-CoV structural proteins M, E, S, and N as indicated were cotransfected into 293 T cells and the cell lysates were prepared for Western blot analysis two days posttransfection. Protein lysate prepared from cells transfected with control plasmid was applied as a negative control (lane Ctrl).
<bold>b</bold>
Electron microscopic analysis of MERS VLPs. The cells were fixed and embedded three days following cotransfection of the plasmids encoding the MERS-CoV structural proteins M, E, and S (VLPdN) or M, E, S, and N (VLP). Images of the sections were examined for the presence of MERS VLPs in a Hitachi H-7100 electron microscope equipped with a Gatan 832 digital camera.
<bold>c</bold>
Separation of MERS VLPs. MERS VLPs collected from culture medium were subjected to a discontinuous sucrose gradient centrifugation as described in Methods. The fractions were collected for Western blot analysis. Lane CL represents the protein lysates of transfected cells and lane VLP represents the total VLPs prior to the gradient centrifugation</p>
</caption>
<graphic xlink:href="12929_2018_449_Fig2_HTML" id="MO2"></graphic>
</fig>
</p>
<p id="Par23">A 258-nt RNA fragment, named PS258(19712–19969)
<sub>ME</sub>
(Fig. 
<xref rid="Fig3" ref-type="fig">3a</xref>
) and that contains the earlier-identified 94-nt stable stem-loop structure (highlighted) as a center domain and extends on both ends, was chosen to begin functional analysis for identification of the putative RNA packaging signal. To examine the packaging activity of the PS258(19712–19969)
<sub>ME</sub>
RNA fragment, the plasmid pEGFP-PS258(19712–19969)ME that expresses heterologous mRNA GFP-PS258(19712–19969)
<sub>ME</sub>
was generated. Cotransfection was performed with the plasmids encoding MERS-CoV structural proteins and plasmid pEGFP-PS258(19712–19969)ME. In addition, plasmid pEGFP-N-PS580 that encodes the GFP-PS580 RNA fragment containing the SARS-CoV RNA packaging signal was applied to examine the specificity of the viral RNA packaging. As shown in Fig.
<xref rid="Fig3" ref-type="fig">3</xref>
, the expression of the viral structural proteins was detected in cell lysates (panel a) and in both the cellular and supernatant VLPs (panel b; VLP, VLP/PS
<sub>ME</sub>
, and VLP/PS
<sub>SA</sub>
). Assembly of the GFP-PS258(19712–19969)
<sub>ME</sub>
into MERS VLPs (VLP/PS
<sub>ME</sub>
) was examined by incubating the VLPs with the virus-permissible Huh7 cells that endogenously express the viral receptor hDPP4 [
<xref ref-type="bibr" rid="CR2">2</xref>
]. As shown in Fig.
<xref rid="Fig3" ref-type="fig">3c</xref>
, GFP-PS258(19712–19969)
<sub>ME</sub>
RNA that assembled into the VLP/PS
<sub>ME</sub>
was evident by the detection of GFP expression upon entering the cells. The expression of GFP was not detected in Huh7 cells coincubating with VLPs collected from the culture medium of cells cotransfected with plasmids encoding the MERS-CoV structural proteins and the control vector pEGFP-N1 (Fig.
<xref rid="Fig3" ref-type="fig">3c</xref>
; VLP). These results demonstrated that the PS258(19712–19969)
<sub>ME</sub>
RNA fragment bears a functional packaging signal that is critical for the assembly of the viral RNA into the MERS VLPs. In the absence of the MERS-CoV RNA sequences, GFP RNA alone was not assembled or expressed in the VLPs. In addition, no GFP expression was detected when the Huh7 cells were incubated with VLPs collected from the culture medium of cells cotransfected with plasmids encoding MERS-CoV structural proteins and the plasmid that encodes the heterologous mRNA GFP-PS580 containing the SARS-CoV RNA packaging signal (Fig.
<xref rid="Fig3" ref-type="fig">3c</xref>
; VLP/PS
<sub>SA</sub>
), which indicated that the SARS-CoV RNA packaging signal could not be assembled into MERS VLPs. This suggests a viral RNA-specific package.
<fig id="Fig3">
<label>Fig. 3</label>
<caption>
<p>Functional analysis of the putative MERS-CoV RNA packaging signal.
<bold>a</bold>
-
<bold>b</bold>
Expression of MERS-CoV structural proteins in transfected cells and VLPs. Western blot analysis was performed with the cell lysates (panel
<bold>a</bold>
) and both the cellular and supernatant VLPs (panel b) following cotransfection of the plasmids encoding the viral structural proteins and a heterologous GFP-PS mRNA as indicated. The secondary structure of the PS258(19712–19969)
<sub>ME</sub>
RNA fragment is shown with the 94-nt stable substructure highlighted as marked in Fig.
<xref rid="Fig1" ref-type="fig">1b</xref>
.
<bold>c</bold>
Functional analysis of RNA packaging signal. MERS VLPs were collected from the medium of the cultured cells following cotransfection of the plasmids encoding the viral structural proteins S, E, M, and N, and the GFP vector control plasmid pEGFP-N1 (indicated by VLP), the putative MERS-CoV packaging signal plasmid pEGFP-PS258(19712–19969)ME (indicated by VLP/PS
<sub>ME</sub>
), and the SARS-CoV packaging signal plasmid pEGFP-N1-PS580 (indicated by VLP/PS
<sub>SA</sub>
). VLPdN/PS
<sub>ME</sub>
represents MERSVLPs produced by cotransfection of the plasmids encoding MERS-CoV M, E, and S proteins and plasmid pEGFP-PS258(19712–19969)ME. These MERS VLPs harvested from different cell sources were incubated with naïve Huh7 cells for 48 h. The treated Huh7 cells were then fixed for immunofluorescence staining with GFP antibody and Hoechst</p>
</caption>
<graphic xlink:href="12929_2018_449_Fig3_HTML" id="MO3"></graphic>
</fig>
</p>
<p id="Par24">In addition to the packaging signal, viral structural proteins may also play roles in the assembly of the viral genome [
<xref ref-type="bibr" rid="CR9">9</xref>
,
<xref ref-type="bibr" rid="CR11">11</xref>
,
<xref ref-type="bibr" rid="CR19">19</xref>
,
<xref ref-type="bibr" rid="CR24">24</xref>
<xref ref-type="bibr" rid="CR26">26</xref>
]. To elucidate the MERS-CoV RNA packaging, MERS VLPs produced in the absence of the N protein (named VLPdN/PS
<sub>ME</sub>
) were incubated with Huh7 cells. In contrast to the expression of GFP in cells incubated with MERS VLP/PS
<sub>ME</sub>
, the GFP signal was not detected in Huh7 cells incubated with VLPdN/PS
<sub>ME</sub>
(Fig.
<xref rid="Fig3" ref-type="fig">3c</xref>
). This result indicates that the MERS-CoV RNA packaging is dependent on the viral N protein.</p>
</sec>
<sec id="Sec15">
<title>MERS-CoV N protein interacts with a stable stem-loop structure in the viral RNA packaging signal</title>
<p id="Par25">To investigate the RNA-binding activity of the MERS-CoV N protein, the His-tagged N protein was expressed in
<italic>E. coli</italic>
BL21(DE3) and purified through a nickel affinity column. As shown in Fig. 
<xref rid="Fig4" ref-type="fig">4</xref>
, the His-tagged full-length N protein of approximately 55 kDa was purified by an elution buffer containing 200 mM imidazole (panel a). Fractions 2 and 3, which showed the peak level of the N protein, were pooled together for the filter binding assay. In addition, a 45-nt RNA fragment spanning nt 19,805 to 19,849 (tentatively named SL19805
<sub>ME</sub>
) of the viral genome that constitutes a stable stem-loop substructure of the PS258(19712–19969)
<sub>ME</sub>
was used in the RNA binding assay. As shown in Fig.
<xref rid="Fig4" ref-type="fig">4b</xref>
, an interaction between the biotinylated SL19805
<sub>ME</sub>
and the MERS-CoV N protein was detected. However, no signals were observed with the protein control BSA and in the control groups of unlabeled and biotin-labeled RNA. These results localized a predicted substructure of the PS258(19712–19969)
<sub>ME</sub>
RNA packaging signal to interact with the viral N protein.
<fig id="Fig4">
<label>Fig. 4</label>
<caption>
<p>The RNA binding activity of MERS-CoV N protein.
<bold>a</bold>
Purification of the His-tagged MERS-CoV full-length N protein. Following expression of the His-tagged MERS-CoV N protein in
<italic>E. coli</italic>
BL21(DE3), the cells were lysed and cell supernatant collected was subjected to protein purification on a nickel-bead affinity column. The His-tagged MERS-CoV N protein eluted by a buffer containing 200 mM imidazole was detected by Coomassie blue staining (top) and Western blot analysis using antibody against the His-tag (bottom). Fractions 2 and 3 were pooled together for the filter binding assay.
<bold>b</bold>
Filter binding assay. The interactions between the MERS-CoV N protein and the biotin-SL19805
<sub>ME</sub>
probe were analyzed by the filter binding assay. Unlabeled and 3’ biotin-labeled RNA fragments with sequences 5′–UCCUGCUUCAACAGUGCUUGGACGGAAC–3′ and the predicted structure (as shown) were used as controls for RNA specificity. BSA was used as a protein control</p>
</caption>
<graphic xlink:href="12929_2018_449_Fig4_HTML" id="MO4"></graphic>
</fig>
</p>
<p id="Par26">Although the structure of the full-length MERS-CoV N protein has not been determined, a recent study revealed structural features of the N-terminal region of MERS-CoV in common with SARS-CoV and other coronaviruses [
<xref ref-type="bibr" rid="CR28">28</xref>
<xref ref-type="bibr" rid="CR30">30</xref>
]. The N protein of coronavirus is structurally organized into two domains, the N-terminal domain (NTD) and C-terminal domain (CTD), which are separated by a flexible linker (Fig. 
<xref rid="Fig5" ref-type="fig">5</xref>
). The NTD structure is organized as an antiparallel β-sheet core domain with disordered loops, whereas the CTD is composed of mainly α-helices. Previous studies demonstrated that the CTD of the SARS-CoV N protein is involved in oligomerization to form a capsid structure, whereas both domains may be involved in RNA binding [
<xref ref-type="bibr" rid="CR19">19</xref>
,
<xref ref-type="bibr" rid="CR30">30</xref>
<xref ref-type="bibr" rid="CR34">34</xref>
]. In addition, the linker is able to modulate the RNA binding activity of the NTD and CTD [
<xref ref-type="bibr" rid="CR35">35</xref>
]. In this study, the RNA-binding characteristics of the MERS-CoV N protein were examined by analyzing the interactions between the SL19805
<sub>ME</sub>
RNA and various fragments of the N protein. Following expression and purification of the His-tagged N proteins (Fig.
<xref rid="Fig5" ref-type="fig">5a</xref>
), a filter binding assay was performed. The results demonstrated the RNA binding activities of the full-length N protein and both the N(1–263) and N(239–413) fragments that represent the NTD plus the flexible linker and the CTD, respectively (Fig.
<xref rid="Fig5" ref-type="fig">5b</xref>
). Nevertheless, when deleting a part of the β-sheet structure of the NTD, the N(1–156) fragment had a lower RNA-binding activity compared to that of the N(1–263) fragment, which indicated that the structural integrity of the NTD could be important for RNA binding. However, a 25-amino-acid N-terminal deletion from the N(239–413) fragment, which generated the N(264–413) fragment, had little effect on the RNA-binding activity. These results indicate that both the NTD and CTD of the MERS-CoV N protein could interact with SL19805
<sub>ME</sub>
, which is a 45-nt stable stem-loop structure in the viral RNA packaging signal.
<fig id="Fig5">
<label>Fig. 5</label>
<caption>
<p>The RNA binding activity of MERS-CoV N fragments.
<bold>a</bold>
Purification of various N fragments. Purification of the full-length (FL) N protein and its subdomains N(1–263), N(264–413), N(1–156), and N(239–413) followed the procedures as described in the legend of Fig.
<xref rid="Fig4" ref-type="fig">4</xref>
. Coomassie blue staining and Western blot analysis are shown.
<bold>b</bold>
Schematic representation of the N subdomains and the filter binding assay. The N protein of coronavirus is organized into two structural domains (NTD and CTD) separated by a flexible linker. The NTD structure mainly has an antiparallel β-sheet core domain, whereas the CTD is composed of mainly α-helices [
<xref ref-type="bibr" rid="CR29">29</xref>
,
<xref ref-type="bibr" rid="CR30">30</xref>
,
<xref ref-type="bibr" rid="CR33">33</xref>
]. The secondary structural elements are indicated by triangles for β-sheets and cylinders for α-helices, and those shown above the N protein fragments (closed boxes) correspond to the structure of the MERS-CoV N protein, whereas those shown under the boxes correspond to the SARS-CoV N protein. The filter binding assay was conducted with the biotin-SL19805
<sub>ME</sub>
and increasing amounts of the N proteins and BSA control as indicated</p>
</caption>
<graphic xlink:href="12929_2018_449_Fig5_HTML" id="MO5"></graphic>
</fig>
</p>
<p id="Par27">Furthermore, although the heterologous mRNA GFP-PS580 containing the SARS-CoV RNA packaging signal could not be assembled into MERS VLPs (Fig.
<xref rid="Fig3" ref-type="fig">3c</xref>
; VLP/PS
<sub>SA</sub>
), the SL19893
<sub>SA</sub>
that represents a 50-nt conserved stem-loop structure within the PS580 showed its ability to interact with the MERS-CoV N protein (Fig. 
<xref rid="Fig6" ref-type="fig">6</xref>
). Nevertheless, the binding activity was much lower than that of the SL19805
<sub>ME</sub>
. This result suggests that interaction of the viral RNA with the N protein may be a prerequisite but not sufficient for RNA packaging into VLPs. Virus-specific RNA sequences and structures may determine the binding activity of the N protein. In addition, subsequent interactions between the N protein and other viral structural proteins may facilitate assembly of the viral RNA into VLPs.
<fig id="Fig6">
<label>Fig. 6</label>
<caption>
<p>The RNA binding activity of the MERS-CoV N protein on SL19805
<sub>ME</sub>
and SL19893
<sub>SA</sub>
. A filter binding assay was performed with MERS-CoV N proteins and the 50-nt biotin-labeled SARS-CoV RNA (SL19893
<sub>SA</sub>
). The control RNAs and proteins are described in the legend of Fig.
<xref rid="Fig4" ref-type="fig">4</xref>
</p>
</caption>
<graphic xlink:href="12929_2018_449_Fig6_HTML" id="MO6"></graphic>
</fig>
</p>
</sec>
</sec>
<sec id="Sec16">
<title>Discussion</title>
<p id="Par28">Our previous study on SARS-CoV indicated an N protein-dependent package of the viral RNA. The RNA packaging signal was biologically identified and located within the viral genome spanning nt 19,715 to 20,294 [
<xref ref-type="bibr" rid="CR19">19</xref>
]. In this study, the prediction from the sequence and structure analysis localized the putative MERS-CoV packaging signal to the 3’ end of the ORF 1b of the viral genome (Fig.
<xref rid="Fig1" ref-type="fig">1</xref>
). Further studies demonstrated that the 258-nt PS258(19712–19969)
<sub>ME</sub>
RNA fragment could function as a packaging signal and drive the packaging of the heterologous GFP gene into the MERS VLPs (Fig.
<xref rid="Fig3" ref-type="fig">3c</xref>
). Minimum sequences and structures required for RNA packaging need to be further elucidated. Nevertheless, the in vitro RNA binding assay demonstrated an interaction between the viral N protein and a 45-nt stable stem-loop structure within the functionally identified packaging signal of the MERS-CoV RNA (Figs. 
<xref rid="Fig4" ref-type="fig">4</xref>
and
<xref rid="Fig5" ref-type="fig">5</xref>
).</p>
<p id="Par29">Previously, studies on MHV mapped a 69-nt stem-loop RNA structure as the core packaging signal of MHV, and a 190-nt RNA fragment containing the core packaging signal has a much higher packaging activity [
<xref ref-type="bibr" rid="CR13">13</xref>
,
<xref ref-type="bibr" rid="CR25">25</xref>
]. In addition, the packaging signal selectively interacts with the viral M protein, which drives the packaging of the viral RNA into the virus particles [
<xref ref-type="bibr" rid="CR25">25</xref>
]. Studies on various coronaviruses indicate that coronaviruses could package the RNA fragments containing their own packaging signals [
<xref ref-type="bibr" rid="CR15">15</xref>
,
<xref ref-type="bibr" rid="CR16">16</xref>
,
<xref ref-type="bibr" rid="CR19">19</xref>
]. In this study, we further demonstrated that MERS VLPs could package the PS258(19712–19969)
<sub>ME</sub>
RNA fragment of MERS-CoV, but not the SARS-CoV packaging signal PS580 (Fig.
<xref rid="Fig3" ref-type="fig">3c</xref>
). This suggests a specificity of the MERS-CoV RNA packaging. In addition, the involvement of the N protein in genome packaging may vary among the different coronaviruses. Previous studies demonstrate an N-dependent packaging of the SARS-CoV RNA packaging signal [
<xref ref-type="bibr" rid="CR19">19</xref>
], but an N-independent packaging of the MHV RNA fragment was also suggested [
<xref ref-type="bibr" rid="CR24">24</xref>
,
<xref ref-type="bibr" rid="CR25">25</xref>
]. In this study, an N-dependent packaging of MERS-CoV RNA was demonstrated (Fig.
<xref rid="Fig3" ref-type="fig">3c</xref>
).</p>
<p id="Par30">The N protein of coronaviruses can be divided into two structural domains (NTD and CTD) and three intrinsically disordered regions (the N-arm, central linker region and C-tail) [
<xref ref-type="bibr" rid="CR10">10</xref>
,
<xref ref-type="bibr" rid="CR36">36</xref>
]. Previous studies demonstrated the involvement of both the structural domains in binding the RNA of SARS-CoV and MHV (either independently or cooperatively as a bipartite) and showed the involvement of the C-terminal domain in oligomerization of the N protein [
<xref ref-type="bibr" rid="CR19">19</xref>
,
<xref ref-type="bibr" rid="CR30">30</xref>
<xref ref-type="bibr" rid="CR34">34</xref>
,
<xref ref-type="bibr" rid="CR36">36</xref>
<xref ref-type="bibr" rid="CR38">38</xref>
]. In this study, the RNA-binding activity was demonstrated for the full-length N protein and both the N(1–263) and N(239–413) fragments that represent the NTD plus the flexible central linker region and the CTD, respectively (Fig.
<xref rid="Fig5" ref-type="fig">5</xref>
). The reduced RNA-binding activity of the N(1–156) fragment may indicate a critical role of the structural integrity of NTD. Alternatively, the central linker region may play a role in RNA binding. However, the N(264–413) fragment that lacks the N-terminal 25 amino acids of the N(239–413) fragment has an RNA-binding activity comparable to the N(239–413). This is different from the observation that the absence of the N-terminal 22 amino acids of SARS CoV N protein CTD significantly diminished its interaction with RNA [
<xref ref-type="bibr" rid="CR31">31</xref>
]. Critical structures and sequences of the MERS-CoV N protein involved in RNA binding could be further studied. The MERS VLP system, which was established here for studying virus assembly and infection, could be used as a model system for evaluation of the efficacy of antiviral drugs.</p>
</sec>
<sec id="Sec17">
<title>Conclusions</title>
<p id="Par31">In this study, a MERS-CoV RNA packaging signal was identified by the detection of GFP expression following incubation of the MERS VLPs carrying the heterologous mRNA GFP-PS258(19712–19969)
<sub>ME</sub>
with the virus permissive Huh 7 cells. Both the NTD and CTD of the MERS-CoV N protein showed binding activity to the 45-nt SL19805
<sub>ME</sub>
RNA fragment that forms a stable stem-loop substructure of the viral RNA packaging signal PS258(19712–19969)
<sub>ME</sub>
. The MERS VLP system could help us understand virus infection and morphogenesis.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgements</title>
<p>We gratefully acknowledge Haagmans BL and Osterhaus AD for providing plasmid pCR4-MERS-S1-Topo.</p>
<sec id="FPar1">
<title>Funding</title>
<p id="Par32">This work was supported by Research Grants 102–2321-B-002-028 and 107–2321-B-002-023 from the Ministry of Science and Technology, Republic of China.</p>
</sec>
<sec id="FPar2" sec-type="data-availability">
<title>Availability of data and materials</title>
<p id="Par33">All data generated or analyzed during this study are included in this article.</p>
</sec>
</ack>
<notes notes-type="author-contribution">
<title>Authors’ contributions</title>
<p>WCH and CHC conceived the study, carried out most of the experiments and analyzed data. WCH drafted the manuscript. WCH, CHC, and CYC all participated in plasmid construction. CYC, WHP, and CLC provided technical assistance on the electron microscopic analysis of MERS VLPs. MFC and SCC conceived the study, participated in its design and coordination, provided technical assistance and revised the manuscript. All authors read and approved the final version of the manuscript.</p>
</notes>
<notes>
<title>Ethics approval and consent to participate</title>
<p id="Par34">Not applicable.</p>
</notes>
<notes notes-type="COI-statement">
<title>Competing interests</title>
<p id="Par35">The authors declare that they have no competing interests.</p>
</notes>
<notes>
<title>Publisher’s Note</title>
<p id="Par36">Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.</p>
</notes>
<ref-list id="Bib1">
<title>References</title>
<ref id="CR1">
<label>1.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zaki</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>van Boheemen</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Bestebroer</surname>
<given-names>TM</given-names>
</name>
<name>
<surname>Osterhaus</surname>
<given-names>AD</given-names>
</name>
<name>
<surname>Fouchier</surname>
<given-names>RA</given-names>
</name>
</person-group>
<article-title>Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia</article-title>
<source>N Engl J Med</source>
<year>2012</year>
<volume>367</volume>
<fpage>1814</fpage>
<lpage>1820</lpage>
<pub-id pub-id-type="doi">10.1056/NEJMoa1211721</pub-id>
<pub-id pub-id-type="pmid">23075143</pub-id>
</element-citation>
</ref>
<ref id="CR2">
<label>2.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Raj</surname>
<given-names>VS</given-names>
</name>
<name>
<surname>Mou</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Smits</surname>
<given-names>SL</given-names>
</name>
<name>
<surname>Dekkers</surname>
<given-names>DH</given-names>
</name>
<name>
<surname>Muller</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Dijkman</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Muth</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Demmers</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Zaki</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Fouchier</surname>
<given-names>RA</given-names>
</name>
<name>
<surname>Thiel</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Drosten</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Rottier</surname>
<given-names>PJ</given-names>
</name>
<name>
<surname>Osterhaus</surname>
<given-names>AD</given-names>
</name>
<name>
<surname>Bosch</surname>
<given-names>BJ</given-names>
</name>
<name>
<surname>Haagmans</surname>
<given-names>BL</given-names>
</name>
</person-group>
<article-title>Dipeptidyl peptidase 4 is a functional receptor for the emerging human coronavirus-EMC</article-title>
<source>Nature</source>
<year>2013</year>
<volume>495</volume>
<fpage>251</fpage>
<lpage>254</lpage>
<pub-id pub-id-type="doi">10.1038/nature12005</pub-id>
<pub-id pub-id-type="pmid">23486063</pub-id>
</element-citation>
</ref>
<ref id="CR3">
<label>3.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Qi</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Bao</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>GF</given-names>
</name>
</person-group>
<article-title>Molecular basis of binding between novel human coronavirus MERS-CoV and its receptor CD26</article-title>
<source>Nature</source>
<year>2013</year>
<volume>500</volume>
<fpage>227</fpage>
<lpage>231</lpage>
<pub-id pub-id-type="doi">10.1038/nature12328</pub-id>
<pub-id pub-id-type="pmid">23831647</pub-id>
</element-citation>
</ref>
<ref id="CR4">
<label>4.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pasternak</surname>
<given-names>AO</given-names>
</name>
<name>
<surname>Spaan</surname>
<given-names>WJ</given-names>
</name>
<name>
<surname>Snijder</surname>
<given-names>EJ</given-names>
</name>
</person-group>
<article-title>Nidovirus transcription: how to make sense...?</article-title>
<source>J Gen Virol</source>
<year>2006</year>
<volume>87</volume>
<fpage>1403</fpage>
<lpage>1421</lpage>
<pub-id pub-id-type="doi">10.1099/vir.0.81611-0</pub-id>
<pub-id pub-id-type="pmid">16690906</pub-id>
</element-citation>
</ref>
<ref id="CR5">
<label>5.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stadler</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Masignani</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Eickmann</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Becker</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Abrignani</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Klenk</surname>
<given-names>HD</given-names>
</name>
<name>
<surname>Rappuoli</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>SARS--beginning to understand a new virus</article-title>
<source>Nat Rev Microbiol</source>
<year>2003</year>
<volume>1</volume>
<fpage>209</fpage>
<lpage>218</lpage>
<pub-id pub-id-type="doi">10.1038/nrmicro775</pub-id>
<pub-id pub-id-type="pmid">15035025</pub-id>
</element-citation>
</ref>
<ref id="CR6">
<label>6.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dires</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Dawo</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Review on Middle East respiratory syndrome</article-title>
<source>Open Acc Lib J</source>
<year>2015</year>
<volume>2</volume>
<fpage>e1749</fpage>
</element-citation>
</ref>
<ref id="CR7">
<label>7.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boscarino</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Logan</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Lacny</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Gallagher</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Envelope protein palmitoylations are crucial for murine coronavirus assembly</article-title>
<source>J Virol</source>
<year>2008</year>
<volume>82</volume>
<fpage>2989</fpage>
<lpage>2999</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.01906-07</pub-id>
<pub-id pub-id-type="pmid">18184706</pub-id>
</element-citation>
</ref>
<ref id="CR8">
<label>8.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Haan</surname>
<given-names>CA</given-names>
</name>
<name>
<surname>Vennema</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Rottier</surname>
<given-names>PJ</given-names>
</name>
</person-group>
<article-title>Assembly of the coronavirus envelope: homotypic interactions between the M proteins</article-title>
<source>J Virol</source>
<year>2000</year>
<volume>74</volume>
<fpage>4967</fpage>
<lpage>4978</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.74.11.4967-4978.2000</pub-id>
<pub-id pub-id-type="pmid">10799570</pub-id>
</element-citation>
</ref>
<ref id="CR9">
<label>9.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vennema</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Godeke</surname>
<given-names>GJ</given-names>
</name>
<name>
<surname>Rossen</surname>
<given-names>JW</given-names>
</name>
<name>
<surname>Voorhout</surname>
<given-names>WF</given-names>
</name>
<name>
<surname>Horzinek</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Opstelten</surname>
<given-names>DJ</given-names>
</name>
<name>
<surname>Rottier</surname>
<given-names>PJ</given-names>
</name>
</person-group>
<article-title>Nucleocapsid-independent assembly of coronavirus-like particles by co-expression of viral envelope protein genes</article-title>
<source>EMBO J</source>
<year>1996</year>
<volume>15</volume>
<fpage>2020</fpage>
<lpage>2028</lpage>
<pub-id pub-id-type="doi">10.1002/j.1460-2075.1996.tb00553.x</pub-id>
<pub-id pub-id-type="pmid">8617249</pub-id>
</element-citation>
</ref>
<ref id="CR10">
<label>10.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname>
<given-names>CK</given-names>
</name>
<name>
<surname>Lo</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>YS</given-names>
</name>
<name>
<surname>Hou</surname>
<given-names>MH</given-names>
</name>
</person-group>
<article-title>Recent insights into the development of therapeutics against coronavirus diseases by targeting N protein</article-title>
<source>Drug Discov Today</source>
<year>2016</year>
<volume>21</volume>
<fpage>562</fpage>
<lpage>572</lpage>
<pub-id pub-id-type="doi">10.1016/j.drudis.2015.11.015</pub-id>
<pub-id pub-id-type="pmid">26691874</pub-id>
</element-citation>
</ref>
<ref id="CR11">
<label>11.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kuo</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Koetzner</surname>
<given-names>CA</given-names>
</name>
<name>
<surname>Hurst</surname>
<given-names>KR</given-names>
</name>
<name>
<surname>Masters</surname>
<given-names>PS</given-names>
</name>
</person-group>
<article-title>Recognition of the murine coronavirus genomic RNA packaging signal depends on the second RNA-binding domain of the nucleocapsid protein</article-title>
<source>J Virol</source>
<year>2014</year>
<volume>88</volume>
<fpage>4451</fpage>
<lpage>4465</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.03866-13</pub-id>
<pub-id pub-id-type="pmid">24501403</pub-id>
</element-citation>
</ref>
<ref id="CR12">
<label>12.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Molenkamp</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Spaan</surname>
<given-names>WJM</given-names>
</name>
</person-group>
<article-title>Identification of a specific interaction between the coronavirus mouse hepatitis virus A59 nucleocapsid protein and packaging signal</article-title>
<source>Virology</source>
<year>1997</year>
<volume>239</volume>
<fpage>78</fpage>
<lpage>86</lpage>
<pub-id pub-id-type="doi">10.1006/viro.1997.8867</pub-id>
<pub-id pub-id-type="pmid">9426448</pub-id>
</element-citation>
</ref>
<ref id="CR13">
<label>13.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fosmire</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Hwang</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Makino</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Identification and characterization of a coronavirus packaging signal</article-title>
<source>J Virol</source>
<year>1992</year>
<volume>66</volume>
<fpage>3522</fpage>
<lpage>3530</lpage>
<pub-id pub-id-type="pmid">1316465</pub-id>
</element-citation>
</ref>
<ref id="CR14">
<label>14.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kuo</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Masters</surname>
<given-names>PS</given-names>
</name>
</person-group>
<article-title>Functional analysis of the murine coronavirus genomic RNA packaging signal</article-title>
<source>J Virol</source>
<year>2013</year>
<volume>87</volume>
<fpage>5182</fpage>
<lpage>5192</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.00100-13</pub-id>
<pub-id pub-id-type="pmid">23449786</pub-id>
</element-citation>
</ref>
<ref id="CR15">
<label>15.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Woo</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Joo</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Narayanan</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>KH</given-names>
</name>
<name>
<surname>Makino</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Murine coronavirus packaging signal confers packaging to nonviral RNA</article-title>
<source>J Virol</source>
<year>1997</year>
<volume>71</volume>
<fpage>824</fpage>
<lpage>827</lpage>
<pub-id pub-id-type="pmid">8985424</pub-id>
</element-citation>
</ref>
<ref id="CR16">
<label>16.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cologna</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Hogue</surname>
<given-names>BG</given-names>
</name>
</person-group>
<article-title>Identification of a bovine coronavirus packaging signal</article-title>
<source>J Virol</source>
<year>2000</year>
<volume>74</volume>
<fpage>580</fpage>
<lpage>583</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.74.1.580-583.2000</pub-id>
<pub-id pub-id-type="pmid">10590153</pub-id>
</element-citation>
</ref>
<ref id="CR17">
<label>17.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>van den Born</surname>
<given-names>E</given-names>
</name>
<name>
<surname>van den Worm</surname>
<given-names>SH</given-names>
</name>
<name>
<surname>Pleij</surname>
<given-names>CW</given-names>
</name>
<name>
<surname>Snijder</surname>
<given-names>EJ</given-names>
</name>
<name>
<surname>Olsthoorn</surname>
<given-names>RC</given-names>
</name>
</person-group>
<article-title>New structure model for the packaging signal in the genome of group IIa coronaviruses</article-title>
<source>J Virol</source>
<year>2007</year>
<volume>81</volume>
<fpage>6771</fpage>
<lpage>6774</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.02231-06</pub-id>
<pub-id pub-id-type="pmid">17428856</pub-id>
</element-citation>
</ref>
<ref id="CR18">
<label>18.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>Olsthoorn</surname>
<given-names>RC</given-names>
</name>
</person-group>
<article-title>Group-specific structural features of the 5’-proximal sequences of coronavirus genomic RNAs</article-title>
<source>Virology</source>
<year>2010</year>
<volume>401</volume>
<fpage>29</fpage>
<lpage>41</lpage>
<pub-id pub-id-type="doi">10.1016/j.virol.2010.02.007</pub-id>
<pub-id pub-id-type="pmid">20202661</pub-id>
</element-citation>
</ref>
<ref id="CR19">
<label>19.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hsieh</surname>
<given-names>PK</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>CC</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>TT</given-names>
</name>
<name>
<surname>Hsiao</surname>
<given-names>CW</given-names>
</name>
<name>
<surname>Kou</surname>
<given-names>YH</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>IY</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>CK</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>TH</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>MF</given-names>
</name>
</person-group>
<article-title>Assembly of severe acute respiratory syndrome coronavirus RNA packaging signal into virus-like particles is nucleocapsid dependent</article-title>
<source>J Virol</source>
<year>2005</year>
<volume>79</volume>
<fpage>13848</fpage>
<lpage>13855</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.79.22.13848-13855.2005</pub-id>
<pub-id pub-id-type="pmid">16254320</pub-id>
</element-citation>
</ref>
<ref id="CR20">
<label>20.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Escors</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Izeta</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Capiscol</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Enjuanes</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Transmissible gastroenteritis coronavirus packaging signal is located at the 5′ end of the virus genome</article-title>
<source>J Virol</source>
<year>2003</year>
<volume>77</volume>
<fpage>7890</fpage>
<lpage>7902</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.77.14.7890-7902.2003</pub-id>
<pub-id pub-id-type="pmid">12829829</pub-id>
</element-citation>
</ref>
<ref id="CR21">
<label>21.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morales</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Mateos-Gomez</surname>
<given-names>PA</given-names>
</name>
<name>
<surname>Capiscol</surname>
<given-names>C</given-names>
</name>
<name>
<surname>del Palacio</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Enjuanes</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Sola</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Transmissible gastroenteritis coronavirus genome packaging signal is located at the 5′ end of the genome and promotes viral RNA incorporation into virions in a replication-independent process</article-title>
<source>J Virol</source>
<year>2013</year>
<volume>87</volume>
<fpage>11579</fpage>
<lpage>11590</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.01836-13</pub-id>
<pub-id pub-id-type="pmid">23966403</pub-id>
</element-citation>
</ref>
<ref id="CR22">
<label>22.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Penzes</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Tibbles</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Shaw</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Britton</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Brown</surname>
<given-names>TD</given-names>
</name>
<name>
<surname>Cavanagh</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Characterization of a replicating and packaged defective RNA of avian coronavirus infectious bronchitis virus</article-title>
<source>Virology</source>
<year>1994</year>
<volume>203</volume>
<fpage>286</fpage>
<lpage>293</lpage>
<pub-id pub-id-type="doi">10.1006/viro.1994.1486</pub-id>
<pub-id pub-id-type="pmid">8053152</pub-id>
</element-citation>
</ref>
<ref id="CR23">
<label>23.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dalton</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Casais</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Shaw</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Stirrups</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Evans</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Britton</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Brown</surname>
<given-names>TD</given-names>
</name>
<name>
<surname>Cavanagh</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Cis-acting sequences required for coronavirus infectious bronchitis virus defective-RNA replication and packaging</article-title>
<source>J Virol</source>
<year>2001</year>
<volume>75</volume>
<fpage>125</fpage>
<lpage>133</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.75.1.125-133.2001</pub-id>
<pub-id pub-id-type="pmid">11119581</pub-id>
</element-citation>
</ref>
<ref id="CR24">
<label>24.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Narayanan</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>CJ</given-names>
</name>
<name>
<surname>Maeda</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Makino</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Nucleocapsid-independent specific viral RNA packaging via viral envelope protein and viral RNA signal</article-title>
<source>J Virol</source>
<year>2003</year>
<volume>77</volume>
<fpage>2922</fpage>
<lpage>2927</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.77.5.2922-2927.2003</pub-id>
<pub-id pub-id-type="pmid">12584316</pub-id>
</element-citation>
</ref>
<ref id="CR25">
<label>25.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Narayanan</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Makino</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Cooperation of an RNA packaging signal and a viral envelope protein in coronavirus RNA packaging</article-title>
<source>J Virol</source>
<year>2001</year>
<volume>75</volume>
<fpage>9059</fpage>
<lpage>9067</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.75.19.9059-9067.2001</pub-id>
<pub-id pub-id-type="pmid">11533169</pub-id>
</element-citation>
</ref>
<ref id="CR26">
<label>26.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kuo</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Koetzner</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Masters</surname>
<given-names>PS</given-names>
</name>
</person-group>
<article-title>A key role for the carboxy-terminal tail of the murine coronavirus nucleocapsid protein in coordination of genome packaging</article-title>
<source>Virology</source>
<year>2016</year>
<volume>494</volume>
<fpage>100</fpage>
<lpage>107</lpage>
<pub-id pub-id-type="doi">10.1016/j.virol.2016.04.009</pub-id>
<pub-id pub-id-type="pmid">27105451</pub-id>
</element-citation>
</ref>
<ref id="CR27">
<label>27.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname>
<given-names>MF</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>CY</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>CJ</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>SC</given-names>
</name>
</person-group>
<article-title>Functional motifs of delta antigen essential for RNA binding and replication of hepatitis delta virus</article-title>
<source>J Virol</source>
<year>1993</year>
<volume>67</volume>
<fpage>2529</fpage>
<lpage>2536</lpage>
<pub-id pub-id-type="pmid">8474158</pub-id>
</element-citation>
</ref>
<ref id="CR28">
<label>28.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname>
<given-names>CK</given-names>
</name>
<name>
<surname>Hou</surname>
<given-names>MH</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>CF</given-names>
</name>
<name>
<surname>Hsiao</surname>
<given-names>CD</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>TH</given-names>
</name>
</person-group>
<article-title>The SARS coronavirus nucleocapsid protein--forms and functions</article-title>
<source>Antivir Res</source>
<year>2014</year>
<volume>103</volume>
<fpage>39</fpage>
<lpage>50</lpage>
<pub-id pub-id-type="doi">10.1016/j.antiviral.2013.12.009</pub-id>
<pub-id pub-id-type="pmid">24418573</pub-id>
</element-citation>
</ref>
<ref id="CR29">
<label>29.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Papageorgiou</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Lichière</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Baklouti</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Ferron</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Sévajol</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Canard</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Coutard</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>Structural characterization of the N-terminal part of the MERS-CoV nucleocapsid by X-ray diffraction and small-angle X-ray scattering</article-title>
<source>Acta Crystallogr D Struct Biol</source>
<year>2016</year>
<volume>72</volume>
<fpage>192</fpage>
<lpage>202</lpage>
<pub-id pub-id-type="doi">10.1107/S2059798315024328</pub-id>
<pub-id pub-id-type="pmid">26894667</pub-id>
</element-citation>
</ref>
<ref id="CR30">
<label>30.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saikatendu</surname>
<given-names>KS</given-names>
</name>
<name>
<surname>Joseph</surname>
<given-names>JS</given-names>
</name>
<name>
<surname>Subramanian</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Neuman</surname>
<given-names>BW</given-names>
</name>
<name>
<surname>Buchmeier</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Stevens</surname>
<given-names>RC</given-names>
</name>
<name>
<surname>Kuhn</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Ribonucleocapsid formation of severe acute respiratory syndrome coronavirus through molecular action of the N-terminal domain of N protein</article-title>
<source>J Virol</source>
<year>2007</year>
<volume>81</volume>
<fpage>3913</fpage>
<lpage>3921</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.02236-06</pub-id>
<pub-id pub-id-type="pmid">17229691</pub-id>
</element-citation>
</ref>
<ref id="CR31">
<label>31.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>CY</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>CK</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>YW</given-names>
</name>
<name>
<surname>Sue</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>Bai</surname>
<given-names>HI</given-names>
</name>
<name>
<surname>Riang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Hsiao</surname>
<given-names>CD</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>TH</given-names>
</name>
</person-group>
<article-title>Structure of the SARS coronavirus nucleocapsid protein RNA-binding dimerization domain suggests a mechanism for helical packaging of viral RNA</article-title>
<source>J Mol Biol</source>
<year>2007</year>
<volume>368</volume>
<fpage>1075</fpage>
<lpage>1086</lpage>
<pub-id pub-id-type="doi">10.1016/j.jmb.2007.02.069</pub-id>
<pub-id pub-id-type="pmid">17379242</pub-id>
</element-citation>
</ref>
<ref id="CR32">
<label>32.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Carboxyl terminus of severe acute respiratory syndrome coronavirus nucleocapsid protein: self-association analysis and nucleic acid binding characterization</article-title>
<source>Biochemistry</source>
<year>2006</year>
<volume>45</volume>
<fpage>11827</fpage>
<lpage>11835</lpage>
<pub-id pub-id-type="doi">10.1021/bi0609319</pub-id>
<pub-id pub-id-type="pmid">17002283</pub-id>
</element-citation>
</ref>
<ref id="CR33">
<label>33.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takeda</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>CK</given-names>
</name>
<name>
<surname>Ikeya</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Güntert</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>YH</given-names>
</name>
<name>
<surname>Hsu</surname>
<given-names>YL</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>TH</given-names>
</name>
<name>
<surname>Kainosho</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Solution structure of the C-terminal dimerization domain of SARS coronavirus nucleocapsid protein solved by the SAIL-NMR method</article-title>
<source>J Mol Biol</source>
<year>2008</year>
<volume>380</volume>
<fpage>608</fpage>
<lpage>622</lpage>
<pub-id pub-id-type="doi">10.1016/j.jmb.2007.11.093</pub-id>
<pub-id pub-id-type="pmid">18561946</pub-id>
</element-citation>
</ref>
<ref id="CR34">
<label>34.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname>
<given-names>IM</given-names>
</name>
<name>
<surname>Gustafson</surname>
<given-names>CL</given-names>
</name>
<name>
<surname>Diao</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Burgner</surname>
<given-names>JW</given-names>
<suffix>II</suffix>
</name>
<name>
<surname>Li</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Recombinant severe acute respiratory syndrome (SARS) coronavirus nucleocapsid protein forms a dimer through its C-terminal domain</article-title>
<source>J Biol Chem</source>
<year>2005</year>
<volume>280</volume>
<fpage>23280</fpage>
<lpage>23286</lpage>
<pub-id pub-id-type="doi">10.1074/jbc.M501015200</pub-id>
<pub-id pub-id-type="pmid">15849181</pub-id>
</element-citation>
</ref>
<ref id="CR35">
<label>35.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname>
<given-names>CK</given-names>
</name>
<name>
<surname>Hsu</surname>
<given-names>YL</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>YH</given-names>
</name>
<name>
<surname>Chao</surname>
<given-names>FA</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>YS</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>CK</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>TH</given-names>
</name>
</person-group>
<article-title>Multiple nucleic acid binding sites and intrinsic disorder of severe acute respiratory syndrome coronavirus nucleocapsid protein: implications for ribonucleocapsid protein packaging</article-title>
<source>J Virol</source>
<year>2009</year>
<volume>83</volume>
<fpage>2255</fpage>
<lpage>2264</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.02001-08</pub-id>
<pub-id pub-id-type="pmid">19052082</pub-id>
</element-citation>
</ref>
<ref id="CR36">
<label>36.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname>
<given-names>CK</given-names>
</name>
<name>
<surname>Sue</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>TH</given-names>
</name>
<name>
<surname>Hsieh</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Tsai</surname>
<given-names>CK</given-names>
</name>
<name>
<surname>Chiang</surname>
<given-names>YC</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>SJ</given-names>
</name>
<name>
<surname>Hsiao</surname>
<given-names>HH</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>WJ</given-names>
</name>
<name>
<surname>Chang</surname>
<given-names>WL</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>CH</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>TH</given-names>
</name>
</person-group>
<article-title>Modular organization of SARS coronavirus nucleocapsid protein</article-title>
<source>J Biomed Sci</source>
<year>2006</year>
<volume>13</volume>
<fpage>59</fpage>
<lpage>72</lpage>
<pub-id pub-id-type="doi">10.1007/s11373-005-9035-9</pub-id>
<pub-id pub-id-type="pmid">16228284</pub-id>
</element-citation>
</ref>
<ref id="CR37">
<label>37.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hurst</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Koetzner</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Masters</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Identification of in vivo interacting domains of the murine coronavirus nucleocapsid protein</article-title>
<source>J Virol</source>
<year>2009</year>
<volume>83</volume>
<fpage>7221</fpage>
<lpage>7234</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.00440-09</pub-id>
<pub-id pub-id-type="pmid">19420077</pub-id>
</element-citation>
</ref>
<ref id="CR38">
<label>38.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Tong</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Lou</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Rao</surname>
<given-names>Z</given-names>
</name>
</person-group>
<article-title>Structures of the N- and C-terminal domains of MHV-A59 nucleocapsid protein corroborate a conserved RNA-protein binding mechanism in coronavirus</article-title>
<source>Protein Cell</source>
<year>2010</year>
<volume>1</volume>
<fpage>688</fpage>
<lpage>697</lpage>
<pub-id pub-id-type="doi">10.1007/s13238-010-0079-x</pub-id>
<pub-id pub-id-type="pmid">21203940</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/MersV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000388  | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000388  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    MersV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Mon Apr 20 23:26:43 2020. Site generation: Sat Mar 27 09:06:09 2021