Apoptotic and Early Innate Immune Responses to PB1-F2 Protein of Influenza A Viruses Belonging to Different Subtypes in Human Lung Epithelial A549 Cells
Identifieur interne : 000895 ( Pmc/Curation ); précédent : 000894; suivant : 000896Apoptotic and Early Innate Immune Responses to PB1-F2 Protein of Influenza A Viruses Belonging to Different Subtypes in Human Lung Epithelial A549 Cells
Auteurs : Gunisha Pasricha [Inde] ; Sanjay Mukherjee [Inde] ; Alok K. Chakrabarti [Inde]Source :
- Advances in Virology [ 1687-8639 ] ; 2018.
Abstract
PB1-F2 is a multifunctional protein and contributes to the pathogenicity of influenza A viruses. PB1-F2 is known to have strain and cell specific functions. In this study we have investigated the apoptotic and inflammatory responses of PB1-F2 protein from influenza viruses of diverse pathogenicities in A549 lung epithelial cells. Overexpression of PB1-F2 resulted in apoptosis and heightened inflammatory response in A549 cells. Comparison revealed that the response varied with each subtype. PB1-F2 protein from highly pathogenic H5N1 virus induced least apoptosis but maximum inflammatory response. Results indicated that apoptosis was mediated through death receptor ligands TNF
Url:
DOI: 10.1155/2018/5057184
PubMed: 30687405
PubMed Central: 6330835
Links toward previous steps (curation, corpus...)
- to stream Pmc, to step Corpus: Pour aller vers cette notice dans l'étape Curation :000895
Links to Exploration step
PMC:6330835Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Apoptotic and Early Innate Immune Responses to PB1-F2 Protein of Influenza A Viruses Belonging to Different Subtypes in Human Lung Epithelial A549 Cells</title>
<author><name sortKey="Pasricha, Gunisha" sort="Pasricha, Gunisha" uniqKey="Pasricha G" first="Gunisha" last="Pasricha">Gunisha Pasricha</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021, India</nlm:aff>
<country xml:lang="fr">Inde</country>
<wicri:regionArea>Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Mukherjee, Sanjay" sort="Mukherjee, Sanjay" uniqKey="Mukherjee S" first="Sanjay" last="Mukherjee">Sanjay Mukherjee</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021, India</nlm:aff>
<country xml:lang="fr">Inde</country>
<wicri:regionArea>Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Chakrabarti, Alok K" sort="Chakrabarti, Alok K" uniqKey="Chakrabarti A" first="Alok K." last="Chakrabarti">Alok K. Chakrabarti</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021, India</nlm:aff>
<country xml:lang="fr">Inde</country>
<wicri:regionArea>Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021</wicri:regionArea>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">30687405</idno>
<idno type="pmc">6330835</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6330835</idno>
<idno type="RBID">PMC:6330835</idno>
<idno type="doi">10.1155/2018/5057184</idno>
<date when="2018">2018</date>
<idno type="wicri:Area/Pmc/Corpus">000895</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000895</idno>
<idno type="wicri:Area/Pmc/Curation">000895</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000895</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Apoptotic and Early Innate Immune Responses to PB1-F2 Protein of Influenza A Viruses Belonging to Different Subtypes in Human Lung Epithelial A549 Cells</title>
<author><name sortKey="Pasricha, Gunisha" sort="Pasricha, Gunisha" uniqKey="Pasricha G" first="Gunisha" last="Pasricha">Gunisha Pasricha</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021, India</nlm:aff>
<country xml:lang="fr">Inde</country>
<wicri:regionArea>Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Mukherjee, Sanjay" sort="Mukherjee, Sanjay" uniqKey="Mukherjee S" first="Sanjay" last="Mukherjee">Sanjay Mukherjee</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021, India</nlm:aff>
<country xml:lang="fr">Inde</country>
<wicri:regionArea>Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Chakrabarti, Alok K" sort="Chakrabarti, Alok K" uniqKey="Chakrabarti A" first="Alok K." last="Chakrabarti">Alok K. Chakrabarti</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021, India</nlm:aff>
<country xml:lang="fr">Inde</country>
<wicri:regionArea>Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021</wicri:regionArea>
</affiliation>
</author>
</analytic>
<series><title level="j">Advances in Virology</title>
<idno type="ISSN">1687-8639</idno>
<idno type="eISSN">1687-8647</idno>
<imprint><date when="2018">2018</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>PB1-F2 is a multifunctional protein and contributes to the pathogenicity of influenza A viruses. PB1-F2 is known to have strain and cell specific functions. In this study we have investigated the apoptotic and inflammatory responses of PB1-F2 protein from influenza viruses of diverse pathogenicities in A549 lung epithelial cells. Overexpression of PB1-F2 resulted in apoptosis and heightened inflammatory response in A549 cells. Comparison revealed that the response varied with each subtype. PB1-F2 protein from highly pathogenic H5N1 virus induced least apoptosis but maximum inflammatory response. Results indicated that apoptosis was mediated through death receptor ligands TNF<italic>α</italic>
and TRAIL via Caspase 8 activation. Significant induction of cytokines/chemokines CXCL10, CCL5, CCL2, IFN<italic>α</italic>
, and IL-6 was noted in A549 cells transfected with PB1-F2 gene construct of 2008 West Bengal H5N1 virus (H5N1-WB). On the contrary, PB1-F2 construct from 2007 highly pathogenic H5N1 isolate (H5N1-M) with truncated N-terminal region did not evoke as exuberant inflammatory response as the other H5N1-WB with full length PB1-F2, signifying the importance of N-terminal region of PB1-F2. Sequence analysis revealed that PB1-F2 proteins derived from different influenza viruses varied at multiple amino acid positions. The secondary structure prediction showed each of the PB1-F2 proteins had distinct helix-loop-helix structure. Thus, our data substantiate the notion that the contribution of PB1-F2 to influenza pathogenicity is greatly strain specific and involves multiple host factors. This data demonstrates that PB1-F2 protein of influenza A virus, when expressed independently is minimally apoptotic and strongly influences the early host response in A549 cells.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Webster, R G" uniqKey="Webster R">R. G. Webster</name>
</author>
<author><name sortKey="Bean, W J" uniqKey="Bean W">W. J. Bean</name>
</author>
<author><name sortKey="Gorman, O T" uniqKey="Gorman O">O. T. Gorman</name>
</author>
<author><name sortKey="Chambers, T M" uniqKey="Chambers T">T. M. Chambers</name>
</author>
<author><name sortKey="Kawaoka, Y" uniqKey="Kawaoka Y">Y. Kawaoka</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shinya, K" uniqKey="Shinya K">K. Shinya</name>
</author>
<author><name sortKey="Makino, A" uniqKey="Makino A">A. Makino</name>
</author>
<author><name sortKey="Kawaoka, Y" uniqKey="Kawaoka Y">Y. Kawaoka</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fukuyama, S" uniqKey="Fukuyama S">S. Fukuyama</name>
</author>
<author><name sortKey="Kawaoka, Y" uniqKey="Kawaoka Y">Y. Kawaoka</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Vasin, A" uniqKey="Vasin A">A. Vasin</name>
</author>
<author><name sortKey="Temkina, O" uniqKey="Temkina O">O. Temkina</name>
</author>
<author><name sortKey="Egorov, V" uniqKey="Egorov V">V. Egorov</name>
</author>
<author><name sortKey="Klotchenko, S" uniqKey="Klotchenko S">S. Klotchenko</name>
</author>
<author><name sortKey="Plotnikova, M" uniqKey="Plotnikova M">M. Plotnikova</name>
</author>
<author><name sortKey="Kiselev, O" uniqKey="Kiselev O">O. Kiselev</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Klemm, C" uniqKey="Klemm C">C. Klemm</name>
</author>
<author><name sortKey="Boergeling, Y" uniqKey="Boergeling Y">Y. Boergeling</name>
</author>
<author><name sortKey="Ludwig, S" uniqKey="Ludwig S">S. Ludwig</name>
</author>
<author><name sortKey="Ehrhardt, C" uniqKey="Ehrhardt C">C. Ehrhardt</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chen, W" uniqKey="Chen W">W. Chen</name>
</author>
<author><name sortKey="Calvo, P A" uniqKey="Calvo P">P. A. Calvo</name>
</author>
<author><name sortKey="Malide, D" uniqKey="Malide D">D. Malide</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wise, H M" uniqKey="Wise H">H. M. Wise</name>
</author>
<author><name sortKey="Foeglein, A" uniqKey="Foeglein A">A. Foeglein</name>
</author>
<author><name sortKey="Sun, J" uniqKey="Sun J">J. Sun</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Varga, Z T" uniqKey="Varga Z">Z. T. Varga</name>
</author>
<author><name sortKey="Ramos, I" uniqKey="Ramos I">I. Ramos</name>
</author>
<author><name sortKey="Hai, R" uniqKey="Hai R">R. Hai</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chakrabarti, A K" uniqKey="Chakrabarti A">A. K. Chakrabarti</name>
</author>
<author><name sortKey="Pasricha, G" uniqKey="Pasricha G">G. Pasricha</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pasricha, G" uniqKey="Pasricha G">G. Pasricha</name>
</author>
<author><name sortKey="Mishra, A C" uniqKey="Mishra A">A. C. Mishra</name>
</author>
<author><name sortKey="Chakrabarti, A K" uniqKey="Chakrabarti A">A. K. Chakrabarti</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chen, C J" uniqKey="Chen C">C.-J. Chen</name>
</author>
<author><name sortKey="Chen, G W" uniqKey="Chen G">G.-W. Chen</name>
</author>
<author><name sortKey="Wang, C H" uniqKey="Wang C">C.-H. Wang</name>
</author>
<author><name sortKey="Huang, C H" uniqKey="Huang C">C.-H. Huang</name>
</author>
<author><name sortKey="Wang, Y C" uniqKey="Wang Y">Y.-C. Wang</name>
</author>
<author><name sortKey="Shih, S R" uniqKey="Shih S">S.-R. Shih</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Marjuki, H" uniqKey="Marjuki H">H. Marjuki</name>
</author>
<author><name sortKey="Scholtissek, C" uniqKey="Scholtissek C">C. Scholtissek</name>
</author>
<author><name sortKey="Franks, J" uniqKey="Franks J">J. Franks</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mcauley, J L" uniqKey="Mcauley J">J. L. McAuley</name>
</author>
<author><name sortKey="Chipuk, J E" uniqKey="Chipuk J">J. E. Chipuk</name>
</author>
<author><name sortKey="Boyd, K L" uniqKey="Boyd K">K. L. Boyd</name>
</author>
<author><name sortKey="Van De Velde, N" uniqKey="Van De Velde N">N. van de Velde</name>
</author>
<author><name sortKey="Green, D R" uniqKey="Green D">D. R. Green</name>
</author>
<author><name sortKey="Mccullers, J A" uniqKey="Mccullers J">J. A. McCullers</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Schmolke, M" uniqKey="Schmolke M">M. Schmolke</name>
</author>
<author><name sortKey="Manicassamy, B" uniqKey="Manicassamy B">B. Manicassamy</name>
</author>
<author><name sortKey="Pena, L" uniqKey="Pena L">L. Pena</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Conenello, G M" uniqKey="Conenello G">G. M. Conenello</name>
</author>
<author><name sortKey="Zamarin, D" uniqKey="Zamarin D">D. Zamarin</name>
</author>
<author><name sortKey="Perrone, L A" uniqKey="Perrone L">L. A. Perrone</name>
</author>
<author><name sortKey="Tumpey, T" uniqKey="Tumpey T">T. Tumpey</name>
</author>
<author><name sortKey="Palese, P" uniqKey="Palese P">P. Palese</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zamarin, D" uniqKey="Zamarin D">D. Zamarin</name>
</author>
<author><name sortKey="Ortigoza, M B" uniqKey="Ortigoza M">M. B. Ortigoza</name>
</author>
<author><name sortKey="Palese, P" uniqKey="Palese P">P. Palese</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mishra, A C" uniqKey="Mishra A">A. C. Mishra</name>
</author>
<author><name sortKey="Cherian, S S" uniqKey="Cherian S">S. S. Cherian</name>
</author>
<author><name sortKey="Chakrabarti, A K" uniqKey="Chakrabarti A">A. K. Chakrabarti</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chakrabarti, A K" uniqKey="Chakrabarti A">A. K. Chakrabarti</name>
</author>
<author><name sortKey="Pawar, S D" uniqKey="Pawar S">S. D. Pawar</name>
</author>
<author><name sortKey="Cherian, S S" uniqKey="Cherian S">S. S. Cherian</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xing, Z" uniqKey="Xing Z">Z. Xing</name>
</author>
<author><name sortKey="Harper, R" uniqKey="Harper R">R. Harper</name>
</author>
<author><name sortKey="Anunciacion, J" uniqKey="Anunciacion J">J. Anunciacion</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Larkin, M A" uniqKey="Larkin M">M. A. Larkin</name>
</author>
<author><name sortKey="Blackshields, G" uniqKey="Blackshields G">G. Blackshields</name>
</author>
<author><name sortKey="Brown, N P" uniqKey="Brown N">N. P. Brown</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hoffmann, E" uniqKey="Hoffmann E">E. Hoffmann</name>
</author>
<author><name sortKey="Stech, J" uniqKey="Stech J">J. Stech</name>
</author>
<author><name sortKey="Guan, Y" uniqKey="Guan Y">Y. Guan</name>
</author>
<author><name sortKey="Webster, R G" uniqKey="Webster R">R. G. Webster</name>
</author>
<author><name sortKey="Perez, D R" uniqKey="Perez D">D. R. Perez</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kamal, R" uniqKey="Kamal R">R. Kamal</name>
</author>
<author><name sortKey="Alymova, I" uniqKey="Alymova I">I. Alymova</name>
</author>
<author><name sortKey="York, I" uniqKey="York I">I. York</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Alymova, I V" uniqKey="Alymova I">I. V. Alymova</name>
</author>
<author><name sortKey="Green, A M" uniqKey="Green A">A. M. Green</name>
</author>
<author><name sortKey="Van De Velde, N" uniqKey="Van De Velde N">N. van de Velde</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zamarin, D" uniqKey="Zamarin D">D. Zamarin</name>
</author>
<author><name sortKey="Garcia Sastre, A" uniqKey="Garcia Sastre A">A. García-Sastre</name>
</author>
<author><name sortKey="Xiao, X" uniqKey="Xiao X">X. Xiao</name>
</author>
<author><name sortKey="Wang, R" uniqKey="Wang R">R. Wang</name>
</author>
<author><name sortKey="Palese, P" uniqKey="Palese P">P. Palese</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Coleman, J R" uniqKey="Coleman J">J. R. Coleman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mcauley, J L" uniqKey="Mcauley J">J. L. McAuley</name>
</author>
<author><name sortKey="Hornung, F" uniqKey="Hornung F">F. Hornung</name>
</author>
<author><name sortKey="Boyd, K L" uniqKey="Boyd K">K. L. Boyd</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gibbs, J S" uniqKey="Gibbs J">J. S. Gibbs</name>
</author>
<author><name sortKey="Malide, D" uniqKey="Malide D">D. Malide</name>
</author>
<author><name sortKey="Hornung, F" uniqKey="Hornung F">F. Hornung</name>
</author>
<author><name sortKey="Bennink, J R" uniqKey="Bennink J">J. R. Bennink</name>
</author>
<author><name sortKey="Yewdell, J W" uniqKey="Yewdell J">J. W. Yewdell</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kurokawa, M" uniqKey="Kurokawa M">M. Kurokawa</name>
</author>
<author><name sortKey="Koyama, A H" uniqKey="Koyama A">A. H. Koyama</name>
</author>
<author><name sortKey="Yasuoka, S" uniqKey="Yasuoka S">S. Yasuoka</name>
</author>
<author><name sortKey="Adachi, A" uniqKey="Adachi A">A. Adachi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Stray, S J" uniqKey="Stray S">S. J. Stray</name>
</author>
<author><name sortKey="Air, G M" uniqKey="Air G">G. M. Air</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wurzer, W J" uniqKey="Wurzer W">W. J. Wurzer</name>
</author>
<author><name sortKey="Planz, O" uniqKey="Planz O">O. Planz</name>
</author>
<author><name sortKey="Ehrhardt, C" uniqKey="Ehrhardt C">C. Ehrhardt</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Elmore, S" uniqKey="Elmore S">S. Elmore</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Silke, J" uniqKey="Silke J">J. Silke</name>
</author>
<author><name sortKey="Vucic, D" uniqKey="Vucic D">D. Vucic</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mcauley, J" uniqKey="Mcauley J">J. McAuley</name>
</author>
<author><name sortKey="Deng, Y M" uniqKey="Deng Y">Y.-M. Deng</name>
</author>
<author><name sortKey="Gilbertson, B" uniqKey="Gilbertson B">B. Gilbertson</name>
</author>
<author><name sortKey="Mackenzie Kludas, C" uniqKey="Mackenzie Kludas C">C. Mackenzie-Kludas</name>
</author>
<author><name sortKey="Barr, I" uniqKey="Barr I">I. Barr</name>
</author>
<author><name sortKey="Brown, L" uniqKey="Brown L">L. Brown</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tauber, S" uniqKey="Tauber S">S. Tauber</name>
</author>
<author><name sortKey="Ligertwood, Y" uniqKey="Ligertwood Y">Y. Ligertwood</name>
</author>
<author><name sortKey="Quigg Nicol, M" uniqKey="Quigg Nicol M">M. Quigg-Nicol</name>
</author>
<author><name sortKey="Dutia, B M" uniqKey="Dutia B">B. M. Dutia</name>
</author>
<author><name sortKey="Elliott, R M" uniqKey="Elliott R">R. M. Elliott</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">Adv Virol</journal-id>
<journal-id journal-id-type="iso-abbrev">Adv Virol</journal-id>
<journal-id journal-id-type="publisher-id">AV</journal-id>
<journal-title-group><journal-title>Advances in Virology</journal-title>
</journal-title-group>
<issn pub-type="ppub">1687-8639</issn>
<issn pub-type="epub">1687-8647</issn>
<publisher><publisher-name>Hindawi</publisher-name>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">30687405</article-id>
<article-id pub-id-type="pmc">6330835</article-id>
<article-id pub-id-type="doi">10.1155/2018/5057184</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Research Article</subject>
</subj-group>
</article-categories>
<title-group><article-title>Apoptotic and Early Innate Immune Responses to PB1-F2 Protein of Influenza A Viruses Belonging to Different Subtypes in Human Lung Epithelial A549 Cells</article-title>
</title-group>
<contrib-group><contrib contrib-type="author"><contrib-id contrib-id-type="orcid" authenticated="false">http://orcid.org/0000-0003-0790-8436</contrib-id>
<name><surname>Pasricha</surname>
<given-names>Gunisha</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Mukherjee</surname>
<given-names>Sanjay</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid" authenticated="false">http://orcid.org/0000-0001-7611-909X</contrib-id>
<name><surname>Chakrabarti</surname>
<given-names>Alok K.</given-names>
</name>
<email>chakrabarti.alok@icmr.gov.in</email>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
</contrib-group>
<aff id="I1">Microbial Containment Complex, National Institute of Virology, Sus Road, Pashan, Pune 411021, India</aff>
<author-notes><fn fn-type="other"><p>Guest Editor: Binod Kumar</p>
</fn>
</author-notes>
<pub-date pub-type="collection"><year>2018</year>
</pub-date>
<pub-date pub-type="epub"><day>31</day>
<month>12</month>
<year>2018</year>
</pub-date>
<volume>2018</volume>
<elocation-id>5057184</elocation-id>
<history><date date-type="received"><day>2</day>
<month>9</month>
<year>2018</year>
</date>
<date date-type="accepted"><day>24</day>
<month>10</month>
<year>2018</year>
</date>
</history>
<permissions><copyright-statement>Copyright © 2018 Gunisha Pasricha et al.</copyright-statement>
<copyright-year>2018</copyright-year>
<license xlink:href="https://creativecommons.org/licenses/by/4.0/"><license-p>This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
</license>
</permissions>
<abstract><p>PB1-F2 is a multifunctional protein and contributes to the pathogenicity of influenza A viruses. PB1-F2 is known to have strain and cell specific functions. In this study we have investigated the apoptotic and inflammatory responses of PB1-F2 protein from influenza viruses of diverse pathogenicities in A549 lung epithelial cells. Overexpression of PB1-F2 resulted in apoptosis and heightened inflammatory response in A549 cells. Comparison revealed that the response varied with each subtype. PB1-F2 protein from highly pathogenic H5N1 virus induced least apoptosis but maximum inflammatory response. Results indicated that apoptosis was mediated through death receptor ligands TNF<italic>α</italic>
and TRAIL via Caspase 8 activation. Significant induction of cytokines/chemokines CXCL10, CCL5, CCL2, IFN<italic>α</italic>
, and IL-6 was noted in A549 cells transfected with PB1-F2 gene construct of 2008 West Bengal H5N1 virus (H5N1-WB). On the contrary, PB1-F2 construct from 2007 highly pathogenic H5N1 isolate (H5N1-M) with truncated N-terminal region did not evoke as exuberant inflammatory response as the other H5N1-WB with full length PB1-F2, signifying the importance of N-terminal region of PB1-F2. Sequence analysis revealed that PB1-F2 proteins derived from different influenza viruses varied at multiple amino acid positions. The secondary structure prediction showed each of the PB1-F2 proteins had distinct helix-loop-helix structure. Thus, our data substantiate the notion that the contribution of PB1-F2 to influenza pathogenicity is greatly strain specific and involves multiple host factors. This data demonstrates that PB1-F2 protein of influenza A virus, when expressed independently is minimally apoptotic and strongly influences the early host response in A549 cells.</p>
</abstract>
<funding-group><award-group><funding-source>Indian Council of Medical Research</funding-source>
</award-group>
<award-group><funding-source>Government of India</funding-source>
</award-group>
</funding-group>
</article-meta>
</front>
<floats-group><fig id="fig1" orientation="portrait" position="float"><label>Figure 1</label>
<caption><p>PB1-F2 sequence comparison and structural predictions. (a) Amino acid multialignment of the five PB1-F2 variants included in this study. PB1-F2 proteins analyzed<italic> in silico </italic>
in this study from the influenza viruses are abbreviated as follows: A/chicken/India/WBNIV2653/2008 (H5N1-WB); A/chicken/India/NIV9743/2007 (H5N1-M); A/chicken/India/WB-NIV1057231/2010 (H9N2); A/aquatic bird/India/NIV-17095/2007 (H11N1); and A/WSN/1933 (H1N1). Eight amino acid residues which have been reported in literature to have significance in enhancing apoptosis and inflammation have been marked with asterisk. L62, R75, R79, and L82 are reported as inflammatory motifs, N66S as a pathogenic marker, L69 and L75 important for mitochondrial localization, K73 and R75 minimally required for apoptosis via mitochondria. (b) Secondary structure predictions were obtained with the software RaptorX program. Straight line structure represents the loop, cylinder represents the <italic>α</italic>
Helix, and arrow head marks the <italic>β</italic>
sheet structure.</p>
</caption>
<graphic xlink:href="AV2018-5057184.001"></graphic>
</fig>
<fig id="fig2" orientation="portrait" position="float"><label>Figure 2</label>
<caption><p>A549 cells grown in a 60 mm culture dish and transfected with different PB1-F2 constructs and empty pcDNA3.1 plasmid as vector (mock) control. Forty-eight-hour after transfection, the cells were lysed and PB1-F2 expression was detected by (a) reverse transcriptase PCR and (b) immunoblotting using a monoclonal mouse anti-HIS antibody. PB1-F2 protein expression analyzed in this study is abbreviated as follows: A/chicken/India/WBNIV2653/2008(H5N1-WB); A/chicken/India/NIV9743/2007 (H5N1-M); A/chicken/India/WB-NIV1057231/2010 (H9N2); A/aquatic bird/India/NIV-17095/2007 (H11N1); and A/WSN/1933 (H1N1).</p>
</caption>
<graphic xlink:href="AV2018-5057184.002"></graphic>
</fig>
<fig id="fig3" orientation="portrait" position="float"><label>Figure 3</label>
<caption><p>Ectopic expression of PB1-F2 protein predisposes cells to minimal apoptosis. A549 cells were transfected with PB1-F2 constructs and the apoptosis was observed by TUNEL staining with FITC-conjugated dUTP cells showing apple green fluorescence which were apoptotic. The overall proportion of death cells was measured by propidium iodide staining (seen as red in color).</p>
</caption>
<graphic xlink:href="AV2018-5057184.003"></graphic>
</fig>
<fig id="fig4" orientation="portrait" position="float"><label>Figure 4</label>
<caption><p>Impact of PB1-F2 expression on the mRNA expression levels of death receptor ligands and receptors. Gene expressions were normalized with the <italic>β</italic>
-actin gene expression level and presented as fold increase relative to nontransfected cell controls. Data asterisks (<italic>∗</italic>
) indicate (<italic>p∗</italic>
< 0.05) and are calculated relative to the mock vector control which is also represented in the figure. This data is representative of three independent experiments. Error bars represent the ± SEM.</p>
</caption>
<graphic xlink:href="AV2018-5057184.004"></graphic>
</fig>
<fig id="fig5" orientation="portrait" position="float"><label>Figure 5</label>
<caption><p>Impact of PB1-F2 expression of the mRNA expression levels of Caspases. Gene expressions were normalized with the <italic>β</italic>
-actin gene expression level and presented as fold increase relative to nontransfected cell controls. Asterisks (<italic>∗</italic>
) indicate (<italic>p∗</italic>
< 0.05) and are calculated relative to the mock vector control which is also represented in the figure. This data is representative of three independent experiments. Error bars represent the ± SEM.</p>
</caption>
<graphic xlink:href="AV2018-5057184.005"></graphic>
</fig>
<fig id="fig6" orientation="portrait" position="float"><label>Figure 6</label>
<caption><p>Impact of PB1-F2 expression on the mRNA expression levels of (a) BCl2 member family which govern the permeabilization of mitochondrial outer membrane. (b) IAP (Inhibitors of Apoptosis) and other antiapoptotic proteins. Gene expressions were normalized with the <italic>β</italic>
-actin gene expression level and presented as fold increase relative to nontransfected cell controls. Data Asterisks (<italic>∗</italic>
) indicate (<italic>p∗</italic>
< 0.05) and are calculated relative to the mock vector control which is also represented in the figure. This data is representative of three independent experiments. Error bars represent the ± SEM.</p>
</caption>
<graphic xlink:href="AV2018-5057184.006"></graphic>
</fig>
<fig id="fig7" orientation="portrait" position="float"><label>Figure 7</label>
<caption><p>Levels of secreted cytokine/chemokine levels in response to PB1-F2 expression in A549 cells measured by ELISArrays. Data are presented as absorbance values at 450 nm. Concentration of the cytokine/chemokines is in pg/ml. Asterisks (<italic>∗</italic>
) indicate (<italic>p∗</italic>
< 0.05) and are calculated relative to the mock vector control which is also represented in the figure. This data is representative of three independent experiments. Error bars represent the ± SEM.</p>
</caption>
<graphic xlink:href="AV2018-5057184.007"></graphic>
</fig>
<table-wrap id="tab1" orientation="portrait" position="float"><label>Table 1</label>
<caption><p>Primer sequences used in the study.</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th align="left" rowspan="1" colspan="1"><bold>Primer</bold>
</th>
<th align="center" rowspan="1" colspan="1"><bold>Sequences 5' to 3'</bold>
</th>
<th align="center" rowspan="1" colspan="1"><bold>Size (bp)</bold>
</th>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1">Uni12</td>
<td align="center" rowspan="1" colspan="1">AGCRAAAGCAGG</td>
<td align="center" rowspan="1" colspan="1"> </td>
</tr>
<tr><td colspan="3" rowspan="1"><hr></hr>
</td>
</tr>
<tr><td rowspan="2" align="left" colspan="1">H1N1</td>
<td align="center" rowspan="1" colspan="1">F- CTTACAGCCATGGGACAGGAACAGG</td>
<td rowspan="2" align="center" colspan="1">270 bp</td>
</tr>
<tr><td align="center" rowspan="1" colspan="1">R- CTTGTGTAAGCTTGTCCACTCGTGT</td>
</tr>
<tr><td colspan="3" rowspan="1"><hr></hr>
</td>
</tr>
<tr><td rowspan="2" align="left" colspan="1">H5N1</td>
<td align="center" rowspan="1" colspan="1">F- ACAGCCATGGAACAGGGACAGGATACA</td>
<td rowspan="2" align="center" colspan="1">270bp</td>
</tr>
<tr><td align="center" rowspan="1" colspan="1">R- GACCTTGGGTGAGTTTATCCACTCTT</td>
</tr>
<tr><td colspan="3" rowspan="1"><hr></hr>
</td>
</tr>
<tr><td rowspan="2" align="left" colspan="1">H5N1-F2</td>
<td align="center" rowspan="1" colspan="1">F- ACCCAATTGATGGACCATTACCTGAG</td>
<td rowspan="2" align="center" colspan="1">156bp</td>
</tr>
<tr><td align="center" rowspan="1" colspan="1">R- GACCTTGGGTGAGTTTATCCACTCTT</td>
</tr>
<tr><td colspan="3" rowspan="1"><hr></hr>
</td>
</tr>
<tr><td rowspan="2" align="left" colspan="1">H11N1</td>
<td align="center" rowspan="1" colspan="1">F- CATACAGCCATGGAACAGGAACAGG</td>
<td rowspan="2" align="center" colspan="1">270bp</td>
</tr>
<tr><td align="center" rowspan="1" colspan="1">R- CTTGGGTGAGTTTCTTGGGTGAGTTTGTCCACTCTTGT</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Sante/explor/H2N2V1/Data/Pmc/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000895 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd -nk 000895 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Sante |area= H2N2V1 |flux= Pmc |étape= Curation |type= RBID |clé= PMC:6330835 |texte= Apoptotic and Early Innate Immune Responses to PB1-F2 Protein of Influenza A Viruses Belonging to Different Subtypes in Human Lung Epithelial A549 Cells }}
Pour générer des pages wiki
HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Curation/RBID.i -Sk "pubmed:30687405" \ | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd \ | NlmPubMed2Wicri -a H2N2V1
This area was generated with Dilib version V0.6.33. |