The early immune response to infection of chickens with Infectious Bronchitis Virus (IBV) in susceptible and resistant birds
Identifieur interne : 000217 ( Pmc/Corpus ); précédent : 000216; suivant : 000218The early immune response to infection of chickens with Infectious Bronchitis Virus (IBV) in susceptible and resistant birds
Auteurs : Jacqueline Smith ; Jean-Remy Sadeyen ; David Cavanagh ; Pete Kaiser ; David W. BurtSource :
- BMC Veterinary Research [ 1746-6148 ] ; 2015.
Abstract
Infectious Bronchitis is a highly contagious respiratory disease which causes tracheal lesions and also affects the reproductive tract and is responsible for large economic losses to the poultry industry every year. This is due to both mortality (either directly provoked by IBV itself or due to subsequent bacterial infection) and lost egg production. The virus is difficult to control by vaccination, so new methods to curb the impact of the disease need to be sought. Here, we seek to identify genes conferring resistance to this coronavirus, which could help in selective breeding programs to rear chickens which do not succumb to the effects of this disease.
Whole genome gene expression microarrays were used to analyse the gene expression differences, which occur upon infection of birds with Infectious Bronchitis Virus (IBV). Tracheal tissue was examined from control and infected birds at 2, 3 and 4 days post-infection in birds known to be either susceptible or resistant to the virus. The host innate immune response was evaluated over these 3 days and differences between the susceptible and resistant lines examined.
Genes and biological pathways involved in the early host response to IBV infection were determined andgene expression differences between susceptible and resistant birds were identified. Potential candidate genes for resistance to IBV are highlighted.
The early host response to IBV is analysed and potential candidate genes for disease resistance are identified. These putative resistance genes can be used as targets for future genetic and functional studies to prove a causative link with resistance to IBV.
The online version of this article (doi:10.1186/s12917-015-0575-6) contains supplementary material, which is available to authorized users.
Url:
DOI: 10.1186/s12917-015-0575-6
PubMed: 26452558
PubMed Central: 4600211
Links to Exploration step
PMC:4600211Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">The early immune response to infection of chickens with Infectious Bronchitis Virus (IBV) in susceptible and resistant birds</title>
<author><name sortKey="Smith, Jacqueline" sort="Smith, Jacqueline" uniqKey="Smith J" first="Jacqueline" last="Smith">Jacqueline Smith</name>
<affiliation><nlm:aff id="Aff1">The Roslin Institute & R(D)SVS, University of Edinburgh, Easter Bush, Midlothian, EH25 9RG UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Sadeyen, Jean Remy" sort="Sadeyen, Jean Remy" uniqKey="Sadeyen J" first="Jean-Remy" last="Sadeyen">Jean-Remy Sadeyen</name>
<affiliation><nlm:aff id="Aff2">The Pirbright Institute, Compton Laboratory, Compton, Berkshire RG20 7NN UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cavanagh, David" sort="Cavanagh, David" uniqKey="Cavanagh D" first="David" last="Cavanagh">David Cavanagh</name>
<affiliation><nlm:aff id="Aff2">The Pirbright Institute, Compton Laboratory, Compton, Berkshire RG20 7NN UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kaiser, Pete" sort="Kaiser, Pete" uniqKey="Kaiser P" first="Pete" last="Kaiser">Pete Kaiser</name>
<affiliation><nlm:aff id="Aff1">The Roslin Institute & R(D)SVS, University of Edinburgh, Easter Bush, Midlothian, EH25 9RG UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Burt, David W" sort="Burt, David W" uniqKey="Burt D" first="David W." last="Burt">David W. Burt</name>
<affiliation><nlm:aff id="Aff1">The Roslin Institute & R(D)SVS, University of Edinburgh, Easter Bush, Midlothian, EH25 9RG UK</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">26452558</idno>
<idno type="pmc">4600211</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4600211</idno>
<idno type="RBID">PMC:4600211</idno>
<idno type="doi">10.1186/s12917-015-0575-6</idno>
<date when="2015">2015</date>
<idno type="wicri:Area/Pmc/Corpus">000217</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000217</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">The early immune response to infection of chickens with Infectious Bronchitis Virus (IBV) in susceptible and resistant birds</title>
<author><name sortKey="Smith, Jacqueline" sort="Smith, Jacqueline" uniqKey="Smith J" first="Jacqueline" last="Smith">Jacqueline Smith</name>
<affiliation><nlm:aff id="Aff1">The Roslin Institute & R(D)SVS, University of Edinburgh, Easter Bush, Midlothian, EH25 9RG UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Sadeyen, Jean Remy" sort="Sadeyen, Jean Remy" uniqKey="Sadeyen J" first="Jean-Remy" last="Sadeyen">Jean-Remy Sadeyen</name>
<affiliation><nlm:aff id="Aff2">The Pirbright Institute, Compton Laboratory, Compton, Berkshire RG20 7NN UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cavanagh, David" sort="Cavanagh, David" uniqKey="Cavanagh D" first="David" last="Cavanagh">David Cavanagh</name>
<affiliation><nlm:aff id="Aff2">The Pirbright Institute, Compton Laboratory, Compton, Berkshire RG20 7NN UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kaiser, Pete" sort="Kaiser, Pete" uniqKey="Kaiser P" first="Pete" last="Kaiser">Pete Kaiser</name>
<affiliation><nlm:aff id="Aff1">The Roslin Institute & R(D)SVS, University of Edinburgh, Easter Bush, Midlothian, EH25 9RG UK</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Burt, David W" sort="Burt, David W" uniqKey="Burt D" first="David W." last="Burt">David W. Burt</name>
<affiliation><nlm:aff id="Aff1">The Roslin Institute & R(D)SVS, University of Edinburgh, Easter Bush, Midlothian, EH25 9RG UK</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">BMC Veterinary Research</title>
<idno type="eISSN">1746-6148</idno>
<imprint><date when="2015">2015</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><sec><title>Background</title>
<p>Infectious Bronchitis is a highly contagious respiratory disease which causes tracheal lesions and also affects the reproductive tract and is responsible for large economic losses to the poultry industry every year. This is due to both mortality (either directly provoked by IBV itself or due to subsequent bacterial infection) and lost egg production. The virus is difficult to control by vaccination, so new methods to curb the impact of the disease need to be sought. Here, we seek to identify genes conferring resistance to this coronavirus, which could help in selective breeding programs to rear chickens which do not succumb to the effects of this disease.</p>
</sec>
<sec><title>Methods</title>
<p>Whole genome gene expression microarrays were used to analyse the gene expression differences, which occur upon infection of birds with Infectious Bronchitis Virus (IBV). Tracheal tissue was examined from control and infected birds at 2, 3 and 4 days post-infection in birds known to be either susceptible or resistant to the virus. The host innate immune response was evaluated over these 3 days and differences between the susceptible and resistant lines examined.</p>
</sec>
<sec><title>Results</title>
<p>Genes and biological pathways involved in the early host response to IBV infection were determined andgene expression differences between susceptible and resistant birds were identified. Potential candidate genes for resistance to IBV are highlighted.</p>
</sec>
<sec><title>Conclusions</title>
<p>The early host response to IBV is analysed and potential candidate genes for disease resistance are identified. These putative resistance genes can be used as targets for future genetic and functional studies to prove a causative link with resistance to IBV.</p>
</sec>
<sec><title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/s12917-015-0575-6) contains supplementary material, which is available to authorized users.</p>
</sec>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Schalk, Af" uniqKey="Schalk A">AF Schalk</name>
</author>
<author><name sortKey="Hawn, Mc" uniqKey="Hawn M">MC Hawn</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Beach, Jr" uniqKey="Beach J">JR Beach</name>
</author>
<author><name sortKey="Schalm, Ow" uniqKey="Schalm O">OW Schalm</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Beaudette, Fr" uniqKey="Beaudette F">FR Beaudette</name>
</author>
<author><name sortKey="Hudson, Cb" uniqKey="Hudson C">CB Hudson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Cavanagh, D" uniqKey="Cavanagh D">D Cavanagh</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Enjuanes, L" uniqKey="Enjuanes L">L Enjuanes</name>
</author>
<author><name sortKey="Sola, I" uniqKey="Sola I">I Sola</name>
</author>
<author><name sortKey="Zu Iga, S" uniqKey="Zu Iga S">S Zúñiga</name>
</author>
<author><name sortKey="Almazan, F" uniqKey="Almazan F">F Almazán</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Casais, R" uniqKey="Casais R">R Casais</name>
</author>
<author><name sortKey="Dove, B" uniqKey="Dove B">B Dove</name>
</author>
<author><name sortKey="Cavanagh, D" uniqKey="Cavanagh D">D Cavanagh</name>
</author>
<author><name sortKey="Britton, P" uniqKey="Britton P">P Britton</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Asif, M" uniqKey="Asif M">M Asif</name>
</author>
<author><name sortKey="Lowenthal, Jw" uniqKey="Lowenthal J">JW Lowenthal</name>
</author>
<author><name sortKey="Ford, Me" uniqKey="Ford M">ME Ford</name>
</author>
<author><name sortKey="Schat, Ka" uniqKey="Schat K">KA Schat</name>
</author>
<author><name sortKey="Kimpton, Wg" uniqKey="Kimpton W">WG Kimpton</name>
</author>
<author><name sortKey="Bean, Ag" uniqKey="Bean A">AG Bean</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jackwood, Mw" uniqKey="Jackwood M">MW Jackwood</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Meulemans, G" uniqKey="Meulemans G">G Meulemans</name>
</author>
<author><name sortKey="Van Den Berg, Tp" uniqKey="Van Den Berg T">TP Van den Berg</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ariaans, Mp" uniqKey="Ariaans M">MP Ariaans</name>
</author>
<author><name sortKey="Matthijs, Mg" uniqKey="Matthijs M">MG Matthijs</name>
</author>
<author><name sortKey="Van Haarlem, D" uniqKey="Van Haarlem D">D van Haarlem</name>
</author>
<author><name sortKey="Van De Haar, P" uniqKey="Van De Haar P">P van de Haar</name>
</author>
<author><name sortKey="Van Eck, Jh" uniqKey="Van Eck J">JH van Eck</name>
</author>
<author><name sortKey="Hensen, Ej" uniqKey="Hensen E">EJ Hensen</name>
</author>
<author><name sortKey="Vervelde, L" uniqKey="Vervelde L">L Vervelde</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Matthijs, Mg" uniqKey="Matthijs M">MG Matthijs</name>
</author>
<author><name sortKey="Van Eck, Jh" uniqKey="Van Eck J">JH van Eck</name>
</author>
<author><name sortKey="Landman, Wj" uniqKey="Landman W">WJ Landman</name>
</author>
<author><name sortKey="Stegeman, Ja" uniqKey="Stegeman J">JA Stegeman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jackwood, Mw" uniqKey="Jackwood M">MW Jackwood</name>
</author>
<author><name sortKey="De Wit, S" uniqKey="De Wit S">S de Wit</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Worthington, Kj" uniqKey="Worthington K">KJ Worthington</name>
</author>
<author><name sortKey="Currie, Rjw" uniqKey="Currie R">RJW Currie</name>
</author>
<author><name sortKey="Jones, Rc" uniqKey="Jones R">RC Jones</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ignjatovic, J" uniqKey="Ignjatovic J">J Ignjatovic</name>
</author>
<author><name sortKey="Gould, G" uniqKey="Gould G">G Gould</name>
</author>
<author><name sortKey="Sapats, S" uniqKey="Sapats S">S Sapats</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mase, M" uniqKey="Mase M">M Mase</name>
</author>
<author><name sortKey="Kawanishi, N" uniqKey="Kawanishi N">N Kawanishi</name>
</author>
<author><name sortKey="Ootani, Y" uniqKey="Ootani Y">Y Ootani</name>
</author>
<author><name sortKey="Murayama, K" uniqKey="Murayama K">K Murayama</name>
</author>
<author><name sortKey="Karino, A" uniqKey="Karino A">A Karino</name>
</author>
<author><name sortKey="Inoue, T" uniqKey="Inoue T">T Inoue</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Banat, Gr" uniqKey="Banat G">GR Banat</name>
</author>
<author><name sortKey="Tkalcic, S" uniqKey="Tkalcic S">S Tkalcic</name>
</author>
<author><name sortKey="Dzielawa, Ja" uniqKey="Dzielawa J">JA Dzielawa</name>
</author>
<author><name sortKey="Jackwood, Mw" uniqKey="Jackwood M">MW Jackwood</name>
</author>
<author><name sortKey="Saggese, Md" uniqKey="Saggese M">MD Saggese</name>
</author>
<author><name sortKey="Yates, L" uniqKey="Yates L">L Yates</name>
</author>
<author><name sortKey="Kopulos, R" uniqKey="Kopulos R">R Kopulos</name>
</author>
<author><name sortKey="Briles, We" uniqKey="Briles W">WE Briles</name>
</author>
<author><name sortKey="Collisson, Ew" uniqKey="Collisson E">EW Collisson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Dar, A" uniqKey="Dar A">A Dar</name>
</author>
<author><name sortKey="Munir, S" uniqKey="Munir S">S Munir</name>
</author>
<author><name sortKey="Vishwanathan, S" uniqKey="Vishwanathan S">S Vishwanathan</name>
</author>
<author><name sortKey="Manuja, A" uniqKey="Manuja A">A Manuja</name>
</author>
<author><name sortKey="Griebel, P" uniqKey="Griebel P">P Griebel</name>
</author>
<author><name sortKey="Tikoo, S" uniqKey="Tikoo S">S Tikoo</name>
</author>
<author><name sortKey="Townsend, H" uniqKey="Townsend H">H Townsend</name>
</author>
<author><name sortKey="Potter, A" uniqKey="Potter A">A Potter</name>
</author>
<author><name sortKey="Kapur, V" uniqKey="Kapur V">V Kapur</name>
</author>
<author><name sortKey="Babiuk, La" uniqKey="Babiuk L">LA Babiuk</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author><name sortKey="Rosa, Ajm" uniqKey="Rosa A">AJM Rosa</name>
</author>
<author><name sortKey="Oliverira, Hn" uniqKey="Oliverira H">HN Oliverira</name>
</author>
<author><name sortKey="Rosa, Gjm" uniqKey="Rosa G">GJM Rosa</name>
</author>
<author><name sortKey="Guo, X" uniqKey="Guo X">X Guo</name>
</author>
<author><name sortKey="Travnicek, M" uniqKey="Travnicek M">M Travnicek</name>
</author>
<author><name sortKey="Girshick, T" uniqKey="Girshick T">T Girshick</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Drosten, C" uniqKey="Drosten C">C Drosten</name>
</author>
<author><name sortKey="Gunther, S" uniqKey="Gunther S">S Günther</name>
</author>
<author><name sortKey="Preiser, W" uniqKey="Preiser W">W Preiser</name>
</author>
<author><name sortKey="Van Der Werf, S" uniqKey="Van Der Werf S">S van der Werf</name>
</author>
<author><name sortKey="Brodt, Hr" uniqKey="Brodt H">HR Brodt</name>
</author>
<author><name sortKey="Becker, S" uniqKey="Becker S">S Becker</name>
</author>
<author><name sortKey="Rabenau, H" uniqKey="Rabenau H">H Rabenau</name>
</author>
<author><name sortKey="Panning, M" uniqKey="Panning M">M Panning</name>
</author>
<author><name sortKey="Kolesnikova, L" uniqKey="Kolesnikova L">L Kolesnikova</name>
</author>
<author><name sortKey="Fouchier, Ra" uniqKey="Fouchier R">RA Fouchier</name>
</author>
<author><name sortKey="Berger, A" uniqKey="Berger A">A Berger</name>
</author>
<author><name sortKey="Burguiere, Am" uniqKey="Burguiere A">AM Burguière</name>
</author>
<author><name sortKey="Cinatl, J" uniqKey="Cinatl J">J Cinatl</name>
</author>
<author><name sortKey="Eickmann, M" uniqKey="Eickmann M">M Eickmann</name>
</author>
<author><name sortKey="Escriou, N" uniqKey="Escriou N">N Escriou</name>
</author>
<author><name sortKey="Grywna, K" uniqKey="Grywna K">K Grywna</name>
</author>
<author><name sortKey="Kramme, S" uniqKey="Kramme S">S Kramme</name>
</author>
<author><name sortKey="Manuguerra, Jc" uniqKey="Manuguerra J">JC Manuguerra</name>
</author>
<author><name sortKey="Muller, S" uniqKey="Muller S">S Müller</name>
</author>
<author><name sortKey="Rickerts, V" uniqKey="Rickerts V">V Rickerts</name>
</author>
<author><name sortKey="Sturmer, M" uniqKey="Sturmer M">M Stürmer</name>
</author>
<author><name sortKey="Vieth, S" uniqKey="Vieth S">S Vieth</name>
</author>
<author><name sortKey="Klenk, Hd" uniqKey="Klenk H">HD Klenk</name>
</author>
<author><name sortKey="Osterhaus, Ad" uniqKey="Osterhaus A">AD Osterhaus</name>
</author>
<author><name sortKey="Schmitz, H" uniqKey="Schmitz H">H Schmitz</name>
</author>
<author><name sortKey="Doerr, Hw" uniqKey="Doerr H">HW Doerr</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ksiazek, Tg" uniqKey="Ksiazek T">TG Ksiazek</name>
</author>
<author><name sortKey="Erdman, D" uniqKey="Erdman D">D Erdman</name>
</author>
<author><name sortKey="Goldsmith, Cs" uniqKey="Goldsmith C">CS Goldsmith</name>
</author>
<author><name sortKey="Zaki, Sr" uniqKey="Zaki S">SR Zaki</name>
</author>
<author><name sortKey="Peret, T" uniqKey="Peret T">T Peret</name>
</author>
<author><name sortKey="Emery, S" uniqKey="Emery S">S Emery</name>
</author>
<author><name sortKey="Tong, S" uniqKey="Tong S">S Tong</name>
</author>
<author><name sortKey="Urbani, C" uniqKey="Urbani C">C Urbani</name>
</author>
<author><name sortKey="Comer, Ja" uniqKey="Comer J">JA Comer</name>
</author>
<author><name sortKey="Lim, W" uniqKey="Lim W">W Lim</name>
</author>
<author><name sortKey="Rollin, Pe" uniqKey="Rollin P">PE Rollin</name>
</author>
<author><name sortKey="Dowell, Sf" uniqKey="Dowell S">SF Dowell</name>
</author>
<author><name sortKey="Ling, Ae" uniqKey="Ling A">AE Ling</name>
</author>
<author><name sortKey="Humphrey, Cd" uniqKey="Humphrey C">CD Humphrey</name>
</author>
<author><name sortKey="Shieh, Wj" uniqKey="Shieh W">WJ Shieh</name>
</author>
<author><name sortKey="Guarner, J" uniqKey="Guarner J">J Guarner</name>
</author>
<author><name sortKey="Paddock, Cd" uniqKey="Paddock C">CD Paddock</name>
</author>
<author><name sortKey="Rota, P" uniqKey="Rota P">P Rota</name>
</author>
<author><name sortKey="Fields, B" uniqKey="Fields B">B Fields</name>
</author>
<author><name sortKey="Derisi, J" uniqKey="Derisi J">J DeRisi</name>
</author>
<author><name sortKey="Yang, Jy" uniqKey="Yang J">JY Yang</name>
</author>
<author><name sortKey="Cox, N" uniqKey="Cox N">N Cox</name>
</author>
<author><name sortKey="Hughes, Jm" uniqKey="Hughes J">JM Hughes</name>
</author>
<author><name sortKey="Leduc, Jw" uniqKey="Leduc J">JW LeDuc</name>
</author>
<author><name sortKey="Bellini, Wj" uniqKey="Bellini W">WJ Bellini</name>
</author>
<author><name sortKey="Anderson, Lj" uniqKey="Anderson L">LJ Anderson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Cook, J" uniqKey="Cook J">J Cook</name>
</author>
<author><name sortKey="Otsuki, K" uniqKey="Otsuki K">K Otsuki</name>
</author>
<author><name sortKey="Huggins, M" uniqKey="Huggins M">M Huggins</name>
</author>
<author><name sortKey="Bumstead, N" uniqKey="Bumstead N">N Bumstead</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Cole, Rk" uniqKey="Cole R">RK Cole</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Talloen, W" uniqKey="Talloen W">W Talloen</name>
</author>
<author><name sortKey="Clevert, Da" uniqKey="Clevert D">DA Clevert</name>
</author>
<author><name sortKey="Hochreiter, S" uniqKey="Hochreiter S">S Hochreiter</name>
</author>
<author><name sortKey="Amaratunga, D" uniqKey="Amaratunga D">D Amaratunga</name>
</author>
<author><name sortKey="Bijnens, L" uniqKey="Bijnens L">L Bijnens</name>
</author>
<author><name sortKey="Kass, S" uniqKey="Kass S">S Kass</name>
</author>
<author><name sortKey="Gohlmann, Hw" uniqKey="Gohlmann H">HW Göhlmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Khatri, P" uniqKey="Khatri P">P Khatri</name>
</author>
<author><name sortKey="Sellamuthu, S" uniqKey="Sellamuthu S">S Sellamuthu</name>
</author>
<author><name sortKey="Malhotra, P" uniqKey="Malhotra P">P Malhotra</name>
</author>
<author><name sortKey="Amin, K" uniqKey="Amin K">K Amin</name>
</author>
<author><name sortKey="Done, A" uniqKey="Done A">A Done</name>
</author>
<author><name sortKey="Draghici, S" uniqKey="Draghici S">S Draghici</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Kanehisa, M" uniqKey="Kanehisa M">M Kanehisa</name>
</author>
<author><name sortKey="Goto, S" uniqKey="Goto S">S Goto</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Eldaghayes, I" uniqKey="Eldaghayes I">I Eldaghayes</name>
</author>
<author><name sortKey="Rothwell, L" uniqKey="Rothwell L">L Rothwell</name>
</author>
<author><name sortKey="Williams, A" uniqKey="Williams A">A Williams</name>
</author>
<author><name sortKey="Withers, D" uniqKey="Withers D">D Withers</name>
</author>
<author><name sortKey="Balu, S" uniqKey="Balu S">S Balu</name>
</author>
<author><name sortKey="Davison, F" uniqKey="Davison F">F Davison</name>
</author>
<author><name sortKey="Kaiser, P" uniqKey="Kaiser P">P Kaiser</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Poh, Ty" uniqKey="Poh T">TY Poh</name>
</author>
<author><name sortKey="Pease, J" uniqKey="Pease J">J Pease</name>
</author>
<author><name sortKey="Young, Jr" uniqKey="Young J">JR Young</name>
</author>
<author><name sortKey="Bumstead, N" uniqKey="Bumstead N">N Bumstead</name>
</author>
<author><name sortKey="Kaiser, P" uniqKey="Kaiser P">P Kaiser</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rothwell, L" uniqKey="Rothwell L">L Rothwell</name>
</author>
<author><name sortKey="Hu, T" uniqKey="Hu T">T Hu</name>
</author>
<author><name sortKey="Wu, Z" uniqKey="Wu Z">Z Wu</name>
</author>
<author><name sortKey="Kaiser, P" uniqKey="Kaiser P">P Kaiser</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Guo, X" uniqKey="Guo X">X Guo</name>
</author>
<author><name sortKey="Rosa, Ajm" uniqKey="Rosa A">AJM Rosa</name>
</author>
<author><name sortKey="Chen, D G" uniqKey="Chen D">D-G Chen</name>
</author>
<author><name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Draghici, S" uniqKey="Draghici S">S Draghici</name>
</author>
<author><name sortKey="Khatri, P" uniqKey="Khatri P">P Khatri</name>
</author>
<author><name sortKey="Tarca, Al" uniqKey="Tarca A">AL Tarca</name>
</author>
<author><name sortKey="Amin, K" uniqKey="Amin K">K Amin</name>
</author>
<author><name sortKey="Done, A" uniqKey="Done A">A Done</name>
</author>
<author><name sortKey="Voichita, C" uniqKey="Voichita C">C Voichita</name>
</author>
<author><name sortKey="Georgescu, C" uniqKey="Georgescu C">C Georgescu</name>
</author>
<author><name sortKey="Romero, R" uniqKey="Romero R">R Romero</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kameka, Am" uniqKey="Kameka A">AM Kameka</name>
</author>
<author><name sortKey="Haddadi, S" uniqKey="Haddadi S">S Haddadi</name>
</author>
<author><name sortKey="Kim, Ds" uniqKey="Kim D">DS Kim</name>
</author>
<author><name sortKey="Cork, Sc" uniqKey="Cork S">SC Cork</name>
</author>
<author><name sortKey="Abdul Careem, Mf" uniqKey="Abdul Careem M">MF Abdul-Careem</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yang, N" uniqKey="Yang N">N Yang</name>
</author>
<author><name sortKey="Ma, P" uniqKey="Ma P">P Ma</name>
</author>
<author><name sortKey="Lang, J" uniqKey="Lang J">J Lang</name>
</author>
<author><name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author><name sortKey="Deng, J" uniqKey="Deng J">J Deng</name>
</author>
<author><name sortKey="Ju, X" uniqKey="Ju X">X JU</name>
</author>
<author><name sortKey="Zhang, G" uniqKey="Zhang G">G Zhang</name>
</author>
<author><name sortKey="Jiang, C" uniqKey="Jiang C">C Jiang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Favoreel, Hw" uniqKey="Favoreel H">HW Favoreel</name>
</author>
<author><name sortKey="Van De Walle, Gr" uniqKey="Van De Walle G">GR Van de Walle</name>
</author>
<author><name sortKey="Nauwynck, Hj" uniqKey="Nauwynck H">HJ Nauwynck</name>
</author>
<author><name sortKey="Pensaert, Mb" uniqKey="Pensaert M">MB Pensaert</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ariaans, Mp" uniqKey="Ariaans M">MP Ariaans</name>
</author>
<author><name sortKey="Van De Haar, Pm" uniqKey="Van De Haar P">PM van de Haar</name>
</author>
<author><name sortKey="Hensen, Ej" uniqKey="Hensen E">EJ Hensen</name>
</author>
<author><name sortKey="Vervelde, L" uniqKey="Vervelde L">L Vervelde</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Vervelde, L" uniqKey="Vervelde L">L Vervelde</name>
</author>
<author><name sortKey="Matthijs, Mg" uniqKey="Matthijs M">MG Matthijs</name>
</author>
<author><name sortKey="Van Haarlem, Da" uniqKey="Van Haarlem D">DA van Haarlem</name>
</author>
<author><name sortKey="De Wit, Jj" uniqKey="De Wit J">JJ de Wit</name>
</author>
<author><name sortKey="Jansen, Ca" uniqKey="Jansen C">CA Jansen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kint, J" uniqKey="Kint J">J Kint</name>
</author>
<author><name sortKey="Fernandez Gutierrez, M" uniqKey="Fernandez Gutierrez M">M Fernandez-Gutierrez</name>
</author>
<author><name sortKey="Maier, Hj" uniqKey="Maier H">HJ Maier</name>
</author>
<author><name sortKey="Britton, P" uniqKey="Britton P">P Britton</name>
</author>
<author><name sortKey="Langereis, Ma" uniqKey="Langereis M">MA Langereis</name>
</author>
<author><name sortKey="Koumans, J" uniqKey="Koumans J">J Koumans</name>
</author>
<author><name sortKey="Wiegertjes, Gf" uniqKey="Wiegertjes G">GF Wiegertjes</name>
</author>
<author><name sortKey="Forlenza, M" uniqKey="Forlenza M">M Forlenza</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sharan, R" uniqKey="Sharan R">R Sharan</name>
</author>
<author><name sortKey="Maron Katz, A" uniqKey="Maron Katz A">A Maron-Katz</name>
</author>
<author><name sortKey="Shamir, R" uniqKey="Shamir R">R Shamir</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Emmott, E" uniqKey="Emmott E">E Emmott</name>
</author>
<author><name sortKey="Munday, D" uniqKey="Munday D">D Munday</name>
</author>
<author><name sortKey="Bickerton, E" uniqKey="Bickerton E">E Bickerton</name>
</author>
<author><name sortKey="Britton, P" uniqKey="Britton P">P Britton</name>
</author>
<author><name sortKey="Rodgers, Ma" uniqKey="Rodgers M">MA Rodgers</name>
</author>
<author><name sortKey="Whitehouse, A" uniqKey="Whitehouse A">A Whitehouse</name>
</author>
<author><name sortKey="Zhou, Em" uniqKey="Zhou E">EM Zhou</name>
</author>
<author><name sortKey="Hiscox, Ja" uniqKey="Hiscox J">JA Hiscox</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Crinion, Ra" uniqKey="Crinion R">RA Crinion</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Brionne, A" uniqKey="Brionne A">A Brionne</name>
</author>
<author><name sortKey="Nys, Y" uniqKey="Nys Y">Y Nys</name>
</author>
<author><name sortKey="Hennequet Antier, C" uniqKey="Hennequet Antier C">C Hennequet-Antier</name>
</author>
<author><name sortKey="Gautron, J" uniqKey="Gautron J">J Gautron</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Cong, F" uniqKey="Cong F">F Cong</name>
</author>
<author><name sortKey="Liu, X" uniqKey="Liu X">X Liu</name>
</author>
<author><name sortKey="Han, Z" uniqKey="Han Z">Z Han</name>
</author>
<author><name sortKey="Shao, Y" uniqKey="Shao Y">Y Shao</name>
</author>
<author><name sortKey="Kong, X" uniqKey="Kong X">X Kong</name>
</author>
<author><name sortKey="Liu, S" uniqKey="Liu S">S Liu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Liu, C" uniqKey="Liu C">C Liu</name>
</author>
<author><name sortKey="Xu, Hy" uniqKey="Xu H">HY Xu</name>
</author>
<author><name sortKey="Liu, Dx" uniqKey="Liu D">DX Liu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Nii, T" uniqKey="Nii T">T Nii</name>
</author>
<author><name sortKey="Isobe, N" uniqKey="Isobe N">N Isobe</name>
</author>
<author><name sortKey="Yoshimura, Y" uniqKey="Yoshimura Y">Y Yoshimura</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Goodbourn, S" uniqKey="Goodbourn S">S Goodbourn</name>
</author>
<author><name sortKey="Didcock, L" uniqKey="Didcock L">L Didcock</name>
</author>
<author><name sortKey="Randall, Re" uniqKey="Randall R">RE Randall</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Haller, O" uniqKey="Haller O">O Haller</name>
</author>
<author><name sortKey="Frese, M" uniqKey="Frese M">M Frese</name>
</author>
<author><name sortKey="Kochs, G" uniqKey="Kochs G">G Kochs</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Perreira, Jm" uniqKey="Perreira J">JM Perreira</name>
</author>
<author><name sortKey="Chin, Cr" uniqKey="Chin C">CR Chin</name>
</author>
<author><name sortKey="Feeley, Em" uniqKey="Feeley E">EM Feeley</name>
</author>
<author><name sortKey="Brass, Al" uniqKey="Brass A">AL Brass</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Smith, J" uniqKey="Smith J">J Smith</name>
</author>
<author><name sortKey="Sadeyen, Jr" uniqKey="Sadeyen J">JR Sadeyen</name>
</author>
<author><name sortKey="Paton, Ir" uniqKey="Paton I">IR Paton</name>
</author>
<author><name sortKey="Hocking, Pm" uniqKey="Hocking P">PM Hocking</name>
</author>
<author><name sortKey="Salmon, N" uniqKey="Salmon N">N Salmon</name>
</author>
<author><name sortKey="Fife, M" uniqKey="Fife M">M Fife</name>
</author>
<author><name sortKey="Nair, V" uniqKey="Nair V">V Nair</name>
</author>
<author><name sortKey="Burt, Dw" uniqKey="Burt D">DW Burt</name>
</author>
<author><name sortKey="Kaiser, P" uniqKey="Kaiser P">P Kaiser</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">BMC Vet Res</journal-id>
<journal-id journal-id-type="iso-abbrev">BMC Vet. Res</journal-id>
<journal-title-group><journal-title>BMC Veterinary Research</journal-title>
</journal-title-group>
<issn pub-type="epub">1746-6148</issn>
<publisher><publisher-name>BioMed Central</publisher-name>
<publisher-loc>London</publisher-loc>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">26452558</article-id>
<article-id pub-id-type="pmc">4600211</article-id>
<article-id pub-id-type="publisher-id">575</article-id>
<article-id pub-id-type="doi">10.1186/s12917-015-0575-6</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Research Article</subject>
</subj-group>
</article-categories>
<title-group><article-title>The early immune response to infection of chickens with Infectious Bronchitis Virus (IBV) in susceptible and resistant birds</article-title>
</title-group>
<contrib-group><contrib contrib-type="author" corresp="yes" equal-contrib="yes"><name><surname>Smith</surname>
<given-names>Jacqueline</given-names>
</name>
<address><email>Jacqueline.smith@roslin.ed.ac.uk</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes"><name><surname>Sadeyen</surname>
<given-names>Jean-Remy</given-names>
</name>
<address><email>jean-remy.sadeyen@pirbright.ac.uk</email>
</address>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Cavanagh</surname>
<given-names>David</given-names>
</name>
<address><email>davecavanagh1000@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Kaiser</surname>
<given-names>Pete</given-names>
</name>
<address><email>Pete.kaiser@roslin.ed.ac.uk</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Burt</surname>
<given-names>David W.</given-names>
</name>
<address><email>Dave.burt@roslin.ed.ac.uk</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<aff id="Aff1"><label></label>
The Roslin Institute & R(D)SVS, University of Edinburgh, Easter Bush, Midlothian, EH25 9RG UK</aff>
<aff id="Aff2"><label></label>
The Pirbright Institute, Compton Laboratory, Compton, Berkshire RG20 7NN UK</aff>
</contrib-group>
<pub-date pub-type="epub"><day>9</day>
<month>10</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="pmc-release"><day>9</day>
<month>10</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="collection"><year>2015</year>
</pub-date>
<volume>11</volume>
<elocation-id>256</elocation-id>
<history><date date-type="received"><day>1</day>
<month>7</month>
<year>2015</year>
</date>
<date date-type="accepted"><day>5</day>
<month>10</month>
<year>2015</year>
</date>
</history>
<permissions><copyright-statement>© Smith et al. 2015</copyright-statement>
<license license-type="OpenAccess"><license-p><bold>Open Access</bold>
This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<abstract id="Abs1"><sec><title>Background</title>
<p>Infectious Bronchitis is a highly contagious respiratory disease which causes tracheal lesions and also affects the reproductive tract and is responsible for large economic losses to the poultry industry every year. This is due to both mortality (either directly provoked by IBV itself or due to subsequent bacterial infection) and lost egg production. The virus is difficult to control by vaccination, so new methods to curb the impact of the disease need to be sought. Here, we seek to identify genes conferring resistance to this coronavirus, which could help in selective breeding programs to rear chickens which do not succumb to the effects of this disease.</p>
</sec>
<sec><title>Methods</title>
<p>Whole genome gene expression microarrays were used to analyse the gene expression differences, which occur upon infection of birds with Infectious Bronchitis Virus (IBV). Tracheal tissue was examined from control and infected birds at 2, 3 and 4 days post-infection in birds known to be either susceptible or resistant to the virus. The host innate immune response was evaluated over these 3 days and differences between the susceptible and resistant lines examined.</p>
</sec>
<sec><title>Results</title>
<p>Genes and biological pathways involved in the early host response to IBV infection were determined andgene expression differences between susceptible and resistant birds were identified. Potential candidate genes for resistance to IBV are highlighted.</p>
</sec>
<sec><title>Conclusions</title>
<p>The early host response to IBV is analysed and potential candidate genes for disease resistance are identified. These putative resistance genes can be used as targets for future genetic and functional studies to prove a causative link with resistance to IBV.</p>
</sec>
<sec><title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/s12917-015-0575-6) contains supplementary material, which is available to authorized users.</p>
</sec>
</abstract>
<kwd-group xml:lang="en"><title>Keywords</title>
<kwd>Chicken</kwd>
<kwd>Infectious bronchitis virus</kwd>
<kwd>Microarray</kwd>
<kwd>Disease resistance</kwd>
<kwd>Candidate gene</kwd>
</kwd-group>
<custom-meta-group><custom-meta><meta-name>issue-copyright-statement</meta-name>
<meta-value>© The Author(s) 2015</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body><sec id="Sec1" sec-type="introduction"><title>Background</title>
<p>Infectious bronchitis (IB) is a highly contagious respiratory disease of chickens first described in the USA in the 1930’s [<xref ref-type="bibr" rid="CR1">1</xref>
–<xref ref-type="bibr" rid="CR3">3</xref>
]. Clinical signs include: coughing, sneezing, rales and nasal discharge. The disease can also affect the reproductive organs, which leads to a decrease in egg quality and production, thus making it a major cause of economic losses within the poultry industry [<xref ref-type="bibr" rid="CR4">4</xref>
]. The causative virus, Infectious Bronchitis Virus (IBV) is a coronavirus, which is an enveloped virus with a single positive-stranded RNA genome, which replicates in the host cell cytoplasm [<xref ref-type="bibr" rid="CR5">5</xref>
]. Proteins encoded by IBV include the viral RNA polymerase, structural spike proteins, membrane and nucleocapsid and various other regulatory proteins. The spike glycoprotein mediates cell attachment and plays a significant role in host cell specificity [<xref ref-type="bibr" rid="CR6">6</xref>
].</p>
<p>The existence of many different IBV serotypes, which are not cross-protective means that control of IB, is very difficult. Mortality is usually fairly low (~5 %), however some strains of the virus can also cause nephritis meaning that, depending on strain, mortality can be greater than 50 % [<xref ref-type="bibr" rid="CR7">7</xref>
, <xref ref-type="bibr" rid="CR8">8</xref>
] or even up to 80 % with some Australian isolates [<xref ref-type="bibr" rid="CR9">9</xref>
]. IBV infection leaves birds more susceptible to colibacillosis [<xref ref-type="bibr" rid="CR10">10</xref>
] and subsequent bacterial infections can also lead to a high level of mortality [<xref ref-type="bibr" rid="CR11">11</xref>
]. Currently, attenuated live vaccines are used in broilers and pullets, and killed vaccines are used in layers and breeders [<xref ref-type="bibr" rid="CR12">12</xref>
]. However, virus control is very difficult, as there are only a few vaccine types and many different strains of IBV. The virus also continues to mutate rapidly, generating more virulent strains of the disease [<xref ref-type="bibr" rid="CR13">13</xref>
–<xref ref-type="bibr" rid="CR15">15</xref>
]. Coronaviruses have now also been detected in other avian species such as turkey, duck, goose, pheasant, guinea fowl, teal, pigeon, peafowl and partridge [<xref ref-type="bibr" rid="CR4">4</xref>
].</p>
<p>The extent to which the virus affects the host is highly dependent on the chicken breed [<xref ref-type="bibr" rid="CR4">4</xref>
] and the MHC B locus is known to play a role in susceptibility to the virus [<xref ref-type="bibr" rid="CR16">16</xref>
]. In this study we attempt to identify non-MHC genes, which may be involved in resistance to IBV. No genetic analyses have thus far been undertaken in order to try and do this and no quantitative trait loci or genes associated with resistance have been determined, so far. Based on differential gene expression in susceptible and resistant lines of chickens, we identify potential candidate genes for disease resistance towards IBV (virulent M41 strain). Building on the previous work by Dar et al. [<xref ref-type="bibr" rid="CR17">17</xref>
] and Wang et al. [<xref ref-type="bibr" rid="CR18">18</xref>
] we used Affymetrix whole-genome chicken microarrays to examine the tracheal gene expression profiles of a line of birds known to be susceptible to IBV infection (line 15I) and a line known to show resistance (line N). We determined the early host response to infection and propose possible candidate genes for involvement in disease resistance towards IBV. Understanding how coronaviruses infect the host and identifying genes involved in resistance is important not only for the poultry industry but also has important implications for human health, as diseases such as SARS are also caused by coronaviruses [<xref ref-type="bibr" rid="CR19">19</xref>
, <xref ref-type="bibr" rid="CR20">20</xref>
].</p>
</sec>
<sec id="Sec2" sec-type="materials|methods"><title>Methods</title>
<sec id="Sec3"><title>Ethics statement</title>
<p>All animal work was conducted according to UK Home Office guidelines and approved by the Roslin Institute Animal Welfare and Ethical Review Body.</p>
</sec>
<sec id="Sec4"><title>Experimental animals</title>
<p>The lines used in these experiments are an IBV susceptible line – line 15I (inbred White Leghorn strain) [<xref ref-type="bibr" rid="CR21">21</xref>
] and an IBV resistant line – line N (non-inbred Cornell strain). Line 15I was developed at East Lansing in the USA in the 1940s [<xref ref-type="bibr" rid="CR22">22</xref>
] and Line N at Cornell, USA in the 1960s [<xref ref-type="bibr" rid="CR23">23</xref>
]. The lines have since been maintained at the Institute for Animal Health in Compton, UK. Two-week-old chicks from each line (15I and N) were separated into two experimental rooms, with <italic>ad libitum</italic>
access to food and water. In one room, 54 birds (27 from each line) were infected with 4 log<sub>10</sub>
CID<sub>50</sub>
(10<sup>4</sup>
CID<sub>50</sub>
) of virulent IBV-M41 strain in a total of 100 μl of 0.2 % BSA in PBS equally by intra nasal and ocular routes. In the other room, 54 control birds (27 from each line) received 100ul PBS via the same route. Trachea samples (upper half) were collected at 2, 3 and 4 days post-infection (9 individual birds from each line at each time point). The trachea of infected and control birds from each line were analysed for viral load using Taqman real-time quantitative RT-PCR assays.</p>
</sec>
<sec id="Sec5"><title>RNA preparation</title>
<p>Tissue samples (~30 mg) were stabilized in RNAlater (Ambion, Life Technologies, Paisley, UK) and disrupted using a bead mill (Retsch MM 300, Retsch, Haan, Germany) at 20 Hz for 4 min. Total RNA was prepared using an RNeasy kit (Qiagen, Crawley, UK) extraction method as per the manufacturer’s protocol. Samples were resuspended in a final volume of 50 μl of RNAse-free water. Concentrations of the samples were calculated by measuring OD<sub>260</sub>
and OD<sub>280</sub>
on a spectrophotometer (Nanodrop, Thermo Scientific, Paisley, UK). Quality of the RNA was checked on a bioanalyser (Agilent Technologies, South Queensferry, UK). An RNA integrity number (RIN) > 8 proved the integrity of the RNA.</p>
</sec>
<sec id="Sec6"><title>Whole genome gene expression microarray hybridization</title>
<p>Biotinylated fragmented cRNA was hybridized to the Affymetrix Chicken Genome Array. This array contains comprehensive coverage of 32,773 transcripts corresponding to over 28,000 chicken genes. The Chicken Genome Array also contains 689 probe sets for detecting 684 transcripts from 17 avian viruses. For each experimental group (control and infected birds in each of the two lines at each of 2, 3 and 4 dpi), three biological replicates (3 RNA pools from 3 birds) were hybridized. Thus, 36 arrays were used in total. Hybridization was performed at 45 °C for 16 hours in a hybridization oven with constant rotation (60 rpm). The microarrays were then automatically washed and stained with streptavidin-phycoerythrin conjugate (SAPE; Invitrogen, Paisley, UK) in a Genechip Fluidics Station (Affymetrix, Santa Clara, CA). Fluorescence intensities were scanned with a GeneArray Scanner 3000 (Affymetrix, Santa Clara, CA). The scanned images were inspected and analyzed using established quality control measures. Array data have been submitted to Array Express (<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/arrayexpress/">http://www.ebi.ac.uk/arrayexpress/</ext-link>
) under the Accession Number E-TABM-1128.</p>
</sec>
<sec id="Sec7"><title>Statistical analysis</title>
<p>Gene expression data generated from the GeneChip Operating Software (GCOS) was normalised using the PLIER (probe logarithmic intensity error) method [<xref ref-type="bibr" rid="CR24">24</xref>
] within the Affymetrix Expression Console software package. This normalised data was then analysed using the limma and FARMS [<xref ref-type="bibr" rid="CR25">25</xref>
] packages within R in Bioconductor [<xref ref-type="bibr" rid="CR26">26</xref>
]. Probes with a False Discovery Rate (FDR) value <0.05 and a fold change ≥1.5 were deemed to be biologically significant.</p>
</sec>
<sec id="Sec8"><title>Analysis of differentially-expressed genes</title>
<p>In order to determine which biological pathways are involved in the responses to viral infection, we analysed our differentially-expressed (DE) genes using Pathway Express [<xref ref-type="bibr" rid="CR27">27</xref>
, <xref ref-type="bibr" rid="CR28">28</xref>
] which uses KEGG pathways [<xref ref-type="bibr" rid="CR29">29</xref>
] to pictorially display up/down regulation of genes. (NB. These diagrams are based on the human pathways and so are not completely representative of the chicken pathways). Genes differentially expressed during the host response (FDR <0.05) were analysed against a reference background consisting of all genes expressed in the experiment. Factors considered by Pathway Express include the magnitude of a gene’s expression change and its position and interactions in any given pathway, thus including an ‘impact factor’ when calculating statistically significant pathways. Anything with a <italic>p</italic>
-value <0.25 is deemed significant when using this software. Use of the Ingenuity Pathway Analysis (IPA) program [<xref ref-type="bibr" rid="CR30">30</xref>
] revealed which canonical pathways are being switched on by IBV infection in the host (with Benjamini-Hochberg multiple testing correction) and allowed us to analyze the gene interaction networks involved in the host response. Genes were clustered by similar expression pattern and analysed for enriched GO-terms and transcription factor binding sites (TFBS) using Expander (v5.2) [<xref ref-type="bibr" rid="CR31">31</xref>
]. Normalised expression data from control samples were compared with infected samples to examine the host response to IBV infection. Enrichment analysis of particular GO terms or TFBS within clusters was done using the TANGO and PRIMA functions, respectively, within the Expander package.</p>
</sec>
<sec id="Sec9"><title>Viral quantification and specific gene expression analysis by quantitative real-time PCR</title>
<p>Taqman real-time quantitative RT-PCR (qRT-PCR) was used to quantify viral RNA levels and for confirmation of the microarray results for the mRNA levels of selected genes. This was performed on 3 replicate pools of 3 samples (9 birds). Primers (Sigma) and probe (PE Applied Biosystems, Warrington, UK) (Table <xref rid="Tab1" ref-type="table">1</xref>
) were designed using Primer Express (PE Applied Biosystems). Briefly, the assays were performed using 2 μL of total RNA and the Taqman FAST Universal PCR Master Mix and one-step RT-PCR mastermix reagents (PE Applied Biosystems) in a 10 μL reaction. Amplification and detection of specific products were performed using the Applied Biosystems 7500 Fast Real-Time PCR System with the following cycle profile: one cycle at 48 °C for 30 min and 95 °C for 20 sec, followed by 40 cycles at 95 °C for 3 sec and 60 °C for 30 sec. Data are expressed in terms of the cycle threshold (Ct) value, normalised for each sample using the Ct value of 28S rRNA product for the same sample, as well described previously [<xref ref-type="bibr" rid="CR32">32</xref>
–<xref ref-type="bibr" rid="CR34">34</xref>
]. Final results are shown as 40-Ct using the normalised value, or as fold-change from uninfected controls.<table-wrap id="Tab1"><label>Table 1</label>
<caption><p>Primers used in QRT-PCR analysis</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Gene</th>
<th>Forward primer</th>
<th>Reverse primer</th>
<th>Probe primer</th>
<th>Opt. primer conc.</th>
<th>Probe (μM)</th>
<th>GenBank</th>
</tr>
</thead>
<tbody><tr><td>28S</td>
<td>GGCGAAGCCAGAGGAAACT</td>
<td>GAC GACCGATTTGCACGTC</td>
<td>AGGACCGCTACGGACCTCCACCA</td>
<td>0.6</td>
<td>5</td>
<td>FM165415</td>
</tr>
<tr><td>C1S</td>
<td>GCGCAAAGGCTGGAAAATAC</td>
<td>TCAAGAACAGAATTGGGAGTGACA</td>
<td>TACTATGCTGAACCCATAACCTGTCTCCCG</td>
<td>0.6</td>
<td>5</td>
<td>NM_001030777</td>
</tr>
<tr><td>CCL13</td>
<td>CAGAGCCTGGCCCAGAGA</td>
<td>TGTCCATTTTGATTCTTCTGGTATG</td>
<td>CTGTGCCTGACAAGTGCTGCTTCAACTT</td>
<td>0.2</td>
<td>5</td>
<td>XM_415779</td>
</tr>
<tr><td>CCLi7 (ah221)</td>
<td>CACAACCTGCTGCTTCTCCTATG</td>
<td>TGTAGGCGGAGGCAATGAG</td>
<td>TCAACGTCCCGTCCCACGCA</td>
<td>0.2</td>
<td>5</td>
<td>AY037860</td>
</tr>
<tr><td>CD38</td>
<td>GCTTGATGGGCTTTCATGGT</td>
<td>CACATTCACTCCATTTTGGACAA</td>
<td>ACCCCTCAGCTCCAGGAATCAACTATGAA</td>
<td>0.6</td>
<td>5</td>
<td>XM_420774</td>
</tr>
<tr><td>CLU</td>
<td>TGAGTCAGAATCCCGTAACTTCAG</td>
<td>GCAGTCCACAGCCAAGATCTC</td>
<td>AGATCCGGCGCAACTCGGCC</td>
<td>0.2</td>
<td>5</td>
<td>NM_204900</td>
</tr>
<tr><td>COX11</td>
<td>TGGGATCTCCACCTACAACGTA</td>
<td>CAGCCACTGTTCTTCAAAACAAA</td>
<td>TGCCCTTCGAAGCAGGACAGTACTTCA</td>
<td>0.4</td>
<td>5</td>
<td>XM_001233972</td>
</tr>
<tr><td>DDT</td>
<td>GGCCCCGAGCGGATT</td>
<td>CATGACTGTTCTGTTCTTGCCAAT</td>
<td>CATTCGCTTTTACCCGCTGGAGCC</td>
<td>0.8</td>
<td>5</td>
<td>NM_001030667</td>
</tr>
<tr><td>FK-506-BP51</td>
<td>CGGAGGATCAAGAGGAAAGGA</td>
<td>CAGAACCCCTCCAGGTGAATT</td>
<td>AAGGCTATTCCAACCCCAACGAAGGTG</td>
<td>0.1</td>
<td>5</td>
<td>NM_001005431</td>
</tr>
<tr><td>HSC20</td>
<td>GGAAATCATGGAAATCAATGAGAAA</td>
<td>CACCTCTTTGGTCAGTTCTTCTTG</td>
<td>CAGAGCCCGAGAACGACGAGATCC</td>
<td>0.8</td>
<td>5</td>
<td>XR_026662</td>
</tr>
<tr><td>IFNAR2</td>
<td>TGGTCACTGCATCTCTAAATAAACATT</td>
<td>CTGCAATTGTGATGCCATAATAATC</td>
<td>CATCCCATCAGCCTGGAAATGCATAACT</td>
<td>0.4</td>
<td>5</td>
<td>NM_204858</td>
</tr>
<tr><td>IGFBP5</td>
<td>GAAGAGCAGCCAGAGGATGGT</td>
<td>GCTTGCACTGCTTCCTCTTGT</td>
<td>CACCTCCCCAACTGCGACCGAAA</td>
<td>0.1</td>
<td>5</td>
<td>XM_422069</td>
</tr>
<tr><td>IRF-7</td>
<td>ACCCGGACCGCCGTAT</td>
<td>GCCCAGGCCTTGAAGATCTC</td>
<td>CATCCCTTGGAAGCACAACGCCA</td>
<td>0.6</td>
<td>5</td>
<td>NM_205372</td>
</tr>
<tr><td>MAFK</td>
<td>GCGATGATGAACTCGTGTCAA</td>
<td>TTCAGACGGATGACCTCCTCTT</td>
<td>TCCGTACGGGAGCTGAACCAGCAC</td>
<td>0.4</td>
<td>5</td>
<td>NM_204756</td>
</tr>
<tr><td>MAP4K4</td>
<td>TGCTATTGAAATGGCTGAAGGA</td>
<td>TCCGTGGGATGAGGAAGAGT</td>
<td>TCCTCCCCTGTGTGACATGCACCC</td>
<td>0.2</td>
<td>5</td>
<td>NM_001031126</td>
</tr>
<tr><td>MMD2</td>
<td>TGCCACGCACGCATTCT</td>
<td>GGTCATCGGAGAGGACGTAGAG</td>
<td>TCCTGCCCAGCATCCTCGGC</td>
<td>0.4</td>
<td>5</td>
<td>XM_414787</td>
</tr>
<tr><td>MX1</td>
<td>TGGACTTCTGCAACGAATTGTC</td>
<td>ATCCAGAAGAGTGCTGAAATGTTTG</td>
<td>TTCACCTCCGCAATCCAGCAAGAGA</td>
<td>0.6</td>
<td>5</td>
<td>NM_204609</td>
</tr>
<tr><td>SRI</td>
<td>TACTATCAGGGCGGGTATGGA</td>
<td>AGCAAAATAACCATACAGAGGATCCT</td>
<td>CAGCTCCAGGAGGCCCATCATTCC</td>
<td>0.1</td>
<td>5</td>
<td>NM_001080865</td>
</tr>
<tr><td>SUCLG2</td>
<td>AGCTTCCCGGCTGTTCAAT</td>
<td>CATGGTCTGCCATCAGCTTTT</td>
<td>AACCCCTAGACGATGGCTGAATCTGCA</td>
<td>0.1</td>
<td>5</td>
<td>NM_001006141</td>
</tr>
<tr><td>TLR3</td>
<td>ATCCATGGTGCAGGAAGTTTAAG</td>
<td>GATGGAGTCTCGACTTTGCTCAATA</td>
<td>TGCATCATGCTTTACAGC</td>
<td>1.0</td>
<td>5</td>
<td>JF273967.1</td>
</tr>
<tr><td>TNFAIP1</td>
<td>GTTGTGGGAAGCACTTTGGAA</td>
<td>TCAACTCCTTGATCTCCTGTCTGT</td>
<td>CCGAGATGACACAATTGCACTTCCAAAA</td>
<td>0.2</td>
<td>5</td>
<td>NM_001030726</td>
</tr>
<tr><td>TP-D53</td>
<td>TGGCCAAGCTAGAGGATGAAA</td>
<td>TCAGGCTCATGCCAAGTTTTT</td>
<td>ACTAGCAGCCAAAGAAAAGCACCTGATTGA</td>
<td>0.2</td>
<td>5</td>
<td>NM_204215</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
</sec>
<sec id="Sec10" sec-type="results"><title>Results and discussion</title>
<sec id="Sec11"><title>Assessment of viral load</title>
<p>Taqman real-time quantitative RT-PCR analysis was used to measure viral load in trachea samples from both control and infected birds from both lines 15I and N. Tracheal tissue was chosen for examination in this study as the target of IBV is the epithelial surface of the respiratory tract. Viral RNA was detected in infected birds, but no significant difference in viral load was detected between lines at any of the days 2, 3 or 4 post infection (Fig. <xref rid="Fig1" ref-type="fig">1</xref>
). This would indicate that the resistance to the virus seen in Line N is due to how the birds respond to the virus once it has entered the body and is not a measure of how the birds can prevent initial infection by the virus itself. When resistance to IBV infection was originally determined in these lines, it was noted that they were equally susceptible to infection, but a variation in outcome was seen. In line N, 33 % of birds showed air sac lesions whereas 73 % of 15I birds presented lesions. Mortality was 0 in line N, but 47 % within line 15I birds. It was hypothesized that the different lines were producing different immunological responses upon infection [<xref ref-type="bibr" rid="CR21">21</xref>
].<fig id="Fig1"><label>Fig. 1</label>
<caption><p>QRT-PCR measurement of viral load in control and infected birds from lines 15I and N. Mean 40-Ct values are shown with the standard error mean indicated</p>
</caption>
<graphic xlink:href="12917_2015_575_Fig1_HTML" id="MO1"></graphic>
</fig>
</p>
</sec>
<sec id="Sec12"><title>Host response to IBV infection</title>
<p>Gene expression differences found in the susceptible 15I line between infected and control birds over days 2, 3 and 4 post infection were analysed, with a view to examining the innate host response to infection by IBV. Genes seen to be induced during the host response to infection include <italic>C1S</italic>
, <italic>IRF1</italic>
, <italic>STAT1</italic>
, <italic>MX1</italic>
, <italic>TLR3</italic>
and <italic>CTSS</italic>
as previously recognised by Guo et al. [<xref ref-type="bibr" rid="CR35">35</xref>
]. We also identified <italic>IFIT5</italic>
, <italic>OASL</italic>
, <italic>SCA2</italic>
, <italic>LYG2</italic>
, <italic>ISG12-2</italic>
, <italic>DDX60</italic>
, <italic>IFIH1</italic>
, <italic>IRF7</italic>
, <italic>ZC3HAV1</italic>
, <italic>DHX58</italic>
, <italic>CCli7</italic>
, <italic>IFITM1</italic>
and <italic>IFITM3</italic>
as being up-regulated in response to IBV infection. Few genes are seen to be down-regulated during the early stage of the host response, but those which are include <italic>CHAC1</italic>
(pro-apoptotic), <italic>HBB</italic>
(implicated in inflammation regulation) and <italic>PDK4</italic>
(glucose regulation). For a full list of the genes involved in the tracheal immune response (133 DE probes), see Additional file <xref rid="MOESM1" ref-type="media">1</xref>
: Table S1.</p>
<p>To elucidate which biological pathways are being perturbed during the host response to IBV infection, we analysed our data using Pathway Express [<xref ref-type="bibr" rid="CR36">36</xref>
]. The resulting pathway diagrams are extremely useful in establishing which gene networks are involved in a particular experimental response. As seen in Fig. <xref rid="Fig2" ref-type="fig">2</xref>
, genes involved in antigen presentation and the Toll-like receptor (TLR) pathway are up-regulated. TLRs identify pathogen associated molecular patterns (PAMPs) and are crucial to the innate immune system. In this study <italic>TLR3</italic>
is shown to be induced at 3 dpi. TLR3 recognizes double-stranded RNA intermediates produced during viral replication and has previously been shown to be induced in the trachea at this time after IBV infection [<xref ref-type="bibr" rid="CR37">37</xref>
]. Another pathway involved is the phosphatidylinositol signalling pathway (Table <xref rid="Tab2" ref-type="table">2</xref>
). Phosphatidylinositol kinases are known to play an important role in the viral life cycle after infection of the host and PI4KB is known to be exploited by coronaviruses for viral entry. The product of PI4KB catalysis is phosphatidylinositol 4-phosphate (PI4P) and coronavirus entry into the host is mediated by the PI4P lipid microenvironment [<xref ref-type="bibr" rid="CR38">38</xref>
]. Genes involved in the complement system are also highlighted as being up-regulated in response to IBV infection. Complement-mediated lysis of viruses is an important facet of the host innate immune system and its role in defence against viral infection [<xref ref-type="bibr" rid="CR39">39</xref>
] – as reflected in the induction of these genes in this study.<fig id="Fig2"><label>Fig. 2</label>
<caption><p>Pathway Express analysis of the host response to IBV infection in the trachea of susceptible birds (Line 15I). Many genes involved in antigen processing and presentation (<bold>a</bold>
) and in the Toll-like receptor pathway (<bold>b</bold>
) can be seen to be up-regulated (shown in red)</p>
</caption>
<graphic xlink:href="12917_2015_575_Fig2_HTML" id="MO2"></graphic>
</fig>
<table-wrap id="Tab2"><label>Table 2</label>
<caption><p>Pathway Express analysis of the host response to IBV infection</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Rank</th>
<th>Pathway name</th>
<th>Impact Factor</th>
<th>Input genes/Genes in Pathway</th>
<th>Corrected gamma <italic>p</italic>
-value</th>
</tr>
</thead>
<tbody><tr><td>1</td>
<td>Antigen processing and presentation</td>
<td>14.244</td>
<td>6/89</td>
<td>9.93E-06</td>
</tr>
<tr><td>2</td>
<td>Toll-like receptor signaling pathway</td>
<td>7.927</td>
<td>5/102</td>
<td>0.003221463</td>
</tr>
<tr><td>3</td>
<td>Notch signaling pathway</td>
<td>7.073</td>
<td>3/47</td>
<td>0.006843371</td>
</tr>
<tr><td>4</td>
<td>Pancreatic cancer</td>
<td>4.448</td>
<td>3/72</td>
<td>0.06375221</td>
</tr>
<tr><td>5</td>
<td>Maturity onset diabetes of the young</td>
<td>3.952</td>
<td>1/24</td>
<td>0.095158775</td>
</tr>
<tr><td>6</td>
<td>Phosphatidylinositol signaling system</td>
<td>3.884</td>
<td>2/76</td>
<td>0.100456001</td>
</tr>
<tr><td>7</td>
<td>Complement and coagulation cascades</td>
<td>3.841</td>
<td>3/69</td>
<td>0.103946526</td>
</tr>
<tr><td>8</td>
<td>mTOR signaling pathway</td>
<td>3.652</td>
<td>2/52</td>
<td>0.120669151</td>
</tr>
<tr><td>9</td>
<td>Acute myeloid leukemia</td>
<td>3.448</td>
<td>2/59</td>
<td>0.141487282</td>
</tr>
<tr><td>10</td>
<td>Systemic lupus erythematosus</td>
<td>3.332</td>
<td>2/144</td>
<td>0.15474593</td>
</tr>
<tr><td>11</td>
<td>VEGF signaling pathway</td>
<td>3.126</td>
<td>2/74</td>
<td>0.181102595</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p>Use of Ingenuity Pathway Analysis (IPA) software also allowed us to determine which biological systems are active during the host response. Up-regulated genes are seen to be part of the canonical biological pathways shown in Fig. <xref rid="Fig3" ref-type="fig">3a</xref>
. Biological processes involving pattern recognition receptors and interferon signalling feature heavily. The interferon response is a powerful antiviral mechanism, which has previously been shown to be involved in the host response after IBV infection. A very early induction of IFN-γ has been reported in splenocytes [<xref ref-type="bibr" rid="CR40">40</xref>
], and in peripheral blood mononuclear cells (PBMCs) and lung leukocytes [<xref ref-type="bibr" rid="CR41">41</xref>
]. <italic>IFNB</italic>
expression has also been reported in trachea between 1 and 2 dpi [<xref ref-type="bibr" rid="CR42">42</xref>
]. We do not see this increase in expression of interferon genes (due to the absence of data earlier than 2 dpi), but we do see the downstream effects, with increased expression of many interferon-induced genes. Specific physiological processes activated upon IBV infection can also be seen in Fig. <xref rid="Fig3" ref-type="fig">3b</xref>
. The stimulation of various different immune cells is seen along with the indication of reproductive abnormality, which would reflect the problems seen with egg-laying upon IBV infection.<fig id="Fig3"><label>Fig. 3</label>
<caption><p>Ingenuity Pathway Analysis (IPA) of genes responding to IBV infection. <bold>a</bold>
Canonical biological pathways which are activated in the host upon IBV infection (<italic>p</italic>
< 0.05). The line represents the ratio of genes represented within each pathway. <bold>b</bold>
The most highly represented (<italic>p</italic>
< 0.05) physiological functions of genes differentially expressed during the host response to IBV (in the trachea in susceptible birds (Line 15I)). Specific functions within groups are highlighted</p>
</caption>
<graphic xlink:href="12917_2015_575_Fig3_HTML" id="MO3"></graphic>
</fig>
</p>
<p>In order to cluster genes seen to be involved in the host response to infectious bronchitis into groups with similar expression profiles and probably sharing similar functions or gene regulatory pathways, we utilised the CLICK algorithm within the Expander program [<xref ref-type="bibr" rid="CR43">43</xref>
]. Figure <xref rid="Fig4" ref-type="fig">4a</xref>
shows the expression profile of genes up-regulated during the response to virus. The Expander program was also used to analyse the Gene Ontology (GO) functional annotations of the genes being differentially expressed. Figure <xref rid="Fig4" ref-type="fig">4b</xref>
shows the biological process terms, which are significantly enriched in the genes responding during the host response to infection. As would be expected, these include terms like ‘innate immune response’ and ‘antigen processing and presentation’. ‘NAD + ADP-ribosyltransferase activity’ and ‘phosphoinositide binding’ are also highlighted. Transcription factor binding sites present in DE genes which are significantly over-represented were also predicted. Figure <xref rid="Fig4" ref-type="fig">4c</xref>
shows that genes up-regulated during the host response have a high proportion of <italic>IRF7</italic>
and ISRE binding sites. <italic>IRF7</italic>
is a transcriptional activator, which binds to the interferon-stimulated response element (ISRE) in IFN promoters and functions as a molecular switch for antiviral activity.<fig id="Fig4"><label>Fig. 4</label>
<caption><p>Gene expression cluster analysis of the host response in susceptible birds (Line 15I) using the Expander program (<ext-link ext-link-type="uri" xlink:href="http://acgt.cs.tau.ac.il/expander/expander.html">http://acgt.cs.tau.ac.il/expander/expander.html</ext-link>
). <bold>a</bold>
The expression profile of genes up-regulated during the response to virus. <bold>b</bold>
The GO biological process terms which are significantly enriched during the host response to infection. The frequency of genes of a functional class within the examined set is described as a percentage. <bold>c</bold>
Binding sites for the transcription factors IRF7 and ISRE are seen to be significantly over-represented in genes up-regulated during the host response to IBV infection. The frequency ratio (frequency in set divided by frequency in background) is shown</p>
</caption>
<graphic xlink:href="12917_2015_575_Fig4_HTML" id="MO4"></graphic>
</fig>
</p>
</sec>
<sec id="Sec13"><title>Differences between susceptible and resistant lines</title>
<p>Analysis of the gene expression differences between infected and control birds across the two lines has provided us with information on how these lines differ in their response to infection. Examination of the gene expression profiles in the control birds of the two different lines also allowed us to identify genes, which are inherently different between the susceptible and resistant birds. It can be seen that there are numerous genes, which show large expression differences between the two lines, even before infection. Dramatic differences in gene expression of certain genes, including <italic>DDT</italic>
, <italic>SRI</italic>
, <italic>BLB1</italic>
, <italic>HSCB</italic>
, <italic>BF1</italic>
, <italic>BF2</italic>
, <italic>SUCLG2, MX1</italic>
and <italic>SRI,</italic>
which are more highly expressed in the resistant N line compared to the susceptible 15I line are noted (Additional file <xref rid="MOESM2" ref-type="media">2</xref>
: Table S2 shows all 1930 DE probes) So, it can be seen that these are genes which have inherently different expression levels between susceptible and resistant birds, even before infection occurs. We therefore postulate that some of these genes may play an important role in disease resistance. The potential interactome of IBV has recently been investigated by stable isotope labelling with amino acids in cell culture (SILAC) coupled to a green fluorescent protein-nanotrap pull-down methodology [<xref ref-type="bibr" rid="CR44">44</xref>
]. Host proteins, which bind to the IBV N protein were identified, some of the genes for which, we see as being inherently expressed at higher levels in susceptible birds in this study. These genes include <italic>MYH9</italic>
, <italic>CAPRIN1</italic>
, <italic>DHX57</italic>
, <italic>HNRNPH3</italic>
, <italic>RPL27A</italic>
, <italic>FMR1</italic>
, <italic>C22orf28</italic>
, <italic>HNRPDL</italic>
, <italic>SFRS3</italic>
, <italic>RPL31</italic>
, <italic>NPM1</italic>
and <italic>RPSA</italic>
. This may therefore be one of the reasons why Line 15I is more susceptible to IBV infection – there are more host proteins to which the virus binds, compared with the resistant Line N.</p>
<p>Upon infection, differences in response are also seen between the two lines. Interestingly, apart from <italic>CD38</italic>
and <italic>CD4</italic>
at 3 dpi and <italic>FKBP5</italic>
at 4 dpi, all other differential gene expression between the lines is seen at 2 dpi in this study (Additional file <xref rid="MOESM3" ref-type="media">3</xref>
: Table S3). CD38 is a glycoprotein found on the surface of many immune cells including CD4+, CD8+, B lymphocytes and natural killer cells and is a marker of cell activation. It functions in cell adhesion, signal transduction and calcium signalling. CD4 is found on the surface of immune cells such as T helper cells, monocytes, macrophages and dendritic cells. It is a membrane glycoprotein which interacts with MHCII antigens. The protein functions to initiate or augment the early phase of T-cell activation. The protein encoded by <italic>FKBP5</italic>
is a member of the immunophilin protein family, which play a role in immuno-regulation and basic cellular processes involving protein folding and trafficking. Early defence by the host is a key mechanism for combatting viral infection, and induction of <italic>IFNB</italic>
and other innate genes in response to IBV infection has been shown to peak around 18–36 hr post infection [<xref ref-type="bibr" rid="CR42">42</xref>
].</p>
<p>In this study, genes more highly expressed (or less down-regulated) in the resistant N line at 2 dpi include a number of collagen genes (<italic>COL3A1</italic>
, <italic>COL1A2</italic>
, <italic>COL9A1</italic>
, <italic>COL9A2</italic>
, <italic>COL6A1</italic>
and <italic>COL4A1</italic>
) and other genes such as <italic>ACAN</italic>
, <italic>FSTL1</italic>
, <italic>COMP</italic>
, <italic>EIF3A</italic>
, <italic>STAT3</italic>
and <italic>IGFBP5</italic>
. Genes seen to be more highly expressed (or less down-regulated) in the susceptible 15I line include <italic>RBM39</italic>
, <italic>MAFB</italic>
, <italic>NNK2</italic>
, <italic>CCN1</italic>
, <italic>MGAT5</italic>
and <italic>THRAP3</italic>
. One consequence of IBV infection is the production of poor quality, misshapen eggs by infected birds [<xref ref-type="bibr" rid="CR45">45</xref>
]. Some of the genes previously identified as being important for the creation of a healthy eggshell are seen to be more highly expressed by the resistant N line birds after infection in this study. These genes include <italic>COL1A2</italic>
, <italic>CRELD2</italic>
, <italic>HSP90B1</italic>
, <italic>P4HB</italic>
and <italic>ERP29</italic>
[<xref ref-type="bibr" rid="CR46">46</xref>
]. For a full list of genes differentially expressed between the two lines in trachea (409 DE probes) see Additional file <xref rid="MOESM3" ref-type="media">3</xref>
: Table S3.</p>
<p>IPA analysis of genes showing different inherent expression between lines 15I and N shows that the molecular functions of these genes is primarily concerned with their involvement in cell death and cell adhesion (Fig. <xref rid="Fig5" ref-type="fig">5</xref>
), two processes previously shown to be significant in infected kidneys [<xref ref-type="bibr" rid="CR47">47</xref>
]. When the differential host responses to infection are examined, it is seen that genes involved in proliferation of T-lymphocytes and genes concerned with cell attachment and cytoplasmic organization are more highly expressed in the resistant line N. Other processes significantly involved are apoptosis and necrosis (Fig. <xref rid="Fig6" ref-type="fig">6a</xref>
), which have been previously documented in IBV-infected Vero cells by Liu et al. [<xref ref-type="bibr" rid="CR48">48</xref>
]. One of the most perturbed biological networks noted in this analysis is that involving genes related to connective tissue disorders and involve many collagen genes. These genes are more highly expressed in susceptible line 15I birds compared to resistant line N birds (Fig. <xref rid="Fig6" ref-type="fig">6b</xref>
) suggesting that IBV infection might cause more disorder of eggshell formation in this line [<xref ref-type="bibr" rid="CR49">49</xref>
]. The production of poor quality eggs by IBV infected birds may, in part be a reflection of the expression of these kinds of gene networks compared to that seen in resistant birds.<fig id="Fig5"><label>Fig. 5</label>
<caption><p>Ingenuity Pathway Analysis (IPA) of genes showing inherent differential expression between susceptible and resistant control birds. This graph shows the most highly represented (<italic>p</italic>
< 0.05) molecular functions of DE genes</p>
</caption>
<graphic xlink:href="12917_2015_575_Fig5_HTML" id="MO5"></graphic>
</fig>
<fig id="Fig6"><label>Fig. 6</label>
<caption><p>Ingenuity Pathway Analysis (IPA) of genes showing differential expression between susceptible and resistant lines during the host response to IBV infection. <bold>a</bold>
The most highly represented (<italic>p</italic>
< 0.05) molecular functions of DE genes. <bold>b</bold>
This biological network shows genes associated with connective tissue disorders. Genes shown in red are more highly expressed in the resistant line and those in green have higher expression in the susceptible line</p>
</caption>
<graphic xlink:href="12917_2015_575_Fig6_HTML" id="MO6"></graphic>
</fig>
</p>
</sec>
<sec id="Sec14"><title>Confirmation of differential gene expression by quantitative real-time PCR</title>
<p>Twenty-one genes were selected for qRT-PCR validation (Table <xref rid="Tab3" ref-type="table">3</xref>
). These genes were chosen based on their involvement in the host response and whether they were differentially expressed between the susceptible and resistant lines (either inherently or during the course of infection). Of the 21 genes tested, 19 showed comparable differential expression to that determined by the arrays. However, the results for <italic>IFNAR2</italic>
and <italic>IGFBP5</italic>
were not confirmed (Additional file <xref rid="MOESM4" ref-type="media">4</xref>
: Figure S1).<table-wrap id="Tab3"><label>Table 3</label>
<caption><p>Genes analyzed by qRT-PCR</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Gene</th>
<th>Description</th>
<th>Fold change</th>
<th>GenBank</th>
<th>Ensembl</th>
</tr>
</thead>
<tbody><tr><td>MX1</td>
<td>Interferon-induced GTP-binding protein Mx</td>
<td>6–20</td>
<td>NM_204609</td>
<td>ENSGALG00000016142</td>
</tr>
<tr><td>C1S</td>
<td>complement component 1, s subcomponent</td>
<td>2–4</td>
<td>NM_001030777</td>
<td>ENSGALG00000014603</td>
</tr>
<tr><td>IRF7</td>
<td>Interferon regulatory factor 7 (IRF-7)</td>
<td>4–5</td>
<td>NM_205372</td>
<td>ENSGALG00000014297</td>
</tr>
<tr><td>TLR3</td>
<td>Toll-like receptor 3</td>
<td>4</td>
<td>NM_001011691</td>
<td>ENSGALG00000013468</td>
</tr>
<tr><td>CCLi7</td>
<td>Chemokine ah221</td>
<td>2–12</td>
<td>AY037860</td>
<td>ENSGALG00000002343</td>
</tr>
<tr><td>CD38</td>
<td>ADP-ribosyl cyclase 1</td>
<td>4–9</td>
<td>XM_420774</td>
<td>ENSGALG00000014508</td>
</tr>
<tr><td>FKBP5</td>
<td>FK-506 binding protein 51</td>
<td>5–6</td>
<td>NM_001005431</td>
<td>ENSGALG00000000947</td>
</tr>
<tr><td>IGFBP5</td>
<td>Insulin-like growth factor binding protein 5</td>
<td>1</td>
<td>XM_422069</td>
<td>ENSGALG00000011468</td>
</tr>
<tr><td>DDT</td>
<td>D-dopachrome tautomerase</td>
<td>2–3</td>
<td>NM_001030667</td>
<td>ENSGALG00000006350</td>
</tr>
<tr><td>SRI</td>
<td>sorcin</td>
<td>2</td>
<td>NM_001080865</td>
<td>ENSGALG00000008985</td>
</tr>
<tr><td>CLU</td>
<td>clusterin</td>
<td>2</td>
<td>NM_204900</td>
<td>ENSGALG00000016587</td>
</tr>
<tr><td>COX11</td>
<td>Cytochrome c oxidase assembly protein COX11, mitochondrial precursor</td>
<td>2</td>
<td>XM_001233972</td>
<td>ENSGALG00000003017</td>
</tr>
<tr><td>MMD2</td>
<td>Monocyte to macrophage differentiation factor 2</td>
<td>2</td>
<td>XM_414787</td>
<td>ENSGALG00000004530</td>
</tr>
<tr><td>IFNAR2</td>
<td>interferon alpha/beta receptor 2</td>
<td>2–3</td>
<td>NM_204858</td>
<td>ENSGALG00000015938</td>
</tr>
<tr><td>TNFAIP1</td>
<td>tumor necrosis factor, alpha-induced protein 1 (endothelial)</td>
<td>2</td>
<td>NM_001030726</td>
<td>ENSGALG00000005715</td>
</tr>
<tr><td>MAP4K4</td>
<td>mitogen-activated protein kinase kinase kinase kinase 4</td>
<td>2</td>
<td>NM_001031126</td>
<td>ENSGALG00000008970</td>
</tr>
<tr><td>MAFK</td>
<td>Transcription factor MafK.</td>
<td>2</td>
<td>NM_204756</td>
<td>ENSGALG00000004189</td>
</tr>
<tr><td>CCL13</td>
<td>similar to Small inducible cytokine A13 precursor (CCL13)</td>
<td>3</td>
<td>XM_415779</td>
<td>ENSGALG00000024470</td>
</tr>
<tr><td>TPD52L1</td>
<td>Tumor protein D53 homolog</td>
<td>13–23</td>
<td>NM_204215</td>
<td>ENSGALG00000014843</td>
</tr>
<tr><td>HSCB</td>
<td>Co-chaperone protein HscB, mitochondrial precursor (Hsc20)</td>
<td>2</td>
<td>XR_026662</td>
<td>ENSGALG00000005706</td>
</tr>
<tr><td>SUCLG2</td>
<td>succinate-CoA ligase, GDP-forming, beta subunit</td>
<td>2</td>
<td>NM_001006141</td>
<td>ENSGALG00000007652</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
<sec id="Sec15"><title>Potential candidate genes for IBV resistance</title>
<p>Besides knowing that the MHC B locus has a bearing on disease resistance, the lack of any genetic information or identified QTL meant that we had to rely upon the gene expression differences we saw between susceptible and resistant lines to give us clues as to genes potentially involved in resistance to IBV infection. Identifying genes which were expressed at different levels in the two lines of birds highlighted B-locus genes (<italic>BLB1, BF1, BF2, B-G</italic>
) as well as bringing to our attention various other non-MHC genes which, due to their known biology, could be candidates for being involved in resistance to IBV infection (Table <xref rid="Tab4" ref-type="table">4</xref>
).<table-wrap id="Tab4"><label>Table 4</label>
<caption><p>Potential candidate genes for involvement in resistance to IBV</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th>Gene</th>
<th>Description</th>
<th>Fold change</th>
<th>GenBank</th>
<th>Ensembl</th>
</tr>
</thead>
<tbody><tr><td>MX1</td>
<td>Interferon-induced GTP-binding protein Mx.</td>
<td>4–24<sup>a</sup>
</td>
<td>NM_204609</td>
<td>ENSGALG00000016142</td>
</tr>
<tr><td>C1S</td>
<td>Complement component 1, s subcomponent</td>
<td>2<sup>a</sup>
</td>
<td>NM_001030777</td>
<td>ENSGALG00000014603</td>
</tr>
<tr><td>IRF7</td>
<td>Interferon regulatory factor 7 (IRF-7).</td>
<td>6<sup>a</sup>
</td>
<td>NM_205372</td>
<td>ENSGALG00000014297</td>
</tr>
<tr><td>TLR3</td>
<td>Toll-like receptor 3</td>
<td>4<sup>a</sup>
</td>
<td>NM_001011691</td>
<td>ENSGALG00000013468</td>
</tr>
<tr><td>C1R</td>
<td>Complement component 1, r subcomponent</td>
<td>2<sup>a</sup>
</td>
<td>XM_416518</td>
<td>ENSGALG00000014659</td>
</tr>
<tr><td>CCLi7</td>
<td>Chemokine ah221</td>
<td>8<sup>a</sup>
</td>
<td>AY037860</td>
<td>ENSGALG00000002343</td>
</tr>
<tr><td>ISG12-2</td>
<td>Interferon stimulated gene 12-2</td>
<td>16–18<sup>a</sup>
</td>
<td>NM_001001296</td>
<td>ENSGALG00000013575</td>
</tr>
<tr><td>IFITM3</td>
<td>Interferon induced transmembrane protein 3</td>
<td>4–5<sup>a</sup>
</td>
<td>KC876032</td>
<td>ENSGALG00000004243</td>
</tr>
<tr><td>CD38</td>
<td>ADP-ribosyl cyclase 1</td>
<td>4<sup>b</sup>
</td>
<td>XM_420774</td>
<td>ENSGALG00000014508</td>
</tr>
<tr><td>CD4</td>
<td>CD4 protein</td>
<td>4<sup>b</sup>
</td>
<td>NM_204649</td>
<td>ENSGALG00000014477</td>
</tr>
<tr><td>FKBP5</td>
<td>FK-506 binding protein 51</td>
<td>2<sup>b</sup>
</td>
<td>NM_001005431</td>
<td>ENSGALG00000000947</td>
</tr>
<tr><td>STAT3</td>
<td>Signal transducer and activator of transcription 3 (acute-phase response factor)</td>
<td>3<sup>b</sup>
</td>
<td>NM_001030931</td>
<td>ENSGALG00000003267</td>
</tr>
<tr><td>OASL</td>
<td>2'-5'-oligoadenylate synthetase-like</td>
<td>4<sup>c</sup>
</td>
<td>NM_205041</td>
<td>ENSGALG00000013723</td>
</tr>
<tr><td>DDT</td>
<td>D-dopachrome tautomerase</td>
<td>62–72<sup>c</sup>
</td>
<td>NM_001030667</td>
<td>ENSGALG00000006350</td>
</tr>
<tr><td>SRI</td>
<td>Sorcin</td>
<td>65–89<sup>c</sup>
</td>
<td>NM_001080865</td>
<td>ENSGALG00000008985</td>
</tr>
<tr><td>BLB1</td>
<td>MHC Class II beta 1 and 2 domains</td>
<td>10–22<sup>c</sup>
</td>
<td>NM_001044694</td>
<td>ENSGALG00000000141</td>
</tr>
<tr><td>IFNAR2</td>
<td>Interferon alpha/beta receptor 2</td>
<td>2–3<sup>c</sup>
</td>
<td>NM_204858</td>
<td>ENSGALG00000015938</td>
</tr>
<tr><td>TPD52L1</td>
<td>Tumor protein D53 homolog</td>
<td>12–14<sup>c</sup>
</td>
<td>NM_204215</td>
<td>ENSGALG00000014843</td>
</tr>
<tr><td>BCL2L1</td>
<td>BCL2-like - apoptosis regulator</td>
<td>1.7<sup>c</sup>
</td>
<td>NM_001025304</td>
<td>ENSGALG00000006211</td>
</tr>
<tr><td>FAIM2</td>
<td>Fas apoptotic inhibitory molecule 2</td>
<td>1.7<sup>c</sup>
</td>
<td>XM_004950568</td>
<td>ENSGALG00000027555</td>
</tr>
<tr><td>CIAPIN1</td>
<td>Cytokine Induced Apoptosis Inhibitor 11</td>
<td>1.7<sup>c</sup>
</td>
<td>NM_001005834</td>
<td>ENSGALG00000005706</td>
</tr>
<tr><td>HSCB</td>
<td>Co-chaperone protein HscB, mitochondrial precursor (Hsc20).</td>
<td>8–10<sup>c</sup>
</td>
<td>XR_026662</td>
<td>ENSGALG00000005706</td>
</tr>
<tr><td>BF1</td>
<td>MHC class I antigen B-F minor heavy chain</td>
<td>13–27<sup>c</sup>
</td>
<td>NM_001097530</td>
<td>ENSGALG00000000178</td>
</tr>
<tr><td>BF2</td>
<td>Major class I glycoprotein precursor</td>
<td>7–8<sup>c</sup>
</td>
<td>NM_001031338</td>
<td>ENSGALG00000000178</td>
</tr>
<tr><td>SUCLG2</td>
<td>succinate-CoA ligase, GDP-forming, beta subunit</td>
<td>16–32<sup>c</sup>
</td>
<td>NM_001006141</td>
<td>ENSGALG00000007652</td>
</tr>
</tbody>
</table>
<table-wrap-foot><p><sup>a</sup>
Upregulated in response to infection in the susceptible line</p>
<p><sup>b</sup>
Higher expression in response to infection in the resistant than in the susceptible line</p>
<p><sup>c</sup>
Inherently higher expression in the resistant line</p>
</table-wrap-foot>
</table-wrap>
</p>
<p><italic>MX1</italic>
, <italic>C1S</italic>
, <italic>IRF7</italic>
, <italic>TLR3</italic>
, <italic>C1R</italic>
, <italic>CCLi7</italic>
, <italic>ISG12-2</italic>
and <italic>IFITM3</italic>
are all strongly induced during the host response to IBV infection. They are all innate immune genes which could potentially have a role in determining susceptibility to the virus. MX1 and IFITM3 are already established as anti-viral molecules [<xref ref-type="bibr" rid="CR50">50</xref>
–<xref ref-type="bibr" rid="CR52">52</xref>
]. <italic>CD38</italic>
, <italic>CD4</italic>
, <italic>FKBP5</italic>
and <italic>STAT3</italic>
all show a higher level of expression during the host response in the resistant birds compared to that of the susceptible birds, indicating their involvement in the host defence mechanism. CD38 and CD4, with their role as receptors on immune cells, as described above, are obvious candidates, along with FKBP5 as an immune-regulator. <italic>STAT3</italic>
is activated by various cytokines and growth factors and functions in cellular processes such as cell growth and apoptosis.</p>
<p>Even before infection, many genes are seen to be highly differentially expressed between lines 15I and N. OASL is an interferon-induced molecule known to have anti-viral activity against certain viruses such as hepatitis C virus. DDT is highly homologous to the macrophage migration inhibition factor, MIF. We have also shown it to be highly differentially expressed in other chicken lines, which are susceptible or resistant to Marek’s Disease virus [<xref ref-type="bibr" rid="CR53">53</xref>
]. IFNAR2 is an obvious candidate prediction, as the interferon response is central to the host’s defence against IBV infection. <italic>TPD52L1</italic>
, <italic>BCL2L1</italic>
, <italic>FAIM2</italic>
and <italic>CIAPIN1</italic>
are all known to be involved in regulation of apoptosis, a process seen to be important during IBV infection. <italic>HSCB</italic>
, <italic>SRI</italic>
, and <italic>SUCLG2</italic>
, although not having an obvious potential biological role in disease resistance, are highly differentially expressed between susceptible and resistant lines and should thus be considered as potential candidates.</p>
</sec>
</sec>
<sec id="Sec16" sec-type="conclusion"><title>Conclusions</title>
<p>Resistance to IBV infection is brought about by the immune response after the virus has entered the host and is not due to prevention of initial viral infection. There is a small initial innate response at 2 dpi, with much more gene expression seen at 3 and 4 dpi. Analysis of genes being activated or inhibited upon infection shows that the biological pathways primarily affected during IBV infection include MAPK signalling, those involved in the interferon response and those involving pattern recognition receptors.</p>
<p>Susceptible and resistant lines show a differential host response mostly at 2 dpi. There are also genes which are inherently different between the two lines studied, including many genes, which control the apoptotic potential of the host. These differences seen in gene expression levels, allow us to postulate on many candidate genes for disease resistance. Some potential candidates for involvement in disease resistance include genes already known to confer resistance to other viral infections (<italic>MHC-B</italic>
locus genes, <italic>MX1</italic>
, <italic>OASL</italic>
and <italic>IFITM3</italic>
), genes involved in apoptotic processes (<italic>TPD52L1</italic>
, <italic>BCL2L1</italic>
, <italic>FAIM2</italic>
and <italic>CIAPIN1</italic>
) and others which could be potential candidates due to their known biology (e.g. <italic>DDT</italic>
and <italic>CD4</italic>
).</p>
</sec>
<sec id="Sec17"><title>Availability of supporting data</title>
<p>Array data have been submitted to Array Express (<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/arrayexpress/">http://www.ebi.ac.uk/arrayexpress/</ext-link>
) under the accession number E-TABM-1128.</p>
</sec>
</body>
<back><app-group><app id="App1"><sec id="Sec18"><title>Additional files</title>
<p><media position="anchor" xlink:href="12917_2015_575_MOESM1_ESM.xlsx" id="MOESM1"><label>Additional file 1: Table S1.</label>
<caption><p>Gene expression seen during the host response to IBV infection in the trachea of susceptible birds. (XLSX 24 kb)</p>
</caption>
</media>
<media position="anchor" xlink:href="12917_2015_575_MOESM2_ESM.xls" id="MOESM2"><label>Additional file 2: Table S2.</label>
<caption><p>Gene expression differences found to be inherent between susceptible and resistant lines in the trachea. (XLS 386 kb)</p>
</caption>
</media>
<media position="anchor" xlink:href="12917_2015_575_MOESM3_ESM.xls" id="MOESM3"><label>Additional file 3: Table S3.</label>
<caption><p>Genes found to be differentially expressed between susceptible and resistant lines in response to IBV infection in the trachea. (XLS 107 kb)</p>
</caption>
</media>
<media position="anchor" xlink:href="12917_2015_575_MOESM4_ESM.pdf" id="MOESM4"><label>Additional file 4: Figure S1.</label>
<caption><p>qRT-PCR analysis of 21 genes differentially expressed during IBV infection. (<bold>A</bold>
). MX1 (<bold>B</bold>
). C1S (<bold>C</bold>
). IRF7 (<bold>D</bold>
). TLR3 (<bold>E</bold>
). CCLi7 (<bold>F</bold>
). DDT (<bold>G</bold>
). SRI (<bold>H</bold>
). CLU (<bold>I</bold>
). COX11 (<bold>J</bold>
). IFNAR2 (<bold>K</bold>
). TNFAIP1 (<bold>L</bold>
). TP-D53 (<bold>M</bold>
). MAP4K4 (<bold>N</bold>
). MAFK (<bold>O</bold>
). CCL13 (<bold>P</bold>
). HSC20 (<bold>Q</bold>
). SUCLG2 (<bold>R</bold>
). MMD2 (<bold>S</bold>
). CD38 (<bold>T</bold>
). FK506-BP51 (<bold>U</bold>
). IGFBP5. Graphs A-E show expression changes during the host response in the susceptible line. Graphs F-R show inherent differences in gene expression between susceptible and resistant control birds, while graphs S-U indicate differential gene expression in susceptible and resistant lines during the host response. (PDF 97 kb)</p>
</caption>
</media>
</p>
</sec>
</app>
</app-group>
<glossary><title>Abbreviations</title>
<def-list><def-item><term>BSA</term>
<def><p>Bovine serum albumin</p>
</def>
</def-item>
<def-item><term>CID<sub>50</sub>
</term>
<def><p>mean chicken infectious dose</p>
</def>
</def-item>
<def-item><term>DE</term>
<def><p>Differentially expressed</p>
</def>
</def-item>
<def-item><term>FARMS</term>
<def><p>Factor Analysis for Robust Microarray Summarization</p>
</def>
</def-item>
<def-item><term>FDR</term>
<def><p>False discovery rate</p>
</def>
</def-item>
<def-item><term>GCOS</term>
<def><p>GeneChip Operating Software</p>
</def>
</def-item>
<def-item><term>GO</term>
<def><p>Gene ontology</p>
</def>
</def-item>
<def-item><term>IB</term>
<def><p>Infectious bronchitis</p>
</def>
</def-item>
<def-item><term>IBV</term>
<def><p>Infectious bronchitis virus</p>
</def>
</def-item>
<def-item><term>KEGG</term>
<def><p>Kyoto Encyclopaedia of Genes and Genomes</p>
</def>
</def-item>
<def-item><term>MHC</term>
<def><p>Major histocompatibility complex</p>
</def>
</def-item>
<def-item><term>OD</term>
<def><p>Optical density</p>
</def>
</def-item>
<def-item><term>PBS</term>
<def><p>Phosphate buffered saline</p>
</def>
</def-item>
<def-item><term>PLIER</term>
<def><p>Probe Logarithmic Error Intensity Estimate</p>
</def>
</def-item>
<def-item><term>qRT-PCR</term>
<def><p>Quantitative reverse transcription polymerase chain reaction</p>
</def>
</def-item>
<def-item><term>QTL</term>
<def><p>Quantitative trait loci</p>
</def>
</def-item>
<def-item><term>RIN</term>
<def><p>RNA integrity number</p>
</def>
</def-item>
<def-item><term>SARS</term>
<def><p>Severe acute respiratory syndrome</p>
</def>
</def-item>
<def-item><term>SILAC</term>
<def><p>Stable isotope labelling with amino acids in cell culture</p>
</def>
</def-item>
<def-item><term>TFBS</term>
<def><p>Transcription factor binding site</p>
</def>
</def-item>
</def-list>
</glossary>
<fn-group><fn><p>Jacqueline Smith and Jean-Remy Sadeyen contributed equally to this work.</p>
</fn>
<fn><p><bold>Competing interests</bold>
</p>
<p>The authors declare no conflicts of interest and no competing financial interests.</p>
</fn>
<fn><p><bold>Authors’ contributions</bold>
</p>
<p>JS performed the arrays, analysed the results and wrote the manuscript; DC carried out challenge experiments, J-RS prepared RNA, measured viral load and performed qRT-PCR; DB and PK conceived and supervised the project and revised the manuscript. All authors read and approved the final manuscript.</p>
</fn>
</fn-group>
<ack><title>Acknowledgements</title>
<p>This work was supported by the Biotechnology and Biological Science Research Council (BBSRC), as part of grant numbers BB/D013704/1, BB/D013704/2 and BB/D010705/1. The authors would like to thank Alison Downing (Edinburgh Genomics, Edinburgh, UK) for excellent technical assistance with the Affymetrix microarray experiments.</p>
</ack>
<ref-list id="Bib1"><title>References</title>
<ref id="CR1"><label>1.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schalk</surname>
<given-names>AF</given-names>
</name>
<name><surname>Hawn</surname>
<given-names>MC</given-names>
</name>
</person-group>
<article-title>An apparently new respiratory disease in baby chicks</article-title>
<source>J Am Vet Med Assoc</source>
<year>1931</year>
<volume>78</volume>
<fpage>413</fpage>
<lpage>422</lpage>
</element-citation>
</ref>
<ref id="CR2"><label>2.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Beach</surname>
<given-names>JR</given-names>
</name>
<name><surname>Schalm</surname>
<given-names>OW</given-names>
</name>
</person-group>
<article-title>Studies of infectious coryza of chickens with special reference to its etiology</article-title>
<source>Poult Sci</source>
<year>1936</year>
<volume>15</volume>
<fpage>199</fpage>
<lpage>206</lpage>
<pub-id pub-id-type="doi">10.3382/ps.0150199</pub-id>
</element-citation>
</ref>
<ref id="CR3"><label>3.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Beaudette</surname>
<given-names>FR</given-names>
</name>
<name><surname>Hudson</surname>
<given-names>CB</given-names>
</name>
</person-group>
<article-title>Cultivation of the virus of infectious bronchitis</article-title>
<source>J Am Vet Med Assoc</source>
<year>1937</year>
<volume>90</volume>
<fpage>51</fpage>
<lpage>58</lpage>
</element-citation>
</ref>
<ref id="CR4"><label>4.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cavanagh</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Coronavirus avian infectious bronchitis virus</article-title>
<source>Vet Res</source>
<year>2007</year>
<volume>38</volume>
<fpage>281</fpage>
<lpage>297</lpage>
<pub-id pub-id-type="doi">10.1051/vetres:2006055</pub-id>
<pub-id pub-id-type="pmid">17296157</pub-id>
</element-citation>
</ref>
<ref id="CR5"><label>5.</label>
<element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Enjuanes</surname>
<given-names>L</given-names>
</name>
<name><surname>Sola</surname>
<given-names>I</given-names>
</name>
<name><surname>Zúñiga</surname>
<given-names>S</given-names>
</name>
<name><surname>Almazán</surname>
<given-names>F</given-names>
</name>
</person-group>
<person-group person-group-type="editor"><name><surname>Mettenleiter</surname>
<given-names>TC</given-names>
</name>
<name><surname>Sobrino</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Coronavirus Replication and Interaction with Host</article-title>
<source>Animal Viruses: Molecular Biology</source>
<year>2008</year>
<publisher-loc>Norfolk</publisher-loc>
<publisher-name>Caister Academic Press</publisher-name>
<fpage>149</fpage>
<lpage>202</lpage>
</element-citation>
</ref>
<ref id="CR6"><label>6.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Casais</surname>
<given-names>R</given-names>
</name>
<name><surname>Dove</surname>
<given-names>B</given-names>
</name>
<name><surname>Cavanagh</surname>
<given-names>D</given-names>
</name>
<name><surname>Britton</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Recombinant avian infectious bronchitis virus expressing a heterologous spike gene demonstrates that the spike protein is a determinant of cell tropism</article-title>
<source>J Virol</source>
<year>2003</year>
<volume>77</volume>
<fpage>9084</fpage>
<lpage>9089</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.77.16.9084-9089.2003</pub-id>
<pub-id pub-id-type="pmid">12885925</pub-id>
</element-citation>
</ref>
<ref id="CR7"><label>7.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Asif</surname>
<given-names>M</given-names>
</name>
<name><surname>Lowenthal</surname>
<given-names>JW</given-names>
</name>
<name><surname>Ford</surname>
<given-names>ME</given-names>
</name>
<name><surname>Schat</surname>
<given-names>KA</given-names>
</name>
<name><surname>Kimpton</surname>
<given-names>WG</given-names>
</name>
<name><surname>Bean</surname>
<given-names>AG</given-names>
</name>
</person-group>
<article-title>Interleukin-6 expression after infectious bronchitis virus infection in chickens</article-title>
<source>Viral Immunol</source>
<year>2007</year>
<volume>20</volume>
<fpage>479</fpage>
<lpage>486</lpage>
<pub-id pub-id-type="doi">10.1089/vim.2006.0109</pub-id>
<pub-id pub-id-type="pmid">17931118</pub-id>
</element-citation>
</ref>
<ref id="CR8"><label>8.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jackwood</surname>
<given-names>MW</given-names>
</name>
</person-group>
<article-title>Review of infectious bronchitis virus around the world</article-title>
<source>Avian Dis</source>
<year>2012</year>
<volume>56</volume>
<fpage>634</fpage>
<lpage>641</lpage>
<pub-id pub-id-type="doi">10.1637/10227-043012-Review.1</pub-id>
<pub-id pub-id-type="pmid">23397833</pub-id>
</element-citation>
</ref>
<ref id="CR9"><label>9.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Meulemans</surname>
<given-names>G</given-names>
</name>
<name><surname>Van den Berg</surname>
<given-names>TP</given-names>
</name>
</person-group>
<article-title>Nephropathogenic avian infectious bronchitis viruses</article-title>
<source>World Poult Sci</source>
<year>1998</year>
<volume>54</volume>
<fpage>145</fpage>
<lpage>153</lpage>
<pub-id pub-id-type="doi">10.1079/WPS19980011</pub-id>
</element-citation>
</ref>
<ref id="CR10"><label>10.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ariaans</surname>
<given-names>MP</given-names>
</name>
<name><surname>Matthijs</surname>
<given-names>MG</given-names>
</name>
<name><surname>van Haarlem</surname>
<given-names>D</given-names>
</name>
<name><surname>van de Haar</surname>
<given-names>P</given-names>
</name>
<name><surname>van Eck</surname>
<given-names>JH</given-names>
</name>
<name><surname>Hensen</surname>
<given-names>EJ</given-names>
</name>
<name><surname>Vervelde</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>The role of phagocytic cells in enhanced susceptibility of broilers to colibacillosis after Infectious Bronchitis Virus infection</article-title>
<source>Vet Immunol Immunopathol</source>
<year>2008</year>
<volume>123</volume>
<fpage>240</fpage>
<lpage>250</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetimm.2008.02.003</pub-id>
<pub-id pub-id-type="pmid">18359518</pub-id>
</element-citation>
</ref>
<ref id="CR11"><label>11.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Matthijs</surname>
<given-names>MG</given-names>
</name>
<name><surname>van Eck</surname>
<given-names>JH</given-names>
</name>
<name><surname>Landman</surname>
<given-names>WJ</given-names>
</name>
<name><surname>Stegeman</surname>
<given-names>JA</given-names>
</name>
</person-group>
<article-title>Ability of Massachusetts-type infectious bronchitis virus to increase colibacillosis susceptibility in commercial broilers: a comparison between vaccine and virulent field virus</article-title>
<source>Avian Pathol</source>
<year>2003</year>
<volume>32</volume>
<fpage>473</fpage>
<lpage>481</lpage>
<pub-id pub-id-type="doi">10.1080/0307945031000154062</pub-id>
<pub-id pub-id-type="pmid">14522702</pub-id>
</element-citation>
</ref>
<ref id="CR12"><label>12.</label>
<element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Jackwood</surname>
<given-names>MW</given-names>
</name>
<name><surname>de Wit</surname>
<given-names>S</given-names>
</name>
</person-group>
<person-group person-group-type="editor"><name><surname>Swayne</surname>
<given-names>DE</given-names>
</name>
<name><surname>Glisson</surname>
<given-names>JR</given-names>
</name>
<name><surname>McDougald</surname>
<given-names>LR</given-names>
</name>
<name><surname>Nolan</surname>
<given-names>LK</given-names>
</name>
<name><surname>Suarez</surname>
<given-names>DL</given-names>
</name>
<name><surname>Nair</surname>
<given-names>VL</given-names>
</name>
</person-group>
<article-title>Infectious Bronchitis</article-title>
<source>Diseases of Poultry</source>
<year>2013</year>
<edition>13</edition>
<publisher-loc>UK</publisher-loc>
<publisher-name>Wiley-Blackwell</publisher-name>
<fpage>139</fpage>
<lpage>160</lpage>
</element-citation>
</ref>
<ref id="CR13"><label>13.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Worthington</surname>
<given-names>KJ</given-names>
</name>
<name><surname>Currie</surname>
<given-names>RJW</given-names>
</name>
<name><surname>Jones</surname>
<given-names>RC</given-names>
</name>
</person-group>
<article-title>A reverse transcriptase–polymerase chain reaction survey of infectious IBV infection bronchitis virus genotypes in Western Europe from 2002 to 2006</article-title>
<source>Avian Pathol</source>
<year>2008</year>
<volume>37</volume>
<fpage>247</fpage>
<lpage>257</lpage>
<pub-id pub-id-type="doi">10.1080/03079450801986529</pub-id>
<pub-id pub-id-type="pmid">18568650</pub-id>
</element-citation>
</ref>
<ref id="CR14"><label>14.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ignjatovic</surname>
<given-names>J</given-names>
</name>
<name><surname>Gould</surname>
<given-names>G</given-names>
</name>
<name><surname>Sapats</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Isolation of a variant infectious bronchitis virus in Australia that further illustrates diversity among emerging strains</article-title>
<source>Arch Virol</source>
<year>2006</year>
<volume>151</volume>
<fpage>1567</fpage>
<lpage>1585</lpage>
<pub-id pub-id-type="doi">10.1007/s00705-006-0726-y</pub-id>
<pub-id pub-id-type="pmid">16501892</pub-id>
</element-citation>
</ref>
<ref id="CR15"><label>15.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mase</surname>
<given-names>M</given-names>
</name>
<name><surname>Kawanishi</surname>
<given-names>N</given-names>
</name>
<name><surname>Ootani</surname>
<given-names>Y</given-names>
</name>
<name><surname>Murayama</surname>
<given-names>K</given-names>
</name>
<name><surname>Karino</surname>
<given-names>A</given-names>
</name>
<name><surname>Inoue</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>A novel genotype of avian infectious bronchitis virus isolated in Japan in 2009</article-title>
<source>J Vet Med Sci</source>
<year>2010</year>
<volume>72</volume>
<fpage>1265</fpage>
<lpage>1268</lpage>
<pub-id pub-id-type="doi">10.1292/jvms.10-0080</pub-id>
<pub-id pub-id-type="pmid">20460833</pub-id>
</element-citation>
</ref>
<ref id="CR16"><label>16.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Banat</surname>
<given-names>GR</given-names>
</name>
<name><surname>Tkalcic</surname>
<given-names>S</given-names>
</name>
<name><surname>Dzielawa</surname>
<given-names>JA</given-names>
</name>
<name><surname>Jackwood</surname>
<given-names>MW</given-names>
</name>
<name><surname>Saggese</surname>
<given-names>MD</given-names>
</name>
<name><surname>Yates</surname>
<given-names>L</given-names>
</name>
<name><surname>Kopulos</surname>
<given-names>R</given-names>
</name>
<name><surname>Briles</surname>
<given-names>WE</given-names>
</name>
<name><surname>Collisson</surname>
<given-names>EW</given-names>
</name>
</person-group>
<article-title>Association of the chicken MHC B haplotypes with resistance to avian coronavirus</article-title>
<source>Dev Comp Immunol</source>
<year>2013</year>
<volume>39</volume>
<fpage>430</fpage>
<lpage>437</lpage>
<pub-id pub-id-type="doi">10.1016/j.dci.2012.10.006</pub-id>
<pub-id pub-id-type="pmid">23178407</pub-id>
</element-citation>
</ref>
<ref id="CR17"><label>17.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dar</surname>
<given-names>A</given-names>
</name>
<name><surname>Munir</surname>
<given-names>S</given-names>
</name>
<name><surname>Vishwanathan</surname>
<given-names>S</given-names>
</name>
<name><surname>Manuja</surname>
<given-names>A</given-names>
</name>
<name><surname>Griebel</surname>
<given-names>P</given-names>
</name>
<name><surname>Tikoo</surname>
<given-names>S</given-names>
</name>
<name><surname>Townsend</surname>
<given-names>H</given-names>
</name>
<name><surname>Potter</surname>
<given-names>A</given-names>
</name>
<name><surname>Kapur</surname>
<given-names>V</given-names>
</name>
<name><surname>Babiuk</surname>
<given-names>LA</given-names>
</name>
</person-group>
<article-title>Transcriptional analysis of avian embryonic tissues following infection with avian infectious bronchitis virus</article-title>
<source>Virus Res</source>
<year>2005</year>
<volume>110</volume>
<fpage>41</fpage>
<lpage>55</lpage>
<pub-id pub-id-type="doi">10.1016/j.virusres.2005.01.006</pub-id>
<pub-id pub-id-type="pmid">15845254</pub-id>
</element-citation>
</ref>
<ref id="CR18"><label>18.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname>
<given-names>X</given-names>
</name>
<name><surname>Rosa</surname>
<given-names>AJM</given-names>
</name>
<name><surname>Oliverira</surname>
<given-names>HN</given-names>
</name>
<name><surname>Rosa</surname>
<given-names>GJM</given-names>
</name>
<name><surname>Guo</surname>
<given-names>X</given-names>
</name>
<name><surname>Travnicek</surname>
<given-names>M</given-names>
</name>
<name><surname>Girshick</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Transcriptome of Local Innate and Adaptive Immunity during Early Phase of Infectious Bronchitis Viral Infection</article-title>
<source>Viral Immunol</source>
<year>2006</year>
<volume>19</volume>
<fpage>768</fpage>
<lpage>774</lpage>
<pub-id pub-id-type="doi">10.1089/vim.2006.19.768</pub-id>
<pub-id pub-id-type="pmid">17201672</pub-id>
</element-citation>
</ref>
<ref id="CR19"><label>19.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Drosten</surname>
<given-names>C</given-names>
</name>
<name><surname>Günther</surname>
<given-names>S</given-names>
</name>
<name><surname>Preiser</surname>
<given-names>W</given-names>
</name>
<name><surname>van der Werf</surname>
<given-names>S</given-names>
</name>
<name><surname>Brodt</surname>
<given-names>HR</given-names>
</name>
<name><surname>Becker</surname>
<given-names>S</given-names>
</name>
<name><surname>Rabenau</surname>
<given-names>H</given-names>
</name>
<name><surname>Panning</surname>
<given-names>M</given-names>
</name>
<name><surname>Kolesnikova</surname>
<given-names>L</given-names>
</name>
<name><surname>Fouchier</surname>
<given-names>RA</given-names>
</name>
<name><surname>Berger</surname>
<given-names>A</given-names>
</name>
<name><surname>Burguière</surname>
<given-names>AM</given-names>
</name>
<name><surname>Cinatl</surname>
<given-names>J</given-names>
</name>
<name><surname>Eickmann</surname>
<given-names>M</given-names>
</name>
<name><surname>Escriou</surname>
<given-names>N</given-names>
</name>
<name><surname>Grywna</surname>
<given-names>K</given-names>
</name>
<name><surname>Kramme</surname>
<given-names>S</given-names>
</name>
<name><surname>Manuguerra</surname>
<given-names>JC</given-names>
</name>
<name><surname>Müller</surname>
<given-names>S</given-names>
</name>
<name><surname>Rickerts</surname>
<given-names>V</given-names>
</name>
<name><surname>Stürmer</surname>
<given-names>M</given-names>
</name>
<name><surname>Vieth</surname>
<given-names>S</given-names>
</name>
<name><surname>Klenk</surname>
<given-names>HD</given-names>
</name>
<name><surname>Osterhaus</surname>
<given-names>AD</given-names>
</name>
<name><surname>Schmitz</surname>
<given-names>H</given-names>
</name>
<name><surname>Doerr</surname>
<given-names>HW</given-names>
</name>
</person-group>
<article-title>Identification of a novel coronavirus in patients with severe acute respiratory syndrome</article-title>
<source>N Engl J Med</source>
<year>2003</year>
<volume>348</volume>
<fpage>1967</fpage>
<lpage>1976</lpage>
<pub-id pub-id-type="doi">10.1056/NEJMoa030747</pub-id>
<pub-id pub-id-type="pmid">12690091</pub-id>
</element-citation>
</ref>
<ref id="CR20"><label>20.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ksiazek</surname>
<given-names>TG</given-names>
</name>
<name><surname>Erdman</surname>
<given-names>D</given-names>
</name>
<name><surname>Goldsmith</surname>
<given-names>CS</given-names>
</name>
<name><surname>Zaki</surname>
<given-names>SR</given-names>
</name>
<name><surname>Peret</surname>
<given-names>T</given-names>
</name>
<name><surname>Emery</surname>
<given-names>S</given-names>
</name>
<name><surname>Tong</surname>
<given-names>S</given-names>
</name>
<name><surname>Urbani</surname>
<given-names>C</given-names>
</name>
<name><surname>Comer</surname>
<given-names>JA</given-names>
</name>
<name><surname>Lim</surname>
<given-names>W</given-names>
</name>
<name><surname>Rollin</surname>
<given-names>PE</given-names>
</name>
<name><surname>Dowell</surname>
<given-names>SF</given-names>
</name>
<name><surname>Ling</surname>
<given-names>AE</given-names>
</name>
<name><surname>Humphrey</surname>
<given-names>CD</given-names>
</name>
<name><surname>Shieh</surname>
<given-names>WJ</given-names>
</name>
<name><surname>Guarner</surname>
<given-names>J</given-names>
</name>
<name><surname>Paddock</surname>
<given-names>CD</given-names>
</name>
<name><surname>Rota</surname>
<given-names>P</given-names>
</name>
<name><surname>Fields</surname>
<given-names>B</given-names>
</name>
<name><surname>DeRisi</surname>
<given-names>J</given-names>
</name>
<name><surname>Yang</surname>
<given-names>JY</given-names>
</name>
<name><surname>Cox</surname>
<given-names>N</given-names>
</name>
<name><surname>Hughes</surname>
<given-names>JM</given-names>
</name>
<name><surname>LeDuc</surname>
<given-names>JW</given-names>
</name>
<name><surname>Bellini</surname>
<given-names>WJ</given-names>
</name>
<name><surname>Anderson</surname>
<given-names>LJ</given-names>
</name>
<collab>SARS Working Group</collab>
</person-group>
<article-title>A novel coronavirus associated with severe acute respiratory syndrome</article-title>
<source>N Engl J Med</source>
<year>2003</year>
<volume>348</volume>
<fpage>1953</fpage>
<lpage>1966</lpage>
<pub-id pub-id-type="doi">10.1056/NEJMoa030781</pub-id>
<pub-id pub-id-type="pmid">12690092</pub-id>
</element-citation>
</ref>
<ref id="CR21"><label>21.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cook</surname>
<given-names>J</given-names>
</name>
<name><surname>Otsuki</surname>
<given-names>K</given-names>
</name>
<name><surname>Huggins</surname>
<given-names>M</given-names>
</name>
<name><surname>Bumstead</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>Investigations into resistance of chicken lines to infection with infectious bronchitis virus</article-title>
<source>Adv Exp Med Biol</source>
<year>1990</year>
<volume>276</volume>
<fpage>491</fpage>
<lpage>496</lpage>
<pub-id pub-id-type="doi">10.1007/978-1-4684-5823-7_68</pub-id>
<pub-id pub-id-type="pmid">1966442</pub-id>
</element-citation>
</ref>
<ref id="CR22"><label>22.</label>
<mixed-citation publication-type="other">Stone HA. Use of highly inbred chickens in research. USDA Agricultural Research Service Technical Bulletin. 1975, No.1514, Washington, DC.</mixed-citation>
</ref>
<ref id="CR23"><label>23.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cole</surname>
<given-names>RK</given-names>
</name>
</person-group>
<article-title>Studies on genetic resistance to Marek's disease</article-title>
<source>Avian Dis</source>
<year>1968</year>
<volume>12</volume>
<fpage>9</fpage>
<lpage>28</lpage>
<pub-id pub-id-type="doi">10.2307/1588081</pub-id>
<pub-id pub-id-type="pmid">5643702</pub-id>
</element-citation>
</ref>
<ref id="CR24"><label>24.</label>
<element-citation publication-type="book"><person-group person-group-type="author"><collab>Affymetrix</collab>
</person-group>
<source>Guide to Probe Logarithmic Intensity Error (PLIER) Estimation</source>
<year>2005</year>
<publisher-loc>Santa Clara</publisher-loc>
<publisher-name>Affymetrix I</publisher-name>
</element-citation>
</ref>
<ref id="CR25"><label>25.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Talloen</surname>
<given-names>W</given-names>
</name>
<name><surname>Clevert</surname>
<given-names>DA</given-names>
</name>
<name><surname>Hochreiter</surname>
<given-names>S</given-names>
</name>
<name><surname>Amaratunga</surname>
<given-names>D</given-names>
</name>
<name><surname>Bijnens</surname>
<given-names>L</given-names>
</name>
<name><surname>Kass</surname>
<given-names>S</given-names>
</name>
<name><surname>Göhlmann</surname>
<given-names>HW</given-names>
</name>
</person-group>
<article-title>I/NI-calls for the exclusion of non-informative genes: a highly effective filtering tool for microarray data</article-title>
<source>Bioinformatics</source>
<year>2007</year>
<volume>23</volume>
<fpage>2897</fpage>
<lpage>2902</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btm478</pub-id>
<pub-id pub-id-type="pmid">17921172</pub-id>
</element-citation>
</ref>
<ref id="CR26"><label>26.</label>
<element-citation publication-type="book"><person-group person-group-type="author"><collab>R Development Core Team</collab>
</person-group>
<source>R: A language and environment for statistical computing</source>
<year>2007</year>
<publisher-loc>Vienna</publisher-loc>
<publisher-name>R Foundation for Statistical Computing</publisher-name>
</element-citation>
</ref>
<ref id="CR27"><label>27.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Khatri</surname>
<given-names>P</given-names>
</name>
<name><surname>Sellamuthu</surname>
<given-names>S</given-names>
</name>
<name><surname>Malhotra</surname>
<given-names>P</given-names>
</name>
<name><surname>Amin</surname>
<given-names>K</given-names>
</name>
<name><surname>Done</surname>
<given-names>A</given-names>
</name>
<name><surname>Draghici</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Recent additions and improvements to the Onto-Tools</article-title>
<source>Nucleic Acids Res</source>
<year>2005</year>
<volume>33</volume>
<issue>Web Server issue</issue>
<fpage>W762</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="doi">10.1093/nar/gki472</pub-id>
<pub-id pub-id-type="pmid">15980579</pub-id>
</element-citation>
</ref>
<ref id="CR28"><label>28.</label>
<mixed-citation publication-type="other">Pathway Express. [<ext-link ext-link-type="uri" xlink:href="http://vortex.cs.wayne.edu/projects.htm">http://vortex.cs.wayne.edu/projects.htm</ext-link>
]</mixed-citation>
</ref>
<ref id="CR29"><label>29.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kanehisa</surname>
<given-names>M</given-names>
</name>
<name><surname>Goto</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>KEGG: kyoto encyclopedia of genes and genomes</article-title>
<source>Nucleic Acids Res</source>
<year>2000</year>
<volume>28</volume>
<fpage>27</fpage>
<lpage>30</lpage>
<pub-id pub-id-type="doi">10.1093/nar/28.1.27</pub-id>
<pub-id pub-id-type="pmid">10592173</pub-id>
</element-citation>
</ref>
<ref id="CR30"><label>30.</label>
<mixed-citation publication-type="other">Ingenuity Pathway Analysis. [Ingenuity® Systems. <ext-link ext-link-type="uri" xlink:href="http://www.ingenuity.com">www.ingenuity.com</ext-link>
]</mixed-citation>
</ref>
<ref id="CR31"><label>31.</label>
<mixed-citation publication-type="other">Expander. [<ext-link ext-link-type="uri" xlink:href="http://acgt.cs.tau.ac.il/expander/expander.html">http://acgt.cs.tau.ac.il/expander/expander.html</ext-link>
]</mixed-citation>
</ref>
<ref id="CR32"><label>32.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Eldaghayes</surname>
<given-names>I</given-names>
</name>
<name><surname>Rothwell</surname>
<given-names>L</given-names>
</name>
<name><surname>Williams</surname>
<given-names>A</given-names>
</name>
<name><surname>Withers</surname>
<given-names>D</given-names>
</name>
<name><surname>Balu</surname>
<given-names>S</given-names>
</name>
<name><surname>Davison</surname>
<given-names>F</given-names>
</name>
<name><surname>Kaiser</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Infectious bursal disease virus: strains that differ in virulence differentially modulate the innate immune response to infection in the chicken bursa</article-title>
<source>Viral Immunol</source>
<year>2006</year>
<volume>19</volume>
<fpage>83</fpage>
<lpage>91</lpage>
<pub-id pub-id-type="doi">10.1089/vim.2006.19.83</pub-id>
<pub-id pub-id-type="pmid">16553553</pub-id>
</element-citation>
</ref>
<ref id="CR33"><label>33.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Poh</surname>
<given-names>TY</given-names>
</name>
<name><surname>Pease</surname>
<given-names>J</given-names>
</name>
<name><surname>Young</surname>
<given-names>JR</given-names>
</name>
<name><surname>Bumstead</surname>
<given-names>N</given-names>
</name>
<name><surname>Kaiser</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Re-evaluation of chicken CXCR1 determines the true gene structure: CXCLi1 (K60) and CXCLi2 (CAF/interleukin-8) are ligands for this receptor</article-title>
<source>J Biol Chem</source>
<year>2008</year>
<volume>283</volume>
<fpage>16408</fpage>
<lpage>16415</lpage>
<pub-id pub-id-type="doi">10.1074/jbc.M800998200</pub-id>
<pub-id pub-id-type="pmid">18417470</pub-id>
</element-citation>
</ref>
<ref id="CR34"><label>34.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rothwell</surname>
<given-names>L</given-names>
</name>
<name><surname>Hu</surname>
<given-names>T</given-names>
</name>
<name><surname>Wu</surname>
<given-names>Z</given-names>
</name>
<name><surname>Kaiser</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Chicken interleukin-21 is costimulatory for T cells and blocks maturation of dendritic cells</article-title>
<source>Dev Comp Immunol</source>
<year>2012</year>
<volume>36</volume>
<fpage>475</fpage>
<lpage>482</lpage>
<pub-id pub-id-type="doi">10.1016/j.dci.2011.08.013</pub-id>
<pub-id pub-id-type="pmid">21911004</pub-id>
</element-citation>
</ref>
<ref id="CR35"><label>35.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guo</surname>
<given-names>X</given-names>
</name>
<name><surname>Rosa</surname>
<given-names>AJM</given-names>
</name>
<name><surname>Chen</surname>
<given-names>D-G</given-names>
</name>
<name><surname>Wang</surname>
<given-names>X</given-names>
</name>
</person-group>
<article-title>Molecular mechanisms of primary and secondary mucosal immunity using avian infectious bronchitis virus as a model system</article-title>
<source>Vet Immunol Immunopathol</source>
<year>2008</year>
<volume>121</volume>
<fpage>332</fpage>
<lpage>343</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetimm.2007.09.016</pub-id>
<pub-id pub-id-type="pmid">17983666</pub-id>
</element-citation>
</ref>
<ref id="CR36"><label>36.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Draghici</surname>
<given-names>S</given-names>
</name>
<name><surname>Khatri</surname>
<given-names>P</given-names>
</name>
<name><surname>Tarca</surname>
<given-names>AL</given-names>
</name>
<name><surname>Amin</surname>
<given-names>K</given-names>
</name>
<name><surname>Done</surname>
<given-names>A</given-names>
</name>
<name><surname>Voichita</surname>
<given-names>C</given-names>
</name>
<name><surname>Georgescu</surname>
<given-names>C</given-names>
</name>
<name><surname>Romero</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>A systems biology approach for pathway level analysis</article-title>
<source>Genome Res</source>
<year>2007</year>
<volume>17</volume>
<fpage>1537</fpage>
<lpage>1545</lpage>
<pub-id pub-id-type="doi">10.1101/gr.6202607</pub-id>
<pub-id pub-id-type="pmid">17785539</pub-id>
</element-citation>
</ref>
<ref id="CR37"><label>37.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kameka</surname>
<given-names>AM</given-names>
</name>
<name><surname>Haddadi</surname>
<given-names>S</given-names>
</name>
<name><surname>Kim</surname>
<given-names>DS</given-names>
</name>
<name><surname>Cork</surname>
<given-names>SC</given-names>
</name>
<name><surname>Abdul-Careem</surname>
<given-names>MF</given-names>
</name>
</person-group>
<article-title>Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens</article-title>
<source>Virology</source>
<year>2014</year>
<volume>450–451</volume>
<fpage>114</fpage>
<lpage>121</lpage>
<pub-id pub-id-type="doi">10.1016/j.virol.2013.12.001</pub-id>
<pub-id pub-id-type="pmid">24503073</pub-id>
</element-citation>
</ref>
<ref id="CR38"><label>38.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname>
<given-names>N</given-names>
</name>
<name><surname>Ma</surname>
<given-names>P</given-names>
</name>
<name><surname>Lang</surname>
<given-names>J</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>Y</given-names>
</name>
<name><surname>Deng</surname>
<given-names>J</given-names>
</name>
<name><surname>JU</surname>
<given-names>X</given-names>
</name>
<name><surname>Zhang</surname>
<given-names>G</given-names>
</name>
<name><surname>Jiang</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Phosphatidylinositol 4-Kinase IIIβ Is Required for Severe Acute Respiratory Syndrome Coronavirus Spike-mediated Cell Entry</article-title>
<source>J Biol Chem</source>
<year>2012</year>
<volume>287</volume>
<fpage>8457</fpage>
<lpage>8467</lpage>
<pub-id pub-id-type="doi">10.1074/jbc.M111.312561</pub-id>
<pub-id pub-id-type="pmid">22253445</pub-id>
</element-citation>
</ref>
<ref id="CR39"><label>39.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Favoreel</surname>
<given-names>HW</given-names>
</name>
<name><surname>Van de Walle</surname>
<given-names>GR</given-names>
</name>
<name><surname>Nauwynck</surname>
<given-names>HJ</given-names>
</name>
<name><surname>Pensaert</surname>
<given-names>MB</given-names>
</name>
</person-group>
<article-title>Virus complement evasion strategies</article-title>
<source>J Gen Virol</source>
<year>2003</year>
<volume>84</volume>
<fpage>1</fpage>
<lpage>15</lpage>
<pub-id pub-id-type="doi">10.1099/vir.0.18709-0</pub-id>
<pub-id pub-id-type="pmid">12533696</pub-id>
</element-citation>
</ref>
<ref id="CR40"><label>40.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ariaans</surname>
<given-names>MP</given-names>
</name>
<name><surname>van de Haar</surname>
<given-names>PM</given-names>
</name>
<name><surname>Hensen</surname>
<given-names>EJ</given-names>
</name>
<name><surname>Vervelde</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Infectious Bronchitis Virus induces acute interferon-gamma production through polyclonal stimulation of chicken leukocytes</article-title>
<source>Virology</source>
<year>2009</year>
<volume>385</volume>
<fpage>68</fpage>
<lpage>73</lpage>
<pub-id pub-id-type="doi">10.1016/j.virol.2008.11.021</pub-id>
<pub-id pub-id-type="pmid">19070879</pub-id>
</element-citation>
</ref>
<ref id="CR41"><label>41.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vervelde</surname>
<given-names>L</given-names>
</name>
<name><surname>Matthijs</surname>
<given-names>MG</given-names>
</name>
<name><surname>van Haarlem</surname>
<given-names>DA</given-names>
</name>
<name><surname>de Wit</surname>
<given-names>JJ</given-names>
</name>
<name><surname>Jansen</surname>
<given-names>CA</given-names>
</name>
</person-group>
<article-title>Rapid NK-cell activation in chicken after infection with infectious bronchitis virus M41</article-title>
<source>Vet Immunol Immunopathol</source>
<year>2013</year>
<volume>151</volume>
<fpage>337</fpage>
<lpage>341</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetimm.2012.11.012</pub-id>
<pub-id pub-id-type="pmid">23245429</pub-id>
</element-citation>
</ref>
<ref id="CR42"><label>42.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kint</surname>
<given-names>J</given-names>
</name>
<name><surname>Fernandez-Gutierrez</surname>
<given-names>M</given-names>
</name>
<name><surname>Maier</surname>
<given-names>HJ</given-names>
</name>
<name><surname>Britton</surname>
<given-names>P</given-names>
</name>
<name><surname>Langereis</surname>
<given-names>MA</given-names>
</name>
<name><surname>Koumans</surname>
<given-names>J</given-names>
</name>
<name><surname>Wiegertjes</surname>
<given-names>GF</given-names>
</name>
<name><surname>Forlenza</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Activation of the chicken type I IFN response by infectious bronchitis coronavirus</article-title>
<source>J Virol</source>
<year>2015</year>
<volume>89</volume>
<fpage>1156</fpage>
<lpage>1167</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.02671-14</pub-id>
<pub-id pub-id-type="pmid">25378498</pub-id>
</element-citation>
</ref>
<ref id="CR43"><label>43.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sharan</surname>
<given-names>R</given-names>
</name>
<name><surname>Maron-Katz</surname>
<given-names>A</given-names>
</name>
<name><surname>Shamir</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>CLICK and EXPANDER: a system for clustering and visualizing gene expression data</article-title>
<source>Bioinformatics</source>
<year>2003</year>
<volume>19</volume>
<fpage>1787</fpage>
<lpage>1799</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btg232</pub-id>
<pub-id pub-id-type="pmid">14512350</pub-id>
</element-citation>
</ref>
<ref id="CR44"><label>44.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Emmott</surname>
<given-names>E</given-names>
</name>
<name><surname>Munday</surname>
<given-names>D</given-names>
</name>
<name><surname>Bickerton</surname>
<given-names>E</given-names>
</name>
<name><surname>Britton</surname>
<given-names>P</given-names>
</name>
<name><surname>Rodgers</surname>
<given-names>MA</given-names>
</name>
<name><surname>Whitehouse</surname>
<given-names>A</given-names>
</name>
<name><surname>Zhou</surname>
<given-names>EM</given-names>
</name>
<name><surname>Hiscox</surname>
<given-names>JA</given-names>
</name>
</person-group>
<article-title>The cellular interactome of the coronavirus infectious bronchitis virus nucleocapsid protein and functional implications for virus biology</article-title>
<source>J Virol</source>
<year>2013</year>
<volume>87</volume>
<fpage>9486</fpage>
<lpage>9500</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.00321-13</pub-id>
<pub-id pub-id-type="pmid">23637410</pub-id>
</element-citation>
</ref>
<ref id="CR45"><label>45.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Crinion</surname>
<given-names>RA</given-names>
</name>
</person-group>
<article-title>Egg quality and production following infectious bronchitis virus exposure at one day old</article-title>
<source>Poult Sci</source>
<year>1972</year>
<volume>51</volume>
<fpage>582</fpage>
<lpage>585</lpage>
<pub-id pub-id-type="doi">10.3382/ps.0510582</pub-id>
<pub-id pub-id-type="pmid">4643125</pub-id>
</element-citation>
</ref>
<ref id="CR46"><label>46.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brionne</surname>
<given-names>A</given-names>
</name>
<name><surname>Nys</surname>
<given-names>Y</given-names>
</name>
<name><surname>Hennequet-Antier</surname>
<given-names>C</given-names>
</name>
<name><surname>Gautron</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Hen uterine gene expression profiling during eggshell formation reveals putative proteins involved in the supply of minerals or in the shell mineralization process</article-title>
<source>BMC Genomics</source>
<year>2014</year>
<volume>15</volume>
<fpage>220</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2164-15-220</pub-id>
<pub-id pub-id-type="pmid">24649854</pub-id>
</element-citation>
</ref>
<ref id="CR47"><label>47.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cong</surname>
<given-names>F</given-names>
</name>
<name><surname>Liu</surname>
<given-names>X</given-names>
</name>
<name><surname>Han</surname>
<given-names>Z</given-names>
</name>
<name><surname>Shao</surname>
<given-names>Y</given-names>
</name>
<name><surname>Kong</surname>
<given-names>X</given-names>
</name>
<name><surname>Liu</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Transcriptome analysis of chicken kidney tissues following coronavirus avian infectious bronchitis virus infection</article-title>
<source>BMC Genomics.</source>
<year>2013</year>
<volume>14</volume>
<fpage>743</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2164-14-743</pub-id>
<pub-id pub-id-type="pmid">24168272</pub-id>
</element-citation>
</ref>
<ref id="CR48"><label>48.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname>
<given-names>C</given-names>
</name>
<name><surname>Xu</surname>
<given-names>HY</given-names>
</name>
<name><surname>Liu</surname>
<given-names>DX</given-names>
</name>
</person-group>
<article-title>Induction of caspase-dependent apoptosis in cultured cells by the avian coronavirus infectious bronchitis virus</article-title>
<source>J Virol</source>
<year>2001</year>
<volume>75</volume>
<fpage>6402</fpage>
<lpage>6409</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.75.14.6402-6409.2001</pub-id>
<pub-id pub-id-type="pmid">11413307</pub-id>
</element-citation>
</ref>
<ref id="CR49"><label>49.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nii</surname>
<given-names>T</given-names>
</name>
<name><surname>Isobe</surname>
<given-names>N</given-names>
</name>
<name><surname>Yoshimura</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Effects of avian infectious bronchitis virus antigen on eggshell formation and immunoreaction in hen oviduct</article-title>
<source>Theriogenology</source>
<year>2014</year>
<volume>81</volume>
<fpage>1129</fpage>
<lpage>1138</lpage>
<pub-id pub-id-type="doi">10.1016/j.theriogenology.2014.02.002</pub-id>
<pub-id pub-id-type="pmid">24612789</pub-id>
</element-citation>
</ref>
<ref id="CR50"><label>50.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Goodbourn</surname>
<given-names>S</given-names>
</name>
<name><surname>Didcock</surname>
<given-names>L</given-names>
</name>
<name><surname>Randall</surname>
<given-names>RE</given-names>
</name>
</person-group>
<article-title>Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures</article-title>
<source>J Gen Virol</source>
<year>2000</year>
<volume>81</volume>
<fpage>2341</fpage>
<lpage>2364</lpage>
<pub-id pub-id-type="doi">10.1099/0022-1317-81-10-2341</pub-id>
<pub-id pub-id-type="pmid">10993923</pub-id>
</element-citation>
</ref>
<ref id="CR51"><label>51.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Haller</surname>
<given-names>O</given-names>
</name>
<name><surname>Frese</surname>
<given-names>M</given-names>
</name>
<name><surname>Kochs</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Mx proteins: Mediators of innate resistance to RNA viruses</article-title>
<source>Rev Sci Technol</source>
<year>1998</year>
<volume>17</volume>
<fpage>220</fpage>
<lpage>230</lpage>
</element-citation>
</ref>
<ref id="CR52"><label>52.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Perreira</surname>
<given-names>JM</given-names>
</name>
<name><surname>Chin</surname>
<given-names>CR</given-names>
</name>
<name><surname>Feeley</surname>
<given-names>EM</given-names>
</name>
<name><surname>Brass</surname>
<given-names>AL</given-names>
</name>
</person-group>
<article-title>IFITMs restrict the replication of multiple pathogenic viruses</article-title>
<source>J Mol Biol</source>
<year>2013</year>
<volume>425</volume>
<fpage>4937</fpage>
<lpage>4955</lpage>
<pub-id pub-id-type="doi">10.1016/j.jmb.2013.09.024</pub-id>
<pub-id pub-id-type="pmid">24076421</pub-id>
</element-citation>
</ref>
<ref id="CR53"><label>53.</label>
<element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname>
<given-names>J</given-names>
</name>
<name><surname>Sadeyen</surname>
<given-names>JR</given-names>
</name>
<name><surname>Paton</surname>
<given-names>IR</given-names>
</name>
<name><surname>Hocking</surname>
<given-names>PM</given-names>
</name>
<name><surname>Salmon</surname>
<given-names>N</given-names>
</name>
<name><surname>Fife</surname>
<given-names>M</given-names>
</name>
<name><surname>Nair</surname>
<given-names>V</given-names>
</name>
<name><surname>Burt</surname>
<given-names>DW</given-names>
</name>
<name><surname>Kaiser</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Systems analysis of immune responses in Marek's disease virus-infected chickens identifies a gene involved in susceptibility and highlights a possible novel pathogenicity mechanism</article-title>
<source>J Virol</source>
<year>2011</year>
<volume>85</volume>
<fpage>11146</fpage>
<lpage>11158</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.05499-11</pub-id>
<pub-id pub-id-type="pmid">21865384</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Sante/explor/CovidV2/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000217 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000217 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Sante |area= CovidV2 |flux= Pmc |étape= Corpus |type= RBID |clé= PMC:4600211 |texte= The early immune response to infection of chickens with Infectious Bronchitis Virus (IBV) in susceptible and resistant birds }}
Pour générer des pages wiki
HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i -Sk "pubmed:26452558" \ | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd \ | NlmPubMed2Wicri -a CovidV2
This area was generated with Dilib version V0.6.33. |