Serveur d'exploration sur le lymphœdème

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

A novel mutation in CELSR1 is associated with hereditary lymphedema

Identifieur interne : 000A55 ( Pmc/Corpus ); précédent : 000A54; suivant : 000A56

A novel mutation in CELSR1 is associated with hereditary lymphedema

Auteurs : M. L. Gonzalez-Garay ; M. B. Aldrich ; J. C. Rasmussen ; R. Guilliod ; P. E. Lapinski ; P. D. King ; E. M. Sevick-Muraca

Source :

RBID : PMC:4743364

Abstract

Background

Biological evidence reported in the literature supports the role of CELSR1 as being essential for valvular function in murine lymphatics. Yet thus far, there have been no variants in CELSR1 associated with lymphatic dysfunction in humans.

Case Presentation

In this report, a rare early inactivating mutation in CELSR1 is found to be causal for non-syndromic, lower extremity lymphedema in a family across three generations. Near-infrared fluorescence lymphatic imaging shows that instead of being propelled within the lumen of well-defined lymphatic vessels, lymph moved in regions of both legs in an unusual fashion and within sheet-like structures.

Conclusion

CELSRI may be responsible for primary, non-syndromic lymphedema in humans.

Electronic supplementary material

The online version of this article (doi:10.1186/s13221-016-0035-5) contains supplementary material, which is available to authorized users.


Url:
DOI: 10.1186/s13221-016-0035-5
PubMed: 26855770
PubMed Central: 4743364

Links to Exploration step

PMC:4743364

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">A novel mutation in
<italic>CELSR1</italic>
is associated with hereditary lymphedema</title>
<author>
<name sortKey="Gonzalez Garay, M L" sort="Gonzalez Garay, M L" uniqKey="Gonzalez Garay M" first="M. L." last="Gonzalez-Garay">M. L. Gonzalez-Garay</name>
<affiliation>
<nlm:aff id="Aff1">Center for Molecular Imaging, The Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center, 1825 Pressler Street, SRB330A, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Aldrich, M B" sort="Aldrich, M B" uniqKey="Aldrich M" first="M. B." last="Aldrich">M. B. Aldrich</name>
<affiliation>
<nlm:aff id="Aff1">Center for Molecular Imaging, The Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center, 1825 Pressler Street, SRB330A, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Rasmussen, J C" sort="Rasmussen, J C" uniqKey="Rasmussen J" first="J. C." last="Rasmussen">J. C. Rasmussen</name>
<affiliation>
<nlm:aff id="Aff1">Center for Molecular Imaging, The Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center, 1825 Pressler Street, SRB330A, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Guilliod, R" sort="Guilliod, R" uniqKey="Guilliod R" first="R." last="Guilliod">R. Guilliod</name>
<affiliation>
<nlm:aff id="Aff2">Memorial Herman Hospital and The University of Texas Health Science Center, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lapinski, P E" sort="Lapinski, P E" uniqKey="Lapinski P" first="P. E." last="Lapinski">P. E. Lapinski</name>
<affiliation>
<nlm:aff id="Aff3">Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="King, P D" sort="King, P D" uniqKey="King P" first="P. D." last="King">P. D. King</name>
<affiliation>
<nlm:aff id="Aff3">Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sevick Muraca, E M" sort="Sevick Muraca, E M" uniqKey="Sevick Muraca E" first="E. M." last="Sevick-Muraca">E. M. Sevick-Muraca</name>
<affiliation>
<nlm:aff id="Aff1">Center for Molecular Imaging, The Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center, 1825 Pressler Street, SRB330A, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">26855770</idno>
<idno type="pmc">4743364</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4743364</idno>
<idno type="RBID">PMC:4743364</idno>
<idno type="doi">10.1186/s13221-016-0035-5</idno>
<date when="2016">2016</date>
<idno type="wicri:Area/Pmc/Corpus">000A55</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000A55</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">A novel mutation in
<italic>CELSR1</italic>
is associated with hereditary lymphedema</title>
<author>
<name sortKey="Gonzalez Garay, M L" sort="Gonzalez Garay, M L" uniqKey="Gonzalez Garay M" first="M. L." last="Gonzalez-Garay">M. L. Gonzalez-Garay</name>
<affiliation>
<nlm:aff id="Aff1">Center for Molecular Imaging, The Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center, 1825 Pressler Street, SRB330A, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Aldrich, M B" sort="Aldrich, M B" uniqKey="Aldrich M" first="M. B." last="Aldrich">M. B. Aldrich</name>
<affiliation>
<nlm:aff id="Aff1">Center for Molecular Imaging, The Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center, 1825 Pressler Street, SRB330A, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Rasmussen, J C" sort="Rasmussen, J C" uniqKey="Rasmussen J" first="J. C." last="Rasmussen">J. C. Rasmussen</name>
<affiliation>
<nlm:aff id="Aff1">Center for Molecular Imaging, The Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center, 1825 Pressler Street, SRB330A, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Guilliod, R" sort="Guilliod, R" uniqKey="Guilliod R" first="R." last="Guilliod">R. Guilliod</name>
<affiliation>
<nlm:aff id="Aff2">Memorial Herman Hospital and The University of Texas Health Science Center, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lapinski, P E" sort="Lapinski, P E" uniqKey="Lapinski P" first="P. E." last="Lapinski">P. E. Lapinski</name>
<affiliation>
<nlm:aff id="Aff3">Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="King, P D" sort="King, P D" uniqKey="King P" first="P. D." last="King">P. D. King</name>
<affiliation>
<nlm:aff id="Aff3">Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sevick Muraca, E M" sort="Sevick Muraca, E M" uniqKey="Sevick Muraca E" first="E. M." last="Sevick-Muraca">E. M. Sevick-Muraca</name>
<affiliation>
<nlm:aff id="Aff1">Center for Molecular Imaging, The Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center, 1825 Pressler Street, SRB330A, Houston, TX 77030 USA</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Vascular Cell</title>
<idno type="eISSN">2045-824X</idno>
<imprint>
<date when="2016">2016</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>Biological evidence reported in the literature supports the role of CELSR1 as being essential for valvular function in murine lymphatics. Yet thus far, there have been no variants in
<italic>CELSR1</italic>
associated with lymphatic dysfunction in humans.</p>
</sec>
<sec>
<title>Case Presentation</title>
<p>In this report, a rare early inactivating mutation in
<italic>CELSR1</italic>
is found to be causal for non-syndromic, lower extremity lymphedema in a family across three generations. Near-infrared fluorescence lymphatic imaging shows that instead of being propelled within the lumen of well-defined lymphatic vessels, lymph moved in regions of both legs in an unusual fashion and within sheet-like structures.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>
<italic>CELSRI</italic>
may be responsible for primary, non-syndromic lymphedema in humans.</p>
</sec>
<sec>
<title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/s13221-016-0035-5) contains supplementary material, which is available to authorized users.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Mortimer, Ps" uniqKey="Mortimer P">PS Mortimer</name>
</author>
<author>
<name sortKey="Rockson, Sg" uniqKey="Rockson S">SG Rockson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ferrell, Re" uniqKey="Ferrell R">RE Ferrell</name>
</author>
<author>
<name sortKey="Levinson, Kl" uniqKey="Levinson K">KL Levinson</name>
</author>
<author>
<name sortKey="Esman, Jh" uniqKey="Esman J">JH Esman</name>
</author>
<author>
<name sortKey="Kimak, Ma" uniqKey="Kimak M">MA Kimak</name>
</author>
<author>
<name sortKey="Lawrence, Ec" uniqKey="Lawrence E">EC Lawrence</name>
</author>
<author>
<name sortKey="Barmada, Mm" uniqKey="Barmada M">MM Barmada</name>
</author>
<author>
<name sortKey="Finegold, Dn" uniqKey="Finegold D">DN Finegold</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brouillard, P" uniqKey="Brouillard P">P Brouillard</name>
</author>
<author>
<name sortKey="Boon, L" uniqKey="Boon L">L Boon</name>
</author>
<author>
<name sortKey="Vikkula, M" uniqKey="Vikkula M">M Vikkula</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mendola, A" uniqKey="Mendola A">A Mendola</name>
</author>
<author>
<name sortKey="Schlogel, Mj" uniqKey="Schlogel M">MJ Schlogel</name>
</author>
<author>
<name sortKey="Ghalamkarpour, A" uniqKey="Ghalamkarpour A">A Ghalamkarpour</name>
</author>
<author>
<name sortKey="Irrthum, A" uniqKey="Irrthum A">A Irrthum</name>
</author>
<author>
<name sortKey="Nguyen, Hl" uniqKey="Nguyen H">HL Nguyen</name>
</author>
<author>
<name sortKey="Fastre, E" uniqKey="Fastre E">E Fastre</name>
</author>
<author>
<name sortKey="Bygum, A" uniqKey="Bygum A">A Bygum</name>
</author>
<author>
<name sortKey="Van Der Vleuten, C" uniqKey="Van Der Vleuten C">C van der Vleuten</name>
</author>
<author>
<name sortKey="Fagerberg, C" uniqKey="Fagerberg C">C Fagerberg</name>
</author>
<author>
<name sortKey="Baselga, E" uniqKey="Baselga E">E Baselga</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sevick Muraca, Em" uniqKey="Sevick Muraca E">EM Sevick-Muraca</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rasmussen, Jc" uniqKey="Rasmussen J">JC Rasmussen</name>
</author>
<author>
<name sortKey="Tan, Ic" uniqKey="Tan I">IC Tan</name>
</author>
<author>
<name sortKey="Marshall, Mv" uniqKey="Marshall M">MV Marshall</name>
</author>
<author>
<name sortKey="Adams, Ke" uniqKey="Adams K">KE Adams</name>
</author>
<author>
<name sortKey="Kwon, S" uniqKey="Kwon S">S Kwon</name>
</author>
<author>
<name sortKey="Fife, Ce" uniqKey="Fife C">CE Fife</name>
</author>
<author>
<name sortKey="Maus, Ea" uniqKey="Maus E">EA Maus</name>
</author>
<author>
<name sortKey="Smith, La" uniqKey="Smith L">LA Smith</name>
</author>
<author>
<name sortKey="Covington, Kr" uniqKey="Covington K">KR Covington</name>
</author>
<author>
<name sortKey="Sevick Muraca, Em" uniqKey="Sevick Muraca E">EM Sevick-Muraca</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rasmussen, Jc" uniqKey="Rasmussen J">JC Rasmussen</name>
</author>
<author>
<name sortKey="Tan, Ic" uniqKey="Tan I">IC Tan</name>
</author>
<author>
<name sortKey="Marshall, Mv" uniqKey="Marshall M">MV Marshall</name>
</author>
<author>
<name sortKey="Fife, Ce" uniqKey="Fife C">CE Fife</name>
</author>
<author>
<name sortKey="Sevick Muraca, Em" uniqKey="Sevick Muraca E">EM Sevick-Muraca</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mckenna, A" uniqKey="Mckenna A">A McKenna</name>
</author>
<author>
<name sortKey="Hanna, M" uniqKey="Hanna M">M Hanna</name>
</author>
<author>
<name sortKey="Banks, E" uniqKey="Banks E">E Banks</name>
</author>
<author>
<name sortKey="Sivachenko, A" uniqKey="Sivachenko A">A Sivachenko</name>
</author>
<author>
<name sortKey="Cibulskis, K" uniqKey="Cibulskis K">K Cibulskis</name>
</author>
<author>
<name sortKey="Kernytsky, A" uniqKey="Kernytsky A">A Kernytsky</name>
</author>
<author>
<name sortKey="Garimella, K" uniqKey="Garimella K">K Garimella</name>
</author>
<author>
<name sortKey="Altshuler, D" uniqKey="Altshuler D">D Altshuler</name>
</author>
<author>
<name sortKey="Gabriel, S" uniqKey="Gabriel S">S Gabriel</name>
</author>
<author>
<name sortKey="Daly, M" uniqKey="Daly M">M Daly</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cingolani, P" uniqKey="Cingolani P">P Cingolani</name>
</author>
<author>
<name sortKey="Platts, A" uniqKey="Platts A">A Platts</name>
</author>
<author>
<name sortKey="Le Wang, L" uniqKey="Le Wang L">L le Wang</name>
</author>
<author>
<name sortKey="Coon, M" uniqKey="Coon M">M Coon</name>
</author>
<author>
<name sortKey="Nguyen, T" uniqKey="Nguyen T">T Nguyen</name>
</author>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L Wang</name>
</author>
<author>
<name sortKey="Land, Sj" uniqKey="Land S">SJ Land</name>
</author>
<author>
<name sortKey="Lu, X" uniqKey="Lu X">X Lu</name>
</author>
<author>
<name sortKey="Ruden, Dm" uniqKey="Ruden D">DM Ruden</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, H" uniqKey="Yang H">H Yang</name>
</author>
<author>
<name sortKey="Wang, K" uniqKey="Wang K">K Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ng, Pc" uniqKey="Ng P">PC Ng</name>
</author>
<author>
<name sortKey="Henikoff, S" uniqKey="Henikoff S">S Henikoff</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schwarz, Jm" uniqKey="Schwarz J">JM Schwarz</name>
</author>
<author>
<name sortKey="Rodelsperger, C" uniqKey="Rodelsperger C">C Rodelsperger</name>
</author>
<author>
<name sortKey="Schuelke, M" uniqKey="Schuelke M">M Schuelke</name>
</author>
<author>
<name sortKey="Seelow, D" uniqKey="Seelow D">D Seelow</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tennessen, Ja" uniqKey="Tennessen J">JA Tennessen</name>
</author>
<author>
<name sortKey="Bigham, Aw" uniqKey="Bigham A">AW Bigham</name>
</author>
<author>
<name sortKey="O Connor, Td" uniqKey="O Connor T">TD O'Connor</name>
</author>
<author>
<name sortKey="Fu, W" uniqKey="Fu W">W Fu</name>
</author>
<author>
<name sortKey="Kenny, Ee" uniqKey="Kenny E">EE Kenny</name>
</author>
<author>
<name sortKey="Gravel, S" uniqKey="Gravel S">S Gravel</name>
</author>
<author>
<name sortKey="Mcgee, S" uniqKey="Mcgee S">S McGee</name>
</author>
<author>
<name sortKey="Do, R" uniqKey="Do R">R Do</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X Liu</name>
</author>
<author>
<name sortKey="Jun, G" uniqKey="Jun G">G Jun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abecasis, Gr" uniqKey="Abecasis G">GR Abecasis</name>
</author>
<author>
<name sortKey="Altshuler, D" uniqKey="Altshuler D">D Altshuler</name>
</author>
<author>
<name sortKey="Auton, A" uniqKey="Auton A">A Auton</name>
</author>
<author>
<name sortKey="Brooks, Ld" uniqKey="Brooks L">LD Brooks</name>
</author>
<author>
<name sortKey="Durbin, Rm" uniqKey="Durbin R">RM Durbin</name>
</author>
<author>
<name sortKey="Gibbs, Ra" uniqKey="Gibbs R">RA Gibbs</name>
</author>
<author>
<name sortKey="Hurles, Me" uniqKey="Hurles M">ME Hurles</name>
</author>
<author>
<name sortKey="Mcvean, Ga" uniqKey="Mcvean G">GA McVean</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Robinson, Jt" uniqKey="Robinson J">JT Robinson</name>
</author>
<author>
<name sortKey="Thorvaldsdottir, H" uniqKey="Thorvaldsdottir H">H Thorvaldsdottir</name>
</author>
<author>
<name sortKey="Winckler, W" uniqKey="Winckler W">W Winckler</name>
</author>
<author>
<name sortKey="Guttman, M" uniqKey="Guttman M">M Guttman</name>
</author>
<author>
<name sortKey="Lander, Es" uniqKey="Lander E">ES Lander</name>
</author>
<author>
<name sortKey="Getz, G" uniqKey="Getz G">G Getz</name>
</author>
<author>
<name sortKey="Mesirov, Jp" uniqKey="Mesirov J">JP Mesirov</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Landrum, Mj" uniqKey="Landrum M">MJ Landrum</name>
</author>
<author>
<name sortKey="Lee, Jm" uniqKey="Lee J">JM Lee</name>
</author>
<author>
<name sortKey="Benson, M" uniqKey="Benson M">M Benson</name>
</author>
<author>
<name sortKey="Brown, G" uniqKey="Brown G">G Brown</name>
</author>
<author>
<name sortKey="Chao, C" uniqKey="Chao C">C Chao</name>
</author>
<author>
<name sortKey="Chitipiralla, S" uniqKey="Chitipiralla S">S Chitipiralla</name>
</author>
<author>
<name sortKey="Gu, B" uniqKey="Gu B">B Gu</name>
</author>
<author>
<name sortKey="Hart, J" uniqKey="Hart J">J Hart</name>
</author>
<author>
<name sortKey="Hoffman, D" uniqKey="Hoffman D">D Hoffman</name>
</author>
<author>
<name sortKey="Hoover, J" uniqKey="Hoover J">J Hoover</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Amberger, Js" uniqKey="Amberger J">JS Amberger</name>
</author>
<author>
<name sortKey="Bocchini, Ca" uniqKey="Bocchini C">CA Bocchini</name>
</author>
<author>
<name sortKey="Schiettecatte, F" uniqKey="Schiettecatte F">F Schiettecatte</name>
</author>
<author>
<name sortKey="Scott, Af" uniqKey="Scott A">AF Scott</name>
</author>
<author>
<name sortKey="Hamosh, A" uniqKey="Hamosh A">A Hamosh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Forbes, Sa" uniqKey="Forbes S">SA Forbes</name>
</author>
<author>
<name sortKey="Beare, D" uniqKey="Beare D">D Beare</name>
</author>
<author>
<name sortKey="Gunasekaran, P" uniqKey="Gunasekaran P">P Gunasekaran</name>
</author>
<author>
<name sortKey="Leung, K" uniqKey="Leung K">K Leung</name>
</author>
<author>
<name sortKey="Bindal, N" uniqKey="Bindal N">N Bindal</name>
</author>
<author>
<name sortKey="Boutselakis, H" uniqKey="Boutselakis H">H Boutselakis</name>
</author>
<author>
<name sortKey="Ding, M" uniqKey="Ding M">M Ding</name>
</author>
<author>
<name sortKey="Bamford, S" uniqKey="Bamford S">S Bamford</name>
</author>
<author>
<name sortKey="Cole, C" uniqKey="Cole C">C Cole</name>
</author>
<author>
<name sortKey="Ward, S" uniqKey="Ward S">S Ward</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hakenberg, J" uniqKey="Hakenberg J">J Hakenberg</name>
</author>
<author>
<name sortKey="Cheng, Wy" uniqKey="Cheng W">WY Cheng</name>
</author>
<author>
<name sortKey="Thomas, P" uniqKey="Thomas P">P Thomas</name>
</author>
<author>
<name sortKey="Wang, Yc" uniqKey="Wang Y">YC Wang</name>
</author>
<author>
<name sortKey="Uzilov, Av" uniqKey="Uzilov A">AV Uzilov</name>
</author>
<author>
<name sortKey="Chen, R" uniqKey="Chen R">R Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rosenbloom, Kr" uniqKey="Rosenbloom K">KR Rosenbloom</name>
</author>
<author>
<name sortKey="Armstrong, J" uniqKey="Armstrong J">J Armstrong</name>
</author>
<author>
<name sortKey="Barber, Gp" uniqKey="Barber G">GP Barber</name>
</author>
<author>
<name sortKey="Casper, J" uniqKey="Casper J">J Casper</name>
</author>
<author>
<name sortKey="Clawson, H" uniqKey="Clawson H">H Clawson</name>
</author>
<author>
<name sortKey="Diekhans, M" uniqKey="Diekhans M">M Diekhans</name>
</author>
<author>
<name sortKey="Dreszer, Tr" uniqKey="Dreszer T">TR Dreszer</name>
</author>
<author>
<name sortKey="Fujita, Pa" uniqKey="Fujita P">PA Fujita</name>
</author>
<author>
<name sortKey="Guruvadoo, L" uniqKey="Guruvadoo L">L Guruvadoo</name>
</author>
<author>
<name sortKey="Haeussler, M" uniqKey="Haeussler M">M Haeussler</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Halbleib, Jm" uniqKey="Halbleib J">JM Halbleib</name>
</author>
<author>
<name sortKey="Nelson, Wj" uniqKey="Nelson W">WJ Nelson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kimura, H" uniqKey="Kimura H">H Kimura</name>
</author>
<author>
<name sortKey="Usui, T" uniqKey="Usui T">T Usui</name>
</author>
<author>
<name sortKey="Tsubouchi, A" uniqKey="Tsubouchi A">A Tsubouchi</name>
</author>
<author>
<name sortKey="Uemura, T" uniqKey="Uemura T">T Uemura</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Formstone, Cj" uniqKey="Formstone C">CJ Formstone</name>
</author>
<author>
<name sortKey="Little, Pf" uniqKey="Little P">PF Little</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Allache, R" uniqKey="Allache R">R Allache</name>
</author>
<author>
<name sortKey="De Marco, P" uniqKey="De Marco P">P De Marco</name>
</author>
<author>
<name sortKey="Merello, E" uniqKey="Merello E">E Merello</name>
</author>
<author>
<name sortKey="Capra, V" uniqKey="Capra V">V Capra</name>
</author>
<author>
<name sortKey="Kibar, Z" uniqKey="Kibar Z">Z Kibar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lei, Y" uniqKey="Lei Y">Y Lei</name>
</author>
<author>
<name sortKey="Zhu, H" uniqKey="Zhu H">H Zhu</name>
</author>
<author>
<name sortKey="Yang, W" uniqKey="Yang W">W Yang</name>
</author>
<author>
<name sortKey="Ross, Me" uniqKey="Ross M">ME Ross</name>
</author>
<author>
<name sortKey="Shaw, Gm" uniqKey="Shaw G">GM Shaw</name>
</author>
<author>
<name sortKey="Finnell, Rh" uniqKey="Finnell R">RH Finnell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tatin, F" uniqKey="Tatin F">F Tatin</name>
</author>
<author>
<name sortKey="Taddei, A" uniqKey="Taddei A">A Taddei</name>
</author>
<author>
<name sortKey="Weston, A" uniqKey="Weston A">A Weston</name>
</author>
<author>
<name sortKey="Fuchs, E" uniqKey="Fuchs E">E Fuchs</name>
</author>
<author>
<name sortKey="Devenport, D" uniqKey="Devenport D">D Devenport</name>
</author>
<author>
<name sortKey="Tissir, F" uniqKey="Tissir F">F Tissir</name>
</author>
<author>
<name sortKey="Makinen, T" uniqKey="Makinen T">T Makinen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Agollah, Gd" uniqKey="Agollah G">GD Agollah</name>
</author>
<author>
<name sortKey="Gonzalez Garay, Ml" uniqKey="Gonzalez Garay M">ML Gonzalez-Garay</name>
</author>
<author>
<name sortKey="Rasmussen, Jc" uniqKey="Rasmussen J">JC Rasmussen</name>
</author>
<author>
<name sortKey="Tan, Ic" uniqKey="Tan I">IC Tan</name>
</author>
<author>
<name sortKey="Aldrich, Mb" uniqKey="Aldrich M">MB Aldrich</name>
</author>
<author>
<name sortKey="Darne, C" uniqKey="Darne C">C Darne</name>
</author>
<author>
<name sortKey="Fife, Ce" uniqKey="Fife C">CE Fife</name>
</author>
<author>
<name sortKey="Guilliod, R" uniqKey="Guilliod R">R Guilliod</name>
</author>
<author>
<name sortKey="Maus, Ea" uniqKey="Maus E">EA Maus</name>
</author>
<author>
<name sortKey="King, Pd" uniqKey="King P">PD King</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="case-report">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Vasc Cell</journal-id>
<journal-title-group>
<journal-title>Vascular Cell</journal-title>
</journal-title-group>
<issn pub-type="epub">2045-824X</issn>
<publisher>
<publisher-name>BioMed Central</publisher-name>
<publisher-loc>London</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">26855770</article-id>
<article-id pub-id-type="pmc">4743364</article-id>
<article-id pub-id-type="publisher-id">35</article-id>
<article-id pub-id-type="doi">10.1186/s13221-016-0035-5</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Case Report</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>A novel mutation in
<italic>CELSR1</italic>
is associated with hereditary lymphedema</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Gonzalez-Garay</surname>
<given-names>M. L.</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Aldrich</surname>
<given-names>M. B.</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Rasmussen</surname>
<given-names>J. C.</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Guilliod</surname>
<given-names>R.</given-names>
</name>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lapinski</surname>
<given-names>P. E.</given-names>
</name>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>King</surname>
<given-names>P. D.</given-names>
</name>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Sevick-Muraca</surname>
<given-names>E. M.</given-names>
</name>
<address>
<phone>713-500-3560</phone>
<email>eva.sevick@uth.tmc.edu</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<aff id="Aff1">
<label></label>
Center for Molecular Imaging, The Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center, 1825 Pressler Street, SRB330A, Houston, TX 77030 USA</aff>
<aff id="Aff2">
<label></label>
Memorial Herman Hospital and The University of Texas Health Science Center, Houston, TX 77030 USA</aff>
<aff id="Aff3">
<label></label>
Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109 USA</aff>
</contrib-group>
<pub-date pub-type="epub">
<day>5</day>
<month>2</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="pmc-release">
<day>5</day>
<month>2</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="collection">
<year>2016</year>
</pub-date>
<volume>8</volume>
<elocation-id>1</elocation-id>
<history>
<date date-type="received">
<day>8</day>
<month>10</month>
<year>2015</year>
</date>
<date date-type="accepted">
<day>29</day>
<month>1</month>
<year>2016</year>
</date>
</history>
<permissions>
<copyright-statement>© Gonzalez-Garay et al. 2016</copyright-statement>
<license license-type="OpenAccess">
<license-p>
<bold>Open Access</bold>
This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<abstract id="Abs1">
<sec>
<title>Background</title>
<p>Biological evidence reported in the literature supports the role of CELSR1 as being essential for valvular function in murine lymphatics. Yet thus far, there have been no variants in
<italic>CELSR1</italic>
associated with lymphatic dysfunction in humans.</p>
</sec>
<sec>
<title>Case Presentation</title>
<p>In this report, a rare early inactivating mutation in
<italic>CELSR1</italic>
is found to be causal for non-syndromic, lower extremity lymphedema in a family across three generations. Near-infrared fluorescence lymphatic imaging shows that instead of being propelled within the lumen of well-defined lymphatic vessels, lymph moved in regions of both legs in an unusual fashion and within sheet-like structures.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>
<italic>CELSRI</italic>
may be responsible for primary, non-syndromic lymphedema in humans.</p>
</sec>
<sec>
<title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/s13221-016-0035-5) contains supplementary material, which is available to authorized users.</p>
</sec>
</abstract>
<kwd-group xml:lang="en">
<title>Keywords</title>
<kwd>Primary lymphedema</kwd>
<kwd>Whole exome sequencing</kwd>
<kwd>Near-infrared fluorescence imaging CELSR1</kwd>
<kwd>Planar polarity</kwd>
</kwd-group>
<funding-group>
<award-group>
<funding-source>
<institution-wrap>
<institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id>
<institution>National Institutes of Health (US)</institution>
</institution-wrap>
</funding-source>
<award-id>R01 HL092923</award-id>
</award-group>
<award-group>
<funding-source>
<institution-wrap>
<institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id>
<institution>National Institutes of Health</institution>
</institution-wrap>
</funding-source>
<award-id>U54 CA136404</award-id>
</award-group>
</funding-group>
<custom-meta-group>
<custom-meta>
<meta-name>issue-copyright-statement</meta-name>
<meta-value>© The Author(s) 2016</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="Sec1">
<title>Background</title>
<p>Lymphedema (LE) is a condition caused by a defective lymphatic system where an excess of fluid accumulates and generates chronic swelling of tissues. Primary LE is a rare genetic disorder that can develop at birth (congenital), at puberty (praecox), or after 35 years of age (tarda) [
<xref ref-type="bibr" rid="CR1">1</xref>
].
<italic>FLT4</italic>
was the first pathogenic gene identified in primary LE [
<xref ref-type="bibr" rid="CR2">2</xref>
], but to date, there is only a handful of genes (
<italic>FOXC2, CCBE1, GCJ2, SOX18, GATA2, PTPN14)</italic>
associated with hereditary LE, with the majority associated with patients in which LE is part of a genetic syndrome [
<xref ref-type="bibr" rid="CR3">3</xref>
]. Mendola et al. recently argued that the genetic cause(s) of the majority of families harboring hereditary LE has not yet been identified. In their group of 78 index patients with inherited LE who were screened for mutations in the top seven LE genes, they found explanations for only 36 % of the cases [
<xref ref-type="bibr" rid="CR4">4</xref>
].</p>
<p>In this report, we present the unusual lymphatic phenotype obtained by near-infrared fluorescence lymphatic imaging (NIRFLI) of a woman diagnosed non-syndromic, lower extremity LE and compare it with that of her asymptomatic mother. From clinical diagnoses and whole exome sequencing (WES) of family members across three generations, we found no gene variants known to be responsible for LE, but instead found a rare, inactivating mutation in
<italic>CELSR1</italic>
that could be causative for the inherited condition and the lymphatic phenotype imaged in the index case.</p>
</sec>
<sec id="Sec2">
<title>Case Presentation</title>
<sec id="Sec3">
<title>Family case report</title>
<p>A 62 yo female previously diagnosed with primary, lower extremity LE (bilateral, Stage II by International Society of Lymphology staging system) and her 84 yo asymptomatic mother enrolled in an ongoing, institutional review board (IRB) and FDA-approved (IND# 102,827) clinical study of lymphatic disorders (Clinical Trials No. NCT00833599: “Imaging lymphatic function in normal subjects and in persons with lymphatic disorders”
<ext-link ext-link-type="uri" xlink:href="http://www.clinicaltrials.gov">www.clinicaltrials.gov</ext-link>
). The index case self-reported onset of lower extremity swelling at age 10, with diagnosis of LE at age 39 at which time she began compression treatment. In addition, she was also previously diagnosed with type 2 diabetes, high cholesterol, and high blood pressure. Following consent, a clinical examination was first performed followed by near-infrared fluorescence lymphatic imaging (NIRFLI) [
<xref ref-type="bibr" rid="CR5">5</xref>
] to assess lymphatic anatomy and function in the legs. Blood was collected for WES of DNA.</p>
<p>Upon questioning, we further found a family history of lower extremity LE and traveled to the family’s hometown to consent, conduct standard clinical examinations (including measurements of leg volumes and assessment of Stemmer’s sign), and to collect blood from family members spanning three generations. We did not perform NIRFLI on these family members. Other than stage I and II bilateral lower extremity, non-syndromic LE, we found no remarkable evidence of disease among the family members.</p>
</sec>
<sec id="Sec4">
<title>Imaging studies</title>
<p>For lymphatic imaging of the daughter and mother, doses of 25 μg of indocyanine green (ICG) in 0.1 cc saline were administered bilaterally in the dorsum of the feet, medial ankles, the medial and lateral calves, and the thighs for a total dose of 300 μg. Images were acquired with exposure times of 200 ms and sequential images were compiled to assess for the presence of active lymphatic propulsion/movement of ICG-laden lymph from the injection sites proximally towards the inguinal lymph node basins. As shown by NIRFLI in Fig. 
<xref rid="Fig1" ref-type="fig">1b</xref>
, the affected daughter had extensive areas of dermal backflow in her lower legs, as commonly observed in LE subjects, but possessed a unique, uncommon flow pattern of lymph movement that appeared in “sheets” rather than within distinct vessel lumens (Additional file
<xref rid="MOESM1" ref-type="media">1</xref>
: Video 1). While the proband’s mother primarily had well-defined and linear lymphatics (Fig. 
<xref rid="Fig1" ref-type="fig">1b</xref>
) as typically seen in healthy subjects [
<xref ref-type="bibr" rid="CR6">6</xref>
,
<xref ref-type="bibr" rid="CR7">7</xref>
], she nonetheless presented with smaller areas of dermal backflow and tortuous lymphatics as shown in the insets of Fig. 
<xref rid="Fig1" ref-type="fig">1b</xref>
. Active lymphatic propulsion of ICG-laden lymph was observed in the well-defined lymphatic vessels in the mother (Additional file
<xref rid="MOESM2" ref-type="media">2</xref>
: Video 2), in contrast to the limited lymphatic movement observed in the daughter.
<fig id="Fig1">
<label>Fig. 1</label>
<caption>
<p>Montages of NIRFLI of the lower extremities of (
<bold>a</bold>
) the proband and (
<bold>b</bold>
) her mother. While the mother had well-defined lymphatics, she also had areas with dermal backflow as shown in the inset images of (
<bold>b</bold>
)</p>
</caption>
<graphic xlink:href="13221_2016_35_Fig1_HTML" id="MO1"></graphic>
</fig>
</p>
</sec>
<sec id="Sec5">
<title>Family evaluation</title>
<p>In addition to the proband and her mother, DNA was collected from 9 family members (subjects 146-154) including 5 members diagnosed with LE upon clinical examination. The pedigree chart in Fig. 
<xref rid="Fig2" ref-type="fig">2</xref>
shows that the diagnosed disorder segregates in an autosomal dominant manner. The affected members exhibited grade II bilateral leg lymphedema, with the exception of subject 154, with grade I bilateral leg lymphedema. DNA was extracted from blood samples using Paxgene Blood DNA Kit (PreAnalytix, Switzerland) according to the vendor's instructions. 2 μg of genomic DNA was submitted to Axeq Technologies for human exome capture sequencing using SureSelect Human All Exon V5 and V5 + UTRs (Agilent Technology, Santa Clara, CA).
<fig id="Fig2">
<label>Fig. 2</label>
<caption>
<p>Pedigree of the family showing members diagnosed with lymphedema (filled black), unknown phenotype (filled gray) and unaffected (open) subjects. Arrow indicates the proband. The small ‘s’ at the left top corner of the subjects indicates when the subject’s DNA was sequenced. A diagonal line indicates that the patient is deceased</p>
</caption>
<graphic xlink:href="13221_2016_35_Fig2_HTML" id="MO2"></graphic>
</fig>
</p>
</sec>
<sec id="Sec6">
<title>Genetic sequencing analyses</title>
<p>Genetic sequencing analysis was conducted as follows. Each pair of fastq files was aligned to human genome (hg19) using Novoalign (Novocraft Technologies;
<ext-link ext-link-type="uri" xlink:href="http://www.novocraft.com">www.novocraft.com</ext-link>
), keeping parameters at the default settings, as recommended by Novocraft Technologies. SAMtools (
<ext-link ext-link-type="uri" xlink:href="http://samtools.sourceforge.net">http://samtools.sourceforge.net</ext-link>
) was used to sort the SAM files, create BAM files, and generate their index files. Picard (SourceForge;
<ext-link ext-link-type="uri" xlink:href="http://broadinstitute.github.io/picard">http://broadinstitute.github.io/picard</ext-link>
) was used to remove all of the PCR duplicates from the BAM files. For local realignments, base quality recalibration, and variant calling, we used Genome Analysis Toolkit (GATK) Version 3.1-1 [
<xref ref-type="bibr" rid="CR8">8</xref>
]. Finally, for variant annotation, we used SnpEff (
<ext-link ext-link-type="uri" xlink:href="http://snpeff.sourceforge.net/">http://snpeff.sourceforge.net/</ext-link>
) [
<xref ref-type="bibr" rid="CR9">9</xref>
], variant tools and ANNOVAR [
<xref ref-type="bibr" rid="CR10">10</xref>
] using multiple databases from UCSC Genome bioinformatics. Functional effects for each non-synonymous coding variant was evaluated using three different functional prediction algorithms: (1) Polyphen 2.0 Prediction of functional effects of human nsSNPs (
<ext-link ext-link-type="uri" xlink:href="http://genetics.bwh.harvard.edu/pph2">http://genetics.bwh.harvard.edu/pph2</ext-link>
) [
<xref ref-type="bibr" rid="CR11">11</xref>
], (2) SIFT [
<xref ref-type="bibr" rid="CR12">12</xref>
] and (3) (
<ext-link ext-link-type="uri" xlink:href="http://www.mutationtaster.org">www.mutationtaster.org</ext-link>
) [
<xref ref-type="bibr" rid="CR13">13</xref>
] using the dbNSFP database [
<xref ref-type="bibr" rid="CR14">14</xref>
]. Filtration of common polymorphisms was accomplished using frequencies from the NHLBI Exome sequencing project (ESP) (
<ext-link ext-link-type="uri" xlink:href="http://evs.gs.washington.edu/EVS">http://evs.gs.washington.edu/EVS</ext-link>
) [
<xref ref-type="bibr" rid="CR15">15</xref>
] and the 1,000 Genomes Project (
<ext-link ext-link-type="uri" xlink:href="http://www.1000genomes.org/data">http://www.1000genomes.org/data</ext-link>
) [
<xref ref-type="bibr" rid="CR16">16</xref>
].</p>
<p>WES results showed that the proband did not have variants in any of the known genes previously associated with lymphatic dysfunction. To maximize the power of the segregation analysis, we selected family members diagnosed with LE from each generation for a total of 5 affected cases. Since we did not have controls of the same ethnicity, we selected 4 unaffected family members to reduce the background and increase the statistical power of the analysis. The raw results from the sequencing passed our standard quality control, and the variant files (vcf) reported a consistent number of variants. After selecting non-synonymous coding variants with low frequency (MAF < 0.1), we performed co-segregation analysis using a dominant model of inheritance. Our analysis generated six potential candidate variants, five of them were eliminated after a quick manual inspection with the Integrative genomics viewer [
<xref ref-type="bibr" rid="CR17">17</xref>
]. We identified a nonsense coding variant that generated a prematurely terminated protein CELSR1 (p.W1957X, Hg19chr22:g.46,790,132C > T; NC_000022.10:g.467901432C > T; NM_014246.1:c.5871G > A). The variant was private to the family and has not been reported in any of the following databases: 1000 Genomes [
<xref ref-type="bibr" rid="CR16">16</xref>
], ESP6500 [
<xref ref-type="bibr" rid="CR15">15</xref>
],UK10K, TCGA germline [
<xref ref-type="bibr" rid="CR18">18</xref>
], Scripps Wellderly [
<xref ref-type="bibr" rid="CR19">19</xref>
], ExAC [
<xref ref-type="bibr" rid="CR20">20</xref>
], dbNSFP [
<xref ref-type="bibr" rid="CR14">14</xref>
], ClinVar [
<xref ref-type="bibr" rid="CR21">21</xref>
], OMIM [
<xref ref-type="bibr" rid="CR22">22</xref>
], COSMIC [
<xref ref-type="bibr" rid="CR23">23</xref>
], and Reference Variant Store (RVS), [
<xref ref-type="bibr" rid="CR24">24</xref>
]. The variant sequence was of high quality with an average of 108.54 ± 20.93 reads per sample, mapping quality > 70, and Phred quality scores > 35. Furthermore, the variant was confirmed in each sample by Sanger sequencing in the forward direction using primer TGAGGTTGGGAGCCGGTAGAGG and the reverse direction using primer GTACCGACAGGGTATGTGAAGGCG (see Additional file
<xref rid="MOESM3" ref-type="media">3</xref>
: Figure S1). The segregation results were perfect, the variant was present in all the affected and was not present in any of the unaffected. We genotyped two additional unaffected members of the family, and they also lacked the variant. We searched using blat a 90 bp region containing the mutation against the human reference hg19 and found that the region was 100 % unique in the human genome. We also found that the same region was totally free of any repeats and evolutionarily conserved in vertebrates according to the comparative genomics track from the UCSC genome browser [
<xref ref-type="bibr" rid="CR25">25</xref>
]. In summary, the ultra-rare damaging variant was present in five affected members and not present in six unaffected family members (Fig. 
<xref rid="Fig3" ref-type="fig">3a</xref>
). From DNA of the family members sampled, there appears to be 100 % penetrance with an autosomal dominant pattern of inheritance.
<fig id="Fig3">
<label>Fig. 3</label>
<caption>
<p>
<bold>a</bold>
Image from the Integrative genomics viewer, showing a 40 bp genomic region containing the variant. Each one of the samples is loaded into the panel. Each panel shows two windows, the top window displays the number of reads, and the allele fraction and the lower window show the alignments of the experimental reads. The bottom panel displays the transcripts with the open reading frames.
<bold>b</bold>
A cartoon representing the predicted protein structure of CELSR1 (uniprot id Q9NYQ6). An arrow represents the location of the mutation. The cartoon was inspired by the publication of Lei, et al.
<italic>,</italic>
2014 [
<xref ref-type="bibr" rid="CR30">30</xref>
]</p>
</caption>
<graphic xlink:href="13221_2016_35_Fig3_HTML" id="MO3"></graphic>
</fig>
</p>
</sec>
</sec>
<sec id="Sec7">
<title>Discussion</title>
<p>CELSR1 is a member of the cadherin superfamily, conserved during evolution with orthologs in invertebrate and vertebrates [
<xref ref-type="bibr" rid="CR26">26</xref>
]. In addition, CELSR1 is an atypical cadherin involved in planar cell polarity. This protein has nine cadherin repeats, eight EGF-like domains, and seven transmembrane segments (Uniprot_id Q9NYQ6). CELSR1 is located at the plasma membrane with the cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. We postulate that when the mutated allele is expressed, the protein lacks the entire cadherin domain, the five EGF domains, and the LamG domains (Fig. 
<xref rid="Fig3" ref-type="fig">3b</xref>
).</p>
<p>
<italic>CELRS1</italic>
has an ortholog in Drosophila, the flamingo (Fmi). Fmi is localized at cell–cell boundaries in the wing. In the absence of Fmi, planar polarity was distorted [
<xref ref-type="bibr" rid="CR27">27</xref>
]. In humans and rodents, there are three genes
<italic>CELSR1–3</italic>
and Celsr1–3. Celsr1 and Celsr2 expression is observed during gastrulation and within the developing nervous system. Celsr3 transcripts are found only at sites of active neurogenesis [
<xref ref-type="bibr" rid="CR28">28</xref>
] and mutations in
<italic>CELSR1</italic>
are associated with neural tube defects in humans [
<xref ref-type="bibr" rid="CR29">29</xref>
,
<xref ref-type="bibr" rid="CR30">30</xref>
].</p>
<p>Recent biological evidence reported in the literature supports the causal role of
<italic>CELSR1</italic>
for LE in the family pedigree. Tatin et al. recently showed that CELSR1 and VANGL2 play critical roles in the complex morphogenetic process of intraluminal valve formation in murine lymphatic vessels. In their work, they demonstrated that during valve leaflet formation, endothelial cells recruit CELSR1 and VANGL2 from filopodia to discrete membrane domains at cell-cell contacts. Furthermore, mouse mutants Crsh (Celsr1) and Looptail (Vangl2) show valve aplasia [
<xref ref-type="bibr" rid="CR31">31</xref>
].</p>
<p>The proband displayed a common lymphatic phenotype consisting of extensive dermal backflow, tortuous vessels, as well as unique “sheet-like flow” in both legs indicating a defect in the valvular mechanism of lymph propulsion in collecting vessels. While we have not conducted functional studies of the
<italic>CELSR1</italic>
mutation identified in this family, the phenotype is consistent with the phenotype described in the mouse mutant Crsh [
<xref ref-type="bibr" rid="CR31">31</xref>
].</p>
<p>In this family, the phenotype was not apparent in any living males, but obviously was passed to daughters through male parents, both now deceased and not available for clinical diagnosis or DNA collection. Three living males in the third and fourth generations were not reported to have lymphedema, but unfortunately not available for clinical diagnosis and genotyping. As a result, we are unable to determine whether penetrance is limited to females.</p>
</sec>
<sec id="Sec8">
<title>Conclusion</title>
<p>This report provides the first evidence that defective planar cell polarity signaling pathway may participate as the cause of primary, non-syndromic lymphedema in humans.</p>
<sec id="Sec9">
<title>Consent</title>
<p>Written informed consent for images contained in this report was obtained from the patient's parents in accordance with the guidelines of the University of Texas Health Science Center Institutional Review Board.</p>
</sec>
</sec>
</body>
<back>
<app-group>
<app id="App1">
<sec id="Sec10">
<title>Additional files</title>
<p>
<media position="anchor" xlink:href="13221_2016_35_MOESM1_ESM.avi" id="MOESM1">
<label>Additional file 1: Video 1.</label>
<caption>
<p>The abnormal NIRFLI movie of lymphatic function in the left foot of the proband showing unusual lymph flow from the dorsal foot injections. (AVI 4088 kb)</p>
</caption>
</media>
<media position="anchor" xlink:href="13221_2016_35_MOESM2_ESM.avi" id="MOESM2">
<label>Additional file 2: Video 2.</label>
<caption>
<p>The normal NIRFLI movie of lymphatic function in the left foot of the asymptomatic mother showing typical lymph flow from the dorsal foot injections within collecting lymphatic vessels. (AVI 5480 kb)</p>
</caption>
</media>
<media position="anchor" xlink:href="13221_2016_35_MOESM3_ESM.tif" id="MOESM3">
<label>Additional file 3: Figure S1.</label>
<caption>
<p>A composite picture of two electropherograms comparing the Sanger sequencing results from two members of a family with lymphedema. The top panel represents the WT sequence of an unaffected family member (#152). The low panel represents the heterozygous mutation in the affected index patient (#143). The validation was performed as described previously [
<xref ref-type="bibr" rid="CR32">32</xref>
] using the following primers: forward TGAGGTTGGGAGCCGGTAGAGG and reverse GTACCGACAGGGTATGTGAAGGCG. (TIF 201 kb)</p>
</caption>
</media>
</p>
</sec>
</app>
</app-group>
<glossary>
<title>Abbreviations</title>
<def-list>
<def-item>
<term>ICG</term>
<def>
<p>indocyanine green</p>
</def>
</def-item>
<def-item>
<term>NIRFLI</term>
<def>
<p>near-infrared fluorescence lymphatic imaging</p>
</def>
</def-item>
<def-item>
<term>LE</term>
<def>
<p>lymphedema</p>
</def>
</def-item>
</def-list>
</glossary>
<fn-group>
<fn>
<p>
<bold>Competing interests</bold>
</p>
<p>JCR and EMS are listed as inventors on patents related to near-infrared fluorescence lymphatic imaging. JCR has received fees for consulting from NIRF Imaging, Inc., a UTHSCH start-up company seeking to commercialize NIRFLI technology. JCR and EMS may receive future financial benefit from NIRF Imaging, Inc. The other authors declare no potential conflict of interest.</p>
</fn>
<fn>
<p>
<bold>Authors’ contributions</bold>
</p>
<p>All authors have either written parts of, reviewed, or offered changes to the manuscript. Bioinformatics (MG-G), manuscript writing (MG-G, JCR, EMS-M); interpretation of results (MG-G, PK, EMS-M, PEL), imaging (MBA, JCR), clinical examination and diagnoses (RG), study design (MG-G, EMS-M). All read and approved the final manuscript.</p>
</fn>
</fn-group>
<ack>
<sec id="FPar1">
<title>Sources of funding</title>
<p>Funded by the National Institutes of Health grants R01 HL092923 and U54 CA136404 (EMS-M).</p>
</sec>
</ack>
<ref-list id="Bib1">
<title>References</title>
<ref id="CR1">
<label>1.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mortimer</surname>
<given-names>PS</given-names>
</name>
<name>
<surname>Rockson</surname>
<given-names>SG</given-names>
</name>
</person-group>
<article-title>New developments in clinical aspects of lymphatic disease</article-title>
<source>J Clin Invest</source>
<year>2014</year>
<volume>124</volume>
<issue>3</issue>
<fpage>915</fpage>
<lpage>921</lpage>
<pub-id pub-id-type="doi">10.1172/JCI71608</pub-id>
<pub-id pub-id-type="pmid">24590276</pub-id>
</element-citation>
</ref>
<ref id="CR2">
<label>2.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ferrell</surname>
<given-names>RE</given-names>
</name>
<name>
<surname>Levinson</surname>
<given-names>KL</given-names>
</name>
<name>
<surname>Esman</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Kimak</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Lawrence</surname>
<given-names>EC</given-names>
</name>
<name>
<surname>Barmada</surname>
<given-names>MM</given-names>
</name>
<name>
<surname>Finegold</surname>
<given-names>DN</given-names>
</name>
</person-group>
<article-title>Hereditary lymphedema: evidence for linkage and genetic heterogeneity</article-title>
<source>Hum Mol Genet</source>
<year>1998</year>
<volume>7</volume>
<issue>13</issue>
<fpage>2073</fpage>
<lpage>2078</lpage>
<pub-id pub-id-type="doi">10.1093/hmg/7.13.2073</pub-id>
<pub-id pub-id-type="pmid">9817924</pub-id>
</element-citation>
</ref>
<ref id="CR3">
<label>3.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brouillard</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Boon</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Vikkula</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Genetics of lymphatic anomalies</article-title>
<source>J Clin Invest</source>
<year>2014</year>
<volume>124</volume>
<issue>3</issue>
<fpage>898</fpage>
<lpage>904</lpage>
<pub-id pub-id-type="doi">10.1172/JCI71614</pub-id>
<pub-id pub-id-type="pmid">24590274</pub-id>
</element-citation>
</ref>
<ref id="CR4">
<label>4.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mendola</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Schlogel</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Ghalamkarpour</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Irrthum</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Nguyen</surname>
<given-names>HL</given-names>
</name>
<name>
<surname>Fastre</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Bygum</surname>
<given-names>A</given-names>
</name>
<name>
<surname>van der Vleuten</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Fagerberg</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Baselga</surname>
<given-names>E</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Mutations in the VEGFR3 signaling pathway explain 36 % of familial lymphedema</article-title>
<source>Mol Syndromol</source>
<year>2013</year>
<volume>4</volume>
<issue>6</issue>
<fpage>257</fpage>
<lpage>266</lpage>
<pub-id pub-id-type="doi">10.1159/000354097</pub-id>
<pub-id pub-id-type="pmid">24167460</pub-id>
</element-citation>
</ref>
<ref id="CR5">
<label>5.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sevick-Muraca</surname>
<given-names>EM</given-names>
</name>
</person-group>
<article-title>Translation of near-infrared fluorescence imaging technologies: emerging clinical applications</article-title>
<source>Annu Rev Med</source>
<year>2012</year>
<volume>63</volume>
<fpage>217</fpage>
<lpage>231</lpage>
<pub-id pub-id-type="doi">10.1146/annurev-med-070910-083323</pub-id>
<pub-id pub-id-type="pmid">22034868</pub-id>
</element-citation>
</ref>
<ref id="CR6">
<label>6.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rasmussen</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>IC</given-names>
</name>
<name>
<surname>Marshall</surname>
<given-names>MV</given-names>
</name>
<name>
<surname>Adams</surname>
<given-names>KE</given-names>
</name>
<name>
<surname>Kwon</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Fife</surname>
<given-names>CE</given-names>
</name>
<name>
<surname>Maus</surname>
<given-names>EA</given-names>
</name>
<name>
<surname>Smith</surname>
<given-names>LA</given-names>
</name>
<name>
<surname>Covington</surname>
<given-names>KR</given-names>
</name>
<name>
<surname>Sevick-Muraca</surname>
<given-names>EM</given-names>
</name>
</person-group>
<article-title>Human Lymphatic Architecture and Dynamic Transport Imaged Using Near-infrared Fluorescence</article-title>
<source>Transl Oncol</source>
<year>2010</year>
<volume>3</volume>
<issue>6</issue>
<fpage>362</fpage>
<lpage>372</lpage>
<pub-id pub-id-type="doi">10.1593/tlo.10190</pub-id>
<pub-id pub-id-type="pmid">21151475</pub-id>
</element-citation>
</ref>
<ref id="CR7">
<label>7.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rasmussen</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>IC</given-names>
</name>
<name>
<surname>Marshall</surname>
<given-names>MV</given-names>
</name>
<name>
<surname>Fife</surname>
<given-names>CE</given-names>
</name>
<name>
<surname>Sevick-Muraca</surname>
<given-names>EM</given-names>
</name>
</person-group>
<article-title>Lymphatic imaging in humans with near-infrared fluorescence</article-title>
<source>Curr Opin Biotechnol</source>
<year>2009</year>
<volume>20</volume>
<issue>1</issue>
<fpage>74</fpage>
<lpage>82</lpage>
<pub-id pub-id-type="doi">10.1016/j.copbio.2009.01.009</pub-id>
<pub-id pub-id-type="pmid">19233639</pub-id>
</element-citation>
</ref>
<ref id="CR8">
<label>8.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>McKenna</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Hanna</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Banks</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Sivachenko</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Cibulskis</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Kernytsky</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Garimella</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Altshuler</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Gabriel</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Daly</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<article-title>The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data</article-title>
<source>Genome Res</source>
<year>2010</year>
<volume>20</volume>
<issue>9</issue>
<fpage>1297</fpage>
<lpage>1303</lpage>
<pub-id pub-id-type="doi">10.1101/gr.107524.110</pub-id>
<pub-id pub-id-type="pmid">20644199</pub-id>
</element-citation>
</ref>
<ref id="CR9">
<label>9.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cingolani</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Platts</surname>
<given-names>A</given-names>
</name>
<name>
<surname>le Wang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Coon</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Nguyen</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Land</surname>
<given-names>SJ</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Ruden</surname>
<given-names>DM</given-names>
</name>
</person-group>
<article-title>A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3</article-title>
<source>Fly (Austin)</source>
<year>2012</year>
<volume>6</volume>
<issue>2</issue>
<fpage>80</fpage>
<lpage>92</lpage>
<pub-id pub-id-type="doi">10.4161/fly.19695</pub-id>
<pub-id pub-id-type="pmid">22728672</pub-id>
</element-citation>
</ref>
<ref id="CR10">
<label>10.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Genomic variant annotation and prioritization with ANNOVAR and wANNOVAR</article-title>
<source>Nat Protoc</source>
<year>2015</year>
<volume>10</volume>
<issue>10</issue>
<fpage>1556</fpage>
<lpage>1566</lpage>
<pub-id pub-id-type="doi">10.1038/nprot.2015.105</pub-id>
<pub-id pub-id-type="pmid">26379229</pub-id>
</element-citation>
</ref>
<ref id="CR11">
<label>11.</label>
<mixed-citation publication-type="other">Adzhubei I, Jordan DM, Sunyaev SR. Predicting functional effect of human missense mutations using PolyPhen-2. Curr Protoc Hum Genet. 2013;Chapter 7:Unit7 20.</mixed-citation>
</ref>
<ref id="CR12">
<label>12.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ng</surname>
<given-names>PC</given-names>
</name>
<name>
<surname>Henikoff</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>SIFT: Predicting amino acid changes that affect protein function</article-title>
<source>Nucleic Acids Res</source>
<year>2003</year>
<volume>31</volume>
<issue>13</issue>
<fpage>3812</fpage>
<lpage>3814</lpage>
<pub-id pub-id-type="doi">10.1093/nar/gkg509</pub-id>
<pub-id pub-id-type="pmid">12824425</pub-id>
</element-citation>
</ref>
<ref id="CR13">
<label>13.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schwarz</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Rodelsperger</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Schuelke</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Seelow</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>MutationTaster evaluates disease-causing potential of sequence alterations</article-title>
<source>Nat Methods</source>
<year>2010</year>
<volume>7</volume>
<issue>8</issue>
<fpage>575</fpage>
<lpage>576</lpage>
<pub-id pub-id-type="doi">10.1038/nmeth0810-575</pub-id>
<pub-id pub-id-type="pmid">20676075</pub-id>
</element-citation>
</ref>
<ref id="CR14">
<label>14.</label>
<mixed-citation publication-type="other">Liu X, Wu C, Li C, Boerwinkle E. dbNSFP v3.0: A One-Stop Database of Functional Predictions and Annotations for Human Non-synonymous and Splice Site SNVs. Hum Mutat. 2015. doi: 10.1002/humu.22932</mixed-citation>
</ref>
<ref id="CR15">
<label>15.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tennessen</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Bigham</surname>
<given-names>AW</given-names>
</name>
<name>
<surname>O'Connor</surname>
<given-names>TD</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Kenny</surname>
<given-names>EE</given-names>
</name>
<name>
<surname>Gravel</surname>
<given-names>S</given-names>
</name>
<name>
<surname>McGee</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Do</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Jun</surname>
<given-names>G</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Evolution and functional impact of rare coding variation from deep sequencing of human exomes</article-title>
<source>Science</source>
<year>2012</year>
<volume>337</volume>
<issue>6090</issue>
<fpage>64</fpage>
<lpage>69</lpage>
<pub-id pub-id-type="doi">10.1126/science.1219240</pub-id>
<pub-id pub-id-type="pmid">22604720</pub-id>
</element-citation>
</ref>
<ref id="CR16">
<label>16.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abecasis</surname>
<given-names>GR</given-names>
</name>
<name>
<surname>Altshuler</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Auton</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Brooks</surname>
<given-names>LD</given-names>
</name>
<name>
<surname>Durbin</surname>
<given-names>RM</given-names>
</name>
<name>
<surname>Gibbs</surname>
<given-names>RA</given-names>
</name>
<name>
<surname>Hurles</surname>
<given-names>ME</given-names>
</name>
<name>
<surname>McVean</surname>
<given-names>GA</given-names>
</name>
</person-group>
<article-title>A map of human genome variation from population-scale sequencing</article-title>
<source>Nature</source>
<year>2010</year>
<volume>467</volume>
<issue>7319</issue>
<fpage>1061</fpage>
<lpage>1073</lpage>
<pub-id pub-id-type="doi">10.1038/nature09534</pub-id>
<pub-id pub-id-type="pmid">20981092</pub-id>
</element-citation>
</ref>
<ref id="CR17">
<label>17.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Robinson</surname>
<given-names>JT</given-names>
</name>
<name>
<surname>Thorvaldsdottir</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Winckler</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Guttman</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Lander</surname>
<given-names>ES</given-names>
</name>
<name>
<surname>Getz</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Mesirov</surname>
<given-names>JP</given-names>
</name>
</person-group>
<article-title>Integrative genomics viewer</article-title>
<source>Nat Biotechnol</source>
<year>2011</year>
<volume>29</volume>
<issue>1</issue>
<fpage>24</fpage>
<lpage>26</lpage>
<pub-id pub-id-type="doi">10.1038/nbt.1754</pub-id>
<pub-id pub-id-type="pmid">21221095</pub-id>
</element-citation>
</ref>
<ref id="CR18">
<label>18.</label>
<mixed-citation publication-type="other">The Cancer Genome Atlas [
<ext-link ext-link-type="uri" xlink:href="http://cancergenome.nih.gov/">http://cancergenome.nih.gov/</ext-link>
].</mixed-citation>
</ref>
<ref id="CR19">
<label>19.</label>
<mixed-citation publication-type="other">The Scripps Wellderly Study [
<ext-link ext-link-type="uri" xlink:href="ftp://stsi-ftp.sdsc.edu/pub/wellderly/">ftp://stsi-ftp.sdsc.edu/pub/wellderly/</ext-link>
].</mixed-citation>
</ref>
<ref id="CR20">
<label>20.</label>
<mixed-citation publication-type="other">Exome Aggregation Consortium (ExAC) [
<ext-link ext-link-type="uri" xlink:href="http://exac.broadinstitute.org">http://exac.broadinstitute.org</ext-link>
].</mixed-citation>
</ref>
<ref id="CR21">
<label>21.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Landrum</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Benson</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Brown</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Chao</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Chitipiralla</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Hart</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Hoffman</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Hoover</surname>
<given-names>J</given-names>
</name>
<etal></etal>
</person-group>
<article-title>ClinVar: public archive of interpretations of clinically relevant variants</article-title>
<source>Nucleic Acids Res</source>
<year>2016</year>
<volume>44</volume>
<issue>D1</issue>
<fpage>D862</fpage>
<lpage>868</lpage>
<pub-id pub-id-type="doi">10.1093/nar/gkv1222</pub-id>
<pub-id pub-id-type="pmid">26582918</pub-id>
</element-citation>
</ref>
<ref id="CR22">
<label>22.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Amberger</surname>
<given-names>JS</given-names>
</name>
<name>
<surname>Bocchini</surname>
<given-names>CA</given-names>
</name>
<name>
<surname>Schiettecatte</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Scott</surname>
<given-names>AF</given-names>
</name>
<name>
<surname>Hamosh</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>OMIM.org: Online Mendelian Inheritance in Man (OMIM(R)), an online catalog of human genes and genetic disorders</article-title>
<source>Nucleic Acids Res</source>
<year>2015</year>
<volume>43</volume>
<issue>Database issue</issue>
<fpage>D789</fpage>
<lpage>798</lpage>
<pub-id pub-id-type="doi">10.1093/nar/gku1205</pub-id>
<pub-id pub-id-type="pmid">25428349</pub-id>
</element-citation>
</ref>
<ref id="CR23">
<label>23.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Forbes</surname>
<given-names>SA</given-names>
</name>
<name>
<surname>Beare</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Gunasekaran</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Leung</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Bindal</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Boutselakis</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Bamford</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Cole</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ward</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<article-title>COSMIC: exploring the world's knowledge of somatic mutations in human cancer</article-title>
<source>Nucleic Acids Res</source>
<year>2015</year>
<volume>43</volume>
<issue>Database issue</issue>
<fpage>D805</fpage>
<lpage>811</lpage>
<pub-id pub-id-type="doi">10.1093/nar/gku1075</pub-id>
<pub-id pub-id-type="pmid">25355519</pub-id>
</element-citation>
</ref>
<ref id="CR24">
<label>24.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hakenberg</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>WY</given-names>
</name>
<name>
<surname>Thomas</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>YC</given-names>
</name>
<name>
<surname>Uzilov</surname>
<given-names>AV</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>Integrating 400 million variants from 80,000 human samples with extensive annotations: towards a knowledge base to analyze disease cohorts</article-title>
<source>BMC Bioinformatics</source>
<year>2016</year>
<volume>17</volume>
<issue>1</issue>
<fpage>24</fpage>
<pub-id pub-id-type="doi">10.1186/s12859-015-0865-9</pub-id>
<pub-id pub-id-type="pmid">26746786</pub-id>
</element-citation>
</ref>
<ref id="CR25">
<label>25.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rosenbloom</surname>
<given-names>KR</given-names>
</name>
<name>
<surname>Armstrong</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Barber</surname>
<given-names>GP</given-names>
</name>
<name>
<surname>Casper</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Clawson</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Diekhans</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Dreszer</surname>
<given-names>TR</given-names>
</name>
<name>
<surname>Fujita</surname>
<given-names>PA</given-names>
</name>
<name>
<surname>Guruvadoo</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Haeussler</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<article-title>The UCSC Genome Browser database: 2015 update</article-title>
<source>Nucleic Acids Res</source>
<year>2015</year>
<volume>43</volume>
<issue>Database issue</issue>
<fpage>D670</fpage>
<lpage>681</lpage>
<pub-id pub-id-type="doi">10.1093/nar/gku1177</pub-id>
<pub-id pub-id-type="pmid">25428374</pub-id>
</element-citation>
</ref>
<ref id="CR26">
<label>26.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Halbleib</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Nelson</surname>
<given-names>WJ</given-names>
</name>
</person-group>
<article-title>Cadherins in development: cell adhesion, sorting, and tissue morphogenesis</article-title>
<source>Genes Dev</source>
<year>2006</year>
<volume>20</volume>
<issue>23</issue>
<fpage>3199</fpage>
<lpage>3214</lpage>
<pub-id pub-id-type="doi">10.1101/gad.1486806</pub-id>
<pub-id pub-id-type="pmid">17158740</pub-id>
</element-citation>
</ref>
<ref id="CR27">
<label>27.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kimura</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Usui</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Tsubouchi</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Uemura</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Potential dual molecular interaction of the Drosophila 7-pass transmembrane cadherin Flamingo in dendritic morphogenesis</article-title>
<source>J Cell Sci</source>
<year>2006</year>
<volume>119</volume>
<issue>Pt 6</issue>
<fpage>1118</fpage>
<lpage>1129</lpage>
<pub-id pub-id-type="doi">10.1242/jcs.02832</pub-id>
<pub-id pub-id-type="pmid">16507587</pub-id>
</element-citation>
</ref>
<ref id="CR28">
<label>28.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Formstone</surname>
<given-names>CJ</given-names>
</name>
<name>
<surname>Little</surname>
<given-names>PF</given-names>
</name>
</person-group>
<article-title>The flamingo-related mouse Celsr family (Celsr1-3) genes exhibit distinct patterns of expression during embryonic development</article-title>
<source>Mech Dev</source>
<year>2001</year>
<volume>109</volume>
<issue>1</issue>
<fpage>91</fpage>
<lpage>94</lpage>
<pub-id pub-id-type="doi">10.1016/S0925-4773(01)00515-9</pub-id>
<pub-id pub-id-type="pmid">11677057</pub-id>
</element-citation>
</ref>
<ref id="CR29">
<label>29.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Allache</surname>
<given-names>R</given-names>
</name>
<name>
<surname>De Marco</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Merello</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Capra</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Kibar</surname>
<given-names>Z</given-names>
</name>
</person-group>
<article-title>Role of the planar cell polarity gene CELSR1 in neural tube defects and caudal agenesis</article-title>
<source>Birth Defects Res A Clin Mol Teratol</source>
<year>2012</year>
<volume>94</volume>
<issue>3</issue>
<fpage>176</fpage>
<lpage>181</lpage>
<pub-id pub-id-type="doi">10.1002/bdra.23002</pub-id>
<pub-id pub-id-type="pmid">22371354</pub-id>
</element-citation>
</ref>
<ref id="CR30">
<label>30.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lei</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Ross</surname>
<given-names>ME</given-names>
</name>
<name>
<surname>Shaw</surname>
<given-names>GM</given-names>
</name>
<name>
<surname>Finnell</surname>
<given-names>RH</given-names>
</name>
</person-group>
<article-title>Identification of novel CELSR1 mutations in spina bifida</article-title>
<source>PLoS One</source>
<year>2014</year>
<volume>9</volume>
<issue>3</issue>
<pub-id pub-id-type="doi">10.1371/journal.pone.0092207</pub-id>
<pub-id pub-id-type="pmid">24632739</pub-id>
</element-citation>
</ref>
<ref id="CR31">
<label>31.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tatin</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Taddei</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Weston</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Fuchs</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Devenport</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Tissir</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Makinen</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Planar cell polarity protein Celsr1 regulates endothelial adherens junctions and directed cell rearrangements during valve morphogenesis</article-title>
<source>Dev Cell</source>
<year>2013</year>
<volume>26</volume>
<issue>1</issue>
<fpage>31</fpage>
<lpage>44</lpage>
<pub-id pub-id-type="doi">10.1016/j.devcel.2013.05.015</pub-id>
<pub-id pub-id-type="pmid">23792146</pub-id>
</element-citation>
</ref>
<ref id="CR32">
<label>32.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Agollah</surname>
<given-names>GD</given-names>
</name>
<name>
<surname>Gonzalez-Garay</surname>
<given-names>ML</given-names>
</name>
<name>
<surname>Rasmussen</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>IC</given-names>
</name>
<name>
<surname>Aldrich</surname>
<given-names>MB</given-names>
</name>
<name>
<surname>Darne</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Fife</surname>
<given-names>CE</given-names>
</name>
<name>
<surname>Guilliod</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Maus</surname>
<given-names>EA</given-names>
</name>
<name>
<surname>King</surname>
<given-names>PD</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Evidence for SH2 domain-containing 5'-inositol phosphatase-2 (SHIP2) contributing to a lymphatic dysfunction</article-title>
<source>PLoS One</source>
<year>2014</year>
<volume>9</volume>
<issue>11</issue>
<pub-id pub-id-type="doi">10.1371/journal.pone.0112548</pub-id>
<pub-id pub-id-type="pmid">25383712</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Sante/explor/LymphedemaV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000A55 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000A55 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Sante
   |area=    LymphedemaV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     PMC:4743364
   |texte=   A novel mutation in CELSR1 is associated with hereditary lymphedema
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i   -Sk "pubmed:26855770" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd   \
       | NlmPubMed2Wicri -a LymphedemaV1 

Wicri

This area was generated with Dilib version V0.6.31.
Data generation: Sat Nov 4 17:40:35 2017. Site generation: Tue Feb 13 16:42:16 2024