Links to Exploration step
Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">The oral microbiome of patients with axial spondyloarthritis compared to healthy individuals</title>
<author><name sortKey="Bisanz, Jordan E" sort="Bisanz, Jordan E" uniqKey="Bisanz J" first="Jordan E." last="Bisanz">Jordan E. Bisanz</name>
<affiliation><nlm:aff id="aff-1"><institution>Department of Microbiology and Immunology, Western University</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Suppiah, Praema" sort="Suppiah, Praema" uniqKey="Suppiah P" first="Praema" last="Suppiah">Praema Suppiah</name>
<affiliation><nlm:aff id="aff-3"><institution>School of Dentistry, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Thomson, W Murray" sort="Thomson, W Murray" uniqKey="Thomson W" first="W. Murray" last="Thomson">W. Murray Thomson</name>
<affiliation><nlm:aff id="aff-3"><institution>School of Dentistry, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Milne, Trudy" sort="Milne, Trudy" uniqKey="Milne T" first="Trudy" last="Milne">Trudy Milne</name>
<affiliation><nlm:aff id="aff-3"><institution>School of Dentistry, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-4"><institution>Sir John Walsh Research Institute, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<addr-line>Otago</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yeoh, Nigel" sort="Yeoh, Nigel" uniqKey="Yeoh N" first="Nigel" last="Yeoh">Nigel Yeoh</name>
<affiliation><nlm:aff id="aff-5"><institution>Dunedin School of Medicine, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nolan, Anita" sort="Nolan, Anita" uniqKey="Nolan A" first="Anita" last="Nolan">Anita Nolan</name>
<affiliation><nlm:aff id="aff-5"><institution>Dunedin School of Medicine, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-6"><institution>Oral Health, AUT</institution>
,<addr-line>Auckland</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ettinger, Grace" sort="Ettinger, Grace" uniqKey="Ettinger G" first="Grace" last="Ettinger">Grace Ettinger</name>
<affiliation><nlm:aff id="aff-1"><institution>Department of Microbiology and Immunology, Western University</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Reid, Gregor" sort="Reid, Gregor" uniqKey="Reid G" first="Gregor" last="Reid">Gregor Reid</name>
<affiliation><nlm:aff id="aff-1"><institution>Department of Microbiology and Immunology, Western University</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-7"><institution>Division of Urology, Department of Surgery, University of Western Ontario</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Gloor, Gregory B" sort="Gloor, Gregory B" uniqKey="Gloor G" first="Gregory B." last="Gloor">Gregory B. Gloor</name>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-8"><institution>Department of Biochemistry, University of Western Ontario</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Burton, Jeremy P" sort="Burton, Jeremy P" uniqKey="Burton J" first="Jeremy P." last="Burton">Jeremy P. Burton</name>
<affiliation><nlm:aff id="aff-1"><institution>Department of Microbiology and Immunology, Western University</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-7"><institution>Division of Urology, Department of Surgery, University of Western Ontario</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cullinan, Mary P" sort="Cullinan, Mary P" uniqKey="Cullinan M" first="Mary P." last="Cullinan">Mary P. Cullinan</name>
<affiliation><nlm:aff id="aff-3"><institution>School of Dentistry, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-4"><institution>Sir John Walsh Research Institute, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<addr-line>Otago</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Stebbings, Simon M" sort="Stebbings, Simon M" uniqKey="Stebbings S" first="Simon M." last="Stebbings">Simon M. Stebbings</name>
<affiliation><nlm:aff id="aff-5"><institution>Dunedin School of Medicine, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">27330858</idno>
<idno type="pmc">4906644</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4906644</idno>
<idno type="RBID">PMC:4906644</idno>
<idno type="doi">10.7717/peerj.2095</idno>
<date when="2016">2016</date>
<idno type="wicri:Area/Pmc/Corpus">000766</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000766</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">The oral microbiome of patients with axial spondyloarthritis compared to healthy individuals</title>
<author><name sortKey="Bisanz, Jordan E" sort="Bisanz, Jordan E" uniqKey="Bisanz J" first="Jordan E." last="Bisanz">Jordan E. Bisanz</name>
<affiliation><nlm:aff id="aff-1"><institution>Department of Microbiology and Immunology, Western University</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Suppiah, Praema" sort="Suppiah, Praema" uniqKey="Suppiah P" first="Praema" last="Suppiah">Praema Suppiah</name>
<affiliation><nlm:aff id="aff-3"><institution>School of Dentistry, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Thomson, W Murray" sort="Thomson, W Murray" uniqKey="Thomson W" first="W. Murray" last="Thomson">W. Murray Thomson</name>
<affiliation><nlm:aff id="aff-3"><institution>School of Dentistry, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Milne, Trudy" sort="Milne, Trudy" uniqKey="Milne T" first="Trudy" last="Milne">Trudy Milne</name>
<affiliation><nlm:aff id="aff-3"><institution>School of Dentistry, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-4"><institution>Sir John Walsh Research Institute, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<addr-line>Otago</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Yeoh, Nigel" sort="Yeoh, Nigel" uniqKey="Yeoh N" first="Nigel" last="Yeoh">Nigel Yeoh</name>
<affiliation><nlm:aff id="aff-5"><institution>Dunedin School of Medicine, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nolan, Anita" sort="Nolan, Anita" uniqKey="Nolan A" first="Anita" last="Nolan">Anita Nolan</name>
<affiliation><nlm:aff id="aff-5"><institution>Dunedin School of Medicine, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-6"><institution>Oral Health, AUT</institution>
,<addr-line>Auckland</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ettinger, Grace" sort="Ettinger, Grace" uniqKey="Ettinger G" first="Grace" last="Ettinger">Grace Ettinger</name>
<affiliation><nlm:aff id="aff-1"><institution>Department of Microbiology and Immunology, Western University</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Reid, Gregor" sort="Reid, Gregor" uniqKey="Reid G" first="Gregor" last="Reid">Gregor Reid</name>
<affiliation><nlm:aff id="aff-1"><institution>Department of Microbiology and Immunology, Western University</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-7"><institution>Division of Urology, Department of Surgery, University of Western Ontario</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Gloor, Gregory B" sort="Gloor, Gregory B" uniqKey="Gloor G" first="Gregory B." last="Gloor">Gregory B. Gloor</name>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-8"><institution>Department of Biochemistry, University of Western Ontario</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Burton, Jeremy P" sort="Burton, Jeremy P" uniqKey="Burton J" first="Jeremy P." last="Burton">Jeremy P. Burton</name>
<affiliation><nlm:aff id="aff-1"><institution>Department of Microbiology and Immunology, Western University</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-2"><institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-7"><institution>Division of Urology, Department of Surgery, University of Western Ontario</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cullinan, Mary P" sort="Cullinan, Mary P" uniqKey="Cullinan M" first="Mary P." last="Cullinan">Mary P. Cullinan</name>
<affiliation><nlm:aff id="aff-3"><institution>School of Dentistry, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff-4"><institution>Sir John Walsh Research Institute, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<addr-line>Otago</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Stebbings, Simon M" sort="Stebbings, Simon M" uniqKey="Stebbings S" first="Simon M." last="Stebbings">Simon M. Stebbings</name>
<affiliation><nlm:aff id="aff-5"><institution>Dunedin School of Medicine, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">PeerJ</title>
<idno type="eISSN">2167-8359</idno>
<imprint><date when="2016">2016</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p><bold>Background.</bold>
A loss of mucosal tolerance to the resident microbiome has been postulated in the aetiopathogenesis of spondyloarthritis, thus the purpose of these studies was to investigate microbial communities that colonise the oral cavity of patients with axial spondyloarthritis (AxSpA) and to compare these with microbial profiles of a matched healthy population.</p>
<p><bold>Methods.</bold>
Thirty-nine participants, 17 patients with AxSpA and 22 age and gender-matched disease-free controls were recruited to the study. For patients with AxSpA, disease activity was assessed using the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI). All participants underwent a detailed dental examination to assess oral health, including the presence of periodontal disease assessed using probing pocket depth (PPD). Plaque samples were obtained and their bacterial populations were profiled using Ion Torrent sequencing of the V6 region of the 16S rRNA gene.</p>
<p><bold>Results.</bold>
Patients with AxSpA had active disease (BASDAI 4.1 ± 2.1 [mean ± SD]), and a significantly greater prevalence of periodontitis (PPD ≥ 4 mm at ≥4 sites) than controls. Bacterial communities did not differ between the two groups with multiple metrics of <italic>α</italic>
and <italic>β</italic>
diversity considered. Analysis of operational taxonomic units (OTUs) and higher levels of taxonomic assignment did not provide strong evidence of any single taxa associated with AxSpA in the subgingival plaque.</p>
<p><bold>Discussion.</bold>
Although 16S rRNA gene sequencing did not identify specific bacterial profiles associated with AxSpA, there remains the potential for the microbiota to exert functional and metabolic influences in the oral cavity which could be involved in the pathogenesis of AxSpA.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Bisanz, Je" uniqKey="Bisanz J">JE Bisanz</name>
</author>
<author><name sortKey="Enos, Mk" uniqKey="Enos M">MK Enos</name>
</author>
<author><name sortKey="Mwanga, Jr" uniqKey="Mwanga J">JR Mwanga</name>
</author>
<author><name sortKey="Changalucha, J" uniqKey="Changalucha J">J Changalucha</name>
</author>
<author><name sortKey="Burton, Jp" uniqKey="Burton J">JP Burton</name>
</author>
<author><name sortKey="Gloor, Gb" uniqKey="Gloor G">GB Gloor</name>
</author>
<author><name sortKey="Reid, G" uniqKey="Reid G">G Reid</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bisanz, Je" uniqKey="Bisanz J">JE Bisanz</name>
</author>
<author><name sortKey="Seney, S" uniqKey="Seney S">S Seney</name>
</author>
<author><name sortKey="Mcmillan, A" uniqKey="Mcmillan A">A McMillan</name>
</author>
<author><name sortKey="Vongsa, R" uniqKey="Vongsa R">R Vongsa</name>
</author>
<author><name sortKey="Koenig, D" uniqKey="Koenig D">D Koenig</name>
</author>
<author><name sortKey="Wong, L" uniqKey="Wong L">L Wong</name>
</author>
<author><name sortKey="Dvoracek, B" uniqKey="Dvoracek B">B Dvoracek</name>
</author>
<author><name sortKey="Gloor, Gb" uniqKey="Gloor G">GB Gloor</name>
</author>
<author><name sortKey="Sumarah, M" uniqKey="Sumarah M">M Sumarah</name>
</author>
<author><name sortKey="Ford, B" uniqKey="Ford B">B Ford</name>
</author>
<author><name sortKey="Herman, D" uniqKey="Herman D">D Herman</name>
</author>
<author><name sortKey="Burton, Jp" uniqKey="Burton J">JP Burton</name>
</author>
<author><name sortKey="Reid, G" uniqKey="Reid G">G Reid</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chen, J" uniqKey="Chen J">J Chen</name>
</author>
<author><name sortKey="Bittinger, K" uniqKey="Bittinger K">K Bittinger</name>
</author>
<author><name sortKey="Charlson, Es" uniqKey="Charlson E">ES Charlson</name>
</author>
<author><name sortKey="Hoffmann, C" uniqKey="Hoffmann C">C Hoffmann</name>
</author>
<author><name sortKey="Lewis, J" uniqKey="Lewis J">J Lewis</name>
</author>
<author><name sortKey="Wu, Gd" uniqKey="Wu G">GD Wu</name>
</author>
<author><name sortKey="Collman, Rg" uniqKey="Collman R">RG Collman</name>
</author>
<author><name sortKey="Bushman, Fd" uniqKey="Bushman F">FD Bushman</name>
</author>
<author><name sortKey="Li, H" uniqKey="Li H">H Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Costello, Me" uniqKey="Costello M">ME Costello</name>
</author>
<author><name sortKey="Elewaut, D" uniqKey="Elewaut D">D Elewaut</name>
</author>
<author><name sortKey="Kenna, Tj" uniqKey="Kenna T">TJ Kenna</name>
</author>
<author><name sortKey="Brown, Ma" uniqKey="Brown M">MA Brown</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="De Pablo, P" uniqKey="De Pablo P">P De Pablo</name>
</author>
<author><name sortKey="Dietrich, T" uniqKey="Dietrich T">T Dietrich</name>
</author>
<author><name sortKey="Mcalindon, Te" uniqKey="Mcalindon T">TE McAlindon</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Eke, Pi" uniqKey="Eke P">PI Eke</name>
</author>
<author><name sortKey="Page, Rc" uniqKey="Page R">RC Page</name>
</author>
<author><name sortKey="Wei, L" uniqKey="Wei L">L Wei</name>
</author>
<author><name sortKey="Thornton Evans, G" uniqKey="Thornton Evans G">G Thornton-Evans</name>
</author>
<author><name sortKey="Genco, Rj" uniqKey="Genco R">RJ Genco</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fernandes, Ad" uniqKey="Fernandes A">AD Fernandes</name>
</author>
<author><name sortKey="Macklaim, Jm" uniqKey="Macklaim J">JM Macklaim</name>
</author>
<author><name sortKey="Linn, Tg" uniqKey="Linn T">TG Linn</name>
</author>
<author><name sortKey="Reid, G" uniqKey="Reid G">G Reid</name>
</author>
<author><name sortKey="Gloor, Gb" uniqKey="Gloor G">GB Gloor</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fernandes, Ad" uniqKey="Fernandes A">AD Fernandes</name>
</author>
<author><name sortKey="Reid, Jn" uniqKey="Reid J">JN Reid</name>
</author>
<author><name sortKey="Macklaim, Jm" uniqKey="Macklaim J">JM Macklaim</name>
</author>
<author><name sortKey="Mcmurrough, Ta" uniqKey="Mcmurrough T">TA McMurrough</name>
</author>
<author><name sortKey="Edgell, Dr" uniqKey="Edgell D">DR Edgell</name>
</author>
<author><name sortKey="Gloor, Gb" uniqKey="Gloor G">GB Gloor</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Garrett, S" uniqKey="Garrett S">S Garrett</name>
</author>
<author><name sortKey="Jenkinson, T" uniqKey="Jenkinson T">T Jenkinson</name>
</author>
<author><name sortKey="Kennedy, Lg" uniqKey="Kennedy L">LG Kennedy</name>
</author>
<author><name sortKey="Whitelock, H" uniqKey="Whitelock H">H Whitelock</name>
</author>
<author><name sortKey="Gaisford, P" uniqKey="Gaisford P">P Gaisford</name>
</author>
<author><name sortKey="Calin, A" uniqKey="Calin A">A Calin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gloor, Gb" uniqKey="Gloor G">GB Gloor</name>
</author>
<author><name sortKey="Macklaim, Jm" uniqKey="Macklaim J">JM Macklaim</name>
</author>
<author><name sortKey="Fernandes, Ad" uniqKey="Fernandes A">AD Fernandes</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hammer, Re" uniqKey="Hammer R">RE Hammer</name>
</author>
<author><name sortKey="Maika, Sd" uniqKey="Maika S">SD Maika</name>
</author>
<author><name sortKey="Richardson, Ja" uniqKey="Richardson J">JA Richardson</name>
</author>
<author><name sortKey="Tang, Jp" uniqKey="Tang J">JP Tang</name>
</author>
<author><name sortKey="Taurog, Jd" uniqKey="Taurog J">JD Taurog</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Keller, Jj" uniqKey="Keller J">JJ Keller</name>
</author>
<author><name sortKey="Kang, J H" uniqKey="Kang J">J-H Kang</name>
</author>
<author><name sortKey="Lin, H C" uniqKey="Lin H">H-C Lin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kempsell, Ke" uniqKey="Kempsell K">KE Kempsell</name>
</author>
<author><name sortKey="Cox, Cj" uniqKey="Cox C">CJ Cox</name>
</author>
<author><name sortKey="Hurle, M" uniqKey="Hurle M">M Hurle</name>
</author>
<author><name sortKey="Wong, A" uniqKey="Wong A">A Wong</name>
</author>
<author><name sortKey="Wilkie, S" uniqKey="Wilkie S">S Wilkie</name>
</author>
<author><name sortKey="Zanders, Ed" uniqKey="Zanders E">ED Zanders</name>
</author>
<author><name sortKey="Gaston, Js" uniqKey="Gaston J">JS Gaston</name>
</author>
<author><name sortKey="Crowe, Js" uniqKey="Crowe J">JS Crowe</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Khan, Ma" uniqKey="Khan M">MA Khan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kramer, Ir" uniqKey="Kramer I">IR Kramer</name>
</author>
<author><name sortKey="Pindborg, Jj" uniqKey="Pindborg J">JJ Pindborg</name>
</author>
<author><name sortKey="Infirri, Js" uniqKey="Infirri J">JS Infirri</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Loyola Rodriguez, Jp" uniqKey="Loyola Rodriguez J">JP Loyola-Rodriguez</name>
</author>
<author><name sortKey="Martinez Martinez, Re" uniqKey="Martinez Martinez R">RE Martinez-Martinez</name>
</author>
<author><name sortKey="Abud Mendoza, C" uniqKey="Abud Mendoza C">C Abud-Mendoza</name>
</author>
<author><name sortKey="Pati O Marin, N" uniqKey="Pati O Marin N">N Patiño-Marin</name>
</author>
<author><name sortKey="Seymour, Gj" uniqKey="Seymour G">GJ Seymour</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Martinez Martinez, Re" uniqKey="Martinez Martinez R">RE Martinez Martinez</name>
</author>
<author><name sortKey="Abud Mendoza, C" uniqKey="Abud Mendoza C">C Abud-Mendoza</name>
</author>
<author><name sortKey="Pati O Marin, N" uniqKey="Pati O Marin N">N Patiño-Marin</name>
</author>
<author><name sortKey="Rizo Rodriguez, Jc" uniqKey="Rizo Rodriguez J">JC Rizo Rodríguez</name>
</author>
<author><name sortKey="Little, Jw" uniqKey="Little J">JW Little</name>
</author>
<author><name sortKey="Loyola Rodriguez, Jp" uniqKey="Loyola Rodriguez J">JP Loyola-Rodriguez</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mielants, H" uniqKey="Mielants H">H Mielants</name>
</author>
<author><name sortKey="Veys, Em" uniqKey="Veys E">EM Veys</name>
</author>
<author><name sortKey="De Vos, M" uniqKey="De Vos M">M De Vos</name>
</author>
<author><name sortKey="Cuvelier, C" uniqKey="Cuvelier C">C Cuvelier</name>
</author>
<author><name sortKey="Goemaere, S" uniqKey="Goemaere S">S Goemaere</name>
</author>
<author><name sortKey="De Clercq, L" uniqKey="De Clercq L">L De Clercq</name>
</author>
<author><name sortKey="Schatteman, L" uniqKey="Schatteman L">L Schatteman</name>
</author>
<author><name sortKey="Elewaut, D" uniqKey="Elewaut D">D Elewaut</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Moen, K" uniqKey="Moen K">K Moen</name>
</author>
<author><name sortKey="Brun, Jg" uniqKey="Brun J">JG Brun</name>
</author>
<author><name sortKey="Eribe, Erk" uniqKey="Eribe E">ERK Eribe</name>
</author>
<author><name sortKey="Olsen, I" uniqKey="Olsen I">I Olsen</name>
</author>
<author><name sortKey="Jonsson, R" uniqKey="Jonsson R">R Jonsson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Moen, K" uniqKey="Moen K">K Moen</name>
</author>
<author><name sortKey="Brun, Jg" uniqKey="Brun J">JG Brun</name>
</author>
<author><name sortKey="Valen, M" uniqKey="Valen M">M Valen</name>
</author>
<author><name sortKey="Skartveit, L" uniqKey="Skartveit L">L Skartveit</name>
</author>
<author><name sortKey="Ribs Eribe, Ek" uniqKey="Ribs Eribe E">EK Ribs Eribe</name>
</author>
<author><name sortKey="Olsen, I" uniqKey="Olsen I">I Olsen</name>
</author>
<author><name sortKey="Jonsson, R" uniqKey="Jonsson R">R Jonsson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ohlrich, Ej" uniqKey="Ohlrich E">EJ Ohlrich</name>
</author>
<author><name sortKey="Cullinan, Mp" uniqKey="Cullinan M">MP Cullinan</name>
</author>
<author><name sortKey="Seymour, Gj" uniqKey="Seymour G">GJ Seymour</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Oksanen, J" uniqKey="Oksanen J">J Oksanen</name>
</author>
<author><name sortKey="Blanchet, Fg" uniqKey="Blanchet F">FG Blanchet</name>
</author>
<author><name sortKey="Kindt, R" uniqKey="Kindt R">R Kindt</name>
</author>
<author><name sortKey="Legendre, P" uniqKey="Legendre P">P Legendre</name>
</author>
<author><name sortKey="Minchin, Pr" uniqKey="Minchin P">PR Minchin</name>
</author>
<author><name sortKey="O Ara, Rb" uniqKey="O Ara R">RB O’Hara</name>
</author>
<author><name sortKey="Simpson, Gl" uniqKey="Simpson G">GL Simpson</name>
</author>
<author><name sortKey="Solymos, P" uniqKey="Solymos P">P Solymos</name>
</author>
<author><name sortKey="Stevens, Mhh" uniqKey="Stevens M">MHH Stevens</name>
</author>
<author><name sortKey="Wagner, H" uniqKey="Wagner H">H Wagner</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ortiz, P" uniqKey="Ortiz P">P Ortiz</name>
</author>
<author><name sortKey="Bissada, Nf" uniqKey="Bissada N">NF Bissada</name>
</author>
<author><name sortKey="Palomo, L" uniqKey="Palomo L">L Palomo</name>
</author>
<author><name sortKey="Han, Yw" uniqKey="Han Y">YW Han</name>
</author>
<author><name sortKey="Al Zahrani, Ms" uniqKey="Al Zahrani M">MS Al-Zahrani</name>
</author>
<author><name sortKey="Panneerselvam, A" uniqKey="Panneerselvam A">A Panneerselvam</name>
</author>
<author><name sortKey="Askari, A" uniqKey="Askari A">A Askari</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pearson, K" uniqKey="Pearson K">K Pearson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Petersen, Pe" uniqKey="Petersen P">PE Petersen</name>
</author>
<author><name sortKey="Ogawa, H" uniqKey="Ogawa H">H Ogawa</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pihlstrom, Bl" uniqKey="Pihlstrom B">BL Pihlstrom</name>
</author>
<author><name sortKey="Michalowicz, Bs" uniqKey="Michalowicz B">BS Michalowicz</name>
</author>
<author><name sortKey="Johnson, Nw" uniqKey="Johnson N">NW Johnson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pischon, N" uniqKey="Pischon N">N Pischon</name>
</author>
<author><name sortKey="Pischon, T" uniqKey="Pischon T">T Pischon</name>
</author>
<author><name sortKey="Gulmez, E" uniqKey="Gulmez E">E Gülmez</name>
</author>
<author><name sortKey="Kroger, J" uniqKey="Kroger J">J Kröger</name>
</author>
<author><name sortKey="Purucker, P" uniqKey="Purucker P">P Purucker</name>
</author>
<author><name sortKey="Kleber, B M" uniqKey="Kleber B">B-M Kleber</name>
</author>
<author><name sortKey="Landau, H" uniqKey="Landau H">H Landau</name>
</author>
<author><name sortKey="Jost Brinkmann, P G" uniqKey="Jost Brinkmann P">P-G Jost-Brinkmann</name>
</author>
<author><name sortKey="Schlattmann, P" uniqKey="Schlattmann P">P Schlattmann</name>
</author>
<author><name sortKey="Zernicke, J" uniqKey="Zernicke J">J Zernicke</name>
</author>
<author><name sortKey="Burmester, G R" uniqKey="Burmester G">G-R Burmester</name>
</author>
<author><name sortKey="Bernimoulin, J P" uniqKey="Bernimoulin J">J-P Bernimoulin</name>
</author>
<author><name sortKey="Buttgereit, F" uniqKey="Buttgereit F">F Buttgereit</name>
</author>
<author><name sortKey="Detert, J" uniqKey="Detert J">J Detert</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pizzo, G" uniqKey="Pizzo G">G Pizzo</name>
</author>
<author><name sortKey="Guiglia, R" uniqKey="Guiglia R">R Guiglia</name>
</author>
<author><name sortKey="Russo, Ll" uniqKey="Russo L">LL Russo</name>
</author>
<author><name sortKey="Campisi, G" uniqKey="Campisi G">G Campisi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rath, Hc" uniqKey="Rath H">HC Rath</name>
</author>
<author><name sortKey="Herfarth, Hh" uniqKey="Herfarth H">HH Herfarth</name>
</author>
<author><name sortKey="Ikeda, Js" uniqKey="Ikeda J">JS Ikeda</name>
</author>
<author><name sortKey="Grenther, Wb" uniqKey="Grenther W">WB Grenther</name>
</author>
<author><name sortKey="Hamm, Te" uniqKey="Hamm T">TE Hamm</name>
</author>
<author><name sortKey="Balish, E" uniqKey="Balish E">E Balish</name>
</author>
<author><name sortKey="Taurog, Jd" uniqKey="Taurog J">JD Taurog</name>
</author>
<author><name sortKey="Hammer, Re" uniqKey="Hammer R">RE Hammer</name>
</author>
<author><name sortKey="Wilson, Kh" uniqKey="Wilson K">KH Wilson</name>
</author>
<author><name sortKey="Sartor, Rb" uniqKey="Sartor R">RB Sartor</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ribeiro, J" uniqKey="Ribeiro J">J Ribeiro</name>
</author>
<author><name sortKey="Leao, A" uniqKey="Leao A">A Leão</name>
</author>
<author><name sortKey="Novaes, Ab" uniqKey="Novaes A">AB Novaes</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Roberts, Rl" uniqKey="Roberts R">RL Roberts</name>
</author>
<author><name sortKey="Wallace, Mc" uniqKey="Wallace M">MC Wallace</name>
</author>
<author><name sortKey="Jones, Gt" uniqKey="Jones G">GT Jones</name>
</author>
<author><name sortKey="Van Rij, Am" uniqKey="Van Rij A">AM Van Rij</name>
</author>
<author><name sortKey="Merriman, Tr" uniqKey="Merriman T">TR Merriman</name>
</author>
<author><name sortKey="Harrison, A" uniqKey="Harrison A">A Harrison</name>
</author>
<author><name sortKey="White, D" uniqKey="White D">D White</name>
</author>
<author><name sortKey="Stamp, Lk" uniqKey="Stamp L">LK Stamp</name>
</author>
<author><name sortKey="Ching, D" uniqKey="Ching D">D Ching</name>
</author>
<author><name sortKey="Highton, J" uniqKey="Highton J">J Highton</name>
</author>
<author><name sortKey="Stebbings, Sm" uniqKey="Stebbings S">SM Stebbings</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rudwaleit, M" uniqKey="Rudwaleit M">M Rudwaleit</name>
</author>
<author><name sortKey="Van Der Heijde, D" uniqKey="Van Der Heijde D">D Van Der Heijde</name>
</author>
<author><name sortKey="Landewe, R" uniqKey="Landewe R">R Landewé</name>
</author>
<author><name sortKey="Akkoc, N" uniqKey="Akkoc N">N Akkoc</name>
</author>
<author><name sortKey="Brandt, J" uniqKey="Brandt J">J Brandt</name>
</author>
<author><name sortKey="Chou, Ct" uniqKey="Chou C">CT Chou</name>
</author>
<author><name sortKey="Dougados, M" uniqKey="Dougados M">M Dougados</name>
</author>
<author><name sortKey="Huang, F" uniqKey="Huang F">F Huang</name>
</author>
<author><name sortKey="Gu, J" uniqKey="Gu J">J Gu</name>
</author>
<author><name sortKey="Kirazli, Y" uniqKey="Kirazli Y">Y Kirazli</name>
</author>
<author><name sortKey="Van Den Bosch, F" uniqKey="Van Den Bosch F">F Van den Bosch</name>
</author>
<author><name sortKey="Olivieri, I" uniqKey="Olivieri I">I Olivieri</name>
</author>
<author><name sortKey="Roussou, E" uniqKey="Roussou E">E Roussou</name>
</author>
<author><name sortKey="Scarpato, S" uniqKey="Scarpato S">S Scarpato</name>
</author>
<author><name sortKey="S Rensen, Ij" uniqKey="S Rensen I">IJ Sørensen</name>
</author>
<author><name sortKey="Valle O Ate, R" uniqKey="Valle O Ate R">R Valle-Oñate</name>
</author>
<author><name sortKey="Weber, U" uniqKey="Weber U">U Weber</name>
</author>
<author><name sortKey="Wei, J" uniqKey="Wei J">J Wei</name>
</author>
<author><name sortKey="Sieper, J" uniqKey="Sieper J">J Sieper</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rudwaleit, M" uniqKey="Rudwaleit M">M Rudwaleit</name>
</author>
<author><name sortKey="Van Der Heijde, D" uniqKey="Van Der Heijde D">D Van Der Heijde</name>
</author>
<author><name sortKey="Landewe, R" uniqKey="Landewe R">R Landewé</name>
</author>
<author><name sortKey="Listing, J" uniqKey="Listing J">J Listing</name>
</author>
<author><name sortKey="Akkoc, N" uniqKey="Akkoc N">N Akkoc</name>
</author>
<author><name sortKey="Brandt, J" uniqKey="Brandt J">J Brandt</name>
</author>
<author><name sortKey="Braun, J" uniqKey="Braun J">J Braun</name>
</author>
<author><name sortKey="Chou, Ct" uniqKey="Chou C">CT Chou</name>
</author>
<author><name sortKey="Collantes Estevez, E" uniqKey="Collantes Estevez E">E Collantes-Estevez</name>
</author>
<author><name sortKey="Dougados, M" uniqKey="Dougados M">M Dougados</name>
</author>
<author><name sortKey="Huang, F" uniqKey="Huang F">F Huang</name>
</author>
<author><name sortKey="Gu, J" uniqKey="Gu J">J Gu</name>
</author>
<author><name sortKey="Khan, Ma" uniqKey="Khan M">MA Khan</name>
</author>
<author><name sortKey="Kirazli, Y" uniqKey="Kirazli Y">Y Kirazli</name>
</author>
<author><name sortKey="Maksymowych, Wp" uniqKey="Maksymowych W">WP Maksymowych</name>
</author>
<author><name sortKey="Mielants, H" uniqKey="Mielants H">H Mielants</name>
</author>
<author><name sortKey="S Rensen, Ij" uniqKey="S Rensen I">IJ Sørensen</name>
</author>
<author><name sortKey="Ozgocmen, S" uniqKey="Ozgocmen S">S Ozgocmen</name>
</author>
<author><name sortKey="Roussou, E" uniqKey="Roussou E">E Roussou</name>
</author>
<author><name sortKey="Valle O Ate, R" uniqKey="Valle O Ate R">R Valle-Oñate</name>
</author>
<author><name sortKey="Weber, U" uniqKey="Weber U">U Weber</name>
</author>
<author><name sortKey="Wei, J" uniqKey="Wei J">J Wei</name>
</author>
<author><name sortKey="Sieper, J" uniqKey="Sieper J">J Sieper</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Savage, A" uniqKey="Savage A">A Savage</name>
</author>
<author><name sortKey="Eaton, Ka" uniqKey="Eaton K">KA Eaton</name>
</author>
<author><name sortKey="Moles, Dr" uniqKey="Moles D">DR Moles</name>
</author>
<author><name sortKey="Needleman, I" uniqKey="Needleman I">I Needleman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Scher, Ju" uniqKey="Scher J">JU Scher</name>
</author>
<author><name sortKey="Ubeda, C" uniqKey="Ubeda C">C Ubeda</name>
</author>
<author><name sortKey="Equinda, M" uniqKey="Equinda M">M Equinda</name>
</author>
<author><name sortKey="Khanin, R" uniqKey="Khanin R">R Khanin</name>
</author>
<author><name sortKey="Buischi, Y" uniqKey="Buischi Y">Y Buischi</name>
</author>
<author><name sortKey="Viale, A" uniqKey="Viale A">A Viale</name>
</author>
<author><name sortKey="Lipuma, L" uniqKey="Lipuma L">L Lipuma</name>
</author>
<author><name sortKey="Attur, M" uniqKey="Attur M">M Attur</name>
</author>
<author><name sortKey="Pillinger, Mh" uniqKey="Pillinger M">MH Pillinger</name>
</author>
<author><name sortKey="Weissmann, G" uniqKey="Weissmann G">G Weissmann</name>
</author>
<author><name sortKey="Littman, Dr" uniqKey="Littman D">DR Littman</name>
</author>
<author><name sortKey="Pamer, Eg" uniqKey="Pamer E">EG Pamer</name>
</author>
<author><name sortKey="Bretz, Wa" uniqKey="Bretz W">WA Bretz</name>
</author>
<author><name sortKey="Abramson, Sb" uniqKey="Abramson S">SB Abramson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Seymour, Gj" uniqKey="Seymour G">GJ Seymour</name>
</author>
<author><name sortKey="Ford, Pj" uniqKey="Ford P">PJ Ford</name>
</author>
<author><name sortKey="Cullinan, Mp" uniqKey="Cullinan M">MP Cullinan</name>
</author>
<author><name sortKey="Leishman, S" uniqKey="Leishman S">S Leishman</name>
</author>
<author><name sortKey="Yamazaki, K" uniqKey="Yamazaki K">K Yamazaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Seymour, Gj" uniqKey="Seymour G">GJ Seymour</name>
</author>
<author><name sortKey="Gemmell, E" uniqKey="Gemmell E">E Gemmell</name>
</author>
<author><name sortKey="Walsh, Rn" uniqKey="Walsh R">RN Walsh</name>
</author>
<author><name sortKey="Powell, N" uniqKey="Powell N">N Powell</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Silness, J" uniqKey="Silness J">J Silness</name>
</author>
<author><name sortKey="Loe, H" uniqKey="Loe H">H Löe</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Taurog, Jd" uniqKey="Taurog J">JD Taurog</name>
</author>
<author><name sortKey="Richardson, Ja" uniqKey="Richardson J">JA Richardson</name>
</author>
<author><name sortKey="Croft, Jt" uniqKey="Croft J">JT Croft</name>
</author>
<author><name sortKey="Simmons, Wa" uniqKey="Simmons W">WA Simmons</name>
</author>
<author><name sortKey="Zhou, M" uniqKey="Zhou M">M Zhou</name>
</author>
<author><name sortKey="Fernandez Sueiro, Jl" uniqKey="Fernandez Sueiro J">JL Fernández-Sueiro</name>
</author>
<author><name sortKey="Balish, E" uniqKey="Balish E">E Balish</name>
</author>
<author><name sortKey="Hammer, Re" uniqKey="Hammer R">RE Hammer</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Van Der Horst Bruinsma, Ie" uniqKey="Van Der Horst Bruinsma I">IE Van der Horst-Bruinsma</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Van Der Linden, S" uniqKey="Van Der Linden S">S Van der Linden</name>
</author>
<author><name sortKey="Valkenburg, Ha" uniqKey="Valkenburg H">HA Valkenburg</name>
</author>
<author><name sortKey="Cats, A" uniqKey="Cats A">A Cats</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yeoh, N" uniqKey="Yeoh N">N Yeoh</name>
</author>
<author><name sortKey="Burton, Jp" uniqKey="Burton J">JP Burton</name>
</author>
<author><name sortKey="Suppiah, P" uniqKey="Suppiah P">P Suppiah</name>
</author>
<author><name sortKey="Reid, G" uniqKey="Reid G">G Reid</name>
</author>
<author><name sortKey="Stebbings, S" uniqKey="Stebbings S">S Stebbings</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">PeerJ</journal-id>
<journal-id journal-id-type="iso-abbrev">PeerJ</journal-id>
<journal-id journal-id-type="publisher-id">peerj</journal-id>
<journal-id journal-id-type="pmc">peerj</journal-id>
<journal-title-group><journal-title>PeerJ</journal-title>
</journal-title-group>
<issn pub-type="epub">2167-8359</issn>
<publisher><publisher-name>PeerJ Inc.</publisher-name>
<publisher-loc>San Francisco, USA</publisher-loc>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">27330858</article-id>
<article-id pub-id-type="pmc">4906644</article-id>
<article-id pub-id-type="publisher-id">2095</article-id>
<article-id pub-id-type="doi">10.7717/peerj.2095</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Microbiology</subject>
</subj-group>
<subj-group subj-group-type="heading"><subject>Dentistry</subject>
</subj-group>
<subj-group subj-group-type="heading"><subject>Rheumatology</subject>
</subj-group>
</article-categories>
<title-group><article-title>The oral microbiome of patients with axial spondyloarthritis compared to healthy individuals</article-title>
</title-group>
<contrib-group><contrib id="author-1" contrib-type="author"><name><surname>Bisanz</surname>
<given-names>Jordan E.</given-names>
</name>
<xref ref-type="aff" rid="aff-1">1</xref>
<xref ref-type="aff" rid="aff-2">2</xref>
</contrib>
<contrib id="author-2" contrib-type="author"><name><surname>Suppiah</surname>
<given-names>Praema</given-names>
</name>
<xref ref-type="aff" rid="aff-3">3</xref>
</contrib>
<contrib id="author-3" contrib-type="author"><name><surname>Thomson</surname>
<given-names>W. Murray</given-names>
</name>
<xref ref-type="aff" rid="aff-3">3</xref>
</contrib>
<contrib id="author-4" contrib-type="author"><name><surname>Milne</surname>
<given-names>Trudy</given-names>
</name>
<xref ref-type="aff" rid="aff-3">3</xref>
<xref ref-type="aff" rid="aff-4">4</xref>
</contrib>
<contrib id="author-5" contrib-type="author"><name><surname>Yeoh</surname>
<given-names>Nigel</given-names>
</name>
<xref ref-type="aff" rid="aff-5">5</xref>
</contrib>
<contrib id="author-6" contrib-type="author"><name><surname>Nolan</surname>
<given-names>Anita</given-names>
</name>
<xref ref-type="aff" rid="aff-5">5</xref>
<xref ref-type="aff" rid="aff-6">6</xref>
</contrib>
<contrib id="author-7" contrib-type="author"><name><surname>Ettinger</surname>
<given-names>Grace</given-names>
</name>
<xref ref-type="aff" rid="aff-1">1</xref>
<xref ref-type="aff" rid="aff-2">2</xref>
</contrib>
<contrib id="author-8" contrib-type="author"><name><surname>Reid</surname>
<given-names>Gregor</given-names>
</name>
<xref ref-type="aff" rid="aff-1">1</xref>
<xref ref-type="aff" rid="aff-2">2</xref>
<xref ref-type="aff" rid="aff-7">7</xref>
</contrib>
<contrib id="author-9" contrib-type="author"><name><surname>Gloor</surname>
<given-names>Gregory B.</given-names>
</name>
<xref ref-type="aff" rid="aff-2">2</xref>
<xref ref-type="aff" rid="aff-8">8</xref>
</contrib>
<contrib id="author-10" contrib-type="author"><name><surname>Burton</surname>
<given-names>Jeremy P.</given-names>
</name>
<xref ref-type="aff" rid="aff-1">1</xref>
<xref ref-type="aff" rid="aff-2">2</xref>
<xref ref-type="aff" rid="aff-7">7</xref>
</contrib>
<contrib id="author-11" contrib-type="author"><name><surname>Cullinan</surname>
<given-names>Mary P.</given-names>
</name>
<xref ref-type="aff" rid="aff-3">3</xref>
<xref ref-type="aff" rid="aff-4">4</xref>
</contrib>
<contrib id="author-12" contrib-type="author" corresp="yes"><name><surname>Stebbings</surname>
<given-names>Simon M.</given-names>
</name>
<email>simon.stebbings@otago.ac.nz</email>
<xref ref-type="aff" rid="aff-5">5</xref>
</contrib>
<aff id="aff-1"><label>1</label>
<institution>Department of Microbiology and Immunology, Western University</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</aff>
<aff id="aff-2"><label>2</label>
<institution>Canadian Centre for Human Microbiome and Probiotic Research, Lawson Health Research Institute</institution>
,<addr-line> London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</aff>
<aff id="aff-3"><label>3</label>
<institution>School of Dentistry, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</aff>
<aff id="aff-4"><label>4</label>
<institution>Sir John Walsh Research Institute, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<addr-line>Otago</addr-line>
,<country>New Zealand</country>
</aff>
<aff id="aff-5"><label>5</label>
<institution>Dunedin School of Medicine, University of Otago</institution>
,<addr-line>Dunedin</addr-line>
,<country>New Zealand</country>
</aff>
<aff id="aff-6"><label>6</label>
<institution>Oral Health, AUT</institution>
,<addr-line>Auckland</addr-line>
,<country>New Zealand</country>
</aff>
<aff id="aff-7"><label>7</label>
<institution>Division of Urology, Department of Surgery, University of Western Ontario</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</aff>
<aff id="aff-8"><label>8</label>
<institution>Department of Biochemistry, University of Western Ontario</institution>
,<addr-line>London</addr-line>
,<addr-line>Ontario</addr-line>
,<country>Canada</country>
</aff>
</contrib-group>
<contrib-group><contrib contrib-type="editor"><name><surname>Eren</surname>
<given-names>A. Murat</given-names>
</name>
</contrib>
</contrib-group>
<pub-date pub-type="epub" date-type="pub" iso-8601-date="2016-06-09"><day>9</day>
<month>6</month>
<year iso-8601-date="2016">2016</year>
</pub-date>
<pub-date pub-type="collection"><year>2016</year>
</pub-date>
<volume>4</volume>
<elocation-id>e2095</elocation-id>
<history><date date-type="received" iso-8601-date="2016-03-25"><day>25</day>
<month>3</month>
<year iso-8601-date="2016">2016</year>
</date>
<date date-type="accepted" iso-8601-date="2016-05-09"><day>9</day>
<month>5</month>
<year iso-8601-date="2016">2016</year>
</date>
</history>
<permissions><copyright-statement>©2016 Bisanz et al.</copyright-statement>
<copyright-year>2016</copyright-year>
<copyright-holder>Bisanz et al.</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This is an open access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>
, which permits unrestricted use, distribution, reproduction and adaptation in any medium and for any purpose provided that it is properly attributed. For attribution, the original author(s), title, publication source (PeerJ) and either DOI or URL of the article must be cited.</license-p>
</license>
</permissions>
<self-uri xlink:href="https://peerj.com/articles/2095"></self-uri>
<abstract><p><bold>Background.</bold>
A loss of mucosal tolerance to the resident microbiome has been postulated in the aetiopathogenesis of spondyloarthritis, thus the purpose of these studies was to investigate microbial communities that colonise the oral cavity of patients with axial spondyloarthritis (AxSpA) and to compare these with microbial profiles of a matched healthy population.</p>
<p><bold>Methods.</bold>
Thirty-nine participants, 17 patients with AxSpA and 22 age and gender-matched disease-free controls were recruited to the study. For patients with AxSpA, disease activity was assessed using the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI). All participants underwent a detailed dental examination to assess oral health, including the presence of periodontal disease assessed using probing pocket depth (PPD). Plaque samples were obtained and their bacterial populations were profiled using Ion Torrent sequencing of the V6 region of the 16S rRNA gene.</p>
<p><bold>Results.</bold>
Patients with AxSpA had active disease (BASDAI 4.1 ± 2.1 [mean ± SD]), and a significantly greater prevalence of periodontitis (PPD ≥ 4 mm at ≥4 sites) than controls. Bacterial communities did not differ between the two groups with multiple metrics of <italic>α</italic>
and <italic>β</italic>
diversity considered. Analysis of operational taxonomic units (OTUs) and higher levels of taxonomic assignment did not provide strong evidence of any single taxa associated with AxSpA in the subgingival plaque.</p>
<p><bold>Discussion.</bold>
Although 16S rRNA gene sequencing did not identify specific bacterial profiles associated with AxSpA, there remains the potential for the microbiota to exert functional and metabolic influences in the oral cavity which could be involved in the pathogenesis of AxSpA.</p>
</abstract>
<kwd-group kwd-group-type="author"><kwd>Periodontal disease</kwd>
<kwd>Microbiome</kwd>
<kwd>Oral cavity</kwd>
<kwd>Axial spondyloarthritis</kwd>
</kwd-group>
<funding-group><award-group id="fund-1"><funding-source>The W. Garfield Weston Foundation</funding-source>
</award-group>
<award-group id="fund-2"><funding-source>New Zealand Dental Association Research Foundation</funding-source>
</award-group>
<award-group id="fund-3"><funding-source>NSERC Canada Graduate Scholarship</funding-source>
</award-group>
<funding-statement>The W. Garfield Weston Foundation and New Zealand Dental Association Research Foundation provided funding for this work. JEB was the recipient of an NSERC Canada Graduate Scholarship. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</funding-statement>
</funding-group>
</article-meta>
</front>
<body><sec sec-type="intro"><title>Introduction</title>
<p>The term spondyloarthritis (SpA) is used to describe a spectrum of diseases which share common clinical features and a common genetic predisposition. Ankylosing spondylitis (AS) is the archetypal clinical phenotype (<xref rid="ref-15" ref-type="bibr">Khan</xref>
, <xref rid="ref-15" ref-type="bibr">2002</xref>
). The strong familial association amongst close relatives with AS is linked with the allele HLA-B27 present in approximately 90% of individuals with AS (<xref rid="ref-32" ref-type="bibr">Roberts et al.</xref>
, <xref rid="ref-32" ref-type="bibr">2013</xref>
). In 2009 the Assessment of SpondyloArthritis international Society (ASAS) proposed new nomenclature for SpA, based on classification criteria (<xref rid="ref-34" ref-type="bibr">Rudwaleit et al.</xref>
, <xref rid="ref-34" ref-type="bibr">2009</xref>
), which has changed the perspective of ankylosing spondylitis (AS) (<xref rid="ref-41" ref-type="bibr">Van der Horst-Bruinsma</xref>
, <xref rid="ref-41" ref-type="bibr">2013</xref>
). The axial form of SpA (AxSpA) is now subdivided in the (early) non-radiographic type (nr-axial SpA) and the radiographic type, which equates to AS (according to the older modified New York criteria (<xref rid="ref-42" ref-type="bibr">Van der Linden, Valkenburg & Cats</xref>
, <xref rid="ref-42" ref-type="bibr">1984</xref>
)). The advantage of the new nomenclature is that it encompasses patients with earlier and less severe disease, and reflects the spectrum of severity seen in clinical practice.</p>
<p>A role for intestinal inflammation in the aetiology of AxSpA is suggested by an association with inflammatory bowel disease (IBD), where 20% of patients develop features of SpA (<xref rid="ref-19" ref-type="bibr">Mielants et al.</xref>
, <xref rid="ref-19" ref-type="bibr">1995</xref>
). In order to investigate aetoiological mechanisms associated with genetic predisposition in AxSpA, transgenic murine models expressing human HLA-B27 have been derived. These animals develop inflammation of the peripheral joints and spine and also develop colitis (<xref rid="ref-11" ref-type="bibr">Hammer et al.</xref>
, <xref rid="ref-11" ref-type="bibr">1990</xref>
). It is thought that the microbiome plays a role in disease pathogenesis, since germfree HLA-B27 transgenic rats do not develop arthritis (<xref rid="ref-40" ref-type="bibr">Taurog et al.</xref>
, <xref rid="ref-40" ref-type="bibr">1994</xref>
). However, arthritis develops when commensal bacteria, such as <italic>Bacteroides vulgatus</italic>
, are introduced into these germfree models (<xref rid="ref-30" ref-type="bibr">Rath et al.</xref>
, <xref rid="ref-30" ref-type="bibr">1996</xref>
).</p>
<p>While the gastrointestinal tract harbours the largest microbiome in humans, other sites have microbial populations which are believed to significantly influence human health; in particular, the oral cavity harbours over 700 bacterial species. Although dental plaque represents a relatively small biomass, it is characterized by a highly dense microbial community which is almost as diverse as those found in the intestinal tract (<xref rid="ref-4" ref-type="bibr">Costello et al.</xref>
, <xref rid="ref-4" ref-type="bibr">2013</xref>
; <xref rid="ref-12" ref-type="bibr">HMPConsortium</xref>
, <xref rid="ref-12" ref-type="bibr">2012</xref>
). Additionally, when periodontal inflammation is evident, the junctional epithelium has greater permeability, with resultant challenge to microbial tolerance and immunogenicity (<xref rid="ref-22" ref-type="bibr">Ohlrich, Cullinan & Seymour</xref>
, <xref rid="ref-22" ref-type="bibr">2009</xref>
).</p>
<p>Periodontal disease is characterised by inflammation of the gingival tissues of the teeth and progressive loss of alveolar bone, resulting in apical migration of the epithelial attachment forming a periodontal pocket between the tooth root and the gingiva, thus creating an anaerobic environment (<xref rid="ref-27" ref-type="bibr">Pihlstrom, Michalowicz & Johnson</xref>
, <xref rid="ref-27" ref-type="bibr">2005</xref>
). Epidemiologic studies show that as many as 10% to 15% of the adult population have severe or advanced periodontitis (<xref rid="ref-26" ref-type="bibr">Petersen & Ogawa</xref>
, <xref rid="ref-26" ref-type="bibr">2005</xref>
). The oral microbiota has a role in periodontal disease and, in turn, is thought to play a contributory role in chronic systemic inflammatory diseases (<xref rid="ref-29" ref-type="bibr">Pizzo et al.</xref>
, <xref rid="ref-29" ref-type="bibr">2010</xref>
). For instance, patients with rheumatoid arthritis (RA) have a higher prevalence of severe periodontitis and tooth loss than healthy controls (<xref rid="ref-5" ref-type="bibr">De Pablo, Dietrich & McAlindon</xref>
, <xref rid="ref-5" ref-type="bibr">2008</xref>
) and the severity of periodontal disease correlates positively with disease activity in RA (<xref rid="ref-31" ref-type="bibr">Ribeiro, Leão & Novaes</xref>
, <xref rid="ref-31" ref-type="bibr">2005</xref>
; <xref rid="ref-17" ref-type="bibr">Loyola-Rodriguez et al.</xref>
, <xref rid="ref-17" ref-type="bibr">2010</xref>
). The composition of the oral microbiota also appears to be a factor in RA (<xref rid="ref-43" ref-type="bibr">Yeoh et al.</xref>
, <xref rid="ref-43" ref-type="bibr">2013</xref>
) and treatment of periodontitis ameliorates RA disease activity (<xref rid="ref-24" ref-type="bibr">Ortiz et al.</xref>
, <xref rid="ref-24" ref-type="bibr">2009</xref>
). It is noteworthy that periodontal pathogens have been detected in the synovial fluid of patients with RA and AxSpA (<xref rid="ref-14" ref-type="bibr">Kempsell et al.</xref>
, <xref rid="ref-14" ref-type="bibr">2000</xref>
; <xref rid="ref-18" ref-type="bibr">Martinez Martinez et al.</xref>
, <xref rid="ref-18" ref-type="bibr">2009</xref>
; <xref rid="ref-20" ref-type="bibr">Moen et al.</xref>
, <xref rid="ref-20" ref-type="bibr">2005</xref>
; <xref rid="ref-21" ref-type="bibr">Moen et al.</xref>
, <xref rid="ref-21" ref-type="bibr">2006</xref>
).</p>
<p>We hypothesize that the microbiota present in dental plaque, which lies in close association with inflamed gingival tissue, allows bacterial components to trigger or perpetuate the inflammatory process in a genetically susceptible host with AxSpA. In order to test this hypothesis, we aimed to investigate the diversity of the microbiome in patients with AxSpA and compare this with healthy matched controls. In addition, we aimed to discover whether particular components of the oral microbiota were deferentially abundant in patients with AxSpA than in healthy individuals, to ascertain whether individual bacteria could be implicated in the pathogenesis of AxSpA.</p>
</sec>
<sec sec-type="materials|methods"><title>Materials & Methods</title>
<sec><title>Participants and sample collection and design</title>
<p>The pilot study used a matched case-control design. The case group comprised 17 with axial SpA as defined by the Assessment in Spondyloarthritis International Society (ASAS) criteria for AxSpA (<xref rid="ref-33" ref-type="bibr">Rudwaleit et al.</xref>
, <xref rid="ref-33" ref-type="bibr">2010</xref>
). These criteria were chosen to provide a sample with a wider range of disease duration and severity than would have been obtained using the modified New York criteria for AS. Patients were randomly selected from those attending the Rheumatology Department at Dunedin Hospital, New Zealand. Participants in the control group were purposively selected from the Electoral Roll and invited by post to participate in the study. They were individually matched to AxSpA patients on the characteristics of age (within two years), gender and ethnicity. In total 317 potential participants were identified from electoral roll. A total of 108 replied to letters sent out and of these, 53 volunteered to participate. Of the 55 who did not participate, 43 declined and six were not eligible due to exclusion criteria. Exclusion criteria for healthy controls were as follows: unable to provide informed consent, pregnancy, history of malignancy, taking anticoagulants, previous history of periodontal treatment, edentulous, history of inflammatory arthritis (including AxSpA), osteoporosis, significant cardiovascular disease, diabetes mellitus or inflammatory bowel disease.</p>
<p>All participants gave written informed consent in accordance with the Declaration of Helsinki, and ethical approval for the study was obtained from the Lower South Regional Ethics Committee, New Zealand (ref: LRS/10/06/020).</p>
<p>In the AxSpA patient group, all participants attended for clinical examination. Disease activity was measured using the Bath Ankylosing Spondylitis (BAS) disease activity index (BASDAI) (<xref rid="ref-9" ref-type="bibr">Garrett et al.</xref>
, <xref rid="ref-9" ref-type="bibr">1994</xref>
). All patients with AxSpA were genotyped for HLA-B27 and had a blood test at the time of sampling to measure C-reactive protein (mg/L). Recent radiographs were reviewed. All participants were surveyed about their smoking status.</p>
</sec>
<sec><title>Oral examination</title>
<p>All participants underwent a detailed clinical oral examination following the World Health Organization (WHO) manual of oral diseases assessment (<xref rid="ref-16" ref-type="bibr">Kramer, Pindborg & Infirri</xref>
, <xref rid="ref-16" ref-type="bibr">1980</xref>
). The principal examiner (PS) underwent calibration prior to clinical data collection with intra-examiner calibration (with ten volunteers not recruited to the study). Data collected included: probing pocket depth (PPD) and gingival recession, clinical attachment loss (CAL) and bleeding on probing (BOP) at six sites per tooth. Other clinical information recorded included assessment of plaque deposits, oral mucosal conditions, and dental caries status: including enumeration of decayed missing or filled teeth (DMFT). The clinical assessor was not formally blinded to the status of the participant (AxSpA or control), this was impractical as many of the patient group had very obvious clinical features of AxSpA. Periodontitis was defined in this study as PPD ≥ 4 mm at ≥4 sites. There is considerable variation in the definition of periodontitis and no international consensus (<xref rid="ref-35" ref-type="bibr">Savage et al.</xref>
, <xref rid="ref-35" ref-type="bibr">2009</xref>
). In this study a definition of periodontitis used for epidemiological studies and defined by the Centre for Disease Control was selected (<xref rid="ref-6" ref-type="bibr">Eke et al.</xref>
, <xref rid="ref-6" ref-type="bibr">2012</xref>
). Observed clinical differences between the two groups were tested for statistical significance in SPSS (Version 21), using (as appropriate) Mann–Whitney <italic>U</italic>
-tests and Chi-square tests, with an alpha value of 0.05.</p>
</sec>
<sec><title>Plaque sampling and DNA extraction</title>
<p>Plaque accumulation was assessed to determine the oral hygiene status of AxSpA patients and controls. A plaque score was recorded for the buccal, palatal and lingual surfaces of all teeth except the third molars (<xref rid="ref-39" ref-type="bibr">Silness & Löe</xref>
, <xref rid="ref-39" ref-type="bibr">1964</xref>
). Subgingival plaque was sampled from all interproximal sites and placed in phosphate-buffered saline for storage at −20 degrees prior to analysis. Plaque sampled from different sites was pooled into a single sample for each individual. Plaque samples were centrifuged for 5 min at 13,000× g and the supernatant removed. Bacterial DNA was extracted using the Purelink Genomic DNA kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol for Gram-positive bacteria.</p>
</sec>
<sec><title>Microbiota analyses</title>
<p>PCR of the V6 region of the 16S rRNA gene, sequencing and demultiplexing of sequencing reads was carried out as before using the Ion Torrent platform (<xref rid="ref-1" ref-type="bibr">Bisanz et al.</xref>
, <xref rid="ref-1" ref-type="bibr">2014a</xref>
; <xref rid="ref-2" ref-type="bibr">Bisanz et al.</xref>
, <xref rid="ref-2" ref-type="bibr">2014b</xref>
). Briefly, The primers used were CCATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXCWACGCGARGAACCTTACC and CCTCTCTATGGGCAGTCGGTGATACRACACGAGCTGACGAC with XXXXX being a sample specific index. 25 cycles of PCR were carried out using GoTaq Colorless Master Mix (Promega) and amplicons were confirmed by gel electrophoresis. Amplicons were quantified and pooled at equimolar concentration using Qubit HSDNA (Life Technologies) before clean up (QIAquick PCR Purification kit). The resulting pool was sequenced at the London Regional Genomics Centre according to standard protocols using an Ion Torrent 316 chip. Raw reads are available in the NCBI Short Read Archive (accession: <ext-link ext-link-type="NCBI:sra" xlink:href="SRX513907">SRX513907</ext-link>
) and the pipeline for demultiplexing and processing is available at <ext-link ext-link-type="uri" xlink:href="https://github.com/ggloor/miseq_bin">github.com/ggloor/miseq_bin</ext-link>
. Reads were filtered to only those containing perfect primer sequences, barcodes and a length between 70 and 90 for the V6 region. Taxonomy was assigned to operational taxonomic units (OTUs; 97% clustering) using the RDP classifier. <italic>α</italic>
and <italic>β</italic>
-diversity analysis and subsequent OTU level associations were made using the VEGAN and GUniFrac R Packages (<xref rid="ref-3" ref-type="bibr">Chen et al.</xref>
, <xref rid="ref-3" ref-type="bibr">2012</xref>
; <xref rid="ref-23" ref-type="bibr">Oksanen et al.</xref>
, <xref rid="ref-23" ref-type="bibr">2016</xref>
). To control for uneven sampling depth, all samples were subsampled to 9,064 reads. To examine differentially abundant taxa and to avoid spurious correlations common with the use of Pearson’s correlation and proportional data (<xref rid="ref-25" ref-type="bibr">Pearson</xref>
, <xref rid="ref-25" ref-type="bibr">1896</xref>
), ALDEx2 (version 2.0.6) (<xref rid="ref-7" ref-type="bibr">Fernandes et al.</xref>
, <xref rid="ref-7" ref-type="bibr">2013</xref>
; <xref rid="ref-8" ref-type="bibr">Fernandes et al.</xref>
, <xref rid="ref-8" ref-type="bibr">2014</xref>
) was used to calculate the centered-log ratio (CLR) of each OTU within a sample from raw read counts. Additionally, this approach includes an estimation of technical variation common to microbiota datasets by randomly drawing Monte-Carlo instances from the Dirichlet distribution. Stringent multiple test correction was applied using Benjamini Hochberg false discovery rate. Associations were then examined in R software using Pearson’s correlation coefficient. Differential abundance of taxa was represented in an effect plot (<xref rid="ref-10" ref-type="bibr">Gloor, Macklaim & Fernandes</xref>
, <xref rid="ref-10" ref-type="bibr">2015</xref>
). To completely recapitulate analysis, the raw code for read processing and analysis, associated metadata, and OTU table (.biom format) are available at <ext-link ext-link-type="uri" xlink:href="https://github.com/jbisanz/ankspon">github.com/jbisanz/ankspon</ext-link>
.</p>
</sec>
</sec>
<sec sec-type="results"><title>Results</title>
<sec><title>Clinical and demographic characteristics of patients and controls</title>
<p>Demographic and disease characteristics of the 17 patients with AxSpA are presented in <xref ref-type="table" rid="table-1">Table 1</xref>
. Of the 17 patients, 14 fulfilled the older modified New York Criteria for ankylosing spondylitis (AS). Four patients with AS had additional SpA spectrum associated diseases including: two with psoriasis and two with inflammatory bowel disease. No patients had a history of reactive arthritis. The mean age of patients was 38 years and of controls was 37 years. Amongst AxSpA patients, disease activity measured by the BASDAI disease activity score showed a mean of 4.0, indicating a group with active disease; although a wide range of disease activity was recorded, with scores ranging from 0.2 to 8.9. Summary data on the two groups’ oral disease characteristics are presented in <xref ref-type="table" rid="table-2">Table 2</xref>
. Patients with AxSpA were significantly more likely than controls to have clinically relevant periodontal disease (PPD ≥ 4 mm at ≥4 sites), more bleeding on probing and a higher mean plaque index.</p>
<table-wrap id="table-1" orientation="portrait" position="float"><object-id pub-id-type="doi">10.7717/peerj.2095/table-1</object-id>
<label>Table 1</label>
<caption><title>Characteristics of AxSpA participants and healthy controls.</title>
</caption>
<alternatives><graphic xlink:href="peerj-04-2095-g004"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col span="1"></col>
<col span="1"></col>
<col span="1"></col>
</colgroup>
<thead><tr><th rowspan="1" colspan="1"> Variable <italic>(number unless otherwise stated)</italic>
</th>
<th rowspan="1" colspan="1"> AxSpA patients (<italic>n</italic>
= 17)</th>
<th rowspan="1" colspan="1"> Healthy controls (<italic>n</italic>
= 22)</th>
</tr>
</thead>
<tbody><tr style="background-color:#C4E8FA"><td rowspan="1" colspan="1"> Female</td>
<td rowspan="1" colspan="1"> 6 (35.3)</td>
<td rowspan="1" colspan="1"> 7 (31.8)</td>
</tr>
<tr style="background-color:#E0F2F8"><td rowspan="1" colspan="1"> Mean age (years; SD)</td>
<td rowspan="1" colspan="1"> 38.0 (12.8)</td>
<td rowspan="1" colspan="1"> 37.0 (12.7)</td>
</tr>
<tr style="background-color:#C4E8FA"><td rowspan="1" colspan="1"> General health</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr style="background-color:#C4E8FA"><td style="padding-left:1pc;" rowspan="1" colspan="1"> Cardiovascular disease</td>
<td rowspan="1" colspan="1"> 11 (64.0)</td>
<td rowspan="1" colspan="1"> 0</td>
</tr>
<tr style="background-color:#C4E8FA"><td style="padding-left:1pc;" rowspan="1" colspan="1"> Diabetes</td>
<td rowspan="1" colspan="1"> 1 (2.4)</td>
<td rowspan="1" colspan="1"> 0</td>
</tr>
<tr style="background-color:#C4E8FA"><td style="padding-left:1pc;" rowspan="1" colspan="1"> Inflammatory bowel disease</td>
<td rowspan="1" colspan="1"> 4 (9.8)</td>
<td rowspan="1" colspan="1"> 0</td>
</tr>
<tr style="background-color:#E0F2F8"><td rowspan="1" colspan="1"> Smoking status</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr style="background-color:#E0F2F8"><td style="padding-left:1pc;" rowspan="1" colspan="1"> Never smoker</td>
<td rowspan="1" colspan="1"> 14 (82.4)</td>
<td rowspan="1" colspan="1"> 13 (59.1)</td>
</tr>
<tr style="background-color:#E0F2F8"><td style="padding-left:1pc;" rowspan="1" colspan="1"> Ex-smoker</td>
<td rowspan="1" colspan="1"> 3 (17.6)</td>
<td rowspan="1" colspan="1"> 6 (27.3)</td>
</tr>
<tr style="background-color:#E0F2F8"><td style="padding-left:1pc;" rowspan="1" colspan="1"> Current smoker</td>
<td rowspan="1" colspan="1"> 0 (0.0)</td>
<td rowspan="1" colspan="1"> 3 (13.6)</td>
</tr>
<tr style="background-color:#C4E8FA"><td rowspan="1" colspan="1"> Number HLA B27 positive</td>
<td rowspan="1" colspan="1"> 17 (100.0)</td>
<td rowspan="1" colspan="1"> –</td>
</tr>
<tr style="background-color:#E0F2F8"><td rowspan="1" colspan="1"> Evidence of sacroiliitis on imaging</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
</tr>
<tr style="background-color::#E0F2F8"><td style="padding-left:1pc;" rowspan="1" colspan="1"> Radiographic</td>
<td rowspan="1" colspan="1"> 14 (76.5)</td>
<td rowspan="1" colspan="1"> –</td>
</tr>
<tr style="background-color::#E0F2F8"><td style="padding-left:1pc;" rowspan="1" colspan="1"> MRI</td>
<td rowspan="1" colspan="1"> 2 (17.6)</td>
<td rowspan="1" colspan="1"> –</td>
</tr>
<tr style="background-color::#E0F2F8"><td style="padding-left:1pc;" rowspan="1" colspan="1"> None apparent on imaging</td>
<td rowspan="1" colspan="1"> 1 (5.8)</td>
<td rowspan="1" colspan="1"> –</td>
</tr>
<tr style="background-color:#C4E8FA"><td rowspan="1" colspan="1"> Mean BASDAI (SD)</td>
<td rowspan="1" colspan="1"> 4.0 (2.1)</td>
<td rowspan="1" colspan="1"> –</td>
</tr>
<tr style="background-color:#E0F2F8"><td rowspan="1" colspan="1"> Mean CRP (mg/L; SD)</td>
<td rowspan="1" colspan="1"> 5.4 (5.3)</td>
<td rowspan="1" colspan="1"> –</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot><fn id="table-1fn"><p><bold>Notes.</bold>
</p>
</fn>
<fn id="table-1fn1"><p>Brackets contain percentages unless otherwise specified.</p>
</fn>
<fn id="table-1fn2" fn-type="other"><p><def-list id="dl1"><def-item><term> BASDAI</term>
<def><p>Bath Ankylosing Spondylitis Disease Activity Index</p>
</def>
</def-item>
<def-item><term> CRP</term>
<def><p>C-reactive Protein</p>
</def>
</def-item>
</def-list>
</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="table-2" orientation="portrait" position="float"><object-id pub-id-type="doi">10.7717/peerj.2095/table-2</object-id>
<label>Table 2</label>
<caption><title>Oral health characteristics of AxSpA patients and healthy controls.</title>
</caption>
<alternatives><graphic xlink:href="peerj-04-2095-g005"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col span="1"></col>
<col span="1"></col>
<col span="1"></col>
<col span="1"></col>
</colgroup>
<thead><tr><th rowspan="1" colspan="1"> Variable <italic>(number unless otherwise stated)</italic>
</th>
<th rowspan="1" colspan="1"> AxSpA patients (<italic>n</italic>
= 22)</th>
<th rowspan="1" colspan="1"> Healthy controls (<italic>n</italic>
= 17)</th>
<th rowspan="1" colspan="1"><italic>p</italic>
-value</th>
</tr>
</thead>
<tbody><tr><td rowspan="1" colspan="1"> Mean decayed missing or filled teeth</td>
<td rowspan="1" colspan="1"> 13.1 (7.6)</td>
<td rowspan="1" colspan="1"> 9.9 (7.6)</td>
<td rowspan="1" colspan="1"> 0.210</td>
</tr>
<tr><td rowspan="1" colspan="1"> Number of individuals with ≥4 sites with PPD ≥ 4 mm (%)</td>
<td rowspan="1" colspan="1"> 11 (64.7)</td>
<td rowspan="1" colspan="1"> 5 (22.7)</td>
<td rowspan="1" colspan="1"> 0.008</td>
</tr>
<tr><td rowspan="1" colspan="1"> Mean number of sites with PPD ≥ 4 mm</td>
<td rowspan="1" colspan="1"> 5.6 (5.1)</td>
<td rowspan="1" colspan="1"> 5.1 (11.5)</td>
<td rowspan="1" colspan="1"> 0.146</td>
</tr>
<tr><td rowspan="1" colspan="1"> Mean number of sites with CAL ≥ 4 mm</td>
<td rowspan="1" colspan="1"> 10.1 (13.4)</td>
<td rowspan="1" colspan="1"> 12.6 (25.1)</td>
<td rowspan="1" colspan="1"> 0.318</td>
</tr>
<tr><td rowspan="1" colspan="1"> Mean number of sites with bleeding on probing</td>
<td rowspan="1" colspan="1"> 36.6 (21.3)</td>
<td rowspan="1" colspan="1"> 23.6 (17.6)</td>
<td rowspan="1" colspan="1"> 0.041</td>
</tr>
<tr><td rowspan="1" colspan="1"> Mean plaque index score</td>
<td rowspan="1" colspan="1"> 1.0 (0.4)</td>
<td rowspan="1" colspan="1"> 0.6 (0.4)</td>
<td rowspan="1" colspan="1"> 0.006</td>
</tr>
<tr><td rowspan="1" colspan="1"> Number meeting CDC severe periodontitis definition (%)</td>
<td rowspan="1" colspan="1"> 1 (0.1)</td>
<td rowspan="1" colspan="1"> 2 (0.1)</td>
<td rowspan="1" colspan="1"> 0.709</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot><fn id="table-2fn"><p><bold>Notes.</bold>
</p>
</fn>
<fn id="table-2fn1"><p>Brackets contain standard deviations unless otherwise indicated.</p>
</fn>
<fn id="table-2fn2" fn-type="other"><p><def-list id="dl2"><def-item><term> PPD</term>
<def><p>Pocket Probing Depth</p>
</def>
</def-item>
<def-item><term> CAL</term>
<def><p>Clinical attachment loss</p>
</def>
</def-item>
</def-list>
</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec><title>The plaque microbiota in AxSpA patients and controls</title>
<p>16S rRNA community profiling of the plaque samples yielded high sequencing depth, with the mean number of quality-filtered reads per sample being 51,203 (range 10,041–82,541, SD 13,549). Clustering was carried out at 97% identity to yield 127 distinct OTUs at ≥1% abundance in at least one sample with an average length of 75 bp after removal of primer and bar code sequences. The OTUs were summarized to the family level and are displayed in <xref ref-type="fig" rid="fig-1">Fig. 1</xref>
. At the family level, the most abundant families across all samples were the Prevotellaceae (13.6%), Streptococcaceae (12.3%), Veillonellaceae (12.1%), Corynebacteriaceae (8.0%) and Actinomycetaceae (6.1%). At the phylum level, the most dominant phyla across all samples were the Firmicutes (28.2%), Bacteroidetes (22.5%) and Actinobacteria (19.3%), with the TM7 phylum being present at 0.3%.</p>
<p>To address how microbial communities may differ between AxSpA and healthy controls, we applied multiple metrics of both <italic>α</italic>
and <italic>β</italic>
diversity (<xref ref-type="fig" rid="fig-2">Fig. 2</xref>
). No alpha diversity metric showed a difference in richness or evenness of communities (<xref ref-type="fig" rid="fig-2">Figs. 2A</xref>
–<xref ref-type="fig" rid="fig-2">2C</xref>
) and no beta diversity metric showed clear clustering by community composition by principal coordinates analysis, which was statistically corroborated by ANOSIM analysis (<italic>p</italic>
> 0.05).</p>
<fig id="fig-1" orientation="portrait" position="float"><object-id pub-id-type="doi">10.7717/peerj.2095/fig-1</object-id>
<label>Figure 1</label>
<caption><title>Heatmap of family-level abundances (calculated post-OTU filtering) of the subgingival plaque microbiome in AxSpa and healthy controls.</title>
</caption>
<graphic xlink:href="peerj-04-2095-g001"></graphic>
</fig>
<fig id="fig-2" orientation="portrait" position="float"><object-id pub-id-type="doi">10.7717/peerj.2095/fig-2</object-id>
<label>Figure 2</label>
<caption><title><italic>α</italic>
and <italic>β</italic>
diversity analysis of differences between AxSpa and healthy control communities.</title>
<p>Three measures of <italic>α</italic>
diversity (Shannon’s (A), Simpson’s (B), and Chao1 (C)) all fail to report a significant difference between disease states in terms of organism richness and evenness (Wilcox rank sum <italic>p</italic>
> 0.05). Similarly, three measures of <italic>β</italic>
diversity (both phylogenetic (E, F)/non-phylogenetic (D) and with (D, E) and without abundance weighting (F)) do not visually or significantly (ANOSIM <italic>p</italic>
> 0.05) report differences between communities.</p>
</caption>
<graphic xlink:href="peerj-04-2095-g002"></graphic>
</fig>
<p>Given that the microbiota in AxSpA patients and controls does not appear to differ at the community level, the analysis focused on individual OTUs and higher level taxonomic assignments (from phylum to species level) associated with both AxSpA and disease activity (BASDAI) in these individuals. No OTUs were associated with AxSpA, based on the robust approach applied with a stringent false discovery rate cutoff. Features were plotted in the context of an effect plot (<xref rid="ref-10" ref-type="bibr">Gloor, Macklaim & Fernandes</xref>
, <xref rid="ref-10" ref-type="bibr">2015</xref>
) demonstrating minimal difference between conditions (<xref ref-type="fig" rid="fig-3">Fig. 3</xref>
). The Actinobacteria phylum (unadjusted <italic>p</italic>
= 0.04) was found to be higher in relative abundance in healthy controls, however this was not significant after multiple testing correction.</p>
<fig id="fig-3" orientation="portrait" position="float"><object-id pub-id-type="doi">10.7717/peerj.2095/fig-3</object-id>
<label>Figure 3</label>
<caption><title>Differential abundance of features (OTUs and higher-level taxonomic assignments) shows a single feature (Actinobacteria; unadjusted <italic>p</italic>
= 0.04) is higher in healthy controls, however this is not significant after multiple testing correction.</title>
<p>Each point represents a feature (taxa) while the <italic>Y</italic>
-axis denotes the difference between healthy controls and AxSpA and the <italic>X</italic>
-axis denotes the dispersion within groups. The broken lines demonstrate the case where difference between groups is equal to the dispersion within groups, and thus significant results would be expected to be found outside of the central area of the plot.</p>
</caption>
<graphic xlink:href="peerj-04-2095-g003"></graphic>
</fig>
<p>Next, in order to investigate the role of the microbiome constituents in disease activity, analysis focused on associations between OTUs (CLR-normalized) and disease activity (BASDAI), quality of life (ASQoL), and systemic inflammation (C-reactive protein) among the individuals with AxSpA. No associations were found with levels of C-reactive protein or BASDAI. Significant correlations (<italic>p</italic>
> 0.05, <italic>r</italic>
< 0.5) were found between 4 taxa and ASQoL; however, these were strongly influenced by a single individual and thus of doubtful validity. When this individual was removed from the analysis, the differences were no longer statistically significant. OTU relative abundances (CLR-normalized) were correlated with periodontal disease (PPD ≥ 4 mm at ≥4 sites) and examined across pooled data from healthy control participants and those with AxSpA (<xref ref-type="table" rid="table-3">Table 3</xref>
). Significant associations were apparent (FDR < 0.1) with high abundance taxa including <italic>Streptococcus spp.</italic>
and <italic>Actinomyces spp</italic>
.</p>
<table-wrap id="table-3" orientation="portrait" position="float"><object-id pub-id-type="doi">10.7717/peerj.2095/table-3</object-id>
<label>Table 3</label>
<caption><title>Correlation analysis of CLR-normalized OTU abundances with the oral health (PPD ≥ 4 mm at ≥4 sites).</title>
</caption>
<alternatives><graphic xlink:href="peerj-04-2095-g006"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col span="1"></col>
<col span="1"></col>
<col span="1"></col>
<col span="1"></col>
</colgroup>
<thead><tr><th rowspan="1" colspan="1"> OTU #</th>
<th rowspan="1" colspan="1"> FDR</th>
<th rowspan="1" colspan="1"><italic>r</italic>
<sup>2</sup>
</th>
<th rowspan="1" colspan="1"> Taxonomic assignment</th>
</tr>
</thead>
<tbody><tr><td rowspan="1" colspan="1"> 13</td>
<td rowspan="1" colspan="1"> 0.007</td>
<td rowspan="1" colspan="1"> −0.619</td>
<td rowspan="1" colspan="1"><italic>Streptococcus spp.</italic>
</td>
</tr>
<tr><td rowspan="1" colspan="1"> 150</td>
<td rowspan="1" colspan="1"> 0.007</td>
<td rowspan="1" colspan="1"> 0.619</td>
<td rowspan="1" colspan="1"><italic>Saprospira spp.</italic>
</td>
</tr>
<tr><td rowspan="1" colspan="1"> 0</td>
<td rowspan="1" colspan="1"> 0.014</td>
<td rowspan="1" colspan="1"> −0.586</td>
<td rowspan="1" colspan="1"><italic>Actinomyces spp.</italic>
</td>
</tr>
<tr><td rowspan="1" colspan="1"> 21</td>
<td rowspan="1" colspan="1"> 0.08</td>
<td rowspan="1" colspan="1"> −0.522</td>
<td rowspan="1" colspan="1"><italic>Actinomyces massiliensis</italic>
</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
</sec>
</sec>
<sec sec-type="discussion"><title>Discussion</title>
<p>To our knowledge, this is the first study to examine oral plaque bacterial communities in relation to oral health in patients with AxSpA using high-throughput DNA sequencing techniques. At the community level, we found no difference between AxSpA patients and healthy controls in either their community structure or in the diversity of organisms in the plaque bacterial communities analyzed. This is despite the confounders that patients with AxSpA had significantly worse oral health than age- and sex-matched controls, with more plaque and a higher prevalence of periodontitis, despite their young mean age. In a similar study examining the oral microbiome in patients with RA, no difference in community profile was found amongst early RA, chronic RA and healthy controls, but differences in the subgingival microbiota were noted in relation to periodontitis (<xref rid="ref-36" ref-type="bibr">Scher et al.</xref>
, <xref rid="ref-36" ref-type="bibr">2012</xref>
).</p>
<p>Analysis at the OTU level failed to demonstrate an association between AxSpA and several bacterial taxa with stringent multiple testing corrections. While this suggests that no single causative-agent in the subgingival plaque is involved in the aetiopathogenesis, it should be noted that, without very many more samples, the sheer number of OTUs compared would make it unlikely that small effect-sizes would be detected. This is a limitation of the current study, and the data presented here should be viewed as a discovery-based approach warranting replicating studies with greater enrollment in order to conclusively rule out false negatives. All aspects of the data have been made publicly available for those researchers wishing to use the data set for hypothesis generation. The use of CLR-normalized relative abundances and modeling of technical error reduces the risk of false associations with low-abundance taxa and spurious correlations frequently reported in microbiota research (<xref rid="ref-7" ref-type="bibr">Fernandes et al.</xref>
, <xref rid="ref-7" ref-type="bibr">2013</xref>
; <xref rid="ref-8" ref-type="bibr">Fernandes et al.</xref>
, <xref rid="ref-8" ref-type="bibr">2014</xref>
). While being a relatively new technology, 16S rRNA variable region surveys via high-throughput sequencing are a relatively coarse method of analysis, and further studies using shotgun-metagenomic and meta-RNA sequencing may provide more in-depth analysis that could discover strain or gene-level associations with disease. Furthermore, given the growing evidence for an association between periodontal disease and AxSpA (<xref rid="ref-13" ref-type="bibr">Keller, Kang & Lin</xref>
, <xref rid="ref-13" ref-type="bibr">2013</xref>
; <xref rid="ref-28" ref-type="bibr">Pischon et al.</xref>
, <xref rid="ref-28" ref-type="bibr">2010</xref>
), future studies should address the potential for the oral microbiota as a causative factor in AxSpA, as opposed to being simply a marker of periodontal disease and inflammation. This is particularly relevant given recent advances in our understanding of the genetic predisposition to AxSpA. Potential mechanisms can only be postulated. However, given evidence from elsewhere in the gut, it is possible that interactions between the autologous microbiome and the host immune system may be implicated in the aetiopathogenesis of AxSpA, since evidence for such a process in the ileo-colon continues to accumulate (<xref rid="ref-4" ref-type="bibr">Costello et al.</xref>
, <xref rid="ref-4" ref-type="bibr">2013</xref>
). At present, there is limited objective evidence that either specific bacteria or alterations in the microbiome as a whole influence the aetiopathogenesis of these conditions (<xref rid="ref-43" ref-type="bibr">Yeoh et al.</xref>
, <xref rid="ref-43" ref-type="bibr">2013</xref>
; <xref rid="ref-4" ref-type="bibr">Costello et al.</xref>
, <xref rid="ref-4" ref-type="bibr">2013</xref>
). Gingivitis and periodontitis are both host immune responses to plaque microbial challenge (<xref rid="ref-38" ref-type="bibr">Seymour et al.</xref>
, <xref rid="ref-38" ref-type="bibr">1988</xref>
). Credible biological mechanisms associating periodontitis and systemic inflammatory conditions have been proposed, but epidemiological confirmation of a causal relationship remains elusive. Associations are not necessarily causal and may comprise but one aspect of a variety of associated environmental risk factors (<xref rid="ref-37" ref-type="bibr">Seymour et al.</xref>
, <xref rid="ref-37" ref-type="bibr">2007</xref>
).</p>
</sec>
<sec sec-type="conclusions"><title>Conclusions</title>
<p>Plaque samples from patients with AxSpA showed no difference in microbial diversity compared with matched controls, despite a higher prevalence of periodontitis. A wide variety of taxa were identified in plaque samples, many of which have been identified in previous studies both in the plaque of patients with periodontitis and in healthy individuals. These findings require further evaluation in larger samples in order to investigate bacterial community profiles and specific organisms of interest with reference to those identified in this study. Further, microbial profiles in the oral cavity should be investigated with other sites of interest including serum and synovial fluid specimens from patients with AxSpA.</p>
</sec>
</body>
<back><ack><p>We are grateful to Mary Wallace for assistance with clinical data management.</p>
</ack>
<sec sec-type="additional-information"><title>Additional Information and Declarations</title>
<fn-group content-type="competing-interests"><title>Competing Interests</title>
<fn id="conflict-1" fn-type="conflict"><p>The authors declare there are no competing interests.</p>
</fn>
</fn-group>
<fn-group content-type="author-contributions"><title>Author Contributions</title>
<fn id="contribution-1" fn-type="con"><p><xref ref-type="contrib" rid="author-1">Jordan E. Bisanz</xref>
analyzed the data, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.</p>
</fn>
<fn id="contribution-2" fn-type="con"><p><xref ref-type="contrib" rid="author-2">Praema Suppiah</xref>
and Nigel Yeoh performed the experiments, analyzed the data, reviewed drafts of the paper.</p>
</fn>
<fn id="contribution-3" fn-type="con"><p><xref ref-type="contrib" rid="author-3">W. Murray Thomson</xref>
conceived and designed the experiments, analyzed the data, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.</p>
</fn>
<fn id="contribution-4" fn-type="con"><p><xref ref-type="contrib" rid="author-4">Trudy Milne</xref>
conceived and designed the experiments, analyzed the data, wrote the paper, reviewed drafts of the paper.</p>
</fn>
<fn id="contribution-5" fn-type="con"><p><xref ref-type="contrib" rid="author-6">Anita Nolan</xref>
conceived and designed the experiments, performed the experiments, analyzed the data, wrote the paper, reviewed drafts of the paper.</p>
</fn>
<fn id="contribution-6" fn-type="con"><p><xref ref-type="contrib" rid="author-7">Grace Ettinger</xref>
wrote the paper, reviewed drafts of the paper.</p>
</fn>
<fn id="contribution-7" fn-type="con"><p><xref ref-type="contrib" rid="author-8">Gregor Reid</xref>
reviewed drafts of the paper.</p>
</fn>
<fn id="contribution-8" fn-type="con"><p><xref ref-type="contrib" rid="author-9">Gregory B. Gloor</xref>
contributed reagents/materials/analysis tools, reviewed drafts of the paper.</p>
</fn>
<fn id="contribution-9" fn-type="con"><p><xref ref-type="contrib" rid="author-10">Jeremy P. Burton</xref>
and <xref ref-type="contrib" rid="author-11">Mary P. Cullinan</xref>
conceived and designed the experiments, contributed reagents/materials/analysis tools, wrote the paper, reviewed drafts of the paper.</p>
</fn>
<fn id="contribution-10" fn-type="con"><p><xref ref-type="contrib" rid="author-12">Simon M. Stebbings</xref>
conceived and designed the experiments, contributed reagents/materials/analysis tools, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.</p>
</fn>
</fn-group>
<fn-group content-type="other"><title>Human Ethics</title>
<fn id="addinfo-1"><p>The following information was supplied relating to ethical approvals (i.e., approving body and any reference numbers):</p>
<p>Lower South Regional Ethics Committee of New Zealand (ref: LRS/10/06/020).</p>
</fn>
</fn-group>
<fn-group content-type="other"><title>DNA Deposition</title>
<fn id="addinfo-2"><p>The following information was supplied regarding the deposition of DNA sequences:</p>
<p>NCBI Short Read Archive: <ext-link ext-link-type="NCBI:sra" xlink:href="SRX513907">SRX513907</ext-link>
.</p>
</fn>
</fn-group>
<fn-group content-type="other"><title>Data Availability</title>
<fn id="addinfo-3"><p>The following information was supplied regarding data availability:</p>
<p>GitHub: <uri xlink:href="https://github.com/jbisanz/ankspon">https://github.com/jbisanz/ankspon</uri>
.</p>
</fn>
</fn-group>
</sec>
<ref-list content-type="authoryear"><title>References</title>
<ref id="ref-1"><label>Bisanz et al. (2014a)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bisanz</surname>
<given-names>JE</given-names>
</name>
<name><surname>Enos</surname>
<given-names>MK</given-names>
</name>
<name><surname>Mwanga</surname>
<given-names>JR</given-names>
</name>
<name><surname>Changalucha</surname>
<given-names>J</given-names>
</name>
<name><surname>Burton</surname>
<given-names>JP</given-names>
</name>
<name><surname>Gloor</surname>
<given-names>GB</given-names>
</name>
<name><surname>Reid</surname>
<given-names>G</given-names>
</name>
</person-group>
<year>2014a</year>
<article-title>Randomized open-label pilot study of the influence of probiotics and the gut microbiome on toxic metal levels in Tanzanian pregnant women and school children</article-title>
<source>mBio</source>
<volume>5</volume>
<issue>5</issue>
<elocation-id>e2095</elocation-id>
<pub-id pub-id-type="doi">10.1128/mBio.01580-14</pub-id>
</element-citation>
</ref>
<ref id="ref-2"><label>Bisanz et al. (2014b)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bisanz</surname>
<given-names>JE</given-names>
</name>
<name><surname>Seney</surname>
<given-names>S</given-names>
</name>
<name><surname>McMillan</surname>
<given-names>A</given-names>
</name>
<name><surname>Vongsa</surname>
<given-names>R</given-names>
</name>
<name><surname>Koenig</surname>
<given-names>D</given-names>
</name>
<name><surname>Wong</surname>
<given-names>L</given-names>
</name>
<name><surname>Dvoracek</surname>
<given-names>B</given-names>
</name>
<name><surname>Gloor</surname>
<given-names>GB</given-names>
</name>
<name><surname>Sumarah</surname>
<given-names>M</given-names>
</name>
<name><surname>Ford</surname>
<given-names>B</given-names>
</name>
<name><surname>Herman</surname>
<given-names>D</given-names>
</name>
<name><surname>Burton</surname>
<given-names>JP</given-names>
</name>
<name><surname>Reid</surname>
<given-names>G</given-names>
</name>
</person-group>
<year>2014b</year>
<article-title>A systems biology approach investigating the effect of probiotics on the vaginal microbiome and host responses in a double blind, placebo-controlled clinical trial of post-menopausal women</article-title>
<source>PLoS ONE</source>
<volume>9</volume>
<issue>8</issue>
<elocation-id>e2095</elocation-id>
<pub-id pub-id-type="doi">10.1371/journal.pone.0104511</pub-id>
</element-citation>
</ref>
<ref id="ref-3"><label>Chen et al. (2012)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname>
<given-names>J</given-names>
</name>
<name><surname>Bittinger</surname>
<given-names>K</given-names>
</name>
<name><surname>Charlson</surname>
<given-names>ES</given-names>
</name>
<name><surname>Hoffmann</surname>
<given-names>C</given-names>
</name>
<name><surname>Lewis</surname>
<given-names>J</given-names>
</name>
<name><surname>Wu</surname>
<given-names>GD</given-names>
</name>
<name><surname>Collman</surname>
<given-names>RG</given-names>
</name>
<name><surname>Bushman</surname>
<given-names>FD</given-names>
</name>
<name><surname>Li</surname>
<given-names>H</given-names>
</name>
</person-group>
<year>2012</year>
<article-title>Associating microbiome composition with environmental covariates using generalized UniFrac distances</article-title>
<source>Bioinformatics</source>
<volume>28</volume>
<issue>16</issue>
<fpage>2106</fpage>
<lpage>2113</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/bts342</pub-id>
<pub-id pub-id-type="pmid">22711789</pub-id>
</element-citation>
</ref>
<ref id="ref-4"><label>Costello et al. (2013)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Costello</surname>
<given-names>ME</given-names>
</name>
<name><surname>Elewaut</surname>
<given-names>D</given-names>
</name>
<name><surname>Kenna</surname>
<given-names>TJ</given-names>
</name>
<name><surname>Brown</surname>
<given-names>MA</given-names>
</name>
</person-group>
<year>2013</year>
<article-title>Microbes, the gut and ankylosing spondylitis</article-title>
<source>Arthritis Research & Therapy</source>
<volume>15</volume>
<comment>Article 214</comment>
<pub-id pub-id-type="doi">10.1186/ar4228</pub-id>
</element-citation>
</ref>
<ref id="ref-5"><label>De Pablo, Dietrich & McAlindon (2008)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>De Pablo</surname>
<given-names>P</given-names>
</name>
<name><surname>Dietrich</surname>
<given-names>T</given-names>
</name>
<name><surname>McAlindon</surname>
<given-names>TE</given-names>
</name>
</person-group>
<year>2008</year>
<article-title>Association of periodontal disease and tooth loss with rheumatoid arthritis in the US population</article-title>
<source>The Journal of Rheumatology</source>
<volume>35</volume>
<issue>1</issue>
<fpage>70</fpage>
<lpage>76</lpage>
<pub-id pub-id-type="pmid">18050377</pub-id>
</element-citation>
</ref>
<ref id="ref-6"><label>Eke et al. (2012)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Eke</surname>
<given-names>PI</given-names>
</name>
<name><surname>Page</surname>
<given-names>RC</given-names>
</name>
<name><surname>Wei</surname>
<given-names>L</given-names>
</name>
<name><surname>Thornton-Evans</surname>
<given-names>G</given-names>
</name>
<name><surname>Genco</surname>
<given-names>RJ</given-names>
</name>
</person-group>
<year>2012</year>
<article-title>Update of the case definitions for population-based surveillance of periodontitis</article-title>
<source>Journal of Periodontology</source>
<volume>83</volume>
<issue>12</issue>
<fpage>1449</fpage>
<lpage>1454</lpage>
<pub-id pub-id-type="doi">10.1902/jop.2012.110664</pub-id>
<pub-id pub-id-type="pmid">22420873</pub-id>
</element-citation>
</ref>
<ref id="ref-7"><label>Fernandes et al. (2013)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fernandes</surname>
<given-names>AD</given-names>
</name>
<name><surname>Macklaim</surname>
<given-names>JM</given-names>
</name>
<name><surname>Linn</surname>
<given-names>TG</given-names>
</name>
<name><surname>Reid</surname>
<given-names>G</given-names>
</name>
<name><surname>Gloor</surname>
<given-names>GB</given-names>
</name>
</person-group>
<year>2013</year>
<article-title>ANOVA-like differential expression (ALDEx) analysis for mixed population RNA-seq</article-title>
<source>PLoS ONE</source>
<volume>8</volume>
<issue>7</issue>
<elocation-id>e2095</elocation-id>
<pub-id pub-id-type="doi">10.1371/journal.pone.0067019</pub-id>
</element-citation>
</ref>
<ref id="ref-8"><label>Fernandes et al. (2014)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fernandes</surname>
<given-names>AD</given-names>
</name>
<name><surname>Reid</surname>
<given-names>JN</given-names>
</name>
<name><surname>Macklaim</surname>
<given-names>JM</given-names>
</name>
<name><surname>McMurrough</surname>
<given-names>TA</given-names>
</name>
<name><surname>Edgell</surname>
<given-names>DR</given-names>
</name>
<name><surname>Gloor</surname>
<given-names>GB</given-names>
</name>
</person-group>
<year>2014</year>
<article-title>Unifying the analysis of high-throughput sequencing datasets: characterizing RNA-seq, 16S rRNA gene sequencing and selective growth experiments by compositional data analysis</article-title>
<source>Microbiome</source>
<volume>2</volume>
<comment>Article 15</comment>
<issue>1</issue>
<pub-id pub-id-type="doi">10.1186/2049-2618-2-15</pub-id>
</element-citation>
</ref>
<ref id="ref-9"><label>Garrett et al. (1994)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Garrett</surname>
<given-names>S</given-names>
</name>
<name><surname>Jenkinson</surname>
<given-names>T</given-names>
</name>
<name><surname>Kennedy</surname>
<given-names>LG</given-names>
</name>
<name><surname>Whitelock</surname>
<given-names>H</given-names>
</name>
<name><surname>Gaisford</surname>
<given-names>P</given-names>
</name>
<name><surname>Calin</surname>
<given-names>A</given-names>
</name>
</person-group>
<year>1994</year>
<article-title>A new approach to defining disease status in ankylosing spondylitis: the Bath Ankylosing Spondylitis Disease Activity Index</article-title>
<source>The Journal of Rheumatology</source>
<volume>21</volume>
<issue>12</issue>
<fpage>2286</fpage>
<lpage>2291</lpage>
<pub-id pub-id-type="pmid">7699630</pub-id>
</element-citation>
</ref>
<ref id="ref-10"><label>Gloor, Macklaim & Fernandes (2015)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gloor</surname>
<given-names>GB</given-names>
</name>
<name><surname>Macklaim</surname>
<given-names>JM</given-names>
</name>
<name><surname>Fernandes</surname>
<given-names>AD</given-names>
</name>
</person-group>
<year>2015</year>
<article-title>Displaying variation in large datasets: plotting a visual summary of effect sizes</article-title>
<source>Journal of Computational and Graphical Statistics</source>
<comment>Epub ahead of print Dec 18 2015</comment>
<pub-id pub-id-type="doi">10.1080/10618600.2015.1131161</pub-id>
</element-citation>
</ref>
<ref id="ref-11"><label>Hammer et al. (1990)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hammer</surname>
<given-names>RE</given-names>
</name>
<name><surname>Maika</surname>
<given-names>SD</given-names>
</name>
<name><surname>Richardson</surname>
<given-names>JA</given-names>
</name>
<name><surname>Tang</surname>
<given-names>JP</given-names>
</name>
<name><surname>Taurog</surname>
<given-names>JD</given-names>
</name>
</person-group>
<year>1990</year>
<article-title>Spontaneous inflammatory disease in transgenic rats expressing HLA-B27 and human beta 2m: an animal model of HLA-B27-associated human disorders</article-title>
<source>Cell</source>
<volume>63</volume>
<issue>5</issue>
<fpage>1099</fpage>
<lpage>1112</lpage>
<pub-id pub-id-type="doi">10.1016/0092-8674(90)90512-D</pub-id>
<pub-id pub-id-type="pmid">2257626</pub-id>
</element-citation>
</ref>
<ref id="ref-12"><label>HMPConsortium (2012)</label>
<element-citation publication-type="journal"><year>2012</year>
<person-group><collab>HMPConsortium</collab>
</person-group>
<article-title>Structure, function and diversity of the healthy human microbiome</article-title>
<source>Nature</source>
<volume>486</volume>
<fpage>207</fpage>
<lpage>214</lpage>
<pub-id pub-id-type="doi">10.1038/nature11234</pub-id>
<pub-id pub-id-type="pmid">22699609</pub-id>
</element-citation>
</ref>
<ref id="ref-13"><label>Keller, Kang & Lin (2013)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Keller</surname>
<given-names>JJ</given-names>
</name>
<name><surname>Kang</surname>
<given-names>J-H</given-names>
</name>
<name><surname>Lin</surname>
<given-names>H-C</given-names>
</name>
</person-group>
<year>2013</year>
<article-title>Association between ankylosing spondylitis and chronic periodontitis: a population-based study</article-title>
<source>Arthritis & Rheumatism</source>
<volume>65</volume>
<issue>1</issue>
<fpage>167</fpage>
<lpage>173</lpage>
<pub-id pub-id-type="doi">10.1002/art.37746</pub-id>
<pub-id pub-id-type="pmid">23055204</pub-id>
</element-citation>
</ref>
<ref id="ref-14"><label>Kempsell et al. (2000)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kempsell</surname>
<given-names>KE</given-names>
</name>
<name><surname>Cox</surname>
<given-names>CJ</given-names>
</name>
<name><surname>Hurle</surname>
<given-names>M</given-names>
</name>
<name><surname>Wong</surname>
<given-names>A</given-names>
</name>
<name><surname>Wilkie</surname>
<given-names>S</given-names>
</name>
<name><surname>Zanders</surname>
<given-names>ED</given-names>
</name>
<name><surname>Gaston</surname>
<given-names>JS</given-names>
</name>
<name><surname>Crowe</surname>
<given-names>JS</given-names>
</name>
</person-group>
<year>2000</year>
<article-title>Reverse transcriptase-PCR analysis of bacterial rRNA for detection and characterization of bacterial species in arthritis synovial tissue</article-title>
<source>Infection and Immunity</source>
<volume>68</volume>
<issue>10</issue>
<fpage>6012</fpage>
<lpage>6026</lpage>
<pub-id pub-id-type="doi">10.1128/IAI.68.10.6012-6026.2000</pub-id>
<pub-id pub-id-type="pmid">10992514</pub-id>
</element-citation>
</ref>
<ref id="ref-15"><label>Khan (2002)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Khan</surname>
<given-names>MA</given-names>
</name>
</person-group>
<year>2002</year>
<article-title>Update on spondyloarthropathies</article-title>
<source>Annals of Internal Medicine</source>
<volume>136</volume>
<issue>12</issue>
<fpage>896</fpage>
<lpage>907</lpage>
<pub-id pub-id-type="doi">10.7326/0003-4819-136-12-200206180-00011</pub-id>
<pub-id pub-id-type="pmid">12069564</pub-id>
</element-citation>
</ref>
<ref id="ref-16"><label>Kramer, Pindborg & Infirri (1980)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kramer</surname>
<given-names>IR</given-names>
</name>
<name><surname>Pindborg</surname>
<given-names>JJ</given-names>
</name>
<name><surname>Infirri</surname>
<given-names>JS</given-names>
</name>
</person-group>
<year>1980</year>
<article-title>Guide to epidemiology and diagnosis of oral mucosal diseases and conditions. World Health Organization</article-title>
<source>Community Dentistry and Oral Epidemiology</source>
<volume>8</volume>
<issue>1</issue>
<fpage>1</fpage>
<lpage>26</lpage>
<pub-id pub-id-type="doi">10.1111/j.1600-0528.1980.tb01249.x</pub-id>
<pub-id pub-id-type="pmid">6929240</pub-id>
</element-citation>
</ref>
<ref id="ref-17"><label>Loyola-Rodriguez et al. (2010)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Loyola-Rodriguez</surname>
<given-names>JP</given-names>
</name>
<name><surname>Martinez-Martinez</surname>
<given-names>RE</given-names>
</name>
<name><surname>Abud-Mendoza</surname>
<given-names>C</given-names>
</name>
<name><surname>Patiño-Marin</surname>
<given-names>N</given-names>
</name>
<name><surname>Seymour</surname>
<given-names>GJ</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Rheumatoid arthritis and the role of oral bacteria</article-title>
<source>Journal of Oral Microbiology</source>
<volume>2</volume>
<fpage>5784</fpage>
<pub-id pub-id-type="doi">10.3402/jom.v2i0.5784</pub-id>
</element-citation>
</ref>
<ref id="ref-18"><label>Martinez Martinez et al. (2009)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martinez Martinez</surname>
<given-names>RE</given-names>
</name>
<name><surname>Abud-Mendoza</surname>
<given-names>C</given-names>
</name>
<name><surname>Patiño-Marin</surname>
<given-names>N</given-names>
</name>
<name><surname>Rizo Rodríguez</surname>
<given-names>JC</given-names>
</name>
<name><surname>Little</surname>
<given-names>JW</given-names>
</name>
<name><surname>Loyola-Rodriguez</surname>
<given-names>JP</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>Detection of periodontal bacterial DNA in serum and synovial fluid in refractory rheumatoid arthritis patients</article-title>
<source>Journal of Clinical Periodontology</source>
<volume>36</volume>
<issue>12</issue>
<fpage>1004</fpage>
<lpage>1010</lpage>
<pub-id pub-id-type="doi">10.1111/j.1600-051X.2009.01496.x</pub-id>
<pub-id pub-id-type="pmid">19929953</pub-id>
</element-citation>
</ref>
<ref id="ref-19"><label>Mielants et al. (1995)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mielants</surname>
<given-names>H</given-names>
</name>
<name><surname>Veys</surname>
<given-names>EM</given-names>
</name>
<name><surname>De Vos</surname>
<given-names>M</given-names>
</name>
<name><surname>Cuvelier</surname>
<given-names>C</given-names>
</name>
<name><surname>Goemaere</surname>
<given-names>S</given-names>
</name>
<name><surname>De Clercq</surname>
<given-names>L</given-names>
</name>
<name><surname>Schatteman</surname>
<given-names>L</given-names>
</name>
<name><surname>Elewaut</surname>
<given-names>D</given-names>
</name>
</person-group>
<year>1995</year>
<article-title>The evolution of spondyloarthropathies in relation to gut histology. I. Clinical aspects</article-title>
<source>The Journal of Rheumatology</source>
<volume>22</volume>
<issue>12</issue>
<fpage>2266</fpage>
<lpage>2272</lpage>
<pub-id pub-id-type="pmid">8835560</pub-id>
</element-citation>
</ref>
<ref id="ref-20"><label>Moen et al. (2005)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moen</surname>
<given-names>K</given-names>
</name>
<name><surname>Brun</surname>
<given-names>JG</given-names>
</name>
<name><surname>Eribe</surname>
<given-names>ERK</given-names>
</name>
<name><surname>Olsen</surname>
<given-names>I</given-names>
</name>
<name><surname>Jonsson</surname>
<given-names>R</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Oral bacterial DNA in synovial fluids of arthritis patients</article-title>
<source>Microbial Ecology in Health and Disease</source>
<volume>17</volume>
<issue>1</issue>
<fpage>2</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="doi">10.1080/08910600510031394</pub-id>
</element-citation>
</ref>
<ref id="ref-21"><label>Moen et al. (2006)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moen</surname>
<given-names>K</given-names>
</name>
<name><surname>Brun</surname>
<given-names>JG</given-names>
</name>
<name><surname>Valen</surname>
<given-names>M</given-names>
</name>
<name><surname>Skartveit</surname>
<given-names>L</given-names>
</name>
<name><surname>Ribs Eribe</surname>
<given-names>EK</given-names>
</name>
<name><surname>Olsen</surname>
<given-names>I</given-names>
</name>
<name><surname>Jonsson</surname>
<given-names>R</given-names>
</name>
</person-group>
<year>2006</year>
<article-title>Synovial inflammation in active rheumatoid arthritis and psoriatic arthritis facilitates trapping of a variety of oral bacterial DNAs</article-title>
<source>Clinical and Experimental Rheumatology</source>
<volume>24</volume>
<fpage>656</fpage>
<lpage>663</lpage>
<pub-id pub-id-type="pmid">17207381</pub-id>
</element-citation>
</ref>
<ref id="ref-22"><label>Ohlrich, Cullinan & Seymour (2009)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ohlrich</surname>
<given-names>EJ</given-names>
</name>
<name><surname>Cullinan</surname>
<given-names>MP</given-names>
</name>
<name><surname>Seymour</surname>
<given-names>GJ</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>The immunopathogenesis of periodontal disease</article-title>
<source>Australian Dental Journal</source>
<volume>54</volume>
<issue>s1</issue>
<fpage>S2</fpage>
<lpage>S10</lpage>
<pub-id pub-id-type="doi">10.1111/j.1834-7819.2009.01139.x</pub-id>
<pub-id pub-id-type="pmid">19737265</pub-id>
</element-citation>
</ref>
<ref id="ref-23"><label>Oksanen et al. (2016)</label>
<element-citation publication-type="other"><person-group person-group-type="author"><name><surname>Oksanen</surname>
<given-names>J</given-names>
</name>
<name><surname>Blanchet</surname>
<given-names>FG</given-names>
</name>
<name><surname>Kindt</surname>
<given-names>R</given-names>
</name>
<name><surname>Legendre</surname>
<given-names>P</given-names>
</name>
<name><surname>Minchin</surname>
<given-names>PR</given-names>
</name>
<name><surname>O’Hara</surname>
<given-names>RB</given-names>
</name>
<name><surname>Simpson</surname>
<given-names>GL</given-names>
</name>
<name><surname>Solymos</surname>
<given-names>P</given-names>
</name>
<name><surname>Stevens</surname>
<given-names>MHH</given-names>
</name>
<name><surname>Wagner</surname>
<given-names>H</given-names>
</name>
</person-group>
<year>2016</year>
<source>vegan: community ecology package</source>
<comment><italic>Available at <uri xlink:href="http://vegan.r-forge.r-project.org/">http://vegan.r-forge.r-project.org/</uri>
</italic>
</comment>
</element-citation>
</ref>
<ref id="ref-24"><label>Ortiz et al. (2009)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ortiz</surname>
<given-names>P</given-names>
</name>
<name><surname>Bissada</surname>
<given-names>NF</given-names>
</name>
<name><surname>Palomo</surname>
<given-names>L</given-names>
</name>
<name><surname>Han</surname>
<given-names>YW</given-names>
</name>
<name><surname>Al-Zahrani</surname>
<given-names>MS</given-names>
</name>
<name><surname>Panneerselvam</surname>
<given-names>A</given-names>
</name>
<name><surname>Askari</surname>
<given-names>A</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>Periodontal therapy reduces the severity of active rheumatoid arthritis in patients treated with or without tumor necrosis factor inhibitors</article-title>
<source>Journal of Periodontology</source>
<volume>80</volume>
<issue>4</issue>
<fpage>535</fpage>
<lpage>540</lpage>
<pub-id pub-id-type="doi">10.1902/jop.2009.080447</pub-id>
<pub-id pub-id-type="pmid">19335072</pub-id>
</element-citation>
</ref>
<ref id="ref-25"><label>Pearson (1896)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pearson</surname>
<given-names>K</given-names>
</name>
</person-group>
<year>1896</year>
<article-title>Mathematical contributions to the theory of evolution.—on a form of spurious correlation which may arise when indices are used in the measurement of organs</article-title>
<source>Proceedings of the Royal Society of London</source>
<volume>60</volume>
<fpage>489</fpage>
<lpage>498</lpage>
</element-citation>
</ref>
<ref id="ref-26"><label>Petersen & Ogawa (2005)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Petersen</surname>
<given-names>PE</given-names>
</name>
<name><surname>Ogawa</surname>
<given-names>H</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Strengthening the prevention of periodontal disease: the WHO approach</article-title>
<source>Journal of Periodontology</source>
<volume>76</volume>
<issue>12</issue>
<fpage>2187</fpage>
<lpage>2193</lpage>
<pub-id pub-id-type="doi">10.1902/jop.2005.76.12.2187</pub-id>
<pub-id pub-id-type="pmid">16332229</pub-id>
</element-citation>
</ref>
<ref id="ref-27"><label>Pihlstrom, Michalowicz & Johnson (2005)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pihlstrom</surname>
<given-names>BL</given-names>
</name>
<name><surname>Michalowicz</surname>
<given-names>BS</given-names>
</name>
<name><surname>Johnson</surname>
<given-names>NW</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Periodontal diseases</article-title>
<source>The Lancet</source>
<volume>366</volume>
<issue>9499</issue>
<fpage>1809</fpage>
<lpage>1820</lpage>
<pub-id pub-id-type="doi">10.1016/S0140-6736(05)67728-8</pub-id>
</element-citation>
</ref>
<ref id="ref-28"><label>Pischon et al. (2010)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pischon</surname>
<given-names>N</given-names>
</name>
<name><surname>Pischon</surname>
<given-names>T</given-names>
</name>
<name><surname>Gülmez</surname>
<given-names>E</given-names>
</name>
<name><surname>Kröger</surname>
<given-names>J</given-names>
</name>
<name><surname>Purucker</surname>
<given-names>P</given-names>
</name>
<name><surname>Kleber</surname>
<given-names>B-M</given-names>
</name>
<name><surname>Landau</surname>
<given-names>H</given-names>
</name>
<name><surname>Jost-Brinkmann</surname>
<given-names>P-G</given-names>
</name>
<name><surname>Schlattmann</surname>
<given-names>P</given-names>
</name>
<name><surname>Zernicke</surname>
<given-names>J</given-names>
</name>
<name><surname>Burmester</surname>
<given-names>G-R</given-names>
</name>
<name><surname>Bernimoulin</surname>
<given-names>J-P</given-names>
</name>
<name><surname>Buttgereit</surname>
<given-names>F</given-names>
</name>
<name><surname>Detert</surname>
<given-names>J</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Periodontal disease in patients with ankylosing spondylitis</article-title>
<source>Annals of the Rheumatic Diseases</source>
<volume>69</volume>
<issue>1</issue>
<fpage>34</fpage>
<lpage>38</lpage>
<pub-id pub-id-type="doi">10.1136/ard.2008.097212</pub-id>
<pub-id pub-id-type="pmid">19126560</pub-id>
</element-citation>
</ref>
<ref id="ref-29"><label>Pizzo et al. (2010)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pizzo</surname>
<given-names>G</given-names>
</name>
<name><surname>Guiglia</surname>
<given-names>R</given-names>
</name>
<name><surname>Russo</surname>
<given-names>LL</given-names>
</name>
<name><surname>Campisi</surname>
<given-names>G</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>Dentistry and internal medicine: from the focal infection theory to the periodontal medicine concept</article-title>
<source>European Journal of Internal Medicine</source>
<volume>21</volume>
<issue>6</issue>
<fpage>496</fpage>
<lpage>502</lpage>
<pub-id pub-id-type="doi">10.1016/j.ejim.2010.07.011</pub-id>
<pub-id pub-id-type="pmid">21111933</pub-id>
</element-citation>
</ref>
<ref id="ref-30"><label>Rath et al. (1996)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rath</surname>
<given-names>HC</given-names>
</name>
<name><surname>Herfarth</surname>
<given-names>HH</given-names>
</name>
<name><surname>Ikeda</surname>
<given-names>JS</given-names>
</name>
<name><surname>Grenther</surname>
<given-names>WB</given-names>
</name>
<name><surname>Hamm</surname>
<given-names>TE</given-names>
</name>
<name><surname>Balish</surname>
<given-names>E</given-names>
</name>
<name><surname>Taurog</surname>
<given-names>JD</given-names>
</name>
<name><surname>Hammer</surname>
<given-names>RE</given-names>
</name>
<name><surname>Wilson</surname>
<given-names>KH</given-names>
</name>
<name><surname>Sartor</surname>
<given-names>RB</given-names>
</name>
</person-group>
<year>1996</year>
<article-title>Normal luminal bacteria, especially Bacteroides species, mediate chronic colitis, gastritis, and arthritis in HLA-B27/human beta2 microglobulin transgenic rats</article-title>
<source>The Journal of Clinical Investigation</source>
<volume>98</volume>
<issue>4</issue>
<fpage>945</fpage>
<lpage>953</lpage>
<pub-id pub-id-type="doi">10.1172/JCI118878</pub-id>
<pub-id pub-id-type="pmid">8770866</pub-id>
</element-citation>
</ref>
<ref id="ref-31"><label>Ribeiro, Leão & Novaes (2005)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ribeiro</surname>
<given-names>J</given-names>
</name>
<name><surname>Leão</surname>
<given-names>A</given-names>
</name>
<name><surname>Novaes</surname>
<given-names>AB</given-names>
</name>
</person-group>
<year>2005</year>
<article-title>Periodontal infection as a possible severity factor for rheumatoid arthritis</article-title>
<source>Journal of Clinical Periodontology</source>
<volume>32</volume>
<issue>4</issue>
<fpage>412</fpage>
<lpage>416</lpage>
<pub-id pub-id-type="doi">10.1111/j.1600-051X.2005.00689.x</pub-id>
<pub-id pub-id-type="pmid">15811060</pub-id>
</element-citation>
</ref>
<ref id="ref-32"><label>Roberts et al. (2013)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Roberts</surname>
<given-names>RL</given-names>
</name>
<name><surname>Wallace</surname>
<given-names>MC</given-names>
</name>
<name><surname>Jones</surname>
<given-names>GT</given-names>
</name>
<name><surname>Van Rij</surname>
<given-names>AM</given-names>
</name>
<name><surname>Merriman</surname>
<given-names>TR</given-names>
</name>
<name><surname>Harrison</surname>
<given-names>A</given-names>
</name>
<name><surname>White</surname>
<given-names>D</given-names>
</name>
<name><surname>Stamp</surname>
<given-names>LK</given-names>
</name>
<name><surname>Ching</surname>
<given-names>D</given-names>
</name>
<name><surname>Highton</surname>
<given-names>J</given-names>
</name>
<name><surname>Stebbings</surname>
<given-names>SM</given-names>
</name>
</person-group>
<year>2013</year>
<article-title>Prevalence of HLA-B27 in the New Zealand population: effect of age and ethnicity</article-title>
<source>Arthritis Research & Therapy</source>
<volume>15</volume>
<comment>Article R158</comment>
<issue>5</issue>
<pub-id pub-id-type="doi">10.1186/ar4341</pub-id>
</element-citation>
</ref>
<ref id="ref-33"><label>Rudwaleit et al. (2010)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rudwaleit</surname>
<given-names>M</given-names>
</name>
<name><surname>Van Der Heijde</surname>
<given-names>D</given-names>
</name>
<name><surname>Landewé</surname>
<given-names>R</given-names>
</name>
<name><surname>Akkoc</surname>
<given-names>N</given-names>
</name>
<name><surname>Brandt</surname>
<given-names>J</given-names>
</name>
<name><surname>Chou</surname>
<given-names>CT</given-names>
</name>
<name><surname>Dougados</surname>
<given-names>M</given-names>
</name>
<name><surname>Huang</surname>
<given-names>F</given-names>
</name>
<name><surname>Gu</surname>
<given-names>J</given-names>
</name>
<name><surname>Kirazli</surname>
<given-names>Y</given-names>
</name>
<name><surname>Van den Bosch</surname>
<given-names>F</given-names>
</name>
<name><surname>Olivieri</surname>
<given-names>I</given-names>
</name>
<name><surname>Roussou</surname>
<given-names>E</given-names>
</name>
<name><surname>Scarpato</surname>
<given-names>S</given-names>
</name>
<name><surname>Sørensen</surname>
<given-names>IJ</given-names>
</name>
<name><surname>Valle-Oñate</surname>
<given-names>R</given-names>
</name>
<name><surname>Weber</surname>
<given-names>U</given-names>
</name>
<name><surname>Wei</surname>
<given-names>J</given-names>
</name>
<name><surname>Sieper</surname>
<given-names>J</given-names>
</name>
</person-group>
<year>2010</year>
<article-title>The Assessment of SpondyloArthritis international Society classification criteria for peripheral spondyloarthritis and for spondyloarthritis in general</article-title>
<source>Annals of the Rheumatic Diseases</source>
<volume>70</volume>
<issue>1</issue>
<fpage>1</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="doi">10.1136/ard.2010.133645</pub-id>
</element-citation>
</ref>
<ref id="ref-34"><label>Rudwaleit et al. (2009)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rudwaleit</surname>
<given-names>M</given-names>
</name>
<name><surname>Van Der Heijde</surname>
<given-names>D</given-names>
</name>
<name><surname>Landewé</surname>
<given-names>R</given-names>
</name>
<name><surname>Listing</surname>
<given-names>J</given-names>
</name>
<name><surname>Akkoc</surname>
<given-names>N</given-names>
</name>
<name><surname>Brandt</surname>
<given-names>J</given-names>
</name>
<name><surname>Braun</surname>
<given-names>J</given-names>
</name>
<name><surname>Chou</surname>
<given-names>CT</given-names>
</name>
<name><surname>Collantes-Estevez</surname>
<given-names>E</given-names>
</name>
<name><surname>Dougados</surname>
<given-names>M</given-names>
</name>
<name><surname>Huang</surname>
<given-names>F</given-names>
</name>
<name><surname>Gu</surname>
<given-names>J</given-names>
</name>
<name><surname>Khan</surname>
<given-names>MA</given-names>
</name>
<name><surname>Kirazli</surname>
<given-names>Y</given-names>
</name>
<name><surname>Maksymowych</surname>
<given-names>WP</given-names>
</name>
<name><surname>Mielants</surname>
<given-names>H</given-names>
</name>
<name><surname>Sørensen</surname>
<given-names>IJ</given-names>
</name>
<name><surname>Ozgocmen</surname>
<given-names>S</given-names>
</name>
<name><surname>Roussou</surname>
<given-names>E</given-names>
</name>
<name><surname>Valle-Oñate</surname>
<given-names>R</given-names>
</name>
<name><surname>Weber</surname>
<given-names>U</given-names>
</name>
<name><surname>Wei</surname>
<given-names>J</given-names>
</name>
<name><surname>Sieper</surname>
<given-names>J</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>The development of Assessment of SpondyloArthritis international Society classification criteria for axial spondyloarthritis (part II): validation and final selection</article-title>
<source>Annals of the Rheumatic Diseases</source>
<volume>68</volume>
<issue>6</issue>
<fpage>777</fpage>
<lpage>783</lpage>
<pub-id pub-id-type="doi">10.1136/ard.2009.108233</pub-id>
<pub-id pub-id-type="pmid">19297344</pub-id>
</element-citation>
</ref>
<ref id="ref-35"><label>Savage et al. (2009)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Savage</surname>
<given-names>A</given-names>
</name>
<name><surname>Eaton</surname>
<given-names>KA</given-names>
</name>
<name><surname>Moles</surname>
<given-names>DR</given-names>
</name>
<name><surname>Needleman</surname>
<given-names>I</given-names>
</name>
</person-group>
<year>2009</year>
<article-title>A systematic review of definitions of periodontitis and methods that have been used to identify this disease</article-title>
<source>Journal of Clinical Periodontology</source>
<volume>36</volume>
<issue>6</issue>
<fpage>458</fpage>
<lpage>467</lpage>
<pub-id pub-id-type="doi">10.1111/j.1600-051X.2009.01408.x</pub-id>
<pub-id pub-id-type="pmid">19508246</pub-id>
</element-citation>
</ref>
<ref id="ref-36"><label>Scher et al. (2012)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Scher</surname>
<given-names>JU</given-names>
</name>
<name><surname>Ubeda</surname>
<given-names>C</given-names>
</name>
<name><surname>Equinda</surname>
<given-names>M</given-names>
</name>
<name><surname>Khanin</surname>
<given-names>R</given-names>
</name>
<name><surname>Buischi</surname>
<given-names>Y</given-names>
</name>
<name><surname>Viale</surname>
<given-names>A</given-names>
</name>
<name><surname>Lipuma</surname>
<given-names>L</given-names>
</name>
<name><surname>Attur</surname>
<given-names>M</given-names>
</name>
<name><surname>Pillinger</surname>
<given-names>MH</given-names>
</name>
<name><surname>Weissmann</surname>
<given-names>G</given-names>
</name>
<name><surname>Littman</surname>
<given-names>DR</given-names>
</name>
<name><surname>Pamer</surname>
<given-names>EG</given-names>
</name>
<name><surname>Bretz</surname>
<given-names>WA</given-names>
</name>
<name><surname>Abramson</surname>
<given-names>SB</given-names>
</name>
</person-group>
<year>2012</year>
<article-title>Periodontal disease and the oral microbiota in new-onset rheumatoid arthritis</article-title>
<source>Arthritis & Rheumatism</source>
<volume>64</volume>
<issue>10</issue>
<fpage>3083</fpage>
<lpage>3094</lpage>
<pub-id pub-id-type="doi">10.1002/art.34539</pub-id>
<pub-id pub-id-type="pmid">22576262</pub-id>
</element-citation>
</ref>
<ref id="ref-37"><label>Seymour et al. (2007)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seymour</surname>
<given-names>GJ</given-names>
</name>
<name><surname>Ford</surname>
<given-names>PJ</given-names>
</name>
<name><surname>Cullinan</surname>
<given-names>MP</given-names>
</name>
<name><surname>Leishman</surname>
<given-names>S</given-names>
</name>
<name><surname>Yamazaki</surname>
<given-names>K</given-names>
</name>
</person-group>
<year>2007</year>
<article-title>Relationship between periodontal infections and systemic disease</article-title>
<source>Clinical Microbiology and Infection</source>
<volume>13</volume>
<issue>s4</issue>
<fpage>3</fpage>
<lpage>10</lpage>
<pub-id pub-id-type="doi">10.1111/j.1469-0691.2007.01798.x</pub-id>
<pub-id pub-id-type="pmid">17716290</pub-id>
</element-citation>
</ref>
<ref id="ref-38"><label>Seymour et al. (1988)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seymour</surname>
<given-names>GJ</given-names>
</name>
<name><surname>Gemmell</surname>
<given-names>E</given-names>
</name>
<name><surname>Walsh</surname>
<given-names>RN</given-names>
</name>
<name><surname>Powell</surname>
<given-names>N</given-names>
</name>
</person-group>
<year>1988</year>
<article-title>Immunohistological analysis of experimental gingivitis in humans</article-title>
<source>Clinical and Experimental Immunology</source>
<volume>71</volume>
<fpage>132</fpage>
<lpage>137</lpage>
<pub-id pub-id-type="pmid">3280178</pub-id>
</element-citation>
</ref>
<ref id="ref-39"><label>Silness & Löe (1964)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Silness</surname>
<given-names>J</given-names>
</name>
<name><surname>Löe</surname>
<given-names>H</given-names>
</name>
</person-group>
<year>1964</year>
<article-title>Periodontal disease in pregnancy II. Correlation between oral hygiene and periodontal condition</article-title>
<source>Acta Odontologica Scandinavica</source>
<volume>22</volume>
<fpage>121</fpage>
<lpage>135</lpage>
<pub-id pub-id-type="doi">10.3109/00016356408993968</pub-id>
<pub-id pub-id-type="pmid">14158464</pub-id>
</element-citation>
</ref>
<ref id="ref-40"><label>Taurog et al. (1994)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Taurog</surname>
<given-names>JD</given-names>
</name>
<name><surname>Richardson</surname>
<given-names>JA</given-names>
</name>
<name><surname>Croft</surname>
<given-names>JT</given-names>
</name>
<name><surname>Simmons</surname>
<given-names>WA</given-names>
</name>
<name><surname>Zhou</surname>
<given-names>M</given-names>
</name>
<name><surname>Fernández-Sueiro</surname>
<given-names>JL</given-names>
</name>
<name><surname>Balish</surname>
<given-names>E</given-names>
</name>
<name><surname>Hammer</surname>
<given-names>RE</given-names>
</name>
</person-group>
<year>1994</year>
<article-title>The germfree state prevents development of gut and joint inflammatory disease in HLA-B27 transgenic rats</article-title>
<source>The Journal of Experimental Medicine</source>
<volume>180</volume>
<issue>6</issue>
<fpage>2359</fpage>
<lpage>2364</lpage>
<pub-id pub-id-type="doi">10.1084/jem.180.6.2359</pub-id>
<pub-id pub-id-type="pmid">7964509</pub-id>
</element-citation>
</ref>
<ref id="ref-41"><label>Van der Horst-Bruinsma (2013)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Van der Horst-Bruinsma</surname>
<given-names>IE</given-names>
</name>
</person-group>
<year>2013</year>
<article-title>Treatment of non-radiographic axial spondyloarthritis: it is only the beginning</article-title>
<source>Annals of the Rheumatic Diseases</source>
<volume>72</volume>
<issue>6</issue>
<fpage>789</fpage>
<lpage>790</lpage>
<pub-id pub-id-type="doi">10.1136/annrheumdis-2012-202908</pub-id>
<pub-id pub-id-type="pmid">23667168</pub-id>
</element-citation>
</ref>
<ref id="ref-42"><label>Van der Linden, Valkenburg & Cats (1984)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Van der Linden</surname>
<given-names>S</given-names>
</name>
<name><surname>Valkenburg</surname>
<given-names>HA</given-names>
</name>
<name><surname>Cats</surname>
<given-names>A</given-names>
</name>
</person-group>
<year>1984</year>
<article-title>Evaluation of diagnostic criteria for ankylosing spondylitis. A proposal for modification of the New York criteria</article-title>
<source>Arthritis & Rheumatism</source>
<volume>27</volume>
<issue>4</issue>
<fpage>361</fpage>
<lpage>368</lpage>
<pub-id pub-id-type="doi">10.1002/art.1780270401</pub-id>
<pub-id pub-id-type="pmid">6231933</pub-id>
</element-citation>
</ref>
<ref id="ref-43"><label>Yeoh et al. (2013)</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yeoh</surname>
<given-names>N</given-names>
</name>
<name><surname>Burton</surname>
<given-names>JP</given-names>
</name>
<name><surname>Suppiah</surname>
<given-names>P</given-names>
</name>
<name><surname>Reid</surname>
<given-names>G</given-names>
</name>
<name><surname>Stebbings</surname>
<given-names>S</given-names>
</name>
</person-group>
<year>2013</year>
<article-title>The role of the microbiome in rheumatic diseases</article-title>
<source>Current Rheumatology Reports</source>
<volume>15</volume>
<comment>Article 314</comment>
<issue>3</issue>
<pub-id pub-id-type="doi">10.1007/s11926-012-0314-y</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Santé/explor/EdenteV2/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000766 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000766 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Santé |area= EdenteV2 |flux= Pmc |étape= Corpus |type= RBID |clé= |texte= }}
![]() | This area was generated with Dilib version V0.6.32. | ![]() |