Serveur d'exploration MERS

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Bacterial Outer Membrane Vesicles (OMVs)-Based Dual Vaccine for Influenza A H1N1 Virus and MERS-CoV

Identifieur interne : 000392 ( Pmc/Checkpoint ); précédent : 000391; suivant : 000393

Bacterial Outer Membrane Vesicles (OMVs)-Based Dual Vaccine for Influenza A H1N1 Virus and MERS-CoV

Auteurs : Mahmoud M. Shehata ; Ahmed Mostafa ; Lisa Teubner ; Sara H. Mahmoud ; Ahmed Kandeil ; Rabeh Elshesheny ; Thamer A. Boubak ; Renate Frantz ; Luigi La Pietra ; Stephan Pleschka ; Ahmed Osman ; Ghazi Kayali [Liban] ; Trinad Chakraborty ; Mohamed A. Ali ; Mobarak Abu Mraheil

Source :

RBID : PMC:6631769

Abstract

Vaccination is the most functional medical intervention to prophylactically control severe diseases caused by human-to-human or animal-to-human transmissible viral pathogens. Annually, seasonal influenza epidemics attack human populations leading to 290–650 thousand deaths/year worldwide. Recently, a novel Middle East Respiratory Syndrome Coronavirus emerged. Together, those two viruses present a significant public health burden in areas where they circulate. Herein, we generated a bacterial outer membrane vesicles (OMVs)-based vaccine presenting the antigenic stable chimeric fusion protein of the H1-type haemagglutinin (HA) of the pandemic influenza A virus (H1N1) strain from 2009 (H1N1pdm09) and the receptor binding domain (RBD) of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) (OMVs-H1/RBD). Our results showed that the chimeric antigen could induce specific neutralizing antibodies against both strains leading to protection of immunized mice against H1N1pdm09 and efficient neutralization of MERS-CoV. This study demonstrate that OMVs-based vaccines presenting viral antigens provide a safe and reliable approach to protect against two different viral infections.


Url:
DOI: 10.3390/vaccines7020046
PubMed: 31141982
PubMed Central: 6631769


Affiliations:


Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:6631769

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Bacterial Outer Membrane Vesicles (OMVs)-Based Dual Vaccine for Influenza A H1N1 Virus and MERS-CoV</title>
<author>
<name sortKey="Shehata, Mahmoud M" sort="Shehata, Mahmoud M" uniqKey="Shehata M" first="Mahmoud M." last="Shehata">Mahmoud M. Shehata</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mostafa, Ahmed" sort="Mostafa, Ahmed" uniqKey="Mostafa A" first="Ahmed" last="Mostafa">Ahmed Mostafa</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-vaccines-07-00046">Institute of Medical Virology, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>Stephan.Pleschka@viro.med.uni-giessen.de</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Teubner, Lisa" sort="Teubner, Lisa" uniqKey="Teubner L" first="Lisa" last="Teubner">Lisa Teubner</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mahmoud, Sara H" sort="Mahmoud, Sara H" uniqKey="Mahmoud S" first="Sara H." last="Mahmoud">Sara H. Mahmoud</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kandeil, Ahmed" sort="Kandeil, Ahmed" uniqKey="Kandeil A" first="Ahmed" last="Kandeil">Ahmed Kandeil</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Elshesheny, Rabeh" sort="Elshesheny, Rabeh" uniqKey="Elshesheny R" first="Rabeh" last="Elshesheny">Rabeh Elshesheny</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Boubak, Thamer A" sort="Boubak, Thamer A" uniqKey="Boubak T" first="Thamer A." last="Boubak">Thamer A. Boubak</name>
<affiliation>
<nlm:aff id="af4-vaccines-07-00046">Biological Department, Faculty of Science, King Abdul Aziz University, Jeddah 80203, Saudi Arabia;
<email>Th_ah@hotmail.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Frantz, Renate" sort="Frantz, Renate" uniqKey="Frantz R" first="Renate" last="Frantz">Renate Frantz</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Pietra, Luigi La" sort="Pietra, Luigi La" uniqKey="Pietra L" first="Luigi La" last="Pietra">Luigi La Pietra</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Pleschka, Stephan" sort="Pleschka, Stephan" uniqKey="Pleschka S" first="Stephan" last="Pleschka">Stephan Pleschka</name>
<affiliation>
<nlm:aff id="af2-vaccines-07-00046">Institute of Medical Virology, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>Stephan.Pleschka@viro.med.uni-giessen.de</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Osman, Ahmed" sort="Osman, Ahmed" uniqKey="Osman A" first="Ahmed" last="Osman">Ahmed Osman</name>
<affiliation>
<nlm:aff id="af5-vaccines-07-00046">Department of Biochemistry, Faculty of Science, Ain Shams University, Cairo 38105, Egypt;
<email>aoegiza@yahoo.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kayali, Ghazi" sort="Kayali, Ghazi" uniqKey="Kayali G" first="Ghazi" last="Kayali">Ghazi Kayali</name>
<affiliation>
<nlm:aff id="af6-vaccines-07-00046">Department of Epidemiology, Human Genetics, and Environmental Sciences, University of Texas, Houston, TX 77030, USA;
<email>ghazi@human-link.org</email>
</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af7-vaccines-07-00046">Human Link, Baabda 1109, Lebanon</nlm:aff>
<country xml:lang="fr">Liban</country>
<wicri:regionArea>Human Link, Baabda 1109</wicri:regionArea>
<wicri:noRegion>Baabda 1109</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Chakraborty, Trinad" sort="Chakraborty, Trinad" uniqKey="Chakraborty T" first="Trinad" last="Chakraborty">Trinad Chakraborty</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Ali, Mohamed A" sort="Ali, Mohamed A" uniqKey="Ali M" first="Mohamed A." last="Ali">Mohamed A. Ali</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mraheil, Mobarak Abu" sort="Mraheil, Mobarak Abu" uniqKey="Mraheil M" first="Mobarak Abu" last="Mraheil">Mobarak Abu Mraheil</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">31141982</idno>
<idno type="pmc">6631769</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6631769</idno>
<idno type="RBID">PMC:6631769</idno>
<idno type="doi">10.3390/vaccines7020046</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">001177</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">001177</idno>
<idno type="wicri:Area/Pmc/Curation">001177</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">001177</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000392</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000392</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Bacterial Outer Membrane Vesicles (OMVs)-Based Dual Vaccine for Influenza A H1N1 Virus and MERS-CoV</title>
<author>
<name sortKey="Shehata, Mahmoud M" sort="Shehata, Mahmoud M" uniqKey="Shehata M" first="Mahmoud M." last="Shehata">Mahmoud M. Shehata</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mostafa, Ahmed" sort="Mostafa, Ahmed" uniqKey="Mostafa A" first="Ahmed" last="Mostafa">Ahmed Mostafa</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-vaccines-07-00046">Institute of Medical Virology, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>Stephan.Pleschka@viro.med.uni-giessen.de</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Teubner, Lisa" sort="Teubner, Lisa" uniqKey="Teubner L" first="Lisa" last="Teubner">Lisa Teubner</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mahmoud, Sara H" sort="Mahmoud, Sara H" uniqKey="Mahmoud S" first="Sara H." last="Mahmoud">Sara H. Mahmoud</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kandeil, Ahmed" sort="Kandeil, Ahmed" uniqKey="Kandeil A" first="Ahmed" last="Kandeil">Ahmed Kandeil</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Elshesheny, Rabeh" sort="Elshesheny, Rabeh" uniqKey="Elshesheny R" first="Rabeh" last="Elshesheny">Rabeh Elshesheny</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Boubak, Thamer A" sort="Boubak, Thamer A" uniqKey="Boubak T" first="Thamer A." last="Boubak">Thamer A. Boubak</name>
<affiliation>
<nlm:aff id="af4-vaccines-07-00046">Biological Department, Faculty of Science, King Abdul Aziz University, Jeddah 80203, Saudi Arabia;
<email>Th_ah@hotmail.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Frantz, Renate" sort="Frantz, Renate" uniqKey="Frantz R" first="Renate" last="Frantz">Renate Frantz</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Pietra, Luigi La" sort="Pietra, Luigi La" uniqKey="Pietra L" first="Luigi La" last="Pietra">Luigi La Pietra</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Pleschka, Stephan" sort="Pleschka, Stephan" uniqKey="Pleschka S" first="Stephan" last="Pleschka">Stephan Pleschka</name>
<affiliation>
<nlm:aff id="af2-vaccines-07-00046">Institute of Medical Virology, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>Stephan.Pleschka@viro.med.uni-giessen.de</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Osman, Ahmed" sort="Osman, Ahmed" uniqKey="Osman A" first="Ahmed" last="Osman">Ahmed Osman</name>
<affiliation>
<nlm:aff id="af5-vaccines-07-00046">Department of Biochemistry, Faculty of Science, Ain Shams University, Cairo 38105, Egypt;
<email>aoegiza@yahoo.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kayali, Ghazi" sort="Kayali, Ghazi" uniqKey="Kayali G" first="Ghazi" last="Kayali">Ghazi Kayali</name>
<affiliation>
<nlm:aff id="af6-vaccines-07-00046">Department of Epidemiology, Human Genetics, and Environmental Sciences, University of Texas, Houston, TX 77030, USA;
<email>ghazi@human-link.org</email>
</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af7-vaccines-07-00046">Human Link, Baabda 1109, Lebanon</nlm:aff>
<country xml:lang="fr">Liban</country>
<wicri:regionArea>Human Link, Baabda 1109</wicri:regionArea>
<wicri:noRegion>Baabda 1109</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Chakraborty, Trinad" sort="Chakraborty, Trinad" uniqKey="Chakraborty T" first="Trinad" last="Chakraborty">Trinad Chakraborty</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Ali, Mohamed A" sort="Ali, Mohamed A" uniqKey="Ali M" first="Mohamed A." last="Ali">Mohamed A. Ali</name>
<affiliation>
<nlm:aff id="af1-vaccines-07-00046">Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mraheil, Mobarak Abu" sort="Mraheil, Mobarak Abu" uniqKey="Mraheil M" first="Mobarak Abu" last="Mraheil">Mobarak Abu Mraheil</name>
<affiliation>
<nlm:aff id="af3-vaccines-07-00046">Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Vaccines</title>
<idno type="eISSN">2076-393X</idno>
<imprint>
<date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Vaccination is the most functional medical intervention to prophylactically control severe diseases caused by human-to-human or animal-to-human transmissible viral pathogens. Annually, seasonal influenza epidemics attack human populations leading to 290–650 thousand deaths/year worldwide. Recently, a novel Middle East Respiratory Syndrome Coronavirus emerged. Together, those two viruses present a significant public health burden in areas where they circulate. Herein, we generated a bacterial outer membrane vesicles (OMVs)-based vaccine presenting the antigenic stable chimeric fusion protein of the H1-type haemagglutinin (HA) of the pandemic influenza A virus (H1N1) strain from 2009 (H1N1pdm09) and the receptor binding domain (RBD) of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) (OMVs-H1/RBD). Our results showed that the chimeric antigen could induce specific neutralizing antibodies against both strains leading to protection of immunized mice against H1N1pdm09 and efficient neutralization of MERS-CoV. This study demonstrate that OMVs-based vaccines presenting viral antigens provide a safe and reliable approach to protect against two different viral infections.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Bhuyan, G S" uniqKey="Bhuyan G">G.S. Bhuyan</name>
</author>
<author>
<name sortKey="Hossain, M A" uniqKey="Hossain M">M.A. Hossain</name>
</author>
<author>
<name sortKey="Sarker, S K" uniqKey="Sarker S">S.K. Sarker</name>
</author>
<author>
<name sortKey="Rahat, A" uniqKey="Rahat A">A. Rahat</name>
</author>
<author>
<name sortKey="Islam, M T" uniqKey="Islam M">M.T. Islam</name>
</author>
<author>
<name sortKey="Haque, T N" uniqKey="Haque T">T.N. Haque</name>
</author>
<author>
<name sortKey="Begum, N" uniqKey="Begum N">N. Begum</name>
</author>
<author>
<name sortKey="Qadri, S K" uniqKey="Qadri S">S.K. Qadri</name>
</author>
<author>
<name sortKey="Muraduzzaman, A K" uniqKey="Muraduzzaman A">A.K. Muraduzzaman</name>
</author>
<author>
<name sortKey="Islam, N N" uniqKey="Islam N">N.N. Islam</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Troeger, C" uniqKey="Troeger C">C. Troeger</name>
</author>
<author>
<name sortKey="Forouzanfar, M" uniqKey="Forouzanfar M">M. Forouzanfar</name>
</author>
<author>
<name sortKey="Rao, P C" uniqKey="Rao P">P.C. Rao</name>
</author>
<author>
<name sortKey="Khalil, I" uniqKey="Khalil I">I. Khalil</name>
</author>
<author>
<name sortKey="Brown, A" uniqKey="Brown A">A. Brown</name>
</author>
<author>
<name sortKey="Swartz, S" uniqKey="Swartz S">S. Swartz</name>
</author>
<author>
<name sortKey="Fullman, N" uniqKey="Fullman N">N. Fullman</name>
</author>
<author>
<name sortKey="Mosser, J" uniqKey="Mosser J">J. Mosser</name>
</author>
<author>
<name sortKey="Thompson, R L" uniqKey="Thompson R">R.L. Thompson</name>
</author>
<author>
<name sortKey="Reiner, R C" uniqKey="Reiner R">R.C. Reiner</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Potter, C W" uniqKey="Potter C">C.W. Potter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Parry, J" uniqKey="Parry J">J. Parry</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bahgat, M M" uniqKey="Bahgat M">M.M. Bahgat</name>
</author>
<author>
<name sortKey="Kutkat, M A" uniqKey="Kutkat M">M.A. Kutkat</name>
</author>
<author>
<name sortKey="Nasraa, M H" uniqKey="Nasraa M">M.H. Nasraa</name>
</author>
<author>
<name sortKey="Mostafa, A" uniqKey="Mostafa A">A. Mostafa</name>
</author>
<author>
<name sortKey="Webby, R" uniqKey="Webby R">R. Webby</name>
</author>
<author>
<name sortKey="Bahgat, I M" uniqKey="Bahgat I">I.M. Bahgat</name>
</author>
<author>
<name sortKey="Ali, M A" uniqKey="Ali M">M.A. Ali</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, H" uniqKey="Chen H">H. Chen</name>
</author>
<author>
<name sortKey="Yuan, H" uniqKey="Yuan H">H. Yuan</name>
</author>
<author>
<name sortKey="Gao, R" uniqKey="Gao R">R. Gao</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
<author>
<name sortKey="Wang, D" uniqKey="Wang D">D. Wang</name>
</author>
<author>
<name sortKey="Xiong, Y" uniqKey="Xiong Y">Y. Xiong</name>
</author>
<author>
<name sortKey="Fan, G" uniqKey="Fan G">G. Fan</name>
</author>
<author>
<name sortKey="Yang, F" uniqKey="Yang F">F. Yang</name>
</author>
<author>
<name sortKey="Li, X" uniqKey="Li X">X. Li</name>
</author>
<author>
<name sortKey="Zhou, J" uniqKey="Zhou J">J. Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shi, W" uniqKey="Shi W">W. Shi</name>
</author>
<author>
<name sortKey="Shi, Y" uniqKey="Shi Y">Y. Shi</name>
</author>
<author>
<name sortKey="Wu, Y" uniqKey="Wu Y">Y. Wu</name>
</author>
<author>
<name sortKey="Liu, D" uniqKey="Liu D">D. Liu</name>
</author>
<author>
<name sortKey="Gao, G F" uniqKey="Gao G">G.F. Gao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lessler, J" uniqKey="Lessler J">J. Lessler</name>
</author>
<author>
<name sortKey="Reich, N G" uniqKey="Reich N">N.G. Reich</name>
</author>
<author>
<name sortKey="Cummings, D A" uniqKey="Cummings D">D.A. Cummings</name>
</author>
<author>
<name sortKey="Nair, H P" uniqKey="Nair H">H.P. Nair</name>
</author>
<author>
<name sortKey="Jordan, H T" uniqKey="Jordan H">H.T. Jordan</name>
</author>
<author>
<name sortKey="Thompson, N" uniqKey="Thompson N">N. Thompson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Neumann, G" uniqKey="Neumann G">G. Neumann</name>
</author>
<author>
<name sortKey="Noda, T" uniqKey="Noda T">T. Noda</name>
</author>
<author>
<name sortKey="Kawaoka, Y" uniqKey="Kawaoka Y">Y. Kawaoka</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chafekar, A" uniqKey="Chafekar A">A. Chafekar</name>
</author>
<author>
<name sortKey="Fielding, B C" uniqKey="Fielding B">B.C. Fielding</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mostafa, A" uniqKey="Mostafa A">A. Mostafa</name>
</author>
<author>
<name sortKey="Pleschka, S" uniqKey="Pleschka S">S. Pleschka</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zost, S J" uniqKey="Zost S">S.J. Zost</name>
</author>
<author>
<name sortKey="Parkhouse, K" uniqKey="Parkhouse K">K. Parkhouse</name>
</author>
<author>
<name sortKey="Gumina, M E" uniqKey="Gumina M">M.E. Gumina</name>
</author>
<author>
<name sortKey="Kim, K" uniqKey="Kim K">K. Kim</name>
</author>
<author>
<name sortKey="Diaz Perez, S" uniqKey="Diaz Perez S">S. Diaz Perez</name>
</author>
<author>
<name sortKey="Wilson, P C" uniqKey="Wilson P">P.C. Wilson</name>
</author>
<author>
<name sortKey="Treanor, J J" uniqKey="Treanor J">J.J. Treanor</name>
</author>
<author>
<name sortKey="Sant, A J" uniqKey="Sant A">A.J. Sant</name>
</author>
<author>
<name sortKey="Cobey, S" uniqKey="Cobey S">S. Cobey</name>
</author>
<author>
<name sortKey="Hensley, S E" uniqKey="Hensley S">S.E. Hensley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wu, N C" uniqKey="Wu N">N.C. Wu</name>
</author>
<author>
<name sortKey="Zost, S J" uniqKey="Zost S">S.J. Zost</name>
</author>
<author>
<name sortKey="Thompson, A J" uniqKey="Thompson A">A.J. Thompson</name>
</author>
<author>
<name sortKey="Oyen, D" uniqKey="Oyen D">D. Oyen</name>
</author>
<author>
<name sortKey="Nycholat, C M" uniqKey="Nycholat C">C.M. Nycholat</name>
</author>
<author>
<name sortKey="Mcbride, R" uniqKey="Mcbride R">R. McBride</name>
</author>
<author>
<name sortKey="Paulson, J C" uniqKey="Paulson J">J.C. Paulson</name>
</author>
<author>
<name sortKey="Hensley, S E" uniqKey="Hensley S">S.E. Hensley</name>
</author>
<author>
<name sortKey="Wilson, I A" uniqKey="Wilson I">I.A. Wilson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gerritzen, M J H" uniqKey="Gerritzen M">M.J.H. Gerritzen</name>
</author>
<author>
<name sortKey="Martens, D E" uniqKey="Martens D">D.E. Martens</name>
</author>
<author>
<name sortKey="Wijffels, R H" uniqKey="Wijffels R">R.H. Wijffels</name>
</author>
<author>
<name sortKey="Van Der Pol, L" uniqKey="Van Der Pol L">L. van der Pol</name>
</author>
<author>
<name sortKey="Stork, M" uniqKey="Stork M">M. Stork</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Anand, D" uniqKey="Anand D">D. Anand</name>
</author>
<author>
<name sortKey="Chaudhuri, A" uniqKey="Chaudhuri A">A. Chaudhuri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zollinger, W D" uniqKey="Zollinger W">W.D. Zollinger</name>
</author>
<author>
<name sortKey="Poolman, J T" uniqKey="Poolman J">J.T. Poolman</name>
</author>
<author>
<name sortKey="Maiden, M C" uniqKey="Maiden M">M.C. Maiden</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fantappie, L" uniqKey="Fantappie L">L. Fantappie</name>
</author>
<author>
<name sortKey="De Santis, M" uniqKey="De Santis M">M. de Santis</name>
</author>
<author>
<name sortKey="Chiarot, E" uniqKey="Chiarot E">E. Chiarot</name>
</author>
<author>
<name sortKey="Carboni, F" uniqKey="Carboni F">F. Carboni</name>
</author>
<author>
<name sortKey="Bensi, G" uniqKey="Bensi G">G. Bensi</name>
</author>
<author>
<name sortKey="Jousson, O" uniqKey="Jousson O">O. Jousson</name>
</author>
<author>
<name sortKey="Margarit, I" uniqKey="Margarit I">I. Margarit</name>
</author>
<author>
<name sortKey="Grandi, G" uniqKey="Grandi G">G. Grandi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mostafa, A" uniqKey="Mostafa A">A. Mostafa</name>
</author>
<author>
<name sortKey="Kanrai, P" uniqKey="Kanrai P">P. Kanrai</name>
</author>
<author>
<name sortKey="Ziebuhr, J" uniqKey="Ziebuhr J">J. Ziebuhr</name>
</author>
<author>
<name sortKey="Pleschka, S" uniqKey="Pleschka S">S. Pleschka</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bommakanti, G" uniqKey="Bommakanti G">G. Bommakanti</name>
</author>
<author>
<name sortKey="Citron, M P" uniqKey="Citron M">M.P. Citron</name>
</author>
<author>
<name sortKey="Hepler, R W" uniqKey="Hepler R">R.W. Hepler</name>
</author>
<author>
<name sortKey="Callahan, C" uniqKey="Callahan C">C. Callahan</name>
</author>
<author>
<name sortKey="Heidecker, G J" uniqKey="Heidecker G">G.J. Heidecker</name>
</author>
<author>
<name sortKey="Najar, T A" uniqKey="Najar T">T.A. Najar</name>
</author>
<author>
<name sortKey="Lu, X" uniqKey="Lu X">X. Lu</name>
</author>
<author>
<name sortKey="Joyce, J G" uniqKey="Joyce J">J.G. Joyce</name>
</author>
<author>
<name sortKey="Shiver, J W" uniqKey="Shiver J">J.W. Shiver</name>
</author>
<author>
<name sortKey="Casimiro, D R" uniqKey="Casimiro D">D.R. Casimiro</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Alshukairi, A N" uniqKey="Alshukairi A">A.N. Alshukairi</name>
</author>
<author>
<name sortKey="Zheng, J" uniqKey="Zheng J">J. Zheng</name>
</author>
<author>
<name sortKey="Zhao, J" uniqKey="Zhao J">J. Zhao</name>
</author>
<author>
<name sortKey="Nehdi, A" uniqKey="Nehdi A">A. Nehdi</name>
</author>
<author>
<name sortKey="Baharoon, S A" uniqKey="Baharoon S">S.A. Baharoon</name>
</author>
<author>
<name sortKey="Layqah, L" uniqKey="Layqah L">L. Layqah</name>
</author>
<author>
<name sortKey="Bokhari, A" uniqKey="Bokhari A">A. Bokhari</name>
</author>
<author>
<name sortKey="Al Johani, S M" uniqKey="Al Johani S">S.M. Al Johani</name>
</author>
<author>
<name sortKey="Samman, N" uniqKey="Samman N">N. Samman</name>
</author>
<author>
<name sortKey="Boudjelal, M" uniqKey="Boudjelal M">M. Boudjelal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ali, M" uniqKey="Ali M">M. Ali</name>
</author>
<author>
<name sortKey="El Shesheny, R" uniqKey="El Shesheny R">R. El-Shesheny</name>
</author>
<author>
<name sortKey="Kandeil, A" uniqKey="Kandeil A">A. Kandeil</name>
</author>
<author>
<name sortKey="Shehata, M" uniqKey="Shehata M">M. Shehata</name>
</author>
<author>
<name sortKey="Elsokary, B" uniqKey="Elsokary B">B. Elsokary</name>
</author>
<author>
<name sortKey="Gomaa, M" uniqKey="Gomaa M">M. Gomaa</name>
</author>
<author>
<name sortKey="Hassan, N" uniqKey="Hassan N">N. Hassan</name>
</author>
<author>
<name sortKey="El Sayed, A" uniqKey="El Sayed A">A. El Sayed</name>
</author>
<author>
<name sortKey="El Taweel, A" uniqKey="El Taweel A">A. El-Taweel</name>
</author>
<author>
<name sortKey="Sobhy, H" uniqKey="Sobhy H">H. Sobhy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Raj, V S" uniqKey="Raj V">V.S. Raj</name>
</author>
<author>
<name sortKey="Mou, H" uniqKey="Mou H">H. Mou</name>
</author>
<author>
<name sortKey="Smits, S L" uniqKey="Smits S">S.L. Smits</name>
</author>
<author>
<name sortKey="Dekkers, D H" uniqKey="Dekkers D">D.H. Dekkers</name>
</author>
<author>
<name sortKey="Muller, M A" uniqKey="Muller M">M.A. Muller</name>
</author>
<author>
<name sortKey="Dijkman, R" uniqKey="Dijkman R">R. Dijkman</name>
</author>
<author>
<name sortKey="Muth, D" uniqKey="Muth D">D. Muth</name>
</author>
<author>
<name sortKey="Demmers, J A" uniqKey="Demmers J">J.A. Demmers</name>
</author>
<author>
<name sortKey="Zaki, A" uniqKey="Zaki A">A. Zaki</name>
</author>
<author>
<name sortKey="Fouchier, R A" uniqKey="Fouchier R">R.A. Fouchier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, S" uniqKey="Zhang S">S. Zhang</name>
</author>
<author>
<name sortKey="Zhou, P" uniqKey="Zhou P">P. Zhou</name>
</author>
<author>
<name sortKey="Wang, P" uniqKey="Wang P">P. Wang</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y. Li</name>
</author>
<author>
<name sortKey="Jiang, L" uniqKey="Jiang L">L. Jiang</name>
</author>
<author>
<name sortKey="Jia, W" uniqKey="Jia W">W. Jia</name>
</author>
<author>
<name sortKey="Wang, H" uniqKey="Wang H">H. Wang</name>
</author>
<author>
<name sortKey="Fan, A" uniqKey="Fan A">A. Fan</name>
</author>
<author>
<name sortKey="Wang, D" uniqKey="Wang D">D. Wang</name>
</author>
<author>
<name sortKey="Shi, X" uniqKey="Shi X">X. Shi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, C" uniqKey="Wang C">C. Wang</name>
</author>
<author>
<name sortKey="Zheng, X" uniqKey="Zheng X">X. Zheng</name>
</author>
<author>
<name sortKey="Gai, W" uniqKey="Gai W">W. Gai</name>
</author>
<author>
<name sortKey="Wong, G" uniqKey="Wong G">G. Wong</name>
</author>
<author>
<name sortKey="Wang, H" uniqKey="Wang H">H. Wang</name>
</author>
<author>
<name sortKey="Jin, H" uniqKey="Jin H">H. Jin</name>
</author>
<author>
<name sortKey="Feng, N" uniqKey="Feng N">N. Feng</name>
</author>
<author>
<name sortKey="Zhao, Y" uniqKey="Zhao Y">Y. Zhao</name>
</author>
<author>
<name sortKey="Zhang, W" uniqKey="Zhang W">W. Zhang</name>
</author>
<author>
<name sortKey="Li, N" uniqKey="Li N">N. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y. Wang</name>
</author>
<author>
<name sortKey="Tai, W" uniqKey="Tai W">W. Tai</name>
</author>
<author>
<name sortKey="Yang, J" uniqKey="Yang J">J. Yang</name>
</author>
<author>
<name sortKey="Zhao, G" uniqKey="Zhao G">G. Zhao</name>
</author>
<author>
<name sortKey="Sun, S" uniqKey="Sun S">S. Sun</name>
</author>
<author>
<name sortKey="Tseng, C K" uniqKey="Tseng C">C.K. Tseng</name>
</author>
<author>
<name sortKey="Jiang, S" uniqKey="Jiang S">S. Jiang</name>
</author>
<author>
<name sortKey="Zhou, Y" uniqKey="Zhou Y">Y. Zhou</name>
</author>
<author>
<name sortKey="Du, L" uniqKey="Du L">L. Du</name>
</author>
<author>
<name sortKey="Gao, J" uniqKey="Gao J">J. Gao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Du, L" uniqKey="Du L">L. Du</name>
</author>
<author>
<name sortKey="Kou, Z" uniqKey="Kou Z">Z. Kou</name>
</author>
<author>
<name sortKey="Ma, C" uniqKey="Ma C">C. Ma</name>
</author>
<author>
<name sortKey="Tao, X" uniqKey="Tao X">X. Tao</name>
</author>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L. Wang</name>
</author>
<author>
<name sortKey="Zhao, G" uniqKey="Zhao G">G. Zhao</name>
</author>
<author>
<name sortKey="Chen, Y" uniqKey="Chen Y">Y. Chen</name>
</author>
<author>
<name sortKey="Yu, F" uniqKey="Yu F">F. Yu</name>
</author>
<author>
<name sortKey="Tseng, C T" uniqKey="Tseng C">C.T. Tseng</name>
</author>
<author>
<name sortKey="Zhou, Y" uniqKey="Zhou Y">Y. Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhao, G" uniqKey="Zhao G">G. Zhao</name>
</author>
<author>
<name sortKey="He, L" uniqKey="He L">L. He</name>
</author>
<author>
<name sortKey="Sun, S" uniqKey="Sun S">S. Sun</name>
</author>
<author>
<name sortKey="Qiu, H" uniqKey="Qiu H">H. Qiu</name>
</author>
<author>
<name sortKey="Tai, W" uniqKey="Tai W">W. Tai</name>
</author>
<author>
<name sortKey="Chen, J" uniqKey="Chen J">J. Chen</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J. Li</name>
</author>
<author>
<name sortKey="Chen, Y" uniqKey="Chen Y">Y. Chen</name>
</author>
<author>
<name sortKey="Guo, Y" uniqKey="Guo Y">Y. Guo</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shehata, M M" uniqKey="Shehata M">M.M. Shehata</name>
</author>
<author>
<name sortKey="Gomaa, M R" uniqKey="Gomaa M">M.R. Gomaa</name>
</author>
<author>
<name sortKey="Ali, M A" uniqKey="Ali M">M.A. Ali</name>
</author>
<author>
<name sortKey="Kayali, G" uniqKey="Kayali G">G. Kayali</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mostafa, A" uniqKey="Mostafa A">A. Mostafa</name>
</author>
<author>
<name sortKey="Kanrai, P" uniqKey="Kanrai P">P. Kanrai</name>
</author>
<author>
<name sortKey="Ziebuhr, J" uniqKey="Ziebuhr J">J. Ziebuhr</name>
</author>
<author>
<name sortKey="Pleschka, S" uniqKey="Pleschka S">S. Pleschka</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Khanna, M" uniqKey="Khanna M">M. Khanna</name>
</author>
<author>
<name sortKey="Sharma, S" uniqKey="Sharma S">S. Sharma</name>
</author>
<author>
<name sortKey="Kumar, B" uniqKey="Kumar B">B. Kumar</name>
</author>
<author>
<name sortKey="Rajput, R" uniqKey="Rajput R">R. Rajput</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lynch, M" uniqKey="Lynch M">M. Lynch</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pritsch, M" uniqKey="Pritsch M">M. Pritsch</name>
</author>
<author>
<name sortKey="Ben Khaled, N" uniqKey="Ben Khaled N">N. Ben-Khaled</name>
</author>
<author>
<name sortKey="Chaloupka, M" uniqKey="Chaloupka M">M. Chaloupka</name>
</author>
<author>
<name sortKey="Kobold, S" uniqKey="Kobold S">S. Kobold</name>
</author>
<author>
<name sortKey="Berens Riha, N" uniqKey="Berens Riha N">N. Berens-Riha</name>
</author>
<author>
<name sortKey="Peter, A" uniqKey="Peter A">A. Peter</name>
</author>
<author>
<name sortKey="Liegl, G" uniqKey="Liegl G">G. Liegl</name>
</author>
<author>
<name sortKey="Schubert, S" uniqKey="Schubert S">S. Schubert</name>
</author>
<author>
<name sortKey="Hoelscher, M" uniqKey="Hoelscher M">M. Hoelscher</name>
</author>
<author>
<name sortKey="Loscher, T" uniqKey="Loscher T">T. Loscher</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Adriani, R" uniqKey="Adriani R">R. Adriani</name>
</author>
<author>
<name sortKey="Mousavi Gargari, S L" uniqKey="Mousavi Gargari S">S.L. Mousavi Gargari</name>
</author>
<author>
<name sortKey="Nazarian, S" uniqKey="Nazarian S">S. Nazarian</name>
</author>
<author>
<name sortKey="Sarvary, S" uniqKey="Sarvary S">S. Sarvary</name>
</author>
<author>
<name sortKey="Noroozi, N" uniqKey="Noroozi N">N. Noroozi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Choi, H I" uniqKey="Choi H">H.I. Choi</name>
</author>
<author>
<name sortKey="Kim, M" uniqKey="Kim M">M. Kim</name>
</author>
<author>
<name sortKey="Jeon, J" uniqKey="Jeon J">J. Jeon</name>
</author>
<author>
<name sortKey="Han, J K" uniqKey="Han J">J.K. Han</name>
</author>
<author>
<name sortKey="Kim, K S" uniqKey="Kim K">K.S. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roy, N" uniqKey="Roy N">N. Roy</name>
</author>
<author>
<name sortKey="Barman, S" uniqKey="Barman S">S. Barman</name>
</author>
<author>
<name sortKey="Ghosh, A" uniqKey="Ghosh A">A. Ghosh</name>
</author>
<author>
<name sortKey="Pal, A" uniqKey="Pal A">A. Pal</name>
</author>
<author>
<name sortKey="Chakraborty, K" uniqKey="Chakraborty K">K. Chakraborty</name>
</author>
<author>
<name sortKey="Das, S S" uniqKey="Das S">S.S. Das</name>
</author>
<author>
<name sortKey="Saha, D R" uniqKey="Saha D">D.R. Saha</name>
</author>
<author>
<name sortKey="Yamasaki, S" uniqKey="Yamasaki S">S. Yamasaki</name>
</author>
<author>
<name sortKey="Koley, H" uniqKey="Koley H">H. Koley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="De Oliveira Santos, F A" uniqKey="De Oliveira Santos F">F.A. de Oliveira Santos</name>
</author>
<author>
<name sortKey="Lincopan, N" uniqKey="Lincopan N">N. Lincopan</name>
</author>
<author>
<name sortKey="De Gaspari, E" uniqKey="De Gaspari E">E. De Gaspari</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Persson, G" uniqKey="Persson G">G. Persson</name>
</author>
<author>
<name sortKey="Pors, S E" uniqKey="Pors S">S.E. Pors</name>
</author>
<author>
<name sortKey="Thofner, I C N" uniqKey="Thofner I">I.C.N. Thofner</name>
</author>
<author>
<name sortKey="Bojesen, A M" uniqKey="Bojesen A">A.M. Bojesen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author>
<name sortKey="Yang, F" uniqKey="Yang F">F. Yang</name>
</author>
<author>
<name sortKey="Zou, J" uniqKey="Zou J">J. Zou</name>
</author>
<author>
<name sortKey="Wu, W" uniqKey="Wu W">W. Wu</name>
</author>
<author>
<name sortKey="Jing, H" uniqKey="Jing H">H. Jing</name>
</author>
<author>
<name sortKey="Gou, Q" uniqKey="Gou Q">Q. Gou</name>
</author>
<author>
<name sortKey="Li, H" uniqKey="Li H">H. Li</name>
</author>
<author>
<name sortKey="Gu, J" uniqKey="Gu J">J. Gu</name>
</author>
<author>
<name sortKey="Zou, Q" uniqKey="Zou Q">Q. Zou</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Der Pol, L" uniqKey="Van Der Pol L">L. van der Pol</name>
</author>
<author>
<name sortKey="Stork, M" uniqKey="Stork M">M. Stork</name>
</author>
<author>
<name sortKey="Van Der Ley, P" uniqKey="Van Der Ley P">P. van der Ley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, S" uniqKey="Wang S">S. Wang</name>
</author>
<author>
<name sortKey="Huang, W" uniqKey="Huang W">W. Huang</name>
</author>
<author>
<name sortKey="Li, K" uniqKey="Li K">K. Li</name>
</author>
<author>
<name sortKey="Yao, Y" uniqKey="Yao Y">Y. Yao</name>
</author>
<author>
<name sortKey="Yang, X" uniqKey="Yang X">X. Yang</name>
</author>
<author>
<name sortKey="Bai, H" uniqKey="Bai H">H. Bai</name>
</author>
<author>
<name sortKey="Sun, W" uniqKey="Sun W">W. Sun</name>
</author>
<author>
<name sortKey="Liu, C" uniqKey="Liu C">C. Liu</name>
</author>
<author>
<name sortKey="Ma, Y" uniqKey="Ma Y">Y. Ma</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bae, E H" uniqKey="Bae E">E.H. Bae</name>
</author>
<author>
<name sortKey="Seo, S H" uniqKey="Seo S">S.H. Seo</name>
</author>
<author>
<name sortKey="Kim, C U" uniqKey="Kim C">C.U. Kim</name>
</author>
<author>
<name sortKey="Jang, M S" uniqKey="Jang M">M.S. Jang</name>
</author>
<author>
<name sortKey="Song, M S" uniqKey="Song M">M.S. Song</name>
</author>
<author>
<name sortKey="Lee, T Y" uniqKey="Lee T">T.Y. Lee</name>
</author>
<author>
<name sortKey="Jeong, Y J" uniqKey="Jeong Y">Y.J. Jeong</name>
</author>
<author>
<name sortKey="Lee, M S" uniqKey="Lee M">M.S. Lee</name>
</author>
<author>
<name sortKey="Park, J H" uniqKey="Park J">J.H. Park</name>
</author>
<author>
<name sortKey="Lee, P" uniqKey="Lee P">P. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Raetz, C R" uniqKey="Raetz C">C.R. Raetz</name>
</author>
<author>
<name sortKey="Whitfield, C" uniqKey="Whitfield C">C. Whitfield</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Der Ley, P" uniqKey="Van Der Ley P">P. van der Ley</name>
</author>
<author>
<name sortKey="Van Den Dobbelsteen, G" uniqKey="Van Den Dobbelsteen G">G. van den Dobbelsteen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mamat, U" uniqKey="Mamat U">U. Mamat</name>
</author>
<author>
<name sortKey="Wilke, K" uniqKey="Wilke K">K. Wilke</name>
</author>
<author>
<name sortKey="Bramhill, D" uniqKey="Bramhill D">D. Bramhill</name>
</author>
<author>
<name sortKey="Schromm, A B" uniqKey="Schromm A">A.B. Schromm</name>
</author>
<author>
<name sortKey="Lindner, B" uniqKey="Lindner B">B. Lindner</name>
</author>
<author>
<name sortKey="Kohl, T A" uniqKey="Kohl T">T.A. Kohl</name>
</author>
<author>
<name sortKey="Corchero, J L" uniqKey="Corchero J">J.L. Corchero</name>
</author>
<author>
<name sortKey="Villaverde, A" uniqKey="Villaverde A">A. Villaverde</name>
</author>
<author>
<name sortKey="Schaffer, L" uniqKey="Schaffer L">L. Schaffer</name>
</author>
<author>
<name sortKey="Head, S R" uniqKey="Head S">S.R. Head</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mamat, U" uniqKey="Mamat U">U. Mamat</name>
</author>
<author>
<name sortKey="Woodard, R W" uniqKey="Woodard R">R.W. Woodard</name>
</author>
<author>
<name sortKey="Wilke, K" uniqKey="Wilke K">K. Wilke</name>
</author>
<author>
<name sortKey="Souvignier, C" uniqKey="Souvignier C">C. Souvignier</name>
</author>
<author>
<name sortKey="Mead, D" uniqKey="Mead D">D. Mead</name>
</author>
<author>
<name sortKey="Steinmetz, E" uniqKey="Steinmetz E">E. Steinmetz</name>
</author>
<author>
<name sortKey="Terry, K" uniqKey="Terry K">K. Terry</name>
</author>
<author>
<name sortKey="Kovacich, C" uniqKey="Kovacich C">C. Kovacich</name>
</author>
<author>
<name sortKey="Zegers, A" uniqKey="Zegers A">A. Zegers</name>
</author>
<author>
<name sortKey="Knox, C" uniqKey="Knox C">C. Knox</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bottero, D" uniqKey="Bottero D">D. Bottero</name>
</author>
<author>
<name sortKey="Zurita, M E" uniqKey="Zurita M">M.E. Zurita</name>
</author>
<author>
<name sortKey="Gaillard, M E" uniqKey="Gaillard M">M.E. Gaillard</name>
</author>
<author>
<name sortKey="Carriquiriborde, F" uniqKey="Carriquiriborde F">F. Carriquiriborde</name>
</author>
<author>
<name sortKey="Martin Aispuro, P" uniqKey="Martin Aispuro P">P. Martin Aispuro</name>
</author>
<author>
<name sortKey="Elizagaray, M" uniqKey="Elizagaray M">M. Elizagaray</name>
</author>
<author>
<name sortKey="Bartel, E" uniqKey="Bartel E">E. Bartel</name>
</author>
<author>
<name sortKey="Castuma, C" uniqKey="Castuma C">C. Castuma</name>
</author>
<author>
<name sortKey="Hozbor, D" uniqKey="Hozbor D">D. Hozbor</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rappazzo, C G" uniqKey="Rappazzo C">C.G. Rappazzo</name>
</author>
<author>
<name sortKey="Watkins, H C" uniqKey="Watkins H">H.C. Watkins</name>
</author>
<author>
<name sortKey="Guarino, C M" uniqKey="Guarino C">C.M. Guarino</name>
</author>
<author>
<name sortKey="Chau, A" uniqKey="Chau A">A. Chau</name>
</author>
<author>
<name sortKey="Lopez, J L" uniqKey="Lopez J">J.L. Lopez</name>
</author>
<author>
<name sortKey="Delisa, M P" uniqKey="Delisa M">M.P. DeLisa</name>
</author>
<author>
<name sortKey="Leifer, C A" uniqKey="Leifer C">C.A. Leifer</name>
</author>
<author>
<name sortKey="Whittaker, G R" uniqKey="Whittaker G">G.R. Whittaker</name>
</author>
<author>
<name sortKey="Putnam, D" uniqKey="Putnam D">D. Putnam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Watkins, H C" uniqKey="Watkins H">H.C. Watkins</name>
</author>
<author>
<name sortKey="Rappazzo, C G" uniqKey="Rappazzo C">C.G. Rappazzo</name>
</author>
<author>
<name sortKey="Higgins, J S" uniqKey="Higgins J">J.S. Higgins</name>
</author>
<author>
<name sortKey="Sun, X" uniqKey="Sun X">X. Sun</name>
</author>
<author>
<name sortKey="Brock, N" uniqKey="Brock N">N. Brock</name>
</author>
<author>
<name sortKey="Chau, A" uniqKey="Chau A">A. Chau</name>
</author>
<author>
<name sortKey="Misra, A" uniqKey="Misra A">A. Misra</name>
</author>
<author>
<name sortKey="Cannizzo, J P B" uniqKey="Cannizzo J">J.P.B. Cannizzo</name>
</author>
<author>
<name sortKey="King, M R" uniqKey="King M">M.R. King</name>
</author>
<author>
<name sortKey="Maines, T R" uniqKey="Maines T">T.R. Maines</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Vaccines (Basel)</journal-id>
<journal-id journal-id-type="iso-abbrev">Vaccines (Basel)</journal-id>
<journal-id journal-id-type="publisher-id">vaccines</journal-id>
<journal-title-group>
<journal-title>Vaccines</journal-title>
</journal-title-group>
<issn pub-type="epub">2076-393X</issn>
<publisher>
<publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">31141982</article-id>
<article-id pub-id-type="pmc">6631769</article-id>
<article-id pub-id-type="doi">10.3390/vaccines7020046</article-id>
<article-id pub-id-type="publisher-id">vaccines-07-00046</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Bacterial Outer Membrane Vesicles (OMVs)-Based Dual Vaccine for Influenza A H1N1 Virus and MERS-CoV</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0001-7556-9398</contrib-id>
<name>
<surname>Shehata</surname>
<given-names>Mahmoud M.</given-names>
</name>
<xref ref-type="aff" rid="af1-vaccines-07-00046">1</xref>
<xref ref-type="author-notes" rid="fn1-vaccines-07-00046"></xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0002-2878-5714</contrib-id>
<name>
<surname>Mostafa</surname>
<given-names>Ahmed</given-names>
</name>
<xref ref-type="aff" rid="af1-vaccines-07-00046">1</xref>
<xref ref-type="aff" rid="af2-vaccines-07-00046">2</xref>
<xref ref-type="author-notes" rid="fn1-vaccines-07-00046"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Teubner</surname>
<given-names>Lisa</given-names>
</name>
<xref ref-type="aff" rid="af3-vaccines-07-00046">3</xref>
<xref ref-type="author-notes" rid="fn1-vaccines-07-00046"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Mahmoud</surname>
<given-names>Sara H.</given-names>
</name>
<xref ref-type="aff" rid="af1-vaccines-07-00046">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0003-3253-6961</contrib-id>
<name>
<surname>Kandeil</surname>
<given-names>Ahmed</given-names>
</name>
<xref ref-type="aff" rid="af1-vaccines-07-00046">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0002-8798-2240</contrib-id>
<name>
<surname>Elshesheny</surname>
<given-names>Rabeh</given-names>
</name>
<xref ref-type="aff" rid="af1-vaccines-07-00046">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Boubak</surname>
<given-names>Thamer A.</given-names>
</name>
<xref ref-type="aff" rid="af4-vaccines-07-00046">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Frantz</surname>
<given-names>Renate</given-names>
</name>
<xref ref-type="aff" rid="af3-vaccines-07-00046">3</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0003-2321-6990</contrib-id>
<name>
<surname>Pietra</surname>
<given-names>Luigi La</given-names>
</name>
<xref ref-type="aff" rid="af3-vaccines-07-00046">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Pleschka</surname>
<given-names>Stephan</given-names>
</name>
<xref ref-type="aff" rid="af2-vaccines-07-00046">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Osman</surname>
<given-names>Ahmed</given-names>
</name>
<xref ref-type="aff" rid="af5-vaccines-07-00046">5</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kayali</surname>
<given-names>Ghazi</given-names>
</name>
<xref ref-type="aff" rid="af6-vaccines-07-00046">6</xref>
<xref ref-type="aff" rid="af7-vaccines-07-00046">7</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0002-1452-4759</contrib-id>
<name>
<surname>Chakraborty</surname>
<given-names>Trinad</given-names>
</name>
<xref ref-type="aff" rid="af3-vaccines-07-00046">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ali</surname>
<given-names>Mohamed A.</given-names>
</name>
<xref ref-type="aff" rid="af1-vaccines-07-00046">1</xref>
<xref rid="c1-vaccines-07-00046" ref-type="corresp">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Mraheil</surname>
<given-names>Mobarak Abu</given-names>
</name>
<xref ref-type="aff" rid="af3-vaccines-07-00046">3</xref>
<xref rid="c1-vaccines-07-00046" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<aff id="af1-vaccines-07-00046">
<label>1</label>
Center of Scientific Excellence for Influenza Viruses, Environmental Research Division, National Research Centre (NRC), Cairo 12622, Egypt;
<email>Mahmoud.Shehata@human-link.org</email>
(M.M.S.);
<email>ahmed_elsayed@daad-alumni.de</email>
(A.M.);
<email>sara.Hussein@human-link.org</email>
(S.H.M.);
<email>ahmed.Kandeil@human-link.org</email>
(A.K.);
<email>rabeh.elshesheny@stjude.org</email>
(R.E.)</aff>
<aff id="af2-vaccines-07-00046">
<label>2</label>
Institute of Medical Virology, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>Stephan.Pleschka@viro.med.uni-giessen.de</email>
</aff>
<aff id="af3-vaccines-07-00046">
<label>3</label>
Institute of Medical Microbiology, German Center for Infection Research (DZIF), Partner Site Giessen-Marburg-Langen Site, Justus-Liebig University Giessen, 35392 Giessen, Germany;
<email>lisa.teubner@mikrobio.med.uni-giessen.de</email>
(L.T.);
<email>renate.frantz@mikrobio.med.uni-giessen.de</email>
(R.F.);
<email>luigi.La-pietra@mikrobio.med.uni-giessen.de</email>
(L.L.P.);
<email>trinad.chakraborty@mikrobio.med.uni-giessen.de</email>
(T.C.)</aff>
<aff id="af4-vaccines-07-00046">
<label>4</label>
Biological Department, Faculty of Science, King Abdul Aziz University, Jeddah 80203, Saudi Arabia;
<email>Th_ah@hotmail.com</email>
</aff>
<aff id="af5-vaccines-07-00046">
<label>5</label>
Department of Biochemistry, Faculty of Science, Ain Shams University, Cairo 38105, Egypt;
<email>aoegiza@yahoo.com</email>
</aff>
<aff id="af6-vaccines-07-00046">
<label>6</label>
Department of Epidemiology, Human Genetics, and Environmental Sciences, University of Texas, Houston, TX 77030, USA;
<email>ghazi@human-link.org</email>
</aff>
<aff id="af7-vaccines-07-00046">
<label>7</label>
Human Link, Baabda 1109, Lebanon</aff>
<author-notes>
<corresp id="c1-vaccines-07-00046">
<label>*</label>
Correspondence:
<email>Mohamedahmedali2004@yahoo.com</email>
(M.A.A.);
<email>Mobarak.Mraheil@mikrobio.med.uni-giessen.de</email>
(M.A.M.)</corresp>
<fn id="fn1-vaccines-07-00046">
<label></label>
<p>These authors contributed equally to this work.</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>28</day>
<month>5</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="collection">
<month>6</month>
<year>2019</year>
</pub-date>
<volume>7</volume>
<issue>2</issue>
<elocation-id>46</elocation-id>
<history>
<date date-type="received">
<day>22</day>
<month>4</month>
<year>2019</year>
</date>
<date date-type="accepted">
<day>24</day>
<month>5</month>
<year>2019</year>
</date>
</history>
<permissions>
<copyright-statement>© 2019 by the authors.</copyright-statement>
<copyright-year>2019</copyright-year>
<license license-type="open-access">
<license-p>Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<p>Vaccination is the most functional medical intervention to prophylactically control severe diseases caused by human-to-human or animal-to-human transmissible viral pathogens. Annually, seasonal influenza epidemics attack human populations leading to 290–650 thousand deaths/year worldwide. Recently, a novel Middle East Respiratory Syndrome Coronavirus emerged. Together, those two viruses present a significant public health burden in areas where they circulate. Herein, we generated a bacterial outer membrane vesicles (OMVs)-based vaccine presenting the antigenic stable chimeric fusion protein of the H1-type haemagglutinin (HA) of the pandemic influenza A virus (H1N1) strain from 2009 (H1N1pdm09) and the receptor binding domain (RBD) of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) (OMVs-H1/RBD). Our results showed that the chimeric antigen could induce specific neutralizing antibodies against both strains leading to protection of immunized mice against H1N1pdm09 and efficient neutralization of MERS-CoV. This study demonstrate that OMVs-based vaccines presenting viral antigens provide a safe and reliable approach to protect against two different viral infections.</p>
</abstract>
<kwd-group>
<kwd>OMVs</kwd>
<kwd>influenza vaccine</kwd>
<kwd>MERS-CoV</kwd>
<kwd>H1N1pdm</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="vaccines-07-00046-f001" orientation="portrait" position="float">
<label>Figure 1</label>
<caption>
<p>Construction of pMP-H1/RBD and characterization of the secreted OMVs-H1/RBD. (
<bold>a</bold>
) Schematic representation of the outer-membrane vesicles (OMVs)-vaccination platform to combat MERS-CoV and pandemic 2009 H1N1 (H1N1pdm09). The target sequences of MERS-CoV (RBD, 720 bp, 240 aa) and H1N1pdm09 (HA) were amplified, purified, digested and ligated to pMPccdB vector. The ligated plasmids harboring the target sequences were transformed into bacteria and the secreted OMVs containing recombinant antigens were then purified for evaluation in mice. Abbreviations: NCR: Non-coding region, SP: Signal peptide, RBD: Receptor binding domain (MERS-CoV), L: Nucleotide sequence of peptide linker (GGTAGCGCCGGTAGCGCCGGA), HA1: Hemagglutinin 1, and HA2: Hemagglutinin 2. (
<bold>b</bold>
) Immunoblotting pattern of OMVs, extracted either from various control/non-transformed OMVs (C1, C2, and C3) (empty OMVs) or pMP-H1/RBD-transformed (OMVs-H1/RBD) DH10ß (S1-S6), against antiserum of swine HA1 antibody.</p>
</caption>
<graphic xlink:href="vaccines-07-00046-g001"></graphic>
</fig>
<fig id="vaccines-07-00046-f002" orientation="portrait" position="float">
<label>Figure 2</label>
<caption>
<p>Immunostimulation of neutralizing antibodies against H1N1pdm2009 and MERS-CoV in mice. (
<bold>a</bold>
) Experimental timeline. (
<bold>b</bold>
) Hemagglutinin Inhibition (HAI) antibody titers against rgH1N1pdm09 in mice sera of vaccinated groups with OMVs-H1/RBD and inactivated H1N1pdm09 were monitored every two weeks in comparison to control PBS and OMVs-empty groups. Statistical changes marked by *
<italic>p</italic>
value < 0.05, **
<italic>p</italic>
value < 0.01, ***
<italic>p</italic>
value < 0.001 and ns
<italic>p</italic>
value > 0.05 non-significant change. (
<bold>c</bold>
) Neutralization titer against MERS-CoV for mice sera vaccinated with inactivated MERS-CoV and OMVs-H1/RBD using plaque reduction neutralization (PRNT) assay. Statistical changes marked by *
<italic>p</italic>
value < 0.05, **
<italic>p</italic>
value < 0.01, ***
<italic>p</italic>
value < 0.001 and ns
<italic>p</italic>
value > 0.05 non-significant change.</p>
</caption>
<graphic xlink:href="vaccines-07-00046-g002"></graphic>
</fig>
<fig id="vaccines-07-00046-f003" orientation="portrait" position="float">
<label>Figure 3</label>
<caption>
<p>Plaque reduction neutralization (PRNT) from week 2 to week 8 in mice sera of vaccinated (
<bold>a</bold>
,
<bold>d</bold>
, and
<bold>e</bold>
) and control groups (
<bold>b</bold>
and
<bold>c</bold>
). (
<bold>f</bold>
) represents the MERS-CoV-positive control for the PRNT assay, cell negative control, and mice sera at zero time of the experiment.</p>
</caption>
<graphic xlink:href="vaccines-07-00046-g003"></graphic>
</fig>
<fig id="vaccines-07-00046-f004" orientation="portrait" position="float">
<label>Figure 4</label>
<caption>
<p>OMVs-based vaccine efficacy following challenge infection. (
<bold>a</bold>
) Body weight loss of female BALB/c mice (6–8 weeks of age) infected intra-nasally with 10
<sup>5.5</sup>
TCID
<sub>50</sub>
dose of Cal-H1N1pdm2009 strain. The body weight loss recorded up to 14 days p.i. and (
<bold>b</bold>
) Survival percentage at indicated time points (up to 14 days p.i.). Mice had to be euthanized when they lost ≥ 30% of their initial body weight.</p>
</caption>
<graphic xlink:href="vaccines-07-00046-g004"></graphic>
</fig>
<table-wrap id="vaccines-07-00046-t001" orientation="portrait" position="float">
<object-id pub-id-type="pii">vaccines-07-00046-t001_Table 1</object-id>
<label>Table 1</label>
<caption>
<p>Primers used in this study.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">PCR Fragment</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Primer Name</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Primer Sequence (5’ to 3’)</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Amplicon Description</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Size (bp)</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Ref.</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">Fragment (1)</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">F1-NcoI-PHW</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CTATTACCATGGTGATGCGGTTTTGGCAGT</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">Part of pMP
<italic>ccd</italic>
B, and 5’-NCR/SP of HA from H1N1pdm</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">419</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">*</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">R1-Bm-H1Gi-PHW</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">ATATCGTCTCGCTTCTGCATTTGCGGTTGCAAATG</td>
</tr>
<tr>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">Fragment (2)</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">F2-Bm-RBD</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">TATTCGTCTCAGAAGCAAAACCTTCTGGCTC</td>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">RBD/peptide linker</td>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">741</td>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">*</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">R2-RBD-Linker</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">TCCGGCGCTACCGGCGCTACCATATTCCACGCAATTGCCTA</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">R2-Bm-RBD- linker</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">ATATCGTCTCGTGTCTCCGGCGCTACCGGCGCTACC</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">Fragment (3)</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">F3-Bm-HA1</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">TATTCGTCTCAGACACATTATGTATAGGTTA</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">Coding sequence of HA and 3’-NCR from H1N1pdm</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">1694</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">*</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">Bm-NS-890R</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">Raetz et al. 2002</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Abbreviations: bp—base pair, NCR—Non-Coding Region, SP—Signal Peptide, RBD—Receptor Binding Domain, Bm—BsmBI restriction enzyme, HA1—Hemagglutinin 1, HA2—Hemagglutinin 2; * In-house primers.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>Liban</li>
</country>
</list>
<tree>
<noCountry>
<name sortKey="Ali, Mohamed A" sort="Ali, Mohamed A" uniqKey="Ali M" first="Mohamed A." last="Ali">Mohamed A. Ali</name>
<name sortKey="Boubak, Thamer A" sort="Boubak, Thamer A" uniqKey="Boubak T" first="Thamer A." last="Boubak">Thamer A. Boubak</name>
<name sortKey="Chakraborty, Trinad" sort="Chakraborty, Trinad" uniqKey="Chakraborty T" first="Trinad" last="Chakraborty">Trinad Chakraborty</name>
<name sortKey="Elshesheny, Rabeh" sort="Elshesheny, Rabeh" uniqKey="Elshesheny R" first="Rabeh" last="Elshesheny">Rabeh Elshesheny</name>
<name sortKey="Frantz, Renate" sort="Frantz, Renate" uniqKey="Frantz R" first="Renate" last="Frantz">Renate Frantz</name>
<name sortKey="Kandeil, Ahmed" sort="Kandeil, Ahmed" uniqKey="Kandeil A" first="Ahmed" last="Kandeil">Ahmed Kandeil</name>
<name sortKey="Mahmoud, Sara H" sort="Mahmoud, Sara H" uniqKey="Mahmoud S" first="Sara H." last="Mahmoud">Sara H. Mahmoud</name>
<name sortKey="Mostafa, Ahmed" sort="Mostafa, Ahmed" uniqKey="Mostafa A" first="Ahmed" last="Mostafa">Ahmed Mostafa</name>
<name sortKey="Mraheil, Mobarak Abu" sort="Mraheil, Mobarak Abu" uniqKey="Mraheil M" first="Mobarak Abu" last="Mraheil">Mobarak Abu Mraheil</name>
<name sortKey="Osman, Ahmed" sort="Osman, Ahmed" uniqKey="Osman A" first="Ahmed" last="Osman">Ahmed Osman</name>
<name sortKey="Pietra, Luigi La" sort="Pietra, Luigi La" uniqKey="Pietra L" first="Luigi La" last="Pietra">Luigi La Pietra</name>
<name sortKey="Pleschka, Stephan" sort="Pleschka, Stephan" uniqKey="Pleschka S" first="Stephan" last="Pleschka">Stephan Pleschka</name>
<name sortKey="Shehata, Mahmoud M" sort="Shehata, Mahmoud M" uniqKey="Shehata M" first="Mahmoud M." last="Shehata">Mahmoud M. Shehata</name>
<name sortKey="Teubner, Lisa" sort="Teubner, Lisa" uniqKey="Teubner L" first="Lisa" last="Teubner">Lisa Teubner</name>
</noCountry>
<country name="Liban">
<noRegion>
<name sortKey="Kayali, Ghazi" sort="Kayali, Ghazi" uniqKey="Kayali G" first="Ghazi" last="Kayali">Ghazi Kayali</name>
</noRegion>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/MersV1/Data/Pmc/Checkpoint
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000392 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd -nk 000392 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    MersV1
   |flux=    Pmc
   |étape=   Checkpoint
   |type=    RBID
   |clé=     PMC:6631769
   |texte=   Bacterial Outer Membrane Vesicles (OMVs)-Based Dual Vaccine for Influenza A H1N1 Virus and MERS-CoV
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/RBID.i   -Sk "pubmed:31141982" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd   \
       | NlmPubMed2Wicri -a MersV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Mon Apr 20 23:26:43 2020. Site generation: Sat Mar 27 09:06:09 2021