Delivery of antagomiR204-conjugated gold nanoparticles from PLGA sheets and its implication in promoting osseointegration of titanium implant in type 2 diabetes mellitus
Identifieur interne : 000267 ( Pmc/Checkpoint ); précédent : 000266; suivant : 000268Delivery of antagomiR204-conjugated gold nanoparticles from PLGA sheets and its implication in promoting osseointegration of titanium implant in type 2 diabetes mellitus
Auteurs : Xiangwei Liu ; Naiwen Tan ; Yuchao Zhou ; Hongbo Wei ; Shuai Ren ; Fan Yu ; Hui Chen ; Chengming Jia ; Guodong Yang [République populaire de Chine] ; Yingliang SongSource :
- International Journal of Nanomedicine [ 1176-9114 ] ; 2017.
Abstract
Impaired osseointegration of the implant remains the big hurdle for dental implant therapy in diabetic patients. In this study, the authors first identified that miR204 was strikingly highly expressed in the bone mesenchymal stem cells (BMSCs) of diabetic rats. Forced expression of miR204 repressed the osteogenic potential of BMSCs, while inhibition of miR204 significantly increased the osteogenic capacity. Moreover, the miR204 inhibitor was conjugated with gold nanoparticles (AuNP-antagomiR204) and dispersed them in the poly(lactic-co-glycolic acid) (PLGA) solution. The AuNP-antagomiR204 containing PLGA solution was applied for coating the surface of titanium implant. Electron microscope revealed that an ultrathin sheet was formed on the surface of the implant, and the AuNPs were evenly dispersed in the coated PLGA sheet. Cellular experiments revealed that these encapsulated AuNP-antagomiR204 were able to be released from the PLGA sheet and uptaken by adherent BMSCs. In vivo animal study further confirmed that the AuNP-antagomiR204 released from PLGA sheet promoted osseointegration, as revealed by microcomputerized tomography (microCT) reconstruction and histological assay. Taken together, this study established that miR204 misexpression accounted for the deficient osseointegation in diabetes mellitus, while PLGA sheets aided the release of AuNP-antagomiR204, which would be a promising strategy for titanium implant surface functionalization toward better osseointegration.
Url:
DOI: 10.2147/IJN.S124584
PubMed: 29026303
PubMed Central: 5627761
Affiliations:
Links toward previous steps (curation, corpus...)
Links to Exploration step
PMC:5627761Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Delivery of antagomiR204-conjugated gold nanoparticles from PLGA sheets and its implication in promoting osseointegration of titanium implant in type 2 diabetes mellitus</title>
<author><name sortKey="Liu, Xiangwei" sort="Liu, Xiangwei" uniqKey="Liu X" first="Xiangwei" last="Liu">Xiangwei Liu</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Tan, Naiwen" sort="Tan, Naiwen" uniqKey="Tan N" first="Naiwen" last="Tan">Naiwen Tan</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Zhou, Yuchao" sort="Zhou, Yuchao" uniqKey="Zhou Y" first="Yuchao" last="Zhou">Yuchao Zhou</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Wei, Hongbo" sort="Wei, Hongbo" uniqKey="Wei H" first="Hongbo" last="Wei">Hongbo Wei</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Ren, Shuai" sort="Ren, Shuai" uniqKey="Ren S" first="Shuai" last="Ren">Shuai Ren</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Yu, Fan" sort="Yu, Fan" uniqKey="Yu F" first="Fan" last="Yu">Fan Yu</name>
<affiliation><nlm:aff id="af2-ijn-12-7089">Department of Prosthodontics, School of Stomatology</nlm:aff>
<wicri:noCountry code="subfield">School of Stomatology</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Chen, Hui" sort="Chen, Hui" uniqKey="Chen H" first="Hui" last="Chen">Hui Chen</name>
<affiliation><nlm:aff id="af3-ijn-12-7089">Department of Plastic Surgery, Tangdu Hospital</nlm:aff>
<wicri:noCountry code="subfield">Tangdu Hospital</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Jia, Chengming" sort="Jia, Chengming" uniqKey="Jia C" first="Chengming" last="Jia">Chengming Jia</name>
<affiliation><nlm:aff id="af4-ijn-12-7089">Department of Traditional Chinese Medicine, Xijing Hospital</nlm:aff>
<wicri:noCountry code="subfield">Xijing Hospital</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Yang, Guodong" sort="Yang, Guodong" uniqKey="Yang G" first="Guodong" last="Yang">Guodong Yang</name>
<affiliation wicri:level="1"><nlm:aff id="af5-ijn-12-7089">Department of Biochemistry and Molecular Biology, Fourth Military Medical University, Xi’an, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Biochemistry and Molecular Biology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author><name sortKey="Song, Yingliang" sort="Song, Yingliang" uniqKey="Song Y" first="Yingliang" last="Song">Yingliang Song</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">29026303</idno>
<idno type="pmc">5627761</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5627761</idno>
<idno type="RBID">PMC:5627761</idno>
<idno type="doi">10.2147/IJN.S124584</idno>
<date when="2017">2017</date>
<idno type="wicri:Area/Pmc/Corpus">002E48</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">002E48</idno>
<idno type="wicri:Area/Pmc/Curation">002E48</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">002E48</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000267</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000267</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Delivery of antagomiR204-conjugated gold nanoparticles from PLGA sheets and its implication in promoting osseointegration of titanium implant in type 2 diabetes mellitus</title>
<author><name sortKey="Liu, Xiangwei" sort="Liu, Xiangwei" uniqKey="Liu X" first="Xiangwei" last="Liu">Xiangwei Liu</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Tan, Naiwen" sort="Tan, Naiwen" uniqKey="Tan N" first="Naiwen" last="Tan">Naiwen Tan</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Zhou, Yuchao" sort="Zhou, Yuchao" uniqKey="Zhou Y" first="Yuchao" last="Zhou">Yuchao Zhou</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Wei, Hongbo" sort="Wei, Hongbo" uniqKey="Wei H" first="Hongbo" last="Wei">Hongbo Wei</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Ren, Shuai" sort="Ren, Shuai" uniqKey="Ren S" first="Shuai" last="Ren">Shuai Ren</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Yu, Fan" sort="Yu, Fan" uniqKey="Yu F" first="Fan" last="Yu">Fan Yu</name>
<affiliation><nlm:aff id="af2-ijn-12-7089">Department of Prosthodontics, School of Stomatology</nlm:aff>
<wicri:noCountry code="subfield">School of Stomatology</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Chen, Hui" sort="Chen, Hui" uniqKey="Chen H" first="Hui" last="Chen">Hui Chen</name>
<affiliation><nlm:aff id="af3-ijn-12-7089">Department of Plastic Surgery, Tangdu Hospital</nlm:aff>
<wicri:noCountry code="subfield">Tangdu Hospital</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Jia, Chengming" sort="Jia, Chengming" uniqKey="Jia C" first="Chengming" last="Jia">Chengming Jia</name>
<affiliation><nlm:aff id="af4-ijn-12-7089">Department of Traditional Chinese Medicine, Xijing Hospital</nlm:aff>
<wicri:noCountry code="subfield">Xijing Hospital</wicri:noCountry>
</affiliation>
</author>
<author><name sortKey="Yang, Guodong" sort="Yang, Guodong" uniqKey="Yang G" first="Guodong" last="Yang">Guodong Yang</name>
<affiliation wicri:level="1"><nlm:aff id="af5-ijn-12-7089">Department of Biochemistry and Molecular Biology, Fourth Military Medical University, Xi’an, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Biochemistry and Molecular Biology, Fourth Military Medical University, Xi’an</wicri:regionArea>
<wicri:noRegion>Xi’an</wicri:noRegion>
</affiliation>
</author>
<author><name sortKey="Song, Yingliang" sort="Song, Yingliang" uniqKey="Song Y" first="Yingliang" last="Song">Yingliang Song</name>
<affiliation><nlm:aff id="af1-ijn-12-7089">State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</nlm:aff>
<wicri:noCountry code="subfield">Department of Implant Dentistry</wicri:noCountry>
</affiliation>
</author>
</analytic>
<series><title level="j">International Journal of Nanomedicine</title>
<idno type="ISSN">1176-9114</idno>
<idno type="eISSN">1178-2013</idno>
<imprint><date when="2017">2017</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>Impaired osseointegration of the implant remains the big hurdle for dental implant therapy in diabetic patients. In this study, the authors first identified that miR204 was strikingly highly expressed in the bone mesenchymal stem cells (BMSCs) of diabetic rats. Forced expression of miR204 repressed the osteogenic potential of BMSCs, while inhibition of miR204 significantly increased the osteogenic capacity. Moreover, the miR204 inhibitor was conjugated with gold nanoparticles (AuNP-antagomiR204) and dispersed them in the poly(lactic-co-glycolic acid) (PLGA) solution. The AuNP-antagomiR204 containing PLGA solution was applied for coating the surface of titanium implant. Electron microscope revealed that an ultrathin sheet was formed on the surface of the implant, and the AuNPs were evenly dispersed in the coated PLGA sheet. Cellular experiments revealed that these encapsulated AuNP-antagomiR204 were able to be released from the PLGA sheet and uptaken by adherent BMSCs. In vivo animal study further confirmed that the AuNP-antagomiR204 released from PLGA sheet promoted osseointegration, as revealed by microcomputerized tomography (microCT) reconstruction and histological assay. Taken together, this study established that miR204 misexpression accounted for the deficient osseointegation in diabetes mellitus, while PLGA sheets aided the release of AuNP-antagomiR204, which would be a promising strategy for titanium implant surface functionalization toward better osseointegration.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Van Velzen, Fjj" uniqKey="Van Velzen F">FJJ van Velzen</name>
</author>
<author><name sortKey="Ofec, R" uniqKey="Ofec R">R Ofec</name>
</author>
<author><name sortKey="Schulten, Eajm" uniqKey="Schulten E">EAJM Schulten</name>
</author>
<author><name sortKey="Ten Bruggenkate, Cm" uniqKey="Ten Bruggenkate C">CM ten Bruggenkate</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Charyeva, O" uniqKey="Charyeva O">O Charyeva</name>
</author>
<author><name sortKey="Altynbekov, K" uniqKey="Altynbekov K">K Altynbekov</name>
</author>
<author><name sortKey="Zhartybaev, R" uniqKey="Zhartybaev R">R Zhartybaev</name>
</author>
<author><name sortKey="Sabdanaliev, A" uniqKey="Sabdanaliev A">A Sabdanaliev</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Marchand, F" uniqKey="Marchand F">F Marchand</name>
</author>
<author><name sortKey="Raskin, A" uniqKey="Raskin A">A Raskin</name>
</author>
<author><name sortKey="Dionnes Hornes, A" uniqKey="Dionnes Hornes A">A Dionnes-Hornes</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Annibali, S" uniqKey="Annibali S">S Annibali</name>
</author>
<author><name sortKey="Pranno, N" uniqKey="Pranno N">N Pranno</name>
</author>
<author><name sortKey="Cristalli, Mp" uniqKey="Cristalli M">MP Cristalli</name>
</author>
<author><name sortKey="La Monaca, G" uniqKey="La Monaca G">G La Monaca</name>
</author>
<author><name sortKey="Polimeni, A" uniqKey="Polimeni A">A Polimeni</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Yang, W" uniqKey="Yang W">W Yang</name>
</author>
<author><name sortKey="Lu, J" uniqKey="Lu J">J Lu</name>
</author>
<author><name sortKey="Jia, W" uniqKey="Jia W">W Jia</name>
</author>
<author><name sortKey="Zhang, L" uniqKey="Zhang L">L Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Napoli, N" uniqKey="Napoli N">N Napoli</name>
</author>
<author><name sortKey="Chandran, M" uniqKey="Chandran M">M Chandran</name>
</author>
<author><name sortKey="Pierroz, Dd" uniqKey="Pierroz D">DD Pierroz</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Merlotti, D" uniqKey="Merlotti D">D Merlotti</name>
</author>
<author><name sortKey="Gennari, L" uniqKey="Gennari L">L Gennari</name>
</author>
<author><name sortKey="Dotta, F" uniqKey="Dotta F">F Dotta</name>
</author>
<author><name sortKey="Lauro, D" uniqKey="Lauro D">D Lauro</name>
</author>
<author><name sortKey="Nuti, R" uniqKey="Nuti R">R Nuti</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Al Amri, Md" uniqKey="Al Amri M">MD Al Amri</name>
</author>
<author><name sortKey="Abduljabbar, Ts" uniqKey="Abduljabbar T">TS Abduljabbar</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="De Souza Bastos, A" uniqKey="De Souza Bastos A">A de Souza Bastos</name>
</author>
<author><name sortKey="Graves, Dt" uniqKey="Graves D">DT Graves</name>
</author>
<author><name sortKey="De Melo Loureiro, Ap" uniqKey="De Melo Loureiro A">AP de Melo Loureiro</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Smeets, R" uniqKey="Smeets R">R Smeets</name>
</author>
<author><name sortKey="Stadlinger, B" uniqKey="Stadlinger B">B Stadlinger</name>
</author>
<author><name sortKey="Schwarz, F" uniqKey="Schwarz F">F Schwarz</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sammartino, G" uniqKey="Sammartino G">G Sammartino</name>
</author>
<author><name sortKey="Dohan Ehrenfest, Dm" uniqKey="Dohan Ehrenfest D">DM Dohan Ehrenfest</name>
</author>
<author><name sortKey="Shibli, Ja" uniqKey="Shibli J">JA Shibli</name>
</author>
<author><name sortKey="Galindo Moreno, P" uniqKey="Galindo Moreno P">P Galindo-Moreno</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, L" uniqKey="Wang L">L Wang</name>
</author>
<author><name sortKey="Zou, D" uniqKey="Zou D">D Zou</name>
</author>
<author><name sortKey="Zhang, S" uniqKey="Zhang S">S Zhang</name>
</author>
<author><name sortKey="Zhao, J" uniqKey="Zhao J">J Zhao</name>
</author>
<author><name sortKey="Pan, K" uniqKey="Pan K">K Pan</name>
</author>
<author><name sortKey="Huang, Y" uniqKey="Huang Y">Y Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shen, X" uniqKey="Shen X">X Shen</name>
</author>
<author><name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author><name sortKey="Gu, Y" uniqKey="Gu Y">Y Gu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pritchard, Cc" uniqKey="Pritchard C">CC Pritchard</name>
</author>
<author><name sortKey="Cheng, Hh" uniqKey="Cheng H">HH Cheng</name>
</author>
<author><name sortKey="Tewari, M" uniqKey="Tewari M">M Tewari</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jonas, S" uniqKey="Jonas S">S Jonas</name>
</author>
<author><name sortKey="Izaurralde, E" uniqKey="Izaurralde E">E Izaurralde</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Epstein, S" uniqKey="Epstein S">S Epstein</name>
</author>
<author><name sortKey="Defeudis, G" uniqKey="Defeudis G">G Defeudis</name>
</author>
<author><name sortKey="Manfrini, S" uniqKey="Manfrini S">S Manfrini</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Macnabb, C" uniqKey="Macnabb C">C MacNabb</name>
</author>
<author><name sortKey="Patton, D" uniqKey="Patton D">D Patton</name>
</author>
<author><name sortKey="Hayes, Js" uniqKey="Hayes J">JS Hayes</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mafi Golchin, M" uniqKey="Mafi Golchin M">M Mafi Golchin</name>
</author>
<author><name sortKey="Heidari, L" uniqKey="Heidari L">L Heidari</name>
</author>
<author><name sortKey="Ghaderian, Sm" uniqKey="Ghaderian S">SM Ghaderian</name>
</author>
<author><name sortKey="Akhavan Niaki, H" uniqKey="Akhavan Niaki H">H Akhavan-Niaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Huang, J" uniqKey="Huang J">J Huang</name>
</author>
<author><name sortKey="Zhao, L" uniqKey="Zhao L">L Zhao</name>
</author>
<author><name sortKey="Xing, L" uniqKey="Xing L">L Xing</name>
</author>
<author><name sortKey="Chen, D" uniqKey="Chen D">D Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zheng, D" uniqKey="Zheng D">D Zheng</name>
</author>
<author><name sortKey="Giljohann, Da" uniqKey="Giljohann D">DA Giljohann</name>
</author>
<author><name sortKey="Chen, Dl" uniqKey="Chen D">DL Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ribot, J" uniqKey="Ribot J">J Ribot</name>
</author>
<author><name sortKey="Caliaperoumal, G" uniqKey="Caliaperoumal G">G Caliaperoumal</name>
</author>
<author><name sortKey="Paquet, J" uniqKey="Paquet J">J Paquet</name>
</author>
<author><name sortKey="Boisson Vidal, C" uniqKey="Boisson Vidal C">C Boisson-Vidal</name>
</author>
<author><name sortKey="Petite, H" uniqKey="Petite H">H Petite</name>
</author>
<author><name sortKey="Anagnostou, F" uniqKey="Anagnostou F">F Anagnostou</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shin, L" uniqKey="Shin L">L Shin</name>
</author>
<author><name sortKey="Peterson, Da" uniqKey="Peterson D">DA Peterson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Devlin, H" uniqKey="Devlin H">H Devlin</name>
</author>
<author><name sortKey="Garland, H" uniqKey="Garland H">H Garland</name>
</author>
<author><name sortKey="Sloan, P" uniqKey="Sloan P">P Sloan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Taylor, Gw" uniqKey="Taylor G">GW Taylor</name>
</author>
<author><name sortKey="Burt, Ba" uniqKey="Burt B">BA Burt</name>
</author>
<author><name sortKey="Becker, Mp" uniqKey="Becker M">MP Becker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Peng, B" uniqKey="Peng B">B Peng</name>
</author>
<author><name sortKey="Chen, Y" uniqKey="Chen Y">Y Chen</name>
</author>
<author><name sortKey="Leong, Kw" uniqKey="Leong K">KW Leong</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Dole, Ns" uniqKey="Dole N">NS Dole</name>
</author>
<author><name sortKey="Delany, Am" uniqKey="Delany A">AM Delany</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lian, Jb" uniqKey="Lian J">JB Lian</name>
</author>
<author><name sortKey="Stein, Gs" uniqKey="Stein G">GS Stein</name>
</author>
<author><name sortKey="Van Wijnen, Aj" uniqKey="Van Wijnen A">AJ van Wijnen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Park, Mg" uniqKey="Park M">MG Park</name>
</author>
<author><name sortKey="Kim, Js" uniqKey="Kim J">JS Kim</name>
</author>
<author><name sortKey="Park, Sy" uniqKey="Park S">SY Park</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Van Wijnen, Aj" uniqKey="Van Wijnen A">AJ van Wijnen</name>
</author>
<author><name sortKey="Van De Peppel, J" uniqKey="Van De Peppel J">J van de Peppel</name>
</author>
<author><name sortKey="Van Leeuwen, Jp" uniqKey="Van Leeuwen J">JP van Leeuwen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sun, Mg" uniqKey="Sun M">MG Sun</name>
</author>
<author><name sortKey="Zhou, Xy" uniqKey="Zhou X">XY Zhou</name>
</author>
<author><name sortKey="Chen, Ll" uniqKey="Chen L">LL Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ghosh, R" uniqKey="Ghosh R">R Ghosh</name>
</author>
<author><name sortKey="Singh, Lc" uniqKey="Singh L">LC Singh</name>
</author>
<author><name sortKey="Shohet, Jm" uniqKey="Shohet J">JM Shohet</name>
</author>
<author><name sortKey="Gunaratne, Ph" uniqKey="Gunaratne P">PH Gunaratne</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xu, Hp" uniqKey="Xu H">HP Xu</name>
</author>
<author><name sortKey="Li, Zy" uniqKey="Li Z">ZY Li</name>
</author>
<author><name sortKey="Si, J" uniqKey="Si J">J Si</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tominaga, N" uniqKey="Tominaga N">N Tominaga</name>
</author>
<author><name sortKey="Yoshioka, Y" uniqKey="Yoshioka Y">Y Yoshioka</name>
</author>
<author><name sortKey="Ochiya, T" uniqKey="Ochiya T">T Ochiya</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wu, K" uniqKey="Wu K">K Wu</name>
</author>
<author><name sortKey="Song, W" uniqKey="Song W">W Song</name>
</author>
<author><name sortKey="Zhao, L" uniqKey="Zhao L">L Zhao</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author><name sortKey="Wu, G" uniqKey="Wu G">G Wu</name>
</author>
<author><name sortKey="Feng, Z" uniqKey="Feng Z">Z Feng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author><name sortKey="Agarwal, P" uniqKey="Agarwal P">P Agarwal</name>
</author>
<author><name sortKey="Zhao, S" uniqKey="Zhao S">S Zhao</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xu, Y" uniqKey="Xu Y">Y Xu</name>
</author>
<author><name sortKey="Kim, Cs" uniqKey="Kim C">CS Kim</name>
</author>
<author><name sortKey="Saylor, Dm" uniqKey="Saylor D">DM Saylor</name>
</author>
<author><name sortKey="Koo, D" uniqKey="Koo D">D Koo</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">Int J Nanomedicine</journal-id>
<journal-id journal-id-type="iso-abbrev">Int J Nanomedicine</journal-id>
<journal-id journal-id-type="publisher-id">International Journal of Nanomedicine</journal-id>
<journal-title-group><journal-title>International Journal of Nanomedicine</journal-title>
</journal-title-group>
<issn pub-type="ppub">1176-9114</issn>
<issn pub-type="epub">1178-2013</issn>
<publisher><publisher-name>Dove Medical Press</publisher-name>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">29026303</article-id>
<article-id pub-id-type="pmc">5627761</article-id>
<article-id pub-id-type="doi">10.2147/IJN.S124584</article-id>
<article-id pub-id-type="publisher-id">ijn-12-7089</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group><article-title>Delivery of antagomiR204-conjugated gold nanoparticles from PLGA sheets and its implication in promoting osseointegration of titanium implant in type 2 diabetes mellitus</article-title>
</title-group>
<contrib-group><contrib contrib-type="author" equal-contrib="yes"><name><surname>Liu</surname>
<given-names>Xiangwei</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-12-7089">1</xref>
<xref ref-type="author-notes" rid="fn1-ijn-12-7089">*</xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes"><name><surname>Tan</surname>
<given-names>Naiwen</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-12-7089">1</xref>
<xref ref-type="author-notes" rid="fn1-ijn-12-7089">*</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Zhou</surname>
<given-names>Yuchao</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-12-7089">1</xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes"><name><surname>Wei</surname>
<given-names>Hongbo</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-12-7089">1</xref>
<xref ref-type="author-notes" rid="fn1-ijn-12-7089">*</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Ren</surname>
<given-names>Shuai</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-12-7089">1</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Yu</surname>
<given-names>Fan</given-names>
</name>
<xref ref-type="aff" rid="af2-ijn-12-7089">2</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Chen</surname>
<given-names>Hui</given-names>
</name>
<xref ref-type="aff" rid="af3-ijn-12-7089">3</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Jia</surname>
<given-names>Chengming</given-names>
</name>
<xref ref-type="aff" rid="af4-ijn-12-7089">4</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Yang</surname>
<given-names>Guodong</given-names>
</name>
<xref ref-type="aff" rid="af5-ijn-12-7089">5</xref>
<xref ref-type="corresp" rid="c1-ijn-12-7089"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Song</surname>
<given-names>Yingliang</given-names>
</name>
<xref ref-type="aff" rid="af1-ijn-12-7089">1</xref>
<xref ref-type="corresp" rid="c2-ijn-12-7089"></xref>
</contrib>
</contrib-group>
<aff id="af1-ijn-12-7089"><label>1</label>
State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Engineering Research Center for Dental Materials and Advanced Manufacture, Department of Implant Dentistry</aff>
<aff id="af2-ijn-12-7089"><label>2</label>
Department of Prosthodontics, School of Stomatology</aff>
<aff id="af3-ijn-12-7089"><label>3</label>
Department of Plastic Surgery, Tangdu Hospital</aff>
<aff id="af4-ijn-12-7089"><label>4</label>
Department of Traditional Chinese Medicine, Xijing Hospital</aff>
<aff id="af5-ijn-12-7089"><label>5</label>
Department of Biochemistry and Molecular Biology, Fourth Military Medical University, Xi’an, China</aff>
<author-notes><corresp id="c1-ijn-12-7089">Correspondence: Guodong Yang, Department of Biochemistry and Molecular Biology, Fourth Military Medical University, No 169 West Changle Road, Xi’an, China, Tel +86 29 8477 4516 ext 8016, Email <email>yanggd@fmmu.edu.cn</email>
</corresp>
<corresp id="c2-ijn-12-7089">Yingliang Song, Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, No 145 West Changle Road, Xi’an, China, Tel +86 29 8477 6454, Email <email>yingliangsong@163.com</email>
</corresp>
<fn id="fn1-ijn-12-7089"><label>*</label>
<p>These authors contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="collection"><year>2017</year>
</pub-date>
<pub-date pub-type="epub"><day>26</day>
<month>9</month>
<year>2017</year>
</pub-date>
<volume>12</volume>
<fpage>7089</fpage>
<lpage>7101</lpage>
<permissions><copyright-statement>© 2017 Liu et al. This work is published and licensed by Dove Medical Press Limited</copyright-statement>
<copyright-year>2017</copyright-year>
<license><license-p>The full terms of this license are available at <ext-link ext-link-type="uri" xlink:href="https://www.dovepress.com/terms.php">https://www.dovepress.com/terms.php</ext-link>
and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">http://creativecommons.org/licenses/by-nc/3.0/</ext-link>
). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed.</license-p>
</license>
</permissions>
<abstract><p>Impaired osseointegration of the implant remains the big hurdle for dental implant therapy in diabetic patients. In this study, the authors first identified that miR204 was strikingly highly expressed in the bone mesenchymal stem cells (BMSCs) of diabetic rats. Forced expression of miR204 repressed the osteogenic potential of BMSCs, while inhibition of miR204 significantly increased the osteogenic capacity. Moreover, the miR204 inhibitor was conjugated with gold nanoparticles (AuNP-antagomiR204) and dispersed them in the poly(lactic-co-glycolic acid) (PLGA) solution. The AuNP-antagomiR204 containing PLGA solution was applied for coating the surface of titanium implant. Electron microscope revealed that an ultrathin sheet was formed on the surface of the implant, and the AuNPs were evenly dispersed in the coated PLGA sheet. Cellular experiments revealed that these encapsulated AuNP-antagomiR204 were able to be released from the PLGA sheet and uptaken by adherent BMSCs. In vivo animal study further confirmed that the AuNP-antagomiR204 released from PLGA sheet promoted osseointegration, as revealed by microcomputerized tomography (microCT) reconstruction and histological assay. Taken together, this study established that miR204 misexpression accounted for the deficient osseointegation in diabetes mellitus, while PLGA sheets aided the release of AuNP-antagomiR204, which would be a promising strategy for titanium implant surface functionalization toward better osseointegration.</p>
</abstract>
<kwd-group><title>Keywords</title>
<kwd>osseointegration</kwd>
<kwd>miR204</kwd>
<kwd>PLGA sheets</kwd>
<kwd>gold nanoparticles</kwd>
<kwd>diabetes mellitus</kwd>
<kwd>titanium implant</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group><fig id="f1-ijn-12-7089" position="float"><label>Figure 1</label>
<caption><p>Upregulation of miR204 contributes to the decreased osteogenesis in the BMSCs of T2DM. Alizarin red staining of extracellular matrix mineralization of osteogenic differentiated BMSCs and BMSCs<sup>-T2DM</sup>
(<bold>A</bold>
) and quantitative data (<bold>B</bold>
). miR204 expression in undifferentiated BMSCs and BMSCs<sup>-T2DM</sup>
(<bold>C</bold>
). miR204 expression in BMSCs and BMSCs<sup>-T2DM</sup>
upon osteogenic induction (<bold>D</bold>
).</p>
<p><bold>Note:</bold>
*<italic>P</italic>
<0.05 versus normal.</p>
<p><bold>Abbreviations:</bold>
T2DM, type 2 diabetes mellitus; BMSCs, bone marrow stem cells; OD, optical density.</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig1"></graphic>
</fig>
<fig id="f2-ijn-12-7089" position="float"><label>Figure 2</label>
<caption><p>Surface morphology of original MAO titanium implant and MAO titanium implant with PLGA coating. Representative SEM image of the original MAO titanium implant surface (<bold>A</bold>
). The border between PLGA coating and titanium implant (<bold>B</bold>
). High magnification image of the white rectangle area in B showing the PLGA penetrated into the micropores of MAO implant (<bold>C</bold>
). High magnification image of the red rectangle area in B displaying the surface of PLGA coating (<bold>D</bold>
).</p>
<p><bold>Abbreviations:</bold>
SEM, scanning electron microscopy; MAO, microarc oxidation; PLGA, poly(lactic-co-glycolic acid).</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig2"></graphic>
</fig>
<fig id="f3-ijn-12-7089" position="float"><label>Figure 3</label>
<caption><p>Representative TEM image showing the distribution of gold nanoparticles in PLGA coating.</p>
<p><bold>Abbreviations:</bold>
TEM, transmission electron microscopy; PLGA, poly(lactic-co-glycolic acid).</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig3"></graphic>
</fig>
<fig id="f4-ijn-12-7089" position="float"><label>Figure 4</label>
<caption><p>3D distribution of Cy3-labeled miRNA inhibitor in PLGA coating. Cy3-labeled miRNA inhibitor was conjugated to AuNP and the AuNP was dispersed into the PLGA solution before sheet making. The resultant PLGA-AuNP-miRNA inhibitor sheet was scanned by confocal laser scan microscope. 3D reconstruction of fluorescence-labeled miRNA inhibitor in PLGA sheet (<bold>A</bold>
). Plane images to show the distribution of the labeled AuNP from surface to inside of the PLGA coating; the plane image was harvested approximately every eight μm (<bold>B</bold>
–<bold>E</bold>
).</p>
<p><bold>Abbreviations:</bold>
3D, three-dimensional; AuNP, gold nanoparticle; miRNA, microRNA; PLGA, poly(lactic-co-glycolic acid).</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig4"></graphic>
</fig>
<fig id="f5-ijn-12-7089" position="float"><label>Figure 5</label>
<caption><p>Uptake of the miRNA-AuNP in the PLGA sheet by seeded cells. BMSCs were seeded on the PLGA sheet. Uptake of the miRNA-AuNP was monitored by confocal laser scan microscope.</p>
<p><bold>Abbreviations:</bold>
AuNP, gold nanoparticles; BMSCs, bone marrow stem cells; miRNA, microRNA; PLGA, poly(lactic-co-glycolic acid).</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig5"></graphic>
</fig>
<fig id="f6-ijn-12-7089" position="float"><label>Figure 6</label>
<caption><p>Cell viability determined by CCK8 (<bold>A</bold>
) and adherent cell numbers determined by counting the Hoechst-stained nuclei (<bold>B</bold>
and <bold>C</bold>
).</p>
<p><bold>Notes:</bold>
(<bold>C</bold>
-a): Control; (<bold>C</bold>
-b): PLGA<sup>-control</sup>
; (<bold>C</bold>
-c): PLGA<sup>-antagomiR204</sup>
.</p>
<p><bold>Abbreviations:</bold>
CCK8, cell counting kit 8; OD, optical density; PLGA, poly(lactic-co-glycolic acid).</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig6"></graphic>
</fig>
<fig id="f7-ijn-12-7089" position="float"><label>Figure 7</label>
<caption><p>Alkaline phosphatase activity assay (<bold>A</bold>
) and alizarin red staining (<bold>B</bold>
), quantitative analysis of the alizarin red staining (<bold>C</bold>
) of BMSCs<sup>-control</sup>
and BMSCs<sup>-antagomiR204</sup>
. Osteogenic-related gene expression determined by RT-PCR after 5 or 10 days osteogenic induction, including <italic>Bmp</italic>
(<bold>D</bold>
), <italic>Opg</italic>
(<bold>E</bold>
), <italic>Alp</italic>
(<bold>F</bold>
), <italic>Runx2</italic>
(<bold>G</bold>
), and <italic>Col 1</italic>
(<bold>H</bold>
).</p>
<p><bold>Note:</bold>
*<italic>P</italic>
<0.05 versus BMSCs<sup>-control</sup>
.</p>
<p><bold>Abbreviations:</bold>
BMSCs, bone marrow stem cells; mRNA, messenger RNA; OD, optical density; RT-PCR, reverse transcription-polymerase chain reaction; <italic>Bmp</italic>
, bone morphogenetic protein; <italic>Opg</italic>
, osteoprotegerin; <italic>AlP</italic>
, alkaline phosphatase; <italic>Runx2</italic>
, runt-related transcription factor 2; <italic>Col I</italic>
, collagen type I.</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig7"></graphic>
</fig>
<fig id="f8-ijn-12-7089" position="float"><label>Figure 8</label>
<caption><p>Removal torque value for the implant samples.</p>
<p><bold>Note:</bold>
*<italic>P</italic>
<0.05 versus control and PLGA<sup>-control</sup>
.</p>
<p><bold>Abbreviation:</bold>
PLGA, poly(lactic-co-glycolic acid).</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig8"></graphic>
</fig>
<fig id="f9-ijn-12-7089" position="float"><label>Figure 9</label>
<caption><p>3D reconstruction of the microCT scan results displaying the bone (yellow) surrounding implant (gray) at 8 weeks after implantation (<bold>A</bold>
). Quantitative analysis of BV/TV (<bold>B</bold>
), trabecular thickness (<bold>C</bold>
), and trabecular spacing (<bold>D</bold>
).</p>
<p><bold>Note:</bold>
*<italic>P</italic>
<0.05 versus control and PLGA<sup>-control</sup>
.</p>
<p><bold>Abbreviations:</bold>
3D, three-dimensional; microCT, microcomputerized tomography; PLGA, poly(lactic-co-glycolic acid); BV, bone volume; TV, total volume.</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig9"></graphic>
</fig>
<fig id="f10-ijn-12-7089" position="float"><label>Figure 10</label>
<caption><p>Van–Gieson staining images displaying the bone (red) attached to implant (black) at 8 weeks after implantation of different surface functionalized implants (<bold>A</bold>
) and quantitative analysis of BIC (<bold>B</bold>
).</p>
<p><bold>Note:</bold>
*<italic>P</italic>
<0.05 versus control and PLGA<sup>-control</sup>
.</p>
<p><bold>Abbreviations:</bold>
PLGA, poly(lactic-co-glycolic acid); BIC, bone–implant contact.</p>
</caption>
<graphic xlink:href="ijn-12-7089Fig10"></graphic>
</fig>
<table-wrap id="t1-ijn-12-7089" position="float"><label>Table 1</label>
<caption><p>Sequences of primers, miR204, and antagomiR204 and the controls used in the study</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th valign="top" align="left" rowspan="1" colspan="1">Name</th>
<th valign="top" align="left" rowspan="1" colspan="1">Forward</th>
<th valign="top" align="left" rowspan="1" colspan="1">Reverse</th>
</tr>
</thead>
<tbody><tr><td valign="top" align="left" rowspan="1" colspan="1"><italic>Bmp</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">ATCGTTACCTCAAGGGAGTGG</td>
<td valign="top" align="left" rowspan="1" colspan="1">GCGACGGCAGTTCTTATTCT</td>
</tr>
<tr><td valign="top" align="left" rowspan="1" colspan="1"><italic>Opg</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">ACCATGTACCGATTGTATC</td>
<td valign="top" align="left" rowspan="1" colspan="1">CTGCCATTTCAAGAGCC</td>
</tr>
<tr><td valign="top" align="left" rowspan="1" colspan="1"><italic>Alp</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">ACAACCTGACTGACCCTTCCC</td>
<td valign="top" align="left" rowspan="1" colspan="1">CAATCCTGCCTCCTTCCACTA</td>
</tr>
<tr><td valign="top" align="left" rowspan="1" colspan="1"><italic>Runx2</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">GAACAGTAGCGGGAGCAT</td>
<td valign="top" align="left" rowspan="1" colspan="1">CCCACATAGGAGGAGAAAA</td>
</tr>
<tr><td valign="top" align="left" rowspan="1" colspan="1"><italic>Col I</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">AAGGCAATGCTGAATCGTCC</td>
<td valign="top" align="left" rowspan="1" colspan="1">TGGTTAGGCTCCTTCAATAGTCC</td>
</tr>
<tr><td valign="top" align="left" rowspan="1" colspan="1">Gapdh</td>
<td valign="top" align="left" rowspan="1" colspan="1">GGTGCTGAGTATGTCGTGGAG</td>
<td valign="top" align="left" rowspan="1" colspan="1">GCGGAGATGATGACCCTTTT</td>
</tr>
<tr><td valign="top" align="left" rowspan="1" colspan="1">Rnu6b</td>
<td valign="top" align="left" rowspan="1" colspan="1">CTCGCTTCGGCAGCACA</td>
<td valign="top" align="left" rowspan="1" colspan="1">AACGCTTCACGAATTTGCGT</td>
</tr>
</tbody>
</table>
<table frame="below" rules="groups"><thead><tr><th valign="top" align="left" rowspan="1" colspan="1">AntagomiRNAs</th>
<th valign="top" align="left" rowspan="1" colspan="1">Sequence</th>
</tr>
</thead>
<tbody><tr><td valign="top" align="left" rowspan="1" colspan="1">AntagomiRScramble</td>
<td valign="top" align="left" rowspan="1" colspan="1">5′-rArUrC rGrArArUrUrCrCrUrGrCrArGrCrCrCrGrUrU (Spacer 18)-Thiol-3′</td>
</tr>
<tr><td valign="top" align="left" rowspan="1" colspan="1">Cy3-antagomiRScramble</td>
<td valign="top" align="left" rowspan="1" colspan="1">5′-Cy3-rArUrC rGrArArUrUrCrCrUrGrCrArGrCrCrCrGrUrU (Spacer 18)-Thiol-3′</td>
</tr>
<tr><td valign="top" align="left" rowspan="1" colspan="1">AntagomiR204</td>
<td valign="top" align="left" rowspan="1" colspan="1">5′-rGrGrCrArUrArGrGrArUrGrArCrArArArGrGrGrArA (Spacer 18)-Thiol-3′</td>
</tr>
<tr><td valign="top" align="left" rowspan="1" colspan="1">Cy3-antagomiR204</td>
<td valign="top" align="left" rowspan="1" colspan="1">5′-Cy3-rGrGrCrArUrArGrGrArUrGrArCrArArArGrGrGrArA (Spacer18)-Thiol-3′</td>
</tr>
</tbody>
</table>
<table-wrap-foot><fn id="tfn1-ijn-12-7089"><p><bold>Abbreviations:</bold>
<italic>Bmp</italic>
, bone morphogenetic protein; <italic>Opg</italic>
, osteoprotegerin; <italic>AlP</italic>
, alkaline phosphatase; <italic>Runx2</italic>
, runt-related transcription factor 2; <italic>Col I</italic>
, collagen type I; Gapdh, glyceraldehyde-3-phosphate dehydrogenase; Rnu6b, RNA U6 small nuclear 2; antagomiR204, microRNA204 inhibitor.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
<affiliations><list><country><li>République populaire de Chine</li>
</country>
</list>
<tree><noCountry><name sortKey="Chen, Hui" sort="Chen, Hui" uniqKey="Chen H" first="Hui" last="Chen">Hui Chen</name>
<name sortKey="Jia, Chengming" sort="Jia, Chengming" uniqKey="Jia C" first="Chengming" last="Jia">Chengming Jia</name>
<name sortKey="Liu, Xiangwei" sort="Liu, Xiangwei" uniqKey="Liu X" first="Xiangwei" last="Liu">Xiangwei Liu</name>
<name sortKey="Ren, Shuai" sort="Ren, Shuai" uniqKey="Ren S" first="Shuai" last="Ren">Shuai Ren</name>
<name sortKey="Song, Yingliang" sort="Song, Yingliang" uniqKey="Song Y" first="Yingliang" last="Song">Yingliang Song</name>
<name sortKey="Tan, Naiwen" sort="Tan, Naiwen" uniqKey="Tan N" first="Naiwen" last="Tan">Naiwen Tan</name>
<name sortKey="Wei, Hongbo" sort="Wei, Hongbo" uniqKey="Wei H" first="Hongbo" last="Wei">Hongbo Wei</name>
<name sortKey="Yu, Fan" sort="Yu, Fan" uniqKey="Yu F" first="Fan" last="Yu">Fan Yu</name>
<name sortKey="Zhou, Yuchao" sort="Zhou, Yuchao" uniqKey="Zhou Y" first="Yuchao" last="Zhou">Yuchao Zhou</name>
</noCountry>
<country name="République populaire de Chine"><noRegion><name sortKey="Yang, Guodong" sort="Yang, Guodong" uniqKey="Yang G" first="Guodong" last="Yang">Guodong Yang</name>
</noRegion>
</country>
</tree>
</affiliations>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Santé/explor/EdenteV2/Data/Pmc/Checkpoint
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000267 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd -nk 000267 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Santé |area= EdenteV2 |flux= Pmc |étape= Checkpoint |type= RBID |clé= PMC:5627761 |texte= Delivery of antagomiR204-conjugated gold nanoparticles from PLGA sheets and its implication in promoting osseointegration of titanium implant in type 2 diabetes mellitus }}
Pour générer des pages wiki
HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/RBID.i -Sk "pubmed:29026303" \ | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd \ | NlmPubMed2Wicri -a EdenteV2
This area was generated with Dilib version V0.6.32. |