Serveur d'exploration sur le patient édenté

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Immobilization of chitosan film containing semaphorin 3A onto a microarc oxidized titanium implant surface via silane reaction to improve MG63 osteogenic differentiation

Identifieur interne : 001420 ( Pmc/Checkpoint ); précédent : 001419; suivant : 001421

Immobilization of chitosan film containing semaphorin 3A onto a microarc oxidized titanium implant surface via silane reaction to improve MG63 osteogenic differentiation

Auteurs : Kaixiu Fang [République populaire de Chine] ; Wen Song [République populaire de Chine] ; Lifeng Wang [République populaire de Chine] ; Sen Jia [République populaire de Chine] ; Hongbo Wei [République populaire de Chine] ; Shuai Ren [République populaire de Chine] ; Xiaoru Xu [République populaire de Chine] ; Yingliang Song [République populaire de Chine]

Source :

RBID : PMC:4200022

Abstract

Improving osseointegration of extensively used titanium (Ti) implants still remains a main theme in implantology. Recently, grafting biomolecules onto a Ti surface has attracted more attention due to their direct participation in the osseointegration process around the implant. Semaphorin 3A (Sema3A) is a new proven osteoprotection molecule and is considered to be a promising therapeutic agent in bone diseases, but how to immobilize the protein onto a Ti surface to acquire a long-term effect is poorly defined. In our study, we tried to use chitosan to wrap Sema3A (CS/Sema) and connect to the microarc oxidized Ti surface via silane glutaraldehyde coupling. The microarc oxidization could formulate porous topography on a Ti surface, and the covalently bonded coating was homogeneously covered on the ridges between the pores without significant influence on the original topography. A burst release of Sema3A was observed in the first few days in phosphate-buffered saline and could be maintained for >2 weeks. Coating in phosphate-buffered saline containing lysozyme was similar, but the release rate was much more rapid. The coating did not significantly affect cellular adhesion, viability, or cytoskeleton arrangement, but the osteogenic-related gene expression was dramatically increased and calcium deposition was also abundantly detected. In conclusion, covalent bonding of CS/Sema could strongly improve osteogenic differentiation of osteoblasts and might be applied for Ti implant surface biofunctionalization.


Url:
DOI: 10.2147/IJN.S68895
PubMed: 25336945
PubMed Central: 4200022


Affiliations:


Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:4200022

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Immobilization of chitosan film containing semaphorin 3A onto a microarc oxidized titanium implant surface via silane reaction to improve MG63 osteogenic differentiation</title>
<author>
<name sortKey="Fang, Kaixiu" sort="Fang, Kaixiu" uniqKey="Fang K" first="Kaixiu" last="Fang">Kaixiu Fang</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Song, Wen" sort="Song, Wen" uniqKey="Song W" first="Wen" last="Song">Wen Song</name>
<affiliation wicri:level="1">
<nlm:aff id="af2-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Wang, Lifeng" sort="Wang, Lifeng" uniqKey="Wang L" first="Lifeng" last="Wang">Lifeng Wang</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Jia, Sen" sort="Jia, Sen" uniqKey="Jia S" first="Sen" last="Jia">Sen Jia</name>
<affiliation wicri:level="1">
<nlm:aff id="af3-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Oral and Maxillofacial Surgery, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Oral and Maxillofacial Surgery, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Wei, Hongbo" sort="Wei, Hongbo" uniqKey="Wei H" first="Hongbo" last="Wei">Hongbo Wei</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Ren, Shuai" sort="Ren, Shuai" uniqKey="Ren S" first="Shuai" last="Ren">Shuai Ren</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Xu, Xiaoru" sort="Xu, Xiaoru" uniqKey="Xu X" first="Xiaoru" last="Xu">Xiaoru Xu</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Song, Yingliang" sort="Song, Yingliang" uniqKey="Song Y" first="Yingliang" last="Song">Yingliang Song</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">25336945</idno>
<idno type="pmc">4200022</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4200022</idno>
<idno type="RBID">PMC:4200022</idno>
<idno type="doi">10.2147/IJN.S68895</idno>
<date when="2014">2014</date>
<idno type="wicri:Area/Pmc/Corpus">002E43</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">002E43</idno>
<idno type="wicri:Area/Pmc/Curation">002E43</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">002E43</idno>
<idno type="wicri:Area/Pmc/Checkpoint">001420</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">001420</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Immobilization of chitosan film containing semaphorin 3A onto a microarc oxidized titanium implant surface via silane reaction to improve MG63 osteogenic differentiation</title>
<author>
<name sortKey="Fang, Kaixiu" sort="Fang, Kaixiu" uniqKey="Fang K" first="Kaixiu" last="Fang">Kaixiu Fang</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Song, Wen" sort="Song, Wen" uniqKey="Song W" first="Wen" last="Song">Wen Song</name>
<affiliation wicri:level="1">
<nlm:aff id="af2-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Wang, Lifeng" sort="Wang, Lifeng" uniqKey="Wang L" first="Lifeng" last="Wang">Lifeng Wang</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Jia, Sen" sort="Jia, Sen" uniqKey="Jia S" first="Sen" last="Jia">Sen Jia</name>
<affiliation wicri:level="1">
<nlm:aff id="af3-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Oral and Maxillofacial Surgery, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Oral and Maxillofacial Surgery, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Wei, Hongbo" sort="Wei, Hongbo" uniqKey="Wei H" first="Hongbo" last="Wei">Hongbo Wei</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Ren, Shuai" sort="Ren, Shuai" uniqKey="Ren S" first="Shuai" last="Ren">Shuai Ren</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Xu, Xiaoru" sort="Xu, Xiaoru" uniqKey="Xu X" first="Xiaoru" last="Xu">Xiaoru Xu</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Song, Yingliang" sort="Song, Yingliang" uniqKey="Song Y" first="Yingliang" last="Song">Yingliang Song</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-ijn-9-4649">State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
</analytic>
<series>
<title level="j">International Journal of Nanomedicine</title>
<idno type="ISSN">1176-9114</idno>
<idno type="eISSN">1178-2013</idno>
<imprint>
<date when="2014">2014</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Improving osseointegration of extensively used titanium (Ti) implants still remains a main theme in implantology. Recently, grafting biomolecules onto a Ti surface has attracted more attention due to their direct participation in the osseointegration process around the implant. Semaphorin 3A (Sema3A) is a new proven osteoprotection molecule and is considered to be a promising therapeutic agent in bone diseases, but how to immobilize the protein onto a Ti surface to acquire a long-term effect is poorly defined. In our study, we tried to use chitosan to wrap Sema3A (CS/Sema) and connect to the microarc oxidized Ti surface via silane glutaraldehyde coupling. The microarc oxidization could formulate porous topography on a Ti surface, and the covalently bonded coating was homogeneously covered on the ridges between the pores without significant influence on the original topography. A burst release of Sema3A was observed in the first few days in phosphate-buffered saline and could be maintained for >2 weeks. Coating in phosphate-buffered saline containing lysozyme was similar, but the release rate was much more rapid. The coating did not significantly affect cellular adhesion, viability, or cytoskeleton arrangement, but the osteogenic-related gene expression was dramatically increased and calcium deposition was also abundantly detected. In conclusion, covalent bonding of CS/Sema could strongly improve osteogenic differentiation of osteoblasts and might be applied for Ti implant surface biofunctionalization.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Elias, Cn" uniqKey="Elias C">CN Elias</name>
</author>
<author>
<name sortKey="Lima, Jhc" uniqKey="Lima J">JHC Lima</name>
</author>
<author>
<name sortKey="Valiev, R" uniqKey="Valiev R">R Valiev</name>
</author>
<author>
<name sortKey="Meyers, Ma" uniqKey="Meyers M">MA Meyers</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Buser, D" uniqKey="Buser D">D Buser</name>
</author>
<author>
<name sortKey="Janner, Sf" uniqKey="Janner S">SF Janner</name>
</author>
<author>
<name sortKey="Wittneben, Jg" uniqKey="Wittneben J">JG Wittneben</name>
</author>
<author>
<name sortKey="Bragger, U" uniqKey="Bragger U">U Bragger</name>
</author>
<author>
<name sortKey="Ramseier, Ca" uniqKey="Ramseier C">CA Ramseier</name>
</author>
<author>
<name sortKey="Salvi, Ge" uniqKey="Salvi G">GE Salvi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhou, X" uniqKey="Zhou X">X Zhou</name>
</author>
<author>
<name sortKey="Zhang, P" uniqKey="Zhang P">P Zhang</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C Zhang</name>
</author>
<author>
<name sortKey="Zhu, Z" uniqKey="Zhu Z">Z Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, W" uniqKey="Zhang W">W Zhang</name>
</author>
<author>
<name sortKey="Li, Z" uniqKey="Li Z">Z Li</name>
</author>
<author>
<name sortKey="Huang, Q" uniqKey="Huang Q">Q Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author>
<name sortKey="Feng, G" uniqKey="Feng G">G Feng</name>
</author>
<author>
<name sortKey="Gao, Y" uniqKey="Gao Y">Y Gao</name>
</author>
<author>
<name sortKey="Luo, E" uniqKey="Luo E">E Luo</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X Liu</name>
</author>
<author>
<name sortKey="Hu, J" uniqKey="Hu J">J Hu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, Ti" uniqKey="Kim T">TI Kim</name>
</author>
<author>
<name sortKey="Jang, Jh" uniqKey="Jang J">JH Jang</name>
</author>
<author>
<name sortKey="Kim, Hw" uniqKey="Kim H">HW Kim</name>
</author>
<author>
<name sortKey="Knowles, Jc" uniqKey="Knowles J">JC Knowles</name>
</author>
<author>
<name sortKey="Ku, Y" uniqKey="Ku Y">Y Ku</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Morra, M" uniqKey="Morra M">M Morra</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, T I" uniqKey="Kim T">T-I Kim</name>
</author>
<author>
<name sortKey="Lee, G" uniqKey="Lee G">G Lee</name>
</author>
<author>
<name sortKey="Jang, J H" uniqKey="Jang J">J-H Jang</name>
</author>
<author>
<name sortKey="Chung, C P" uniqKey="Chung C">C-P Chung</name>
</author>
<author>
<name sortKey="Ku, Y" uniqKey="Ku Y">Y Ku</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, F" uniqKey="Wang F">F Wang</name>
</author>
<author>
<name sortKey="Song, Yl" uniqKey="Song Y">YL Song</name>
</author>
<author>
<name sortKey="Li, Cx" uniqKey="Li C">CX Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y Liu</name>
</author>
<author>
<name sortKey="Enggist, L" uniqKey="Enggist L">L Enggist</name>
</author>
<author>
<name sortKey="Kuffer, Af" uniqKey="Kuffer A">AF Kuffer</name>
</author>
<author>
<name sortKey="Buser, D" uniqKey="Buser D">D Buser</name>
</author>
<author>
<name sortKey="Hunziker, Eb" uniqKey="Hunziker E">EB Hunziker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shimono, K" uniqKey="Shimono K">K Shimono</name>
</author>
<author>
<name sortKey="Oshima, M" uniqKey="Oshima M">M Oshima</name>
</author>
<author>
<name sortKey="Arakawa, H" uniqKey="Arakawa H">H Arakawa</name>
</author>
<author>
<name sortKey="Kimura, A" uniqKey="Kimura A">A Kimura</name>
</author>
<author>
<name sortKey="Nawachi, K" uniqKey="Nawachi K">K Nawachi</name>
</author>
<author>
<name sortKey="Kuboki, T" uniqKey="Kuboki T">T Kuboki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fukuda, T" uniqKey="Fukuda T">T Fukuda</name>
</author>
<author>
<name sortKey="Takeda, S" uniqKey="Takeda S">S Takeda</name>
</author>
<author>
<name sortKey="Xu, R" uniqKey="Xu R">R Xu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hayashi, M" uniqKey="Hayashi M">M Hayashi</name>
</author>
<author>
<name sortKey="Nakashima, T" uniqKey="Nakashima T">T Nakashima</name>
</author>
<author>
<name sortKey="Taniguchi, M" uniqKey="Taniguchi M">M Taniguchi</name>
</author>
<author>
<name sortKey="Kodama, T" uniqKey="Kodama T">T Kodama</name>
</author>
<author>
<name sortKey="Kumanogoh, A" uniqKey="Kumanogoh A">A Kumanogoh</name>
</author>
<author>
<name sortKey="Takayanagi, H" uniqKey="Takayanagi H">H Takayanagi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rudzinski, We" uniqKey="Rudzinski W">WE Rudzinski</name>
</author>
<author>
<name sortKey="Aminabhavi, Tm" uniqKey="Aminabhavi T">TM Aminabhavi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abarrategi, A" uniqKey="Abarrategi A">A Abarrategi</name>
</author>
<author>
<name sortKey="Civantos, A" uniqKey="Civantos A">A Civantos</name>
</author>
<author>
<name sortKey="Ramos, V" uniqKey="Ramos V">V Ramos</name>
</author>
<author>
<name sortKey="Sanz Casado, Jv" uniqKey="Sanz Casado J">JV Sanz Casado</name>
</author>
<author>
<name sortKey="L Pez Lacomba, Jl" uniqKey="L Pez Lacomba J">JL López-Lacomba</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Renoud, P" uniqKey="Renoud P">P Renoud</name>
</author>
<author>
<name sortKey="Toury, B" uniqKey="Toury B">B Toury</name>
</author>
<author>
<name sortKey="Benayoun, S" uniqKey="Benayoun S">S Benayoun</name>
</author>
<author>
<name sortKey="Attik, G" uniqKey="Attik G">G Attik</name>
</author>
<author>
<name sortKey="Grosgogeat, B" uniqKey="Grosgogeat B">B Grosgogeat</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Norowski, Pa" uniqKey="Norowski P">PA Norowski</name>
</author>
<author>
<name sortKey="Courtney, Hs" uniqKey="Courtney H">HS Courtney</name>
</author>
<author>
<name sortKey="Babu, J" uniqKey="Babu J">J Babu</name>
</author>
<author>
<name sortKey="Haggard, Wo" uniqKey="Haggard W">WO Haggard</name>
</author>
<author>
<name sortKey="Bumgardner, Jd" uniqKey="Bumgardner J">JD Bumgardner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Swanson, Te" uniqKey="Swanson T">TE Swanson</name>
</author>
<author>
<name sortKey="Cheng, X" uniqKey="Cheng X">X Cheng</name>
</author>
<author>
<name sortKey="Friedrich, C" uniqKey="Friedrich C">C Friedrich</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Huang, P" uniqKey="Huang P">P Huang</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author>
<name sortKey="Xu, K" uniqKey="Xu K">K Xu</name>
</author>
<author>
<name sortKey="Han, Y" uniqKey="Han Y">Y Han</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Han, Y" uniqKey="Han Y">Y Han</name>
</author>
<author>
<name sortKey="Chen, D" uniqKey="Chen D">D Chen</name>
</author>
<author>
<name sortKey="Sun, J" uniqKey="Sun J">J Sun</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author>
<name sortKey="Xu, K" uniqKey="Xu K">K Xu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Song, W" uniqKey="Song W">W Song</name>
</author>
<author>
<name sortKey="Wu, K" uniqKey="Wu K">K Wu</name>
</author>
<author>
<name sortKey="Yan, J" uniqKey="Yan J">J Yan</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author>
<name sortKey="Zhao, L" uniqKey="Zhao L">L Zhao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhao, L" uniqKey="Zhao L">L Zhao</name>
</author>
<author>
<name sortKey="Mei, S" uniqKey="Mei S">S Mei</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
<author>
<name sortKey="Chu, Pk" uniqKey="Chu P">PK Chu</name>
</author>
<author>
<name sortKey="Wu, Z" uniqKey="Wu Z">Z Wu</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
<author>
<name sortKey="Zhao, L" uniqKey="Zhao L">L Zhao</name>
</author>
<author>
<name sortKey="Ma, Q" uniqKey="Ma Q">Q Ma</name>
</author>
<author>
<name sortKey="Wang, Q" uniqKey="Wang Q">Q Wang</name>
</author>
<author>
<name sortKey="Chu, Pk" uniqKey="Chu P">PK Chu</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dunleavy, Cs" uniqKey="Dunleavy C">CS Dunleavy</name>
</author>
<author>
<name sortKey="Golosnoy, Io" uniqKey="Golosnoy I">IO Golosnoy</name>
</author>
<author>
<name sortKey="Curran, Ja" uniqKey="Curran J">JA Curran</name>
</author>
<author>
<name sortKey="Clyne, Tw" uniqKey="Clyne T">TW Clyne</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author>
<name sortKey="Xi, Z" uniqKey="Xi Z">Z Xi</name>
</author>
<author>
<name sortKey="Liu, Z" uniqKey="Liu Z">Z Liu</name>
</author>
<author>
<name sortKey="Yang, L" uniqKey="Yang L">L Yang</name>
</author>
<author>
<name sortKey="Cao, Y" uniqKey="Cao Y">Y Cao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yuan, Y" uniqKey="Yuan Y">Y Yuan</name>
</author>
<author>
<name sortKey="Chesnutt, Bm" uniqKey="Chesnutt B">BM Chesnutt</name>
</author>
<author>
<name sortKey="Wright, L" uniqKey="Wright L">L Wright</name>
</author>
<author>
<name sortKey="Haggard, Wo" uniqKey="Haggard W">WO Haggard</name>
</author>
<author>
<name sortKey="Bumgardner, Jd" uniqKey="Bumgardner J">JD Bumgardner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cust Dio, Ca" uniqKey="Cust Dio C">CA Custódio</name>
</author>
<author>
<name sortKey="Alves, Cm" uniqKey="Alves C">CM Alves</name>
</author>
<author>
<name sortKey="Reis, Rl" uniqKey="Reis R">RL Reis</name>
</author>
<author>
<name sortKey="Mano, Jf" uniqKey="Mano J">JF Mano</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hamilton, V" uniqKey="Hamilton V">V Hamilton</name>
</author>
<author>
<name sortKey="Yuan, Y" uniqKey="Yuan Y">Y Yuan</name>
</author>
<author>
<name sortKey="Rigney, Da" uniqKey="Rigney D">DA Rigney</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tran, Ts" uniqKey="Tran T">TS Tran</name>
</author>
<author>
<name sortKey="Kolodkin, Al" uniqKey="Kolodkin A">AL Kolodkin</name>
</author>
<author>
<name sortKey="Bharadwaj, R" uniqKey="Bharadwaj R">R Bharadwaj</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lepelletier, Y" uniqKey="Lepelletier Y">Y Lepelletier</name>
</author>
<author>
<name sortKey="Moura, Ic" uniqKey="Moura I">IC Moura</name>
</author>
<author>
<name sortKey="Hadj Slimane, R" uniqKey="Hadj Slimane R">R Hadj-Slimane</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Int J Nanomedicine</journal-id>
<journal-id journal-id-type="iso-abbrev">Int J Nanomedicine</journal-id>
<journal-id journal-id-type="publisher-id">International Journal of Nanomedicine</journal-id>
<journal-title-group>
<journal-title>International Journal of Nanomedicine</journal-title>
</journal-title-group>
<issn pub-type="ppub">1176-9114</issn>
<issn pub-type="epub">1178-2013</issn>
<publisher>
<publisher-name>Dove Medical Press</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">25336945</article-id>
<article-id pub-id-type="pmc">4200022</article-id>
<article-id pub-id-type="doi">10.2147/IJN.S68895</article-id>
<article-id pub-id-type="publisher-id">ijn-9-4649</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Immobilization of chitosan film containing semaphorin 3A onto a microarc oxidized titanium implant surface via silane reaction to improve MG63 osteogenic differentiation</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Fang</surname>
<given-names>Kaixiu</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-9-4649">1</xref>
<xref ref-type="author-notes" rid="fn1-ijn-9-4649">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Song</surname>
<given-names>Wen</given-names>
</name>
<xref ref-type="aff" rid="af2-ijn-9-4649">2</xref>
<xref ref-type="author-notes" rid="fn1-ijn-9-4649">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Lifeng</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-9-4649">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jia</surname>
<given-names>Sen</given-names>
</name>
<xref ref-type="aff" rid="af3-ijn-9-4649">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wei</surname>
<given-names>Hongbo</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-9-4649">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ren</surname>
<given-names>Shuai</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-9-4649">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xu</surname>
<given-names>Xiaoru</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-9-4649">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Song</surname>
<given-names>Yingliang</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-9-4649">1</xref>
<xref ref-type="corresp" rid="c1-ijn-9-4649"></xref>
</contrib>
</contrib-group>
<aff id="af1-ijn-9-4649">
<label>1</label>
State Key Laboratory of Military Stomatology, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</aff>
<aff id="af2-ijn-9-4649">
<label>2</label>
State Key Laboratory of Military Stomatology, Department of Prosthetic Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</aff>
<aff id="af3-ijn-9-4649">
<label>3</label>
State Key Laboratory of Military Stomatology, Department of Oral and Maxillofacial Surgery, School of Stomatology, Fourth Military Medical University, Xi’an, People’s Republic of China</aff>
<author-notes>
<corresp id="c1-ijn-9-4649">Correspondence: Yingliang Song, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, 145 West Changle Road, Xi’an 710032, People’s Republic of China, Email
<email>songyingliang@yahoo.com</email>
</corresp>
<fn id="fn1-ijn-9-4649">
<p>*These authors contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="collection">
<year>2014</year>
</pub-date>
<pub-date pub-type="epub">
<day>03</day>
<month>10</month>
<year>2014</year>
</pub-date>
<volume>9</volume>
<fpage>4649</fpage>
<lpage>4657</lpage>
<permissions>
<copyright-statement>© 2014 Fang et al. This work is published by Dove Medical Press Limited, and licensed under Creative Commons Attribution – Non Commercial (unported, v3.0) License</copyright-statement>
<copyright-year>2014</copyright-year>
<license>
<license-p>The full terms of the License are available at
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">http://creativecommons.org/licenses/by-nc/3.0/</ext-link>
. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed.</license-p>
</license>
</permissions>
<abstract>
<p>Improving osseointegration of extensively used titanium (Ti) implants still remains a main theme in implantology. Recently, grafting biomolecules onto a Ti surface has attracted more attention due to their direct participation in the osseointegration process around the implant. Semaphorin 3A (Sema3A) is a new proven osteoprotection molecule and is considered to be a promising therapeutic agent in bone diseases, but how to immobilize the protein onto a Ti surface to acquire a long-term effect is poorly defined. In our study, we tried to use chitosan to wrap Sema3A (CS/Sema) and connect to the microarc oxidized Ti surface via silane glutaraldehyde coupling. The microarc oxidization could formulate porous topography on a Ti surface, and the covalently bonded coating was homogeneously covered on the ridges between the pores without significant influence on the original topography. A burst release of Sema3A was observed in the first few days in phosphate-buffered saline and could be maintained for >2 weeks. Coating in phosphate-buffered saline containing lysozyme was similar, but the release rate was much more rapid. The coating did not significantly affect cellular adhesion, viability, or cytoskeleton arrangement, but the osteogenic-related gene expression was dramatically increased and calcium deposition was also abundantly detected. In conclusion, covalent bonding of CS/Sema could strongly improve osteogenic differentiation of osteoblasts and might be applied for Ti implant surface biofunctionalization.</p>
</abstract>
<kwd-group>
<title>Keywords</title>
<kwd>titanium</kwd>
<kwd>semaphorin 3A</kwd>
<kwd>silane reaction</kwd>
<kwd>microarc oxidation</kwd>
<kwd>osteogenic differentiation</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="f1-ijn-9-4649" position="float">
<label>Figure 1</label>
<caption>
<p>The coating morphology observation by scanning electron microscopy (
<bold>A</bold>
) and water contact angle measurement (
<bold>B</bold>
).</p>
<p>
<bold>Note:</bold>
*
<italic>P</italic>
<0.05 vs MAO.</p>
<p>
<bold>Abbreviations:</bold>
CS/Sema, chitosan–semaphorin 3A; MAO, microarc oxidation.</p>
</caption>
<graphic xlink:href="ijn-9-4649Fig1"></graphic>
</fig>
<fig id="f2-ijn-9-4649" position="float">
<label>Figure 2</label>
<caption>
<p>Accumulated release profile of CS/Sema–MAO in PBS and PBS + lysozyme (
<bold>A</bold>
) and the morphology observation of the substrate after 1 day (
<bold>B1</bold>
), 3 days (
<bold>B2</bold>
), 7 days (
<bold>B3</bold>
), and 14 days (
<bold>B4</bold>
) of dissolution in PBS.</p>
<p>
<bold>Abbreviations:</bold>
CS/Sema, chitosan–semaphorin 3A; MAO, microarc oxidation; PBS, phosphate-buffered saline.</p>
</caption>
<graphic xlink:href="ijn-9-4649Fig2"></graphic>
</fig>
<fig id="f3-ijn-9-4649" position="float">
<label>Figure 3</label>
<caption>
<p>Cell adhesion visualized by 4′,6-diamidino-2-phenylindole staining (
<bold>A</bold>
), scanning electron microscope (
<bold>B</bold>
) and number counts (
<bold>C</bold>
).</p>
<p>
<bold>Notes:</bold>
(
<bold>A</bold>
)(
<bold>a</bold>
) and (
<bold>B</bold>
)(
<bold>a</bold>
): CS/Sema-MAO; (
<bold>A</bold>
)(
<bold>b</bold>
) and (
<bold>B</bold>
)(
<bold>b</bold>
): CS/BSA-MAO; (
<bold>A</bold>
)(
<bold>c</bold>
) and (
<bold>B</bold>
)(
<bold>c</bold>
): CS-MAO; (
<bold>A</bold>
)(
<bold>d</bold>
) and (
<bold>B</bold>
)(
<bold>d</bold>
): MAO.</p>
<p>
<bold>Abbreviations:</bold>
CS/Sema, chitosan–semaphorin 3A; MAO, microarc oxidation; CS/BSA, chitosan-bovine serum albumin.</p>
</caption>
<graphic xlink:href="ijn-9-4649Fig3"></graphic>
</fig>
<fig id="f4-ijn-9-4649" position="float">
<label>Figure 4</label>
<caption>
<p>Cellular viability carried out by 3-(4,5-dimethylthiazol-2yl)-2, 5-diphenyltetrazolium bromide assay.</p>
<p>
<bold>Abbreviations:</bold>
CS/Sema, chitosan–semaphorin 3A; MAO, microarc oxidation; CS/BSA, chitosan-bovine serum albumin.</p>
</caption>
<graphic xlink:href="ijn-9-4649Fig4"></graphic>
</fig>
<fig id="f5-ijn-9-4649" position="float">
<label>Figure 5</label>
<caption>
<p>Cytoskeleton staining by rhodamine phalloidin under confocal laser scanning microscopy observation.</p>
<p>
<bold>Notes:</bold>
A: CS/Sema–MAO; B: CS/BSA–MAO; C: CS–MAO; D: MAO; scale bar =100 μm.</p>
<p>
<bold>Abbreviations:</bold>
CS/Sema, chitosan–semaphorin 3A; MAO, microarc oxidation.</p>
</caption>
<graphic xlink:href="ijn-9-4649Fig5"></graphic>
</fig>
<fig id="f6-ijn-9-4649" position="float">
<label>Figure 6</label>
<caption>
<p>Osteogenic-related gene expression quantified by real-time quantitative polymerase chain reaction after osteogenic induction of 3 days (
<bold>A</bold>
) and 7 days (
<bold>B</bold>
). The relative protein level after 3 days of culture was analyzed with Western blot (
<bold>C</bold>
).</p>
<p>
<bold>Notes:</bold>
*
<italic>P</italic>
<0.05 vs CS/BSA–MAO, CS–MAO, and MAO.</p>
<p>
<bold>Abbreviations:</bold>
CS/Sema, chitosan–semaphorin 3A; MAO, microarc oxidation; RUNX2, runt-related transcription factor 2; ALP, alkaline phosphatase; OCN, osteocalcin; BMP, bone morphogenetic protein; CS/BSA, chitosan-bovine serum albumin; mRNA, messenger RNA.</p>
</caption>
<graphic xlink:href="ijn-9-4649Fig6"></graphic>
</fig>
<fig id="f7-ijn-9-4649" position="float">
<label>Figure 7</label>
<caption>
<p>Extracellular matrix mineralization stained by Alizarin Red Solution (
<bold>A</bold>
) and optical density measurement (
<bold>B</bold>
).</p>
<p>
<bold>Notes:</bold>
*
<italic>P</italic>
<0.05 vs CS/BSA–MAO, CS–MAO, and MAO.</p>
<p>
<bold>Abbreviations:</bold>
CS/Sema, chitosan–semaphorin 3A; MAO, microarc oxidation; CS/BSA, chitosan-bovine serum albumin.</p>
</caption>
<graphic xlink:href="ijn-9-4649Fig7"></graphic>
</fig>
<table-wrap id="t1-ijn-9-4649" position="float">
<label>Table 1</label>
<caption>
<p>Primers used for real-time quantitative polymerase chain reaction</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1">Gene</th>
<th align="left" valign="top" rowspan="1" colspan="1">Forward primer sequence (5′-3′)</th>
<th align="left" valign="top" rowspan="1" colspan="1">Reverse primer sequence (5′-3′)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>RUNX2</italic>
</td>
<td align="left" valign="top" rowspan="1" colspan="1">CACTGGCGCTGCAACAAGA</td>
<td align="left" valign="top" rowspan="1" colspan="1">CATTCCGGAGCTCAGCAGAATAA</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>ALP</italic>
</td>
<td align="left" valign="top" rowspan="1" colspan="1">CCTTGTAGCCAGGCCCATTG</td>
<td align="left" valign="top" rowspan="1" colspan="1">GGACCATTCCCACGTCTTCAC</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>OCN</italic>
</td>
<td align="left" valign="top" rowspan="1" colspan="1">CCCAGGCGCTACCTGTATCAA</td>
<td align="left" valign="top" rowspan="1" colspan="1">GGTCAGCCAACTCGTCACAGTC</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>BMP</italic>
</td>
<td align="left" valign="top" rowspan="1" colspan="1">CAACACCGTGCTCAGCTTCC</td>
<td align="left" valign="top" rowspan="1" colspan="1">TTCCCACTCATTTCTGAAAGTTCC</td>
</tr>
<tr>
<td align="left" valign="top" rowspan="1" colspan="1">
<italic>β-actin</italic>
</td>
<td align="left" valign="top" rowspan="1" colspan="1">TGGCACCCAGCACAATGAA</td>
<td align="left" valign="top" rowspan="1" colspan="1">CTAAGTCATAGTCCGCCTAGAAGCA</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="tfn1-ijn-9-4649">
<p>
<bold>Abbreviations:</bold>
RUNX2, runt-related transcription factor 2; ALP, alkaline phosphatase; OCN, osteocalcin; BMP, bone morphogenetic protein.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>République populaire de Chine</li>
</country>
</list>
<tree>
<country name="République populaire de Chine">
<noRegion>
<name sortKey="Fang, Kaixiu" sort="Fang, Kaixiu" uniqKey="Fang K" first="Kaixiu" last="Fang">Kaixiu Fang</name>
</noRegion>
<name sortKey="Jia, Sen" sort="Jia, Sen" uniqKey="Jia S" first="Sen" last="Jia">Sen Jia</name>
<name sortKey="Ren, Shuai" sort="Ren, Shuai" uniqKey="Ren S" first="Shuai" last="Ren">Shuai Ren</name>
<name sortKey="Song, Wen" sort="Song, Wen" uniqKey="Song W" first="Wen" last="Song">Wen Song</name>
<name sortKey="Song, Yingliang" sort="Song, Yingliang" uniqKey="Song Y" first="Yingliang" last="Song">Yingliang Song</name>
<name sortKey="Wang, Lifeng" sort="Wang, Lifeng" uniqKey="Wang L" first="Lifeng" last="Wang">Lifeng Wang</name>
<name sortKey="Wei, Hongbo" sort="Wei, Hongbo" uniqKey="Wei H" first="Hongbo" last="Wei">Hongbo Wei</name>
<name sortKey="Xu, Xiaoru" sort="Xu, Xiaoru" uniqKey="Xu X" first="Xiaoru" last="Xu">Xiaoru Xu</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Santé/explor/EdenteV2/Data/Pmc/Checkpoint
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 001420 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd -nk 001420 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Santé
   |area=    EdenteV2
   |flux=    Pmc
   |étape=   Checkpoint
   |type=    RBID
   |clé=     PMC:4200022
   |texte=   Immobilization of chitosan film containing semaphorin 3A onto a microarc oxidized titanium implant surface via silane reaction to improve MG63 osteogenic differentiation
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/RBID.i   -Sk "pubmed:25336945" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd   \
       | NlmPubMed2Wicri -a EdenteV2 

Wicri

This area was generated with Dilib version V0.6.32.
Data generation: Thu Nov 30 15:26:48 2017. Site generation: Tue Mar 8 16:36:20 2022