Serveur d'exploration H2N2

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 000A36 ( Pmc/Corpus ); précédent : 000A359; suivant : 000A370 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Influenza A H1N1pdm 2009 Virus in Paraguay: Nucleotide Point Mutations in Hemagglutinin and Neuraminidase Genes are not Associated with Drug Resistance</title>
<author>
<name sortKey="Espinola, Emilio E" sort="Espinola, Emilio E" uniqKey="Espinola E" first="Emilio E" last="Espínola">Emilio E. Espínola</name>
<affiliation>
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Amarilla, Alberto A" sort="Amarilla, Alberto A" uniqKey="Amarilla A" first="Alberto A" last="Amarilla">Alberto A. Amarilla</name>
<affiliation>
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Martinez, Magaly" sort="Martinez, Magaly" uniqKey="Martinez M" first="Magaly" last="Martínez">Magaly Martínez</name>
<affiliation>
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Aquino, Victor H" sort="Aquino, Victor H" uniqKey="Aquino V" first="Víctor H" last="Aquino">Víctor H. Aquino</name>
<affiliation>
<nlm:aff id="aff2">Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Russomando, Graciela" sort="Russomando, Graciela" uniqKey="Russomando G" first="Graciela" last="Russomando">Graciela Russomando</name>
<affiliation>
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">25328558</idno>
<idno type="pmc">4200701</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4200701</idno>
<idno type="RBID">PMC:4200701</idno>
<idno type="doi">10.2174/1874357901408010009</idno>
<date when="2014">2014</date>
<idno type="wicri:Area/Pmc/Corpus">000A36</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000A36</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Influenza A H1N1pdm 2009 Virus in Paraguay: Nucleotide Point Mutations in Hemagglutinin and Neuraminidase Genes are not Associated with Drug Resistance</title>
<author>
<name sortKey="Espinola, Emilio E" sort="Espinola, Emilio E" uniqKey="Espinola E" first="Emilio E" last="Espínola">Emilio E. Espínola</name>
<affiliation>
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Amarilla, Alberto A" sort="Amarilla, Alberto A" uniqKey="Amarilla A" first="Alberto A" last="Amarilla">Alberto A. Amarilla</name>
<affiliation>
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Martinez, Magaly" sort="Martinez, Magaly" uniqKey="Martinez M" first="Magaly" last="Martínez">Magaly Martínez</name>
<affiliation>
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Aquino, Victor H" sort="Aquino, Victor H" uniqKey="Aquino V" first="Víctor H" last="Aquino">Víctor H. Aquino</name>
<affiliation>
<nlm:aff id="aff2">Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Russomando, Graciela" sort="Russomando, Graciela" uniqKey="Russomando G" first="Graciela" last="Russomando">Graciela Russomando</name>
<affiliation>
<nlm:aff id="aff1">Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">The Open Virology Journal</title>
<idno type="eISSN">1874-3579</idno>
<imprint>
<date when="2014">2014</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Influenza virus is associated with upper respiratory tract infections. The fourth influenza pandemic was declared in 2009. The aim of this study was to determine the genetic variability of the 2009 H1N1 pandemic virus circulating in Paraguay. Nasal swabs were collected from 181 patients with flu symptoms managed at the Hospital of the Medical School in Asunción, Paraguay, between August and October 2009. Virus detection was carried out by real-time reverse transcription-polymerase chain reaction, followed by sequencing of the hemagglutinin and neuraminidase genes, and phylogenetic analysis. H1N1pdm09 was detected in 14.9% (27/181) of the suspected cases. Analysis of 13 samples showed that these viruses the clustered in a single genetic group. Neither the mutation related to exacerbation of disease (D239G in hemagglutinin) nor that related to antiviral resistance (H275Y in neuraminidase), both detected in neighboring countries, were found. This genetic analysis of H1N1pdm09 will help to understand the spread of the disease.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Knipe, Dm" uniqKey="Knipe D">DM Knipe</name>
</author>
<author>
<name sortKey=" Howley, Pm" uniqKey=" Howley P">PM Howley</name>
</author>
<author>
<name sortKey=" Griffin, De" uniqKey=" Griffin D">DE Griffin</name>
</author>
<author>
<name sortKey="Lamb, Ra" uniqKey="Lamb R">RA Lamb</name>
</author>
<author>
<name sortKey=" Krug, Rm" uniqKey=" Krug R">RM Krug</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tong, S" uniqKey="Tong S">S Tong</name>
</author>
<author>
<name sortKey="Zhu, X" uniqKey="Zhu X">X Zhu</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Qu, Y" uniqKey="Qu Y">Y Qu</name>
</author>
<author>
<name sortKey="Zhang, R" uniqKey="Zhang R">R Zhang</name>
</author>
<author>
<name sortKey="Cui, P" uniqKey="Cui P">P Cui</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Babakir Mina, M" uniqKey="Babakir Mina M">M Babakir-Mina</name>
</author>
<author>
<name sortKey="Dimonte, S" uniqKey="Dimonte S">S Dimonte</name>
</author>
<author>
<name sortKey="Perno, Cf" uniqKey="Perno C">CF Perno</name>
</author>
<author>
<name sortKey=" Ciotti, M" uniqKey=" Ciotti M">M Ciotti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Garten, Rj" uniqKey="Garten R">RJ Garten</name>
</author>
<author>
<name sortKey=" Davis, Ct" uniqKey=" Davis C">CT Davis</name>
</author>
<author>
<name sortKey=" Russell, Ca" uniqKey=" Russell C">CA Russell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Barrero, Pr" uniqKey="Barrero P">PR Barrero</name>
</author>
<author>
<name sortKey=" Viegas, M" uniqKey=" Viegas M">M Viegas</name>
</author>
<author>
<name sortKey="Valinotto, Le" uniqKey="Valinotto L">LE Valinotto</name>
</author>
<author>
<name sortKey=" Mistchenko, As" uniqKey=" Mistchenko A">AS Mistchenko</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Souza, Tm" uniqKey="Souza T">TM Souza</name>
</author>
<author>
<name sortKey=" Resende, Pc" uniqKey=" Resende P">PC Resende</name>
</author>
<author>
<name sortKey=" Fintelman Rodrigues, N" uniqKey=" Fintelman Rodrigues N">N Fintelman-Rodrigues</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cabello, A" uniqKey="Cabello A">A Cabello</name>
</author>
<author>
<name sortKey="Von Horoch, M" uniqKey="Von Horoch M">M von Horoch</name>
</author>
<author>
<name sortKey="Ojeda, A" uniqKey="Ojeda A">A Ojeda</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hall, Ta" uniqKey="Hall T">TA Hall</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Thompson, Jd" uniqKey="Thompson J">JD Thompson</name>
</author>
<author>
<name sortKey=" Higgins, Dg" uniqKey=" Higgins D">DG Higgins</name>
</author>
<author>
<name sortKey=" Gibson, Tj" uniqKey=" Gibson T">TJ Gibson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Espinola, Ee" uniqKey="Espinola E">EE Espinola</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tamura, K" uniqKey="Tamura K">K Tamura</name>
</author>
<author>
<name sortKey="Peterson, D" uniqKey="Peterson D">D Peterson</name>
</author>
<author>
<name sortKey="Peterson, N" uniqKey="Peterson N">N Peterson</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ekiert, Dc" uniqKey="Ekiert D">DC Ekiert</name>
</author>
<author>
<name sortKey=" Bhabha, G" uniqKey=" Bhabha G">G Bhabha</name>
</author>
<author>
<name sortKey="Elsliger, Ma" uniqKey="Elsliger M">MA Elsliger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kilander, A" uniqKey="Kilander A">A Kilander</name>
</author>
<author>
<name sortKey="Rykkvin, R" uniqKey="Rykkvin R">R Rykkvin</name>
</author>
<author>
<name sortKey="Dudman, S" uniqKey="Dudman S">S Dudman</name>
</author>
<author>
<name sortKey="Hungnes, O" uniqKey="Hungnes O">O Hungnes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y Liu</name>
</author>
<author>
<name sortKey="Childs, Ra" uniqKey="Childs R">RA Childs</name>
</author>
<author>
<name sortKey=" Matrosovich, T" uniqKey=" Matrosovich T">T Matrosovich</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ikonen, N" uniqKey="Ikonen N">N Ikonen</name>
</author>
<author>
<name sortKey="Haanpaa, M" uniqKey="Haanpaa M">M Haanpaa</name>
</author>
<author>
<name sortKey="Ronkko, E" uniqKey="Ronkko E">E Ronkko</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pan, C" uniqKey="Pan C">C Pan</name>
</author>
<author>
<name sortKey="Cheung, B" uniqKey="Cheung B">B Cheung</name>
</author>
<author>
<name sortKey="Tan, S" uniqKey="Tan S">S Tan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Deyde, Vm" uniqKey="Deyde V">VM Deyde</name>
</author>
<author>
<name sortKey=" Nguyen, T" uniqKey=" Nguyen T">T Nguyen</name>
</author>
<author>
<name sortKey="Bright, Ra" uniqKey="Bright R">RA Bright</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Der Vries, E" uniqKey="Van Der Vries E">E van der Vries</name>
</author>
<author>
<name sortKey="Stelma, Ff" uniqKey="Stelma F">FF Stelma</name>
</author>
<author>
<name sortKey=" Boucher, Ca" uniqKey=" Boucher C">CA Boucher</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Harvala, H" uniqKey="Harvala H">H Harvala</name>
</author>
<author>
<name sortKey="Gunson, R" uniqKey="Gunson R">R Gunson</name>
</author>
<author>
<name sortKey="Simmonds, P" uniqKey="Simmonds P">P Simmonds</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Open Virol J</journal-id>
<journal-id journal-id-type="iso-abbrev">Open Virol J</journal-id>
<journal-id journal-id-type="publisher-id">TOVJ</journal-id>
<journal-title-group>
<journal-title>The Open Virology Journal</journal-title>
</journal-title-group>
<issn pub-type="epub">1874-3579</issn>
<publisher>
<publisher-name>Bentham Open</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">25328558</article-id>
<article-id pub-id-type="pmc">4200701</article-id>
<article-id pub-id-type="publisher-id">TOVJ-8-9</article-id>
<article-id pub-id-type="doi">10.2174/1874357901408010009</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Influenza A H1N1pdm 2009 Virus in Paraguay: Nucleotide Point Mutations in Hemagglutinin and Neuraminidase Genes are not Associated with Drug Resistance</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Espínola</surname>
<given-names>Emilio E</given-names>
</name>
<xref ref-type="corresp" rid="cor1">*</xref>
<xref ref-type="aff" rid="aff1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Amarilla</surname>
<given-names>Alberto A</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
<xref ref-type="aff" rid="aff2">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Martínez</surname>
<given-names>Magaly</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Aquino</surname>
<given-names>Víctor H</given-names>
</name>
<xref ref-type="aff" rid="aff2">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Russomando</surname>
<given-names>Graciela</given-names>
</name>
<xref ref-type="aff" rid="aff1">1</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
Departamento de Biología Molecular y Genética, Instituto de Investigaciones en Ciencias de la Salud, Universidad Nacional de Asunción, Paraguay</aff>
<aff id="aff2">
<label>2</label>
Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, Ribeirão Preto, SP, Brazil</aff>
<author-notes>
<corresp id="cor1">
<label>*</label>
Address correspondence to this author at the Rio de la Plata y Lagerenza, CP1120, Asunción, Paraguay; Tel: +595 21 424 520; Fax: +595 21 480 185; E-mail:
<email xlink:href="emilioespinola@hotmail.com">emilioespinola@hotmail.com</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>29 </day>
<month>9</month>
<year>2014</year>
</pub-date>
<pub-date pub-type="collection">
<year>2014</year>
</pub-date>
<volume>8</volume>
<fpage>9</fpage>
<lpage>13</lpage>
<history>
<date date-type="received">
<day>13</day>
<month>6</month>
<year>2014</year>
</date>
<date date-type="rev-recd">
<day>15</day>
<month>7</month>
<year>2014</year>
</date>
<date date-type="accepted">
<day>18</day>
<month>7</month>
<year>2014</year>
</date>
</history>
<permissions>
<copyright-statement>© Bobardt
<italic>et al.</italic>
; Licensee
<italic>Bentham Open.</italic>
</copyright-statement>
<copyright-year>2014</copyright-year>
<copyright-holder>Bobardt</copyright-holder>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">
<license-p>This is an open access article licensed under the terms of the Creative Commons Attribution Non-Commercial License (
<uri xlink:type="simple" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">http://creativecommons.org/licenses/by-nc/3.0/</uri>
) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.</license-p>
</license>
</permissions>
<abstract>
<p>Influenza virus is associated with upper respiratory tract infections. The fourth influenza pandemic was declared in 2009. The aim of this study was to determine the genetic variability of the 2009 H1N1 pandemic virus circulating in Paraguay. Nasal swabs were collected from 181 patients with flu symptoms managed at the Hospital of the Medical School in Asunción, Paraguay, between August and October 2009. Virus detection was carried out by real-time reverse transcription-polymerase chain reaction, followed by sequencing of the hemagglutinin and neuraminidase genes, and phylogenetic analysis. H1N1pdm09 was detected in 14.9% (27/181) of the suspected cases. Analysis of 13 samples showed that these viruses the clustered in a single genetic group. Neither the mutation related to exacerbation of disease (D239G in hemagglutinin) nor that related to antiviral resistance (H275Y in neuraminidase), both detected in neighboring countries, were found. This genetic analysis of H1N1pdm09 will help to understand the spread of the disease.</p>
</abstract>
<kwd-group>
<title>Keywords</title>
<kwd>Hemagglutinin</kwd>
<kwd>pandemic influenza H1N1 2009</kwd>
<kwd>neuraminidase</kwd>
<kwd>respiratory disease</kwd>
<kwd>swine flu.</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec sec-type="intro">
<title>INTRODUCTION</title>
<p>Influenza A viruses, which infect a wide variety of mammals and birds, belong to the
<italic>Orthomyxoviridae</italic>
family. These enveloped viruses have a genome composed of eight segments of single-stranded, negative-sense RNA. Two antigenic proteins are anchored in the virus envelope: Hemagglutinin (HA) and Neuraminidase (NA). These proteins, which exhibit higher antigenic variability than the other virus proteins, are the main determinants of pathogenicity [
<xref rid="R1" ref-type="bibr">1</xref>
]. Eighteen HA subtypes (H1-H18), and eleven NA subtypes (N1-N11) have been found [
<xref rid="R2" ref-type="bibr">2</xref>
], and several combinations of these proteins due to genetic reassortment can be detected in nature [
<xref rid="R1" ref-type="bibr">1</xref>
].</p>
<p>The fourth influenza pandemic (H1N1) was declared on June 11 (2009) [
<xref rid="R3" ref-type="bibr">3</xref>
], after the cases of 1918 (H1N1), 1957 (H2N2), and 1968 (H3N2) [
<xref rid="R1" ref-type="bibr">1</xref>
]. It is thought that the new 2009 H1N1 pandemic virus (henceforth, H1N1pdm09) has emerged through at least four reassortment and transmission events among swine, avian and human H1N1 lineages, probably in Asia and North America [
<xref rid="R4" ref-type="bibr">4</xref>
]. Particularly, the HA segment of H1N1pdm09 was originated from the American swine lineage, whereas the NA segment derives from the European swine lineage [
<xref rid="R5" ref-type="bibr">5</xref>
,
<xref rid="R6" ref-type="bibr"> 6</xref>
].</p>
<p>In South America, information about H1N1pdm09 diversity is scarce. However, circulation of antiviral resistant strains has been reported in countries neighboring Paraguay. In Argentina, a study carried out in 2009 isolated six oseltamivir-resistant strains containing the NA H275Y mutation, from 262 cases with mild to severe forms of the disease; none of the mutations in HA or NA were related to fatal cases [
<xref rid="R7" ref-type="bibr">7</xref>
]. In Brazil, another study carried out in 2009 found one oseltamivir-resistant strain out of 305 cases from a patient with scarce medical record [
<xref rid="R8" ref-type="bibr">8</xref>
].</p>
<p>In Paraguay, the first confirmed case was declared on May 19, 2009 and by the end of that year, 8,284 H1N1pdm09 suspected cases were reported, including 987 confirmed cases and 46 deaths (May to December 2009) [
<xref rid="R9" ref-type="bibr">9</xref>
]. Approximately 50% of the suspected cases were reported in July 2009, 60% of whom were female, 30% ranged from 20 to 39 years of age, and 60% were inhabitants of the Central Department and Asunción. The severity of the disease, and mortality related to H1N1pdm09 infection were associated with the presence of pre-existing medical conditions, such as obesity, pregnancy, diabetes mellitus, and cardiovascular disease, as well as with being male, older than 60 years, and not vaccinated against seasonal influenza virus during 2009 [
<xref rid="R10" ref-type="bibr">10</xref>
].</p>
<p>The aim of this study was to determine the genetic variability of the H1N1pdm09 viruses circulating in the Central Department of Paraguay during the pandemic phase. Nasal swabs were obtained from 181 children and adults with clinical symptoms of influenza-like illness or severe acute respiratory infection (suspected cases), without data of antiviral treatment, managed at the Hospital of the Medical School, National University of Asunción (UNA), Paraguay, between August and October 2009 [
<xref rid="R10" ref-type="bibr">10</xref>
]. This Hospital provides medical care to low-income families residing in the Central Department, which has a population of around two million (~25% of the Paraguayan population). Samples were collected by the hospital personnel using a synthetic swab (Dacron) and stored in 2 mL of viral transport medium (0.5% BSA, 100 U/mL penicillin, 100 U/mL gentamicin, diluted in PBS). Samples were collected within two-five days of the appearance of symptoms. These samples were maintained at 4ºC for up to three days and then sent to the Molecular Biology Laboratory of the
<italic>Instituto de Investigaciones en Ciencias de la Salud</italic>
, UNA (IICS-UNA). The samples were fractionated and stored at -80ºC until analysis. Samples were codified to maintain confidentiality of patients.</p>
<p>Total RNA was extracted from 200 µL of sample with the AxyPrep Body Fluid Viral DNA/RNA Miniprep Kit (Axygen Biosciences, CA, USA), following the manufacturer’s recommendations, and then eluted in 60 µL of nuclease-free water.</p>
<p>Real time reverse transcription-polymerase chain reaction (RT-PCR) analysis was carried out following standard procedures [
<xref rid="R11" ref-type="bibr">11</xref>
]. Briefly, the reaction contained 5 µL of total RNA, 0.5 µL of primers and TaqMan probes (Influenza A 2009 H1N1 Assay Sets v1.0, Applied Biosystems, CA, USA), 0.5 µL of one-step enzymes (AgPath-ID One-Step RT-PCR Kit, Ambion, CA, USA), and 12.5 µL of 2X buffer in a final volume of 25 µL. Each sample was analyzed in four different tubes, depending on the amplified gene target: matrix (InfA, 106-bp), swine nucleoprotein (swInfA, 195-bp), swine HA type 1 (swH1, 116-bp), and human RNase P (internal control, 65-bp). A 7500 Real-Time PCR System (Applied Biosystems) was used. The mixture was incubated at 50ºC for 30 min, followed by incubation at 95ºC for 2 min, and 40 cycles of amplification, each consisting of </p>
<p>incubations at 95ºC for 15 sec and 55ºC for 30 sec. A sample was considered positive if both the InfA and the respective subtype (swInfA or swH1) reaction curves crossed the threshold (Ct) line within the first 40 cycles [
<xref rid="R11" ref-type="bibr">11</xref>
].</p>
<p>The HA and NA genes were amplified by RT-PCR. The reaction for cDNA synthesis contained 10 µL of total RNA, 200 ng of random primers (Invitrogen, USA), 0.25 mM dNTPs mix (Invitrogen), 80 U of RNAseOUT (Invitrogen), 200 U of M-MLV Reverse Transcriptase (Promega, USA), and 8 μL 5X buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl
<sub>2</sub>
, 50 mM DTT), in a final volume of 40 µL. The mixture was incubated at 25ºC for 10 min, followed by incubation at 37ºC for 4 h, and a final incubation of 5 min at 85ºC.</p>
<p>Three overlapping fragments of the HA and NA genes were amplified by PCR: HA (635-bp, 864-bp, and 813-bp), and NA (584-bp, 681-bp, and 473-bp). The amplification reaction contained 5 µL of cDNA, 0.15 µM of each primer (primers used are listed in Table
<bold>
<xref ref-type="table" rid="T1">1</xref>
</bold>
), 0.25 mM dNTPs mix (Invitrogen), 1.5 U of DFS-Taq DNA polymerase (Bioron, Germany), and 5 µL 10X buffer II (500 mM KCl, 100 mM Tris-HCl pH 8.8, 0.1% Tween-20, 15 mM MgCl
<sub>2</sub>
), in a final volume of 50 µL. The cycling conditions were as follows: denaturation at 95ºC for 2 min, and 45 cycles of amplification, each consisting of denaturation at 95ºC for 30 sec, primer annealing at 45ºC for 30 sec, and primer extension at 72ºC for 5 min, followed by a final extension at 72ºC for 7 min. The PCR products were analyzed in 1.8% agarose gels, stained with ethidium bromide, and visualized under UV light. Standard procedures to avoid any type of contamination with amplicons were performed in different rooms.</p>
<p>The HA and NA PCR products were purified from 1.8% agarose gels, using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences), and directly sequenced (both strands, 3X coverage each) in an ABI PRISM 310 DNA analyzer (Applied Biosystems). Nucleotide sequences were manually edited with BioEdit v.7.0.5 [
<xref rid="R12" ref-type="bibr">12</xref>
], and aligned with </p>
<p>CLUSTAL W [
<xref rid="R13" ref-type="bibr">13</xref>
]. The HA and NA sequences obtained were compared with 2,038 HA and 1,273 NA coding sequences of H1N1pdm09 reported worldwide during 2009-2010 [
<xref rid="R14" ref-type="bibr">14</xref>
]. Phylogenetic relationships were reconstructed by the neighbor-joining method with Kimura’s two-parameter as the model of nucleotide substitution and bootstrap analysis of 1,000 replicates, as incorporated in MEGA v5 [
<xref rid="R15" ref-type="bibr">15</xref>
]. The sequences selected from subtypes H1-H18 and N1-N11 were obtained from GenBank. The nucleotide sequences for the HA and NA genes obtained in this study were deposited in GenBank, under the following accession numbers: HA (JX625229– JX625241), and NA (JX625242– JX625254).</p>
<p>Written informed consent was obtained from parents or guardians of all participating individuals. This study was approved by the Ethics Committee of the IICS-UNA, under code M13/10.</p>
<p>Genomic RNA of H1N1pdm09 was detected by real-time RT-PCR in 14.9% (27/181) of the suspected cases. However, it was possible to amplify and sequence the DNA of the HA and NA genes of 13 samples, with Ct values<30. High percentage of genetic identity, ranging from 99.7% to 100% for the HA gene, and 99.5% to 100% for the NA gene, was observed among the viruses analyzed. This is in agreement with our previous report showing that the HA and NA gene sequences have a high percentage of identity with the H1N1pdm09 viruses reported worldwide during 2009-2010 [
<xref rid="R14" ref-type="bibr">14</xref>
]. The high percentages of nucleotide identity are in agreement with the single clustering of Paraguayan samples and those from the 2009-2010 worldwide circulation, as shown in the phylogenetic trees (Fig.
<bold>
<xref ref-type="fig" rid="F1">1</xref>
</bold>
). The high percentages of HA and NA nucleotide identity are also in agreement with published serological data, which show that the new pandemic viruses are antigenically very similar [
<xref rid="R6" ref-type="bibr">6</xref>
].</p>
<p>When the deduced HA and NA amino acid sequences of Paraguayan H1N1pdm09 viruses were compared with the early vaccine strain A/California/07/2009 (isolated in California, USA, and sequenced and published by the CDC on April 27) [
<xref rid="R16" ref-type="bibr">16</xref>
], several amino acid mutations were found. Two amino acid substitutions, S220T (100%), and E391K (30.8%), were observed in the HA protein of the Paraguayan viruses (Table
<bold>
<xref ref-type="table" rid="T2">2</xref>
</bold>
). The amino acid S220 is localized within the HA antigenic site designated Ca (site C, subsite a) as well as at the receptor binding domain (RBD); thus, S220T could affect the transmissibility and infectivity of H1N1 in humans. The substitution E391K found in this study has been previously identified as part of a highly conserved epitope in the 1918 H1N1 virus, with a possible role in membrane fusion [
<xref rid="R17" ref-type="bibr">17</xref>
]. In the HA protein, we did not find the S101N mutation, which is thought to be an adaptation to the human host, or D239E/G, which has been associated with severe clinical outcomes [
<xref rid="R18" ref-type="bibr">18</xref>
] and exacerbate forms of respiratory disease [
<xref rid="R19" ref-type="bibr">19</xref>
], or N387H, localized at a glycosylation site that could potentially affect the antigenic properties of influenza viruses [
<xref rid="R20" ref-type="bibr">20</xref>
].</p>
<p>The NA protein of the Paraguayan viruses showed two amino acid substitutions, V106I (100%) and N248D (100%). This is in agreement with the observation that both mutations were present in respiratory samples at increasing numbers through the early pandemic phase (April to December 2009) </p>
<p>[
<xref rid="R21" ref-type="bibr">21</xref>
]. V106I was reported in H1N1 cases of the 20
<sup>th</sup>
century (in 1918 [pandemic] and 1977), whereas N248D was also reported in 1977. Since the residue at position 248 is located at the drug target domain (DTD), a mutation at this point could potentially affect the sensitivity of antiviral drugs. We did not find the NA D199N mutation associated with an increase in oseltamivir resistance published in both seasonal and H5N1 virus strains [
<xref rid="R22" ref-type="bibr">22</xref>
], or the I223R mutation associated with resistance to oseltamivir, zanamivir and peramivir [
<xref rid="R23" ref-type="bibr">23</xref>
], or H275Y, located at the DTD and related to oseltamivir resistance especially in immunocompromised or severely ill people [
<xref rid="R24" ref-type="bibr">24</xref>
]. In countries neighboring Paraguay, such as Argentina and Brazil, however, some studies reported the circulation of oseltamivir-resistant strains [
<xref rid="R7" ref-type="bibr">7</xref>
,
<xref rid="R8" ref-type="bibr"> 8</xref>
]. Thus, we cannot discard the possibility of circulation of H1N1pdm09 drug-resistant strains during the pandemic phase in Paraguay. The lack of detection could be related to the small number of sequenced viruses from confirmed cases in the country during the study period.</p>
</sec>
<sec sec-type="conclusion">
<title>CONCLUSION</title>
<p>In conclusion, the genetic analysis of H1N1pdm09 circulating in our region will help to understand the antigenicity and transmissibility of this virus associated with amino acid mutations, and will foster national surveillance systems.</p>
</sec>
</body>
<back>
<ack>
<title>ACKNOWLEDGEMENTS</title>
<p>This work (project code: INV11) was supported by the Consejo Nacional de Ciencia y Tecnología (CONACYT) ― Programa de Apoyo al Desarrollo de la Ciencia, Tecnología e Innovación en Paraguay (BID 1698/OC-PR).</p>
</ack>
<sec>
<title>CONFLICT OF INTEREST</title>
<p>The authors confirm that this article content has no conflict of interest.</p>
</sec>
<ref-list>
<title>REFERENCES</title>
<ref id="R1">
<label>1</label>
<element-citation publication-type="book">
<person-group person-group-type="editor">
<name>
<surname>Knipe</surname>
<given-names>DM</given-names>
</name>
<name>
<surname> Howley</surname>
<given-names>PM</given-names>
</name>
<name>
<surname> Griffin</surname>
<given-names>DE</given-names>
</name>
<name>
<surname>Lamb</surname>
<given-names>RA</given-names>
</name>
<name>
<surname> Krug</surname>
<given-names>RM</given-names>
</name>
</person-group>
<article-title>Orthomyxoviridae The viruses and their replication Fields Virology.</article-title>
<year>2001</year>
<publisher-loc>Lippincott Williams & Wilkins.</publisher-loc>
<publisher-name>Philadelphia</publisher-name>
<fpage>1487</fpage>
<lpage>531</lpage>
</element-citation>
</ref>
<ref id="R2">
<label>2</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tong</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y </given-names>
</name>
<etal></etal>
</person-group>
<article-title>New world bats harbor diverse influenza A viruses.</article-title>
<source>PLoS Pathog.</source>
<year>2013</year>
<volume>9</volume>
<issue>10</issue>
<fpage> e1003657</fpage>
<pub-id pub-id-type="pmid">24130481</pub-id>
</element-citation>
</ref>
<ref id="R3">
<label>3</label>
<element-citation publication-type="book">
<article-title>WHO Pandemic (H1N1):2009 update 75.</article-title>
<source>Accessed on January 1 2012. Available from http: //www.who.int</source>
</element-citation>
</ref>
<ref id="R4">
<label>4</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>P </given-names>
</name>
<etal></etal>
</person-group>
<article-title>Evolutionary genomics of the pandemic 2009, H1N1 influenza viruses (pH1N 1v).</article-title>
<source>Virol J.</source>
<year>2011</year>
<volume>8</volume>
<fpage> e250</fpage>
</element-citation>
</ref>
<ref id="R5">
<label>5</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Babakir-Mina</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Dimonte</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Perno</surname>
<given-names>CF</given-names>
</name>
<name>
<surname> Ciotti</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Origin of the 2009, Mexico influenza virus a comparative phylogenetic analysis of the principal external antigens and matrix protein.</article-title>
<source>Arch Virol.</source>
<year>2009</year>
<volume>154</volume>
<issue>8</issue>
<fpage> 1349</fpage>
<lpage>52</lpage>
<pub-id pub-id-type="pmid">19582546</pub-id>
</element-citation>
</ref>
<ref id="R6">
<label>6</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garten</surname>
<given-names>RJ</given-names>
</name>
<name>
<surname> Davis</surname>
<given-names>CT</given-names>
</name>
<name>
<surname> Russell</surname>
<given-names>CA </given-names>
</name>
<etal></etal>
</person-group>
<article-title>Antigenic and genetic characteristics of swine-origin 2009, A(H1N1):influenza viruses circulating in humans.</article-title>
<source>Science.</source>
<year>2009</year>
<volume>325</volume>
<issue>5937</issue>
<fpage> 197</fpage>
<lpage>201</lpage>
<pub-id pub-id-type="pmid">19465683</pub-id>
</element-citation>
</ref>
<ref id="R7">
<label>7</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barrero</surname>
<given-names>PR</given-names>
</name>
<name>
<surname> Viegas</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Valinotto</surname>
<given-names>LE</given-names>
</name>
<name>
<surname> Mistchenko</surname>
<given-names>AS</given-names>
</name>
</person-group>
<article-title>Genetic and phylogenetic analyses of influenza A H1N1pdm virus in Buenos Aires, Argentina.</article-title>
<source>J Virol.</source>
<year>2011</year>
<volume>85</volume>
<issue>2</issue>
<fpage> 1058</fpage>
<lpage>66</lpage>
<pub-id pub-id-type="pmid">21047959</pub-id>
</element-citation>
</ref>
<ref id="R8">
<label>8</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Souza</surname>
<given-names>TM</given-names>
</name>
<name>
<surname> Resende</surname>
<given-names>PC</given-names>
</name>
<name>
<surname> Fintelman-Rodrigues</surname>
<given-names>N </given-names>
</name>
<etal></etal>
</person-group>
<article-title>Detection of oseltamivir-resistant pandemic influenza A(H1N1)pdm2009, in Brazil can community transmission be ruled outκ.</article-title>
<source>PLoS One.</source>
<year>2013</year>
<volume>8</volume>
<issue>11</issue>
<fpage> e80081</fpage>
<pub-id pub-id-type="pmid">24244615</pub-id>
</element-citation>
</ref>
<ref id="R9">
<label>9</label>
<element-citation publication-type="webpage">
<article-title>DGVS MSPyBS (Paraguay) Boletín semanal de situación epidemiológica.</article-title>
<source>January 8 2010. Accesed on January 30 2010. Available from http: //www.vigisalud.gov.py</source>
</element-citation>
</ref>
<ref id="R10">
<label>10</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cabello</surname>
<given-names>A</given-names>
</name>
<name>
<surname>von Horoch</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ojeda</surname>
<given-names>A </given-names>
</name>
<etal></etal>
</person-group>
<article-title>Factores asociados a mortalidad en la pandemia de influenza H1N1 2009, en Paraguay.</article-title>
<source>Mem. Inst. Investig. Cienc. Salud.</source>
<year>2011</year>
<volume>7</volume>
<issue>1</issue>
<fpage> 5</fpage>
<lpage>12</lpage>
</element-citation>
</ref>
<ref id="R11">
<label>11</label>
<element-citation publication-type="webpage">
<article-title>WHO CDC protocol of realtime RTPCR for influenza A(H1N1).</article-title>
<source>April 284 2009. Available from http: //www.who.int</source>
</element-citation>
</ref>
<ref id="R12">
<label>12</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hall</surname>
<given-names>TA</given-names>
</name>
</person-group>
<article-title>BioEdit a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.</article-title>
<source>Nucl Acids Symp Ser.</source>
<year>1999</year>
<volume>41</volume>
<fpage> 95</fpage>
<lpage>8</lpage>
</element-citation>
</ref>
<ref id="R13">
<label>13</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thompson</surname>
<given-names>JD</given-names>
</name>
<name>
<surname> Higgins</surname>
<given-names>DG</given-names>
</name>
<name>
<surname> Gibson</surname>
<given-names>TJ</given-names>
</name>
</person-group>
<article-title>CLUSTAL W improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.</article-title>
<source>Nucleic Acids Res.</source>
<year>1994</year>
<volume>22</volume>
<issue>22</issue>
<fpage> 4673</fpage>
<lpage>80</lpage>
<pub-id pub-id-type="pmid">7984417</pub-id>
</element-citation>
</ref>
<ref id="R14">
<label>14</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Espinola</surname>
<given-names>EE</given-names>
</name>
</person-group>
<article-title>Genome stability of pandemic influenza A (H1N1):2009, based on analysis of hemagglutinin and neuraminidase genes.</article-title>
<source>Open Virol J.</source>
<year>2012</year>
<volume>6</volume>
<fpage> 59</fpage>
<lpage>63</lpage>
<pub-id pub-id-type="pmid">22582106</pub-id>
</element-citation>
</ref>
<ref id="R15">
<label>15</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tamura</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Peterson</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Peterson</surname>
<given-names>N </given-names>
</name>
<etal></etal>
</person-group>
<article-title>MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.</article-title>
<source>Mol Biol Evol.</source>
<year>2011</year>
<volume>28</volume>
<issue>10</issue>
<fpage> 2731</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">21546353</pub-id>
</element-citation>
</ref>
<ref id="R16">
<label>16</label>
<element-citation publication-type="journal">
<article-title>Centers for Disease Control and Prevention.Swine influenza A (H1N1):infection in two children-Southern California March-April 2009.</article-title>
<source> MMWR Morb Mortal Wkly Rep.</source>
<year>2009</year>
<volume>58</volume>
<issue>15</issue>
<fpage> 400</fpage>
<lpage>2</lpage>
<pub-id pub-id-type="pmid">19390508</pub-id>
</element-citation>
</ref>
<ref id="R17">
<label>17</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ekiert</surname>
<given-names>DC</given-names>
</name>
<name>
<surname> Bhabha</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Elsliger</surname>
<given-names>MA </given-names>
</name>
<etal></etal>
</person-group>
<article-title>Antibody recognition of a highly conserved influenza virus epitope.</article-title>
<source>Science.</source>
<year>2009</year>
<volume>324</volume>
<issue>5924</issue>
<fpage> 246</fpage>
<lpage>51</lpage>
<pub-id pub-id-type="pmid">19251591</pub-id>
</element-citation>
</ref>
<ref id="R18">
<label>18</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kilander</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Rykkvin</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Dudman</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Hungnes</surname>
<given-names>O</given-names>
</name>
</person-group>
<article-title>Observed association between the HA1 mutation D222G in the 2009 pandemic influenza A(H1N1):virus and severe clinical outcome, Norway 2009-2010.</article-title>
<source>Euro Surveill.</source>
<year>2010</year>
<volume>15</volume>
<fpage> e19498</fpage>
</element-citation>
</ref>
<ref id="R19">
<label>19</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Childs</surname>
<given-names>RA</given-names>
</name>
<name>
<surname> Matrosovich</surname>
<given-names>T </given-names>
</name>
<etal></etal>
</person-group>
<article-title>Altered receptor specificity and cell tropism of D222G hemagglutinin mutants isolated from fatal cases of pandemic A(H1N1):2009 influenza virus.</article-title>
<source>J Virol.</source>
<year>2010</year>
<volume>84</volume>
<issue>22</issue>
<fpage> 12069</fpage>
<lpage>74</lpage>
<pub-id pub-id-type="pmid">20826688</pub-id>
</element-citation>
</ref>
<ref id="R20">
<label>20</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ikonen</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Haanpaa</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ronkko</surname>
<given-names>E </given-names>
</name>
<etal></etal>
</person-group>
<article-title>Genetic diversity of the 2009 pandemic influenza A(H1N1):viruses in Finland.</article-title>
<source>PLoS One.</source>
<year>2010</year>
<volume>5</volume>
<issue>10</issue>
<fpage> e13329</fpage>
<pub-id pub-id-type="pmid">20975994</pub-id>
</element-citation>
</ref>
<ref id="R21">
<label>21</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pan</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Cheung</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>S </given-names>
</name>
<etal></etal>
</person-group>
<article-title>Genomic signature and mutation trend analysis of pandemic (H1N1):2009 influenza A virus.</article-title>
<source>PLoS One.</source>
<year>2010</year>
<volume>5</volume>
<issue>3</issue>
<fpage> e9549</fpage>
<pub-id pub-id-type="pmid">20221396</pub-id>
</element-citation>
</ref>
<ref id="R22">
<label>22</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deyde</surname>
<given-names>VM</given-names>
</name>
<name>
<surname> Nguyen</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Bright</surname>
<given-names>RA </given-names>
</name>
<etal></etal>
</person-group>
<article-title>Detection of molecular markers of antiviral resistance in influenza A (H5N1):viruses using a pyrosequencing method.</article-title>
<source>Antimicrob Agents Chemother.</source>
<year>2009</year>
<volume>53</volume>
<issue>3</issue>
<fpage> 1039</fpage>
<lpage>47</lpage>
<pub-id pub-id-type="pmid">19124660</pub-id>
</element-citation>
</ref>
<ref id="R23">
<label>23</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>van der Vries</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Stelma</surname>
<given-names>FF</given-names>
</name>
<name>
<surname> Boucher</surname>
<given-names>CA</given-names>
</name>
</person-group>
<article-title>Emergence of a multidrug-resistant pandemic influenza A (H1N1):virus.</article-title>
<source>N Engl J Med.</source>
<year>2010</year>
<volume>363</volume>
<issue>14</issue>
<fpage> 1381</fpage>
<lpage>2</lpage>
<pub-id pub-id-type="pmid">20879894</pub-id>
</element-citation>
</ref>
<ref id="R24">
<label>24</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harvala</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Gunson</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Simmonds</surname>
<given-names>P </given-names>
</name>
<etal></etal>
</person-group>
<article-title>The emergence of oseltamivir-resistant pandemic influenza A (H1N1):2009 virus amongst hospitalised immunocompromised patients in Scotland, November-December, 2009.</article-title>
<source>Euro Surveill.</source>
<year>2010</year>
<volume>15</volume>
<issue>14</issue>
<fpage> e19536</fpage>
</element-citation>
</ref>
</ref-list>
</back>
<floats-group>
<fig id="F1" position="float">
<label>Fig. (1)</label>
<caption>
<p>Phylogenetic trees corresponding to complete coding nucleotide sequences for the (
<bold>A</bold>
) HA and (
<bold>B</bold>
) NA genes, respectively, each comparing all known subtypes, four worldwide H1N1pdm09 strains (randomly selected), 13 Paraguayan isolates, and the vaccine strain A/California/07/2009. Each sequence is indicated with its GenBank accession number, host of origin (omitted for human strains), geographical origin, name of isolate, and year of isolation. Bootstrap values greater than 70%are shown at branch nodes. Paraguayan isolates are shown with a filled circle. Branch distances are indicated by a scale bar (0.02 nt substitution per site) at the bottom of each tree. </p>
</caption>
<graphic xlink:href="TOVJ-8-9_F1"></graphic>
</fig>
<table-wrap id="T1" position="float">
<label>Table 1.</label>
<caption>
<p>Primers used for complete amplification of the HA and NA coding sequences.</p>
</caption>
<table frame="border" rules="all" width="100%">
<thead>
<tr>
<th align="center" rowspan="1" colspan="1">
<bold>Primer</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Gene</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Position*</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Sense</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Sequence (5' → 3')</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" rowspan="1" colspan="1">ha 635</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">-40 to -22</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">ATACGACTAGCAAAAGCAGGGG </td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 635'</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">574 to 595</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">GATGGTGAATGCCCCATAGCAC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 864</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">514 to 532</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">GGAAATTCATACCCAAAGC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 864'</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">1,356 to 1,377</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">CACATTTGAATCGTGGTAGTCC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 813</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">938 to 962</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">ATCCGATCACAATTGGAAAATGTCC </td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">ha 813'</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">1,727 to 1,750</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">GTGTCAGTAGAAACAAGGGTGTTT</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 584</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">-20 to -6</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">AGCAAAAGCAGGAGT </td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 584'</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">545 to 564</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">GATGCCATCATGACAAGCAC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 681</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">466 to 485</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">CGAACCCTAATGAGCTGTCC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 681'</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">1,126 to 1,146</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">CCCAGTCCATCCGTTCGGATC</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 473</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">966 to 988</td>
<td align="center" rowspan="1" colspan="1">Forward</td>
<td align="center" rowspan="1" colspan="1">CGGAGACAATCCACGCCCTAATG</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">na 473'</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">1,424 to 1,438</td>
<td align="center" rowspan="1" colspan="1">Reverse</td>
<td align="center" rowspan="1" colspan="1">AGTAGAAACAAGGAG</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="T1F1">
<label>*</label>
<p>Nucleotide positions are based on the H1N1pdm 09 vaccine strain A/California/07/2009.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="T2" position="float">
<label>Table 2.</label>
<caption>
<p>Expected and observed amino acid mutations for the HA and NA genes found in this study. </p>
</caption>
<table frame="border" rules="all" width="100%">
<thead>
<tr>
<th align="center" rowspan="1" colspan="1">
<bold>Mutation*</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Gene</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Percentage (Expected)**</bold>
</th>
<th align="center" rowspan="1" colspan="1">
<bold>Percentage (Observed)</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" rowspan="1" colspan="1">S101N</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">0.2%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">S220T</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">76.7%</td>
<td align="center" rowspan="1" colspan="1">100%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">D239E</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">5.5%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">D239G</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">2.6%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">N387H</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">1.7%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">E391K</td>
<td align="center" rowspan="1" colspan="1">HA</td>
<td align="center" rowspan="1" colspan="1">15.6%</td>
<td align="center" rowspan="1" colspan="1">30.8%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">V106I</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">85.1%</td>
<td align="center" rowspan="1" colspan="1">100%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">D199N</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">0.3%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">I223R</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">0.2%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">N248D</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">85.9%</td>
<td align="center" rowspan="1" colspan="1">100%</td>
</tr>
<tr>
<td align="center" rowspan="1" colspan="1">H275Y</td>
<td align="center" rowspan="1" colspan="1">NA</td>
<td align="center" rowspan="1" colspan="1">2.0%</td>
<td align="center" rowspan="1" colspan="1">0.0%</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="T2F1">
<label>*</label>
<p>Amino acid positions are based on the H1N1pdm 09 vaccine strain A/California/07/2009.</p>
</fn>
<fn id="T2F2">
<label>**</label>
<p>Expected percentage of mutations for the HA and NA genes, based on published worldwide data [14].</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/H2N2V1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000A36  | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000A36  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    H2N2V1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Tue Apr 14 19:59:40 2020. Site generation: Thu Mar 25 15:38:26 2021