Serveur d'exploration Covid (26 mars)

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Microarray analysis of infectious bronchitis virus infection of chicken primary dendritic cells

Identifieur interne : 000200 ( Pmc/Corpus ); précédent : 000199; suivant : 000201

Microarray analysis of infectious bronchitis virus infection of chicken primary dendritic cells

Auteurs : Jian Lin ; Zhisheng Wang ; Jialu Wang ; Qian Yang

Source :

RBID : PMC:6615177

Abstract

Background

Avian infectious bronchitis virus (IBV) is a major respiratory disease-causing agent in birds that leads to significant losses. Dendritic cells (DCs) are specialised cells responsible for sampling antigens and presenting them to T cells, which also play an essential role in recognising and neutralising viruses. Recent studies have suggested that non-coding RNAs may regulate the functional program of DCs. Expression of host non-coding RNAs changes markedly during infectious bronchitis virus infection, but their role in regulating host immune function has not been explored. Here, microarrays of mRNAs, miRNAs, and lncRNAs were globally performed to analyse how avian DCs respond to IBV.

Results

First, we found that IBV stimulation did not enhance the maturation ability of avian DCs. Interestingly, inactivated IBV was better able than IBV to induce DC maturation and activate lymphocytes. We identified 1093 up-regulated and 845 down-regulated mRNAs in IBV-infected avian DCs. Gene Ontology analysis suggested that cellular macromolecule and protein location (GO-BP) and transcription factor binding (GO-MF) were abundant in IBV-stimulated avian DCs. Meanwhile, pathway analysis indicated that the oxidative phosphorylation and leukocyte transendothelial migration signalling pathways might be activated in the IBV group. Moreover, alteration of microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) was detected in IBV-stimulated avian DCs. In total, 19 significantly altered (7 up and 12 down) miRNAs and 101 (75 up and 26 down) lncRNAs were identified in the IBV-treated group. Further analysis showed that the actin cytoskeleton and MAPK signal pathway were related to the target genes of IBV-stimulated miRNAs. Finally, our study identified 2 TF-microRNA and 53 TF–microRNA–mRNA interactions involving 1 TF, 2 miRNAs, and 53 mRNAs in IBV-stimulated avian DCs.

Conclusions

Our research suggests a new mechanism to explain why IBV actively blocks innate responses needed for inducing immune gene expression and also provides insight into the pathogenic mechanisms of avian IBV.

Electronic supplementary material

The online version of this article (10.1186/s12864-019-5940-6) contains supplementary material, which is available to authorized users.


Url:
DOI: 10.1186/s12864-019-5940-6
PubMed: 31286855
PubMed Central: 6615177

Links to Exploration step

PMC:6615177

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Microarray analysis of infectious bronchitis virus infection of chicken primary dendritic cells</title>
<author>
<name sortKey="Lin, Jian" sort="Lin, Jian" uniqKey="Lin J" first="Jian" last="Lin">Jian Lin</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Life Sciences,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Veterinary medicine,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Zhisheng" sort="Wang, Zhisheng" uniqKey="Wang Z" first="Zhisheng" last="Wang">Zhisheng Wang</name>
<affiliation>
<nlm:aff id="Aff3">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0001 0017 5204</institution-id>
<institution-id institution-id-type="GRID">grid.454840.9</institution-id>
<institution>National Veterinary Product Engineering Research Center, Jiangsu Academy of Agricultural Sciences,</institution>
</institution-wrap>
Nanjing, China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Jialu" sort="Wang, Jialu" uniqKey="Wang J" first="Jialu" last="Wang">Jialu Wang</name>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Veterinary medicine,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yang, Qian" sort="Yang, Qian" uniqKey="Yang Q" first="Qian" last="Yang">Qian Yang</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Life Sciences,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Veterinary medicine,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">31286855</idno>
<idno type="pmc">6615177</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6615177</idno>
<idno type="RBID">PMC:6615177</idno>
<idno type="doi">10.1186/s12864-019-5940-6</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">000200</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000200</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Microarray analysis of infectious bronchitis virus infection of chicken primary dendritic cells</title>
<author>
<name sortKey="Lin, Jian" sort="Lin, Jian" uniqKey="Lin J" first="Jian" last="Lin">Jian Lin</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Life Sciences,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Veterinary medicine,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Zhisheng" sort="Wang, Zhisheng" uniqKey="Wang Z" first="Zhisheng" last="Wang">Zhisheng Wang</name>
<affiliation>
<nlm:aff id="Aff3">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0001 0017 5204</institution-id>
<institution-id institution-id-type="GRID">grid.454840.9</institution-id>
<institution>National Veterinary Product Engineering Research Center, Jiangsu Academy of Agricultural Sciences,</institution>
</institution-wrap>
Nanjing, China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Jialu" sort="Wang, Jialu" uniqKey="Wang J" first="Jialu" last="Wang">Jialu Wang</name>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Veterinary medicine,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yang, Qian" sort="Yang, Qian" uniqKey="Yang Q" first="Qian" last="Yang">Qian Yang</name>
<affiliation>
<nlm:aff id="Aff1">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Life Sciences,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Veterinary medicine,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">BMC Genomics</title>
<idno type="eISSN">1471-2164</idno>
<imprint>
<date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p id="Par1">Avian infectious bronchitis virus (IBV) is a major respiratory disease-causing agent in birds that leads to significant losses. Dendritic cells (DCs) are specialised cells responsible for sampling antigens and presenting them to T cells, which also play an essential role in recognising and neutralising viruses. Recent studies have suggested that non-coding RNAs may regulate the functional program of DCs. Expression of host non-coding RNAs changes markedly during infectious bronchitis virus infection, but their role in regulating host immune function has not been explored. Here, microarrays of mRNAs, miRNAs, and lncRNAs were globally performed to analyse how avian DCs respond to IBV.</p>
</sec>
<sec>
<title>Results</title>
<p id="Par2">First, we found that IBV stimulation did not enhance the maturation ability of avian DCs. Interestingly, inactivated IBV was better able than IBV to induce DC maturation and activate lymphocytes. We identified 1093 up-regulated and 845 down-regulated mRNAs in IBV-infected avian DCs. Gene Ontology analysis suggested that cellular macromolecule and protein location (GO-BP) and transcription factor binding (GO-MF) were abundant in IBV-stimulated avian DCs. Meanwhile, pathway analysis indicated that the oxidative phosphorylation and leukocyte transendothelial migration signalling pathways might be activated in the IBV group. Moreover, alteration of microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) was detected in IBV-stimulated avian DCs. In total, 19 significantly altered (7 up and 12 down) miRNAs and 101 (75 up and 26 down) lncRNAs were identified in the IBV-treated group. Further analysis showed that the actin cytoskeleton and MAPK signal pathway were related to the target genes of IBV-stimulated miRNAs. Finally, our study identified 2 TF-microRNA and 53 TF–microRNA–mRNA interactions involving 1 TF, 2 miRNAs, and 53 mRNAs in IBV-stimulated avian DCs.</p>
</sec>
<sec>
<title>Conclusions</title>
<p id="Par3">Our research suggests a new mechanism to explain why IBV actively blocks innate responses needed for inducing immune gene expression and also provides insight into the pathogenic mechanisms of avian IBV.</p>
</sec>
<sec>
<title>Electronic supplementary material</title>
<p>The online version of this article (10.1186/s12864-019-5940-6) contains supplementary material, which is available to authorized users.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Bande, F" uniqKey="Bande F">F Bande</name>
</author>
<author>
<name sortKey="Arshad, Ss" uniqKey="Arshad S">SS Arshad</name>
</author>
<author>
<name sortKey="Omar, Ar" uniqKey="Omar A">AR Omar</name>
</author>
<author>
<name sortKey="Hair Bejo, M" uniqKey="Hair Bejo M">M Hair-Bejo</name>
</author>
<author>
<name sortKey="Mahmuda, A" uniqKey="Mahmuda A">A Mahmuda</name>
</author>
<author>
<name sortKey="Nair, V" uniqKey="Nair V">V Nair</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Marandino, A" uniqKey="Marandino A">A Marandino</name>
</author>
<author>
<name sortKey="Tomas, G" uniqKey="Tomas G">G Tomas</name>
</author>
<author>
<name sortKey="Panzera, Y" uniqKey="Panzera Y">Y Panzera</name>
</author>
<author>
<name sortKey="Greif, G" uniqKey="Greif G">G Greif</name>
</author>
<author>
<name sortKey="Parodi Talice, A" uniqKey="Parodi Talice A">A Parodi-Talice</name>
</author>
<author>
<name sortKey="Hernandez, M" uniqKey="Hernandez M">M Hernandez</name>
</author>
<author>
<name sortKey="Techera, C" uniqKey="Techera C">C Techera</name>
</author>
<author>
<name sortKey="Hernandez, D" uniqKey="Hernandez D">D Hernandez</name>
</author>
<author>
<name sortKey="Perez, R" uniqKey="Perez R">R Perez</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Smith, J" uniqKey="Smith J">J Smith</name>
</author>
<author>
<name sortKey="Sadeyen, Jr" uniqKey="Sadeyen J">JR Sadeyen</name>
</author>
<author>
<name sortKey="Cavanagh, D" uniqKey="Cavanagh D">D Cavanagh</name>
</author>
<author>
<name sortKey="Kaiser, P" uniqKey="Kaiser P">P Kaiser</name>
</author>
<author>
<name sortKey="Burt, Dw" uniqKey="Burt D">DW Burt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kjaerup, Rm" uniqKey="Kjaerup R">RM Kjaerup</name>
</author>
<author>
<name sortKey="Dalgaard, Ts" uniqKey="Dalgaard T">TS Dalgaard</name>
</author>
<author>
<name sortKey="Norup, Lr" uniqKey="Norup L">LR Norup</name>
</author>
<author>
<name sortKey="Hamzic, E" uniqKey="Hamzic E">E Hamzic</name>
</author>
<author>
<name sortKey="Sorensen, P" uniqKey="Sorensen P">P Sorensen</name>
</author>
<author>
<name sortKey="Juul Madsen, Hr" uniqKey="Juul Madsen H">HR Juul-Madsen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Britton, P" uniqKey="Britton P">P Britton</name>
</author>
<author>
<name sortKey="Armesto, M" uniqKey="Armesto M">M Armesto</name>
</author>
<author>
<name sortKey="Cavanagh, D" uniqKey="Cavanagh D">D Cavanagh</name>
</author>
<author>
<name sortKey="Keep, S" uniqKey="Keep S">S Keep</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Habibi, M" uniqKey="Habibi M">M Habibi</name>
</author>
<author>
<name sortKey="Karimi, V" uniqKey="Karimi V">V Karimi</name>
</author>
<author>
<name sortKey="Langeroudi, Ag" uniqKey="Langeroudi A">AG Langeroudi</name>
</author>
<author>
<name sortKey="Ghafouri, Sa" uniqKey="Ghafouri S">SA Ghafouri</name>
</author>
<author>
<name sortKey="Hashemzadeh, M" uniqKey="Hashemzadeh M">M Hashemzadeh</name>
</author>
<author>
<name sortKey="Farahani, Rk" uniqKey="Farahani R">RK Farahani</name>
</author>
<author>
<name sortKey="Maghsoudloo, H" uniqKey="Maghsoudloo H">H Maghsoudloo</name>
</author>
<author>
<name sortKey="Abdollahi, H" uniqKey="Abdollahi H">H Abdollahi</name>
</author>
<author>
<name sortKey="Seifouri, P" uniqKey="Seifouri P">P Seifouri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ndegwa, En" uniqKey="Ndegwa E">EN Ndegwa</name>
</author>
<author>
<name sortKey="Toro, H" uniqKey="Toro H">H Toro</name>
</author>
<author>
<name sortKey="Van Santen, Vl" uniqKey="Van Santen V">VL van Santen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Okino, Ch" uniqKey="Okino C">CH Okino</name>
</author>
<author>
<name sortKey="Alessi, Ac" uniqKey="Alessi A">AC Alessi</name>
</author>
<author>
<name sortKey="Montassier Mde, F" uniqKey="Montassier Mde F">F Montassier Mde</name>
</author>
<author>
<name sortKey="Rosa, Aj" uniqKey="Rosa A">AJ Rosa</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author>
<name sortKey="Montassier, Hj" uniqKey="Montassier H">HJ Montassier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ambali, Ag" uniqKey="Ambali A">AG Ambali</name>
</author>
<author>
<name sortKey="Jones, Rc" uniqKey="Jones R">RC Jones</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cavanagh, D" uniqKey="Cavanagh D">D Cavanagh</name>
</author>
<author>
<name sortKey="Casais, R" uniqKey="Casais R">R Casais</name>
</author>
<author>
<name sortKey="Armesto, M" uniqKey="Armesto M">M Armesto</name>
</author>
<author>
<name sortKey="Hodgson, T" uniqKey="Hodgson T">T Hodgson</name>
</author>
<author>
<name sortKey="Izadkhasti, S" uniqKey="Izadkhasti S">S Izadkhasti</name>
</author>
<author>
<name sortKey="Davies, M" uniqKey="Davies M">M Davies</name>
</author>
<author>
<name sortKey="Lin, F" uniqKey="Lin F">F Lin</name>
</author>
<author>
<name sortKey="Tarpey, I" uniqKey="Tarpey I">I Tarpey</name>
</author>
<author>
<name sortKey="Britton, P" uniqKey="Britton P">P Britton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Juul Madsen, Hr" uniqKey="Juul Madsen H">HR Juul-Madsen</name>
</author>
<author>
<name sortKey="Norup, Lr" uniqKey="Norup L">LR Norup</name>
</author>
<author>
<name sortKey="Jorgensen, Ph" uniqKey="Jorgensen P">PH Jorgensen</name>
</author>
<author>
<name sortKey="Handberg, Kj" uniqKey="Handberg K">KJ Handberg</name>
</author>
<author>
<name sortKey="Wattrang, E" uniqKey="Wattrang E">E Wattrang</name>
</author>
<author>
<name sortKey="Dalgaard, Ts" uniqKey="Dalgaard T">TS Dalgaard</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jiang, L" uniqKey="Jiang L">L Jiang</name>
</author>
<author>
<name sortKey="Zhao, W" uniqKey="Zhao W">W Zhao</name>
</author>
<author>
<name sortKey="Han, Z" uniqKey="Han Z">Z Han</name>
</author>
<author>
<name sortKey="Chen, Y" uniqKey="Chen Y">Y Chen</name>
</author>
<author>
<name sortKey="Zhao, Y" uniqKey="Zhao Y">Y Zhao</name>
</author>
<author>
<name sortKey="Sun, J" uniqKey="Sun J">J Sun</name>
</author>
<author>
<name sortKey="Li, H" uniqKey="Li H">H Li</name>
</author>
<author>
<name sortKey="Shao, Y" uniqKey="Shao Y">Y Shao</name>
</author>
<author>
<name sortKey="Liu, L" uniqKey="Liu L">L Liu</name>
</author>
<author>
<name sortKey="Liu, S" uniqKey="Liu S">S Liu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhou, S" uniqKey="Zhou S">S Zhou</name>
</author>
<author>
<name sortKey="Tang, M" uniqKey="Tang M">M Tang</name>
</author>
<author>
<name sortKey="Jiang, Y" uniqKey="Jiang Y">Y Jiang</name>
</author>
<author>
<name sortKey="Chen, X" uniqKey="Chen X">X Chen</name>
</author>
<author>
<name sortKey="Shen, X" uniqKey="Shen X">X Shen</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Dai, Y" uniqKey="Dai Y">Y Dai</name>
</author>
<author>
<name sortKey="Zou, J" uniqKey="Zou J">J Zou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Amarasinghe, A" uniqKey="Amarasinghe A">A Amarasinghe</name>
</author>
<author>
<name sortKey="Abdul Cader, Ms" uniqKey="Abdul Cader M">MS Abdul-Cader</name>
</author>
<author>
<name sortKey="Nazir, S" uniqKey="Nazir S">S Nazir</name>
</author>
<author>
<name sortKey="De Silva, Su" uniqKey="De Silva S">SU De Silva</name>
</author>
<author>
<name sortKey="Van Der Meer, F" uniqKey="Van Der Meer F">F van der Meer</name>
</author>
<author>
<name sortKey="Cork, Sc" uniqKey="Cork S">SC Cork</name>
</author>
<author>
<name sortKey="Gomis, S" uniqKey="Gomis S">S Gomis</name>
</author>
<author>
<name sortKey="Abdul Careem, Mf" uniqKey="Abdul Careem M">MF Abdul-Careem</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ammayappan, A" uniqKey="Ammayappan A">A Ammayappan</name>
</author>
<author>
<name sortKey="Vakharia, Vn" uniqKey="Vakharia V">VN Vakharia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Alonso Caplen, Fv" uniqKey="Alonso Caplen F">FV Alonso-Caplen</name>
</author>
<author>
<name sortKey="Matsuoka, Y" uniqKey="Matsuoka Y">Y Matsuoka</name>
</author>
<author>
<name sortKey="Wilcox, Ge" uniqKey="Wilcox G">GE Wilcox</name>
</author>
<author>
<name sortKey="Compans, Rw" uniqKey="Compans R">RW Compans</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author>
<name sortKey="Qi, X" uniqKey="Qi X">X Qi</name>
</author>
<author>
<name sortKey="Gao, H" uniqKey="Gao H">H Gao</name>
</author>
<author>
<name sortKey="Gao, Y" uniqKey="Gao Y">Y Gao</name>
</author>
<author>
<name sortKey="Lin, H" uniqKey="Lin H">H Lin</name>
</author>
<author>
<name sortKey="Song, X" uniqKey="Song X">X Song</name>
</author>
<author>
<name sortKey="Pei, L" uniqKey="Pei L">L Pei</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jauregui Zuniga, D" uniqKey="Jauregui Zuniga D">D Jauregui-Zuniga</name>
</author>
<author>
<name sortKey="Pedraza Escalona, M" uniqKey="Pedraza Escalona M">M Pedraza-Escalona</name>
</author>
<author>
<name sortKey="Espino Solis, Gp" uniqKey="Espino Solis G">GP Espino-Solis</name>
</author>
<author>
<name sortKey="Quintero Hernandez, V" uniqKey="Quintero Hernandez V">V Quintero-Hernandez</name>
</author>
<author>
<name sortKey="Olvera Rodriguez, A" uniqKey="Olvera Rodriguez A">A Olvera-Rodriguez</name>
</author>
<author>
<name sortKey="Diaz Salinas, Ma" uniqKey="Diaz Salinas M">MA Diaz-Salinas</name>
</author>
<author>
<name sortKey="Lopez, S" uniqKey="Lopez S">S Lopez</name>
</author>
<author>
<name sortKey="Possani, Ld" uniqKey="Possani L">LD Possani</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nagy, N" uniqKey="Nagy N">N Nagy</name>
</author>
<author>
<name sortKey="Bodi, I" uniqKey="Bodi I">I Bodi</name>
</author>
<author>
<name sortKey="Olah, I" uniqKey="Olah I">I Olah</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lin, J" uniqKey="Lin J">J Lin</name>
</author>
<author>
<name sortKey="Xia, J" uniqKey="Xia J">J Xia</name>
</author>
<author>
<name sortKey="Zhang, K" uniqKey="Zhang K">K Zhang</name>
</author>
<author>
<name sortKey="Yang, Q" uniqKey="Yang Q">Q Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seo, W" uniqKey="Seo W">W Seo</name>
</author>
<author>
<name sortKey="Taniuchi, I" uniqKey="Taniuchi I">I Taniuchi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tarifeno Saldivia, E" uniqKey="Tarifeno Saldivia E">E Tarifeno-Saldivia</name>
</author>
<author>
<name sortKey="Valenzuela Miranda, D" uniqKey="Valenzuela Miranda D">D Valenzuela-Miranda</name>
</author>
<author>
<name sortKey="Gallardo Escarate, C" uniqKey="Gallardo Escarate C">C Gallardo-Escarate</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="He, R" uniqKey="He R">R He</name>
</author>
<author>
<name sortKey="Gu, X" uniqKey="Gu X">X Gu</name>
</author>
<author>
<name sortKey="Lai, W" uniqKey="Lai W">W Lai</name>
</author>
<author>
<name sortKey="Peng, X" uniqKey="Peng X">X Peng</name>
</author>
<author>
<name sortKey="Yang, G" uniqKey="Yang G">G Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Robertson, Sarah A" uniqKey="Robertson S">Sarah A. Robertson</name>
</author>
<author>
<name sortKey="Zhang, Bihong" uniqKey="Zhang B">Bihong Zhang</name>
</author>
<author>
<name sortKey="Chan, Honyueng" uniqKey="Chan H">Honyueng Chan</name>
</author>
<author>
<name sortKey="Sharkey, David J" uniqKey="Sharkey D">David J. Sharkey</name>
</author>
<author>
<name sortKey="Barry, Simon C" uniqKey="Barry S">Simon C. Barry</name>
</author>
<author>
<name sortKey="Fullston, Tod" uniqKey="Fullston T">Tod Fullston</name>
</author>
<author>
<name sortKey="Schjenken, John E" uniqKey="Schjenken J">John E. Schjenken</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lin, J" uniqKey="Lin J">J Lin</name>
</author>
<author>
<name sortKey="Xia, J" uniqKey="Xia J">J Xia</name>
</author>
<author>
<name sortKey="Chen, Yt" uniqKey="Chen Y">YT Chen</name>
</author>
<author>
<name sortKey="Zhang, Ky" uniqKey="Zhang K">KY Zhang</name>
</author>
<author>
<name sortKey="Zeng, Y" uniqKey="Zeng Y">Y Zeng</name>
</author>
<author>
<name sortKey="Yang, Q" uniqKey="Yang Q">Q Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lin, J" uniqKey="Lin J">J Lin</name>
</author>
<author>
<name sortKey="Xia, J" uniqKey="Xia J">J Xia</name>
</author>
<author>
<name sortKey="Tu, Cz" uniqKey="Tu C">CZ Tu</name>
</author>
<author>
<name sortKey="Zhang, Ky" uniqKey="Zhang K">KY Zhang</name>
</author>
<author>
<name sortKey="Zeng, Y" uniqKey="Zeng Y">Y Zeng</name>
</author>
<author>
<name sortKey="Yang, Q" uniqKey="Yang Q">Q Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rosenberger, Cm" uniqKey="Rosenberger C">CM Rosenberger</name>
</author>
<author>
<name sortKey="Podyminogin, Rl" uniqKey="Podyminogin R">RL Podyminogin</name>
</author>
<author>
<name sortKey="Diercks, Ah" uniqKey="Diercks A">AH Diercks</name>
</author>
<author>
<name sortKey="Treuting, Pm" uniqKey="Treuting P">PM Treuting</name>
</author>
<author>
<name sortKey="Peschon, Jj" uniqKey="Peschon J">JJ Peschon</name>
</author>
<author>
<name sortKey="Rodriguez, D" uniqKey="Rodriguez D">D Rodriguez</name>
</author>
<author>
<name sortKey="Gundapuneni, M" uniqKey="Gundapuneni M">M Gundapuneni</name>
</author>
<author>
<name sortKey="Weiss, Mj" uniqKey="Weiss M">MJ Weiss</name>
</author>
<author>
<name sortKey="Aderem, A" uniqKey="Aderem A">A Aderem</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author>
<name sortKey="Jiang, D" uniqKey="Jiang D">D Jiang</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C Zhang</name>
</author>
<author>
<name sortKey="Tan, H" uniqKey="Tan H">H Tan</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author>
<name sortKey="Lv, S" uniqKey="Lv S">S Lv</name>
</author>
<author>
<name sortKey="Hou, X" uniqKey="Hou X">X Hou</name>
</author>
<author>
<name sortKey="Cui, X" uniqKey="Cui X">X Cui</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lin, J" uniqKey="Lin J">J Lin</name>
</author>
<author>
<name sortKey="Chen, Yt" uniqKey="Chen Y">YT Chen</name>
</author>
<author>
<name sortKey="Xia, J" uniqKey="Xia J">J Xia</name>
</author>
<author>
<name sortKey="Yang, Q" uniqKey="Yang Q">Q Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lucio, B" uniqKey="Lucio B">B Lucio</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fu, J" uniqKey="Fu J">J Fu</name>
</author>
<author>
<name sortKey="Liang, J" uniqKey="Liang J">J Liang</name>
</author>
<author>
<name sortKey="Kang, Hh" uniqKey="Kang H">HH Kang</name>
</author>
<author>
<name sortKey="Lin, J" uniqKey="Lin J">J Lin</name>
</author>
<author>
<name sortKey="Yu, Qh" uniqKey="Yu Q">QH Yu</name>
</author>
<author>
<name sortKey="Yang, Q" uniqKey="Yang Q">Q Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yin, Y" uniqKey="Yin Y">Y Yin</name>
</author>
<author>
<name sortKey="Qin, T" uniqKey="Qin T">T Qin</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author>
<name sortKey="Lin, J" uniqKey="Lin J">J Lin</name>
</author>
<author>
<name sortKey="Yu, Q" uniqKey="Yu Q">Q Yu</name>
</author>
<author>
<name sortKey="Yang, Q" uniqKey="Yang Q">Q Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Takashi, Y" uniqKey="Takashi Y">Y Takashi</name>
</author>
<author>
<name sortKey="Tatsuya, M" uniqKey="Tatsuya M">M Tatsuya</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Peng, Z" uniqKey="Peng Z">Z Peng</name>
</author>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J Wang</name>
</author>
<author>
<name sortKey="Shan, B" uniqKey="Shan B">B Shan</name>
</author>
<author>
<name sortKey="Yuan, F" uniqKey="Yuan F">F Yuan</name>
</author>
<author>
<name sortKey="Li, B" uniqKey="Li B">B Li</name>
</author>
<author>
<name sortKey="Dong, Y" uniqKey="Dong Y">Y Dong</name>
</author>
<author>
<name sortKey="Peng, W" uniqKey="Peng W">W Peng</name>
</author>
<author>
<name sortKey="Shi, W" uniqKey="Shi W">W Shi</name>
</author>
<author>
<name sortKey="Cheng, Y" uniqKey="Cheng Y">Y Cheng</name>
</author>
<author>
<name sortKey="Gao, Y" uniqKey="Gao Y">Y Gao</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shannon, P" uniqKey="Shannon P">P Shannon</name>
</author>
<author>
<name sortKey="Markiel, A" uniqKey="Markiel A">A Markiel</name>
</author>
<author>
<name sortKey="Ozier, O" uniqKey="Ozier O">O Ozier</name>
</author>
<author>
<name sortKey="Baliga, Ns" uniqKey="Baliga N">NS Baliga</name>
</author>
<author>
<name sortKey="Wang, Jt" uniqKey="Wang J">JT Wang</name>
</author>
<author>
<name sortKey="Ramage, D" uniqKey="Ramage D">D Ramage</name>
</author>
<author>
<name sortKey="Amin, N" uniqKey="Amin N">N Amin</name>
</author>
<author>
<name sortKey="Schwikowski, B" uniqKey="Schwikowski B">B Schwikowski</name>
</author>
<author>
<name sortKey="Ideker, T" uniqKey="Ideker T">T Ideker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cyplik, P" uniqKey="Cyplik P">P Cyplik</name>
</author>
<author>
<name sortKey="Schmidt, M" uniqKey="Schmidt M">M Schmidt</name>
</author>
<author>
<name sortKey="Szulc, A" uniqKey="Szulc A">A Szulc</name>
</author>
<author>
<name sortKey="Marecik, R" uniqKey="Marecik R">R Marecik</name>
</author>
<author>
<name sortKey="Lisiecki, P" uniqKey="Lisiecki P">P Lisiecki</name>
</author>
<author>
<name sortKey="Heipieper, Hj" uniqKey="Heipieper H">HJ Heipieper</name>
</author>
<author>
<name sortKey="Owsianiak, M" uniqKey="Owsianiak M">M Owsianiak</name>
</author>
<author>
<name sortKey="Vainshtein, M" uniqKey="Vainshtein M">M Vainshtein</name>
</author>
<author>
<name sortKey="Chrzanowski, L" uniqKey="Chrzanowski L">L Chrzanowski</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, Jh" uniqKey="Yang J">JH Yang</name>
</author>
<author>
<name sortKey="Li, Jh" uniqKey="Li J">JH Li</name>
</author>
<author>
<name sortKey="Jiang, S" uniqKey="Jiang S">S Jiang</name>
</author>
<author>
<name sortKey="Zhou, H" uniqKey="Zhou H">H Zhou</name>
</author>
<author>
<name sortKey="Qu, Lh" uniqKey="Qu L">LH Qu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Banchereau, J" uniqKey="Banchereau J">J Banchereau</name>
</author>
<author>
<name sortKey="Briere, F" uniqKey="Briere F">F Briere</name>
</author>
<author>
<name sortKey="Caux, C" uniqKey="Caux C">C Caux</name>
</author>
<author>
<name sortKey="Davoust, J" uniqKey="Davoust J">J Davoust</name>
</author>
<author>
<name sortKey="Lebecque, S" uniqKey="Lebecque S">S Lebecque</name>
</author>
<author>
<name sortKey="Liu, Yj" uniqKey="Liu Y">YJ Liu</name>
</author>
<author>
<name sortKey="Pulendran, B" uniqKey="Pulendran B">B Pulendran</name>
</author>
<author>
<name sortKey="Palucka, K" uniqKey="Palucka K">K Palucka</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Quinteros, Ja" uniqKey="Quinteros J">JA Quinteros</name>
</author>
<author>
<name sortKey="Lee, Sw" uniqKey="Lee S">SW Lee</name>
</author>
<author>
<name sortKey="Markham, Pf" uniqKey="Markham P">PF Markham</name>
</author>
<author>
<name sortKey="Noormohammadi, Ah" uniqKey="Noormohammadi A">AH Noormohammadi</name>
</author>
<author>
<name sortKey="Hartley, Ca" uniqKey="Hartley C">CA Hartley</name>
</author>
<author>
<name sortKey="Legione, Ar" uniqKey="Legione A">AR Legione</name>
</author>
<author>
<name sortKey="Coppo, Mj" uniqKey="Coppo M">MJ Coppo</name>
</author>
<author>
<name sortKey="Vaz, Pk" uniqKey="Vaz P">PK Vaz</name>
</author>
<author>
<name sortKey="Browning, Gf" uniqKey="Browning G">GF Browning</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bande, F" uniqKey="Bande F">F Bande</name>
</author>
<author>
<name sortKey="Arshad, Ss" uniqKey="Arshad S">SS Arshad</name>
</author>
<author>
<name sortKey="Omar, Ar" uniqKey="Omar A">AR Omar</name>
</author>
<author>
<name sortKey="Bejo, Mh" uniqKey="Bejo M">MH Bejo</name>
</author>
<author>
<name sortKey="Abubakar, Ms" uniqKey="Abubakar M">MS Abubakar</name>
</author>
<author>
<name sortKey="Abba, Y" uniqKey="Abba Y">Y Abba</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Real Time, R" uniqKey="Real Time R">R Real-Time</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rouse, Bt" uniqKey="Rouse B">BT Rouse</name>
</author>
<author>
<name sortKey="Sehrawat, S" uniqKey="Sehrawat S">S Sehrawat</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cardinaud, S" uniqKey="Cardinaud S">S Cardinaud</name>
</author>
<author>
<name sortKey="Urrutia, A" uniqKey="Urrutia A">A Urrutia</name>
</author>
<author>
<name sortKey="Rouers, A" uniqKey="Rouers A">A Rouers</name>
</author>
<author>
<name sortKey="Coulon, Pg" uniqKey="Coulon P">PG Coulon</name>
</author>
<author>
<name sortKey="Kervevan, J" uniqKey="Kervevan J">J Kervevan</name>
</author>
<author>
<name sortKey="Richetta, C" uniqKey="Richetta C">C Richetta</name>
</author>
<author>
<name sortKey="Bet, A" uniqKey="Bet A">A Bet</name>
</author>
<author>
<name sortKey="Maze, Ea" uniqKey="Maze E">EA Maze</name>
</author>
<author>
<name sortKey="Larsen, M" uniqKey="Larsen M">M Larsen</name>
</author>
<author>
<name sortKey="Iglesias, Mc" uniqKey="Iglesias M">MC Iglesias</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Palucka, K" uniqKey="Palucka K">K Palucka</name>
</author>
<author>
<name sortKey="Banchereau, J" uniqKey="Banchereau J">J Banchereau</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seifi, S" uniqKey="Seifi S">S Seifi</name>
</author>
<author>
<name sortKey="Boroomand, Z" uniqKey="Boroomand Z">Z Boroomand</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Winter, C" uniqKey="Winter C">C Winter</name>
</author>
<author>
<name sortKey="Herrler, G" uniqKey="Herrler G">G Herrler</name>
</author>
<author>
<name sortKey="Neumann, U" uniqKey="Neumann U">U Neumann</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abd El Rahman, S" uniqKey="Abd El Rahman S">S Abd El Rahman</name>
</author>
<author>
<name sortKey="El Kenawy, Aa" uniqKey="El Kenawy A">AA El-Kenawy</name>
</author>
<author>
<name sortKey="Neumann, U" uniqKey="Neumann U">U Neumann</name>
</author>
<author>
<name sortKey="Herrler, G" uniqKey="Herrler G">G Herrler</name>
</author>
<author>
<name sortKey="Winter, C" uniqKey="Winter C">C Winter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author>
<name sortKey="Buckles, E" uniqKey="Buckles E">E Buckles</name>
</author>
<author>
<name sortKey="Whittaker, Gr" uniqKey="Whittaker G">GR Whittaker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guo, X" uniqKey="Guo X">X Guo</name>
</author>
<author>
<name sortKey="Rosa, Aj" uniqKey="Rosa A">AJ Rosa</name>
</author>
<author>
<name sortKey="Chen, Dg" uniqKey="Chen D">DG Chen</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author>
<name sortKey="Rosa, Aj" uniqKey="Rosa A">AJ Rosa</name>
</author>
<author>
<name sortKey="Oliverira, Hn" uniqKey="Oliverira H">HN Oliverira</name>
</author>
<author>
<name sortKey="Rosa, Gj" uniqKey="Rosa G">GJ Rosa</name>
</author>
<author>
<name sortKey="Guo, X" uniqKey="Guo X">X Guo</name>
</author>
<author>
<name sortKey="Travnicek, M" uniqKey="Travnicek M">M Travnicek</name>
</author>
<author>
<name sortKey="Girshick, T" uniqKey="Girshick T">T Girshick</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lu, Erick" uniqKey="Lu E">Erick Lu</name>
</author>
<author>
<name sortKey="Dang, Eric V" uniqKey="Dang E">Eric V. Dang</name>
</author>
<author>
<name sortKey="Mcdonald, Jeffrey G" uniqKey="Mcdonald J">Jeffrey G. McDonald</name>
</author>
<author>
<name sortKey="Cyster, Jason G" uniqKey="Cyster J">Jason G. Cyster</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Maggi, J" uniqKey="Maggi J">J Maggi</name>
</author>
<author>
<name sortKey="Schinnerling, K" uniqKey="Schinnerling K">K Schinnerling</name>
</author>
<author>
<name sortKey="Pesce, B" uniqKey="Pesce B">B Pesce</name>
</author>
<author>
<name sortKey="Hilkens, Cm" uniqKey="Hilkens C">CM Hilkens</name>
</author>
<author>
<name sortKey="Catalan, D" uniqKey="Catalan D">D Catalan</name>
</author>
<author>
<name sortKey="Aguillon, Jc" uniqKey="Aguillon J">JC Aguillon</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sato, K" uniqKey="Sato K">K Sato</name>
</author>
<author>
<name sortKey="Honda, Si" uniqKey="Honda S">SI Honda</name>
</author>
<author>
<name sortKey="Shibuya, A" uniqKey="Shibuya A">A Shibuya</name>
</author>
<author>
<name sortKey="Shibuya, K" uniqKey="Shibuya K">K Shibuya</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Groux, H" uniqKey="Groux H">H Groux</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Beckebaum, S" uniqKey="Beckebaum S">S Beckebaum</name>
</author>
<author>
<name sortKey="Cicinnati, Vr" uniqKey="Cicinnati V">VR Cicinnati</name>
</author>
<author>
<name sortKey="Zhang, X" uniqKey="Zhang X">X Zhang</name>
</author>
<author>
<name sortKey="Ferencik, S" uniqKey="Ferencik S">S Ferencik</name>
</author>
<author>
<name sortKey="Frilling, A" uniqKey="Frilling A">A Frilling</name>
</author>
<author>
<name sortKey="Grosse Wilde, H" uniqKey="Grosse Wilde H">H Grosse-Wilde</name>
</author>
<author>
<name sortKey="Broelsch, Ce" uniqKey="Broelsch C">CE Broelsch</name>
</author>
<author>
<name sortKey="Gerken, G" uniqKey="Gerken G">G Gerken</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Umbach, Jl" uniqKey="Umbach J">JL Umbach</name>
</author>
<author>
<name sortKey="Cullen, Br" uniqKey="Cullen B">BR Cullen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, N" uniqKey="Li N">N Li</name>
</author>
<author>
<name sortKey="Yan, Y" uniqKey="Yan Y">Y Yan</name>
</author>
<author>
<name sortKey="Zhang, A" uniqKey="Zhang A">A Zhang</name>
</author>
<author>
<name sortKey="Gao, J" uniqKey="Gao J">J Gao</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C Zhang</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author>
<name sortKey="Hou, G" uniqKey="Hou G">G Hou</name>
</author>
<author>
<name sortKey="Zhang, G" uniqKey="Zhang G">G Zhang</name>
</author>
<author>
<name sortKey="Jia, J" uniqKey="Jia J">J Jia</name>
</author>
<author>
<name sortKey="Zhou, Em" uniqKey="Zhou E">EM Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Miesen, P" uniqKey="Miesen P">P Miesen</name>
</author>
<author>
<name sortKey="Ivens, A" uniqKey="Ivens A">A Ivens</name>
</author>
<author>
<name sortKey="Buck, Ah" uniqKey="Buck A">AH Buck</name>
</author>
<author>
<name sortKey="Van Rij, Rp" uniqKey="Van Rij R">RP van Rij</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Duru, N" uniqKey="Duru N">N Duru</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author>
<name sortKey="Gernapudi, R" uniqKey="Gernapudi R">R Gernapudi</name>
</author>
<author>
<name sortKey="Wolfson, B" uniqKey="Wolfson B">B Wolfson</name>
</author>
<author>
<name sortKey="Lo, Pk" uniqKey="Lo P">PK Lo</name>
</author>
<author>
<name sortKey="Yao, Y" uniqKey="Yao Y">Y Yao</name>
</author>
<author>
<name sortKey="Zhou, Q" uniqKey="Zhou Q">Q Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dong, W" uniqKey="Dong W">W Dong</name>
</author>
<author>
<name sortKey="Yao, C" uniqKey="Yao C">C Yao</name>
</author>
<author>
<name sortKey="Teng, X" uniqKey="Teng X">X Teng</name>
</author>
<author>
<name sortKey="Chai, J" uniqKey="Chai J">J Chai</name>
</author>
<author>
<name sortKey="Yang, X" uniqKey="Yang X">X Yang</name>
</author>
<author>
<name sortKey="Li, B" uniqKey="Li B">B Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Song, L" uniqKey="Song L">L Song</name>
</author>
<author>
<name sortKey="Liu, H" uniqKey="Liu H">H Liu</name>
</author>
<author>
<name sortKey="Gao, S" uniqKey="Gao S">S Gao</name>
</author>
<author>
<name sortKey="Jiang, W" uniqKey="Jiang W">W Jiang</name>
</author>
<author>
<name sortKey="Huang, W" uniqKey="Huang W">W Huang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
<author>
<name sortKey="Cheng, M" uniqKey="Cheng M">M Cheng</name>
</author>
<author>
<name sortKey="Qiao, S" uniqKey="Qiao S">S Qiao</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author>
<name sortKey="Li, H" uniqKey="Li H">H Li</name>
</author>
<author>
<name sortKey="Wang, N" uniqKey="Wang N">N Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Ys" uniqKey="Wang Y">YS Wang</name>
</author>
<author>
<name sortKey="Ouyang, W" uniqKey="Ouyang W">W Ouyang</name>
</author>
<author>
<name sortKey="Pan, Qx" uniqKey="Pan Q">QX Pan</name>
</author>
<author>
<name sortKey="Wang, Xl" uniqKey="Wang X">XL Wang</name>
</author>
<author>
<name sortKey="Xia, Xx" uniqKey="Xia X">XX Xia</name>
</author>
<author>
<name sortKey="Bi, Zw" uniqKey="Bi Z">ZW Bi</name>
</author>
<author>
<name sortKey="Wang, Yq" uniqKey="Wang Y">YQ Wang</name>
</author>
<author>
<name sortKey="Wang, Xm" uniqKey="Wang X">XM Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author>
<name sortKey="Brahmakshatriya, V" uniqKey="Brahmakshatriya V">V Brahmakshatriya</name>
</author>
<author>
<name sortKey="Zhu, H" uniqKey="Zhu H">H Zhu</name>
</author>
<author>
<name sortKey="Lupiani, B" uniqKey="Lupiani B">B Lupiani</name>
</author>
<author>
<name sortKey="Reddy, Sm" uniqKey="Reddy S">SM Reddy</name>
</author>
<author>
<name sortKey="Yoon, Bj" uniqKey="Yoon B">BJ Yoon</name>
</author>
<author>
<name sortKey="Gunaratne, Ph" uniqKey="Gunaratne P">PH Gunaratne</name>
</author>
<author>
<name sortKey="Kim, Jh" uniqKey="Kim J">JH Kim</name>
</author>
<author>
<name sortKey="Chen, R" uniqKey="Chen R">R Chen</name>
</author>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Peng, X" uniqKey="Peng X">X Peng</name>
</author>
<author>
<name sortKey="Gao, Qs" uniqKey="Gao Q">QS Gao</name>
</author>
<author>
<name sortKey="Zhou, L" uniqKey="Zhou L">L Zhou</name>
</author>
<author>
<name sortKey="Chen, Zh" uniqKey="Chen Z">ZH Chen</name>
</author>
<author>
<name sortKey="Lu, S" uniqKey="Lu S">S Lu</name>
</author>
<author>
<name sortKey="Huang, Hj" uniqKey="Huang H">HJ Huang</name>
</author>
<author>
<name sortKey="Zhan, Cy" uniqKey="Zhan C">CY Zhan</name>
</author>
<author>
<name sortKey="Xiang, M" uniqKey="Xiang M">M Xiang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kemper, C" uniqKey="Kemper C">C Kemper</name>
</author>
<author>
<name sortKey="Atkinson, Jp" uniqKey="Atkinson J">JP Atkinson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Banat, Gr" uniqKey="Banat G">GR Banat</name>
</author>
<author>
<name sortKey="Tkalcic, S" uniqKey="Tkalcic S">S Tkalcic</name>
</author>
<author>
<name sortKey="Dzielawa, Ja" uniqKey="Dzielawa J">JA Dzielawa</name>
</author>
<author>
<name sortKey="Jackwood, Mw" uniqKey="Jackwood M">MW Jackwood</name>
</author>
<author>
<name sortKey="Saggese, Md" uniqKey="Saggese M">MD Saggese</name>
</author>
<author>
<name sortKey="Yates, L" uniqKey="Yates L">L Yates</name>
</author>
<author>
<name sortKey="Kopulos, R" uniqKey="Kopulos R">R Kopulos</name>
</author>
<author>
<name sortKey="Briles, We" uniqKey="Briles W">WE Briles</name>
</author>
<author>
<name sortKey="Collisson, Ew" uniqKey="Collisson E">EW Collisson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bacon, Ld" uniqKey="Bacon L">LD Bacon</name>
</author>
<author>
<name sortKey="Hunter, Db" uniqKey="Hunter D">DB Hunter</name>
</author>
<author>
<name sortKey="Zhang, Hm" uniqKey="Zhang H">HM Zhang</name>
</author>
<author>
<name sortKey="Brand, K" uniqKey="Brand K">K Brand</name>
</author>
<author>
<name sortKey="Etches, R" uniqKey="Etches R">R Etches</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Izumi, G" uniqKey="Izumi G">G Izumi</name>
</author>
<author>
<name sortKey="Koga, K" uniqKey="Koga K">K Koga</name>
</author>
<author>
<name sortKey="Takamura, M" uniqKey="Takamura M">M Takamura</name>
</author>
<author>
<name sortKey="Makabe, T" uniqKey="Makabe T">T Makabe</name>
</author>
<author>
<name sortKey="Nagai, M" uniqKey="Nagai M">M Nagai</name>
</author>
<author>
<name sortKey="Urata, Y" uniqKey="Urata Y">Y Urata</name>
</author>
<author>
<name sortKey="Harada, M" uniqKey="Harada M">M Harada</name>
</author>
<author>
<name sortKey="Hirata, T" uniqKey="Hirata T">T Hirata</name>
</author>
<author>
<name sortKey="Hirota, Y" uniqKey="Hirota Y">Y Hirota</name>
</author>
<author>
<name sortKey="Fujii, T" uniqKey="Fujii T">T Fujii</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lo, Yl" uniqKey="Lo Y">YL Lo</name>
</author>
<author>
<name sortKey="Liou, Gg" uniqKey="Liou G">GG Liou</name>
</author>
<author>
<name sortKey="Lyu, Jh" uniqKey="Lyu J">JH Lyu</name>
</author>
<author>
<name sortKey="Hsiao, M" uniqKey="Hsiao M">M Hsiao</name>
</author>
<author>
<name sortKey="Hsu, Tl" uniqKey="Hsu T">TL Hsu</name>
</author>
<author>
<name sortKey="Wong, Ch" uniqKey="Wong C">CH Wong</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chang, Wc" uniqKey="Chang W">WC Chang</name>
</author>
<author>
<name sortKey="White, Mr" uniqKey="White M">MR White</name>
</author>
<author>
<name sortKey="Moyo, P" uniqKey="Moyo P">P Moyo</name>
</author>
<author>
<name sortKey="Mcclear, S" uniqKey="Mcclear S">S McClear</name>
</author>
<author>
<name sortKey="Thiel, S" uniqKey="Thiel S">S Thiel</name>
</author>
<author>
<name sortKey="Hartshorn, Kl" uniqKey="Hartshorn K">KL Hartshorn</name>
</author>
<author>
<name sortKey="Takahashi, K" uniqKey="Takahashi K">K Takahashi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Michelow, Ic" uniqKey="Michelow I">IC Michelow</name>
</author>
<author>
<name sortKey="Lear, C" uniqKey="Lear C">C Lear</name>
</author>
<author>
<name sortKey="Scully, C" uniqKey="Scully C">C Scully</name>
</author>
<author>
<name sortKey="Prugar, Li" uniqKey="Prugar L">LI Prugar</name>
</author>
<author>
<name sortKey="Longley, Cb" uniqKey="Longley C">CB Longley</name>
</author>
<author>
<name sortKey="Yantosca, Lm" uniqKey="Yantosca L">LM Yantosca</name>
</author>
<author>
<name sortKey="Ji, X" uniqKey="Ji X">X Ji</name>
</author>
<author>
<name sortKey="Karpel, M" uniqKey="Karpel M">M Karpel</name>
</author>
<author>
<name sortKey="Brudner, M" uniqKey="Brudner M">M Brudner</name>
</author>
<author>
<name sortKey="Takahashi, K" uniqKey="Takahashi K">K Takahashi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brown, Ks" uniqKey="Brown K">KS Brown</name>
</author>
<author>
<name sortKey="Keogh, Mj" uniqKey="Keogh M">MJ Keogh</name>
</author>
<author>
<name sortKey="Owsianka, Am" uniqKey="Owsianka A">AM Owsianka</name>
</author>
<author>
<name sortKey="Adair, R" uniqKey="Adair R">R Adair</name>
</author>
<author>
<name sortKey="Patel, Ah" uniqKey="Patel A">AH Patel</name>
</author>
<author>
<name sortKey="Arnold, Jn" uniqKey="Arnold J">JN Arnold</name>
</author>
<author>
<name sortKey="Ball, Jk" uniqKey="Ball J">JK Ball</name>
</author>
<author>
<name sortKey="Sim, Rb" uniqKey="Sim R">RB Sim</name>
</author>
<author>
<name sortKey="Tarr, Aw" uniqKey="Tarr A">AW Tarr</name>
</author>
<author>
<name sortKey="Hickling, Tp" uniqKey="Hickling T">TP Hickling</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tawana, K" uniqKey="Tawana K">K Tawana</name>
</author>
<author>
<name sortKey="Rio Machin, A" uniqKey="Rio Machin A">A Rio-Machin</name>
</author>
<author>
<name sortKey="Preudhomme, C" uniqKey="Preudhomme C">C Preudhomme</name>
</author>
<author>
<name sortKey="Fitzgibbon, J" uniqKey="Fitzgibbon J">J Fitzgibbon</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yu, Wq" uniqKey="Yu W">WQ Yu</name>
</author>
<author>
<name sortKey="Sun, Jn" uniqKey="Sun J">JN Sun</name>
</author>
<author>
<name sortKey="Tan, Yh" uniqKey="Tan Y">YH Tan</name>
</author>
<author>
<name sortKey="Cui, Jw" uniqKey="Cui J">JW Cui</name>
</author>
<author>
<name sortKey="Li, W" uniqKey="Li W">W Li</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">BMC Genomics</journal-id>
<journal-id journal-id-type="iso-abbrev">BMC Genomics</journal-id>
<journal-title-group>
<journal-title>BMC Genomics</journal-title>
</journal-title-group>
<issn pub-type="epub">1471-2164</issn>
<publisher>
<publisher-name>BioMed Central</publisher-name>
<publisher-loc>London</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">31286855</article-id>
<article-id pub-id-type="pmc">6615177</article-id>
<article-id pub-id-type="publisher-id">5940</article-id>
<article-id pub-id-type="doi">10.1186/s12864-019-5940-6</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Microarray analysis of infectious bronchitis virus infection of chicken primary dendritic cells</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Lin</surname>
<given-names>Jian</given-names>
</name>
<address>
<email>linjian@njau.edu.cn</email>
</address>
<xref ref-type="aff" rid="Aff1">1</xref>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wang</surname>
<given-names>Zhisheng</given-names>
</name>
<address>
<email>zhisheng.wang@163.com</email>
</address>
<xref ref-type="aff" rid="Aff3">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Jialu</given-names>
</name>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Yang</surname>
<given-names>Qian</given-names>
</name>
<address>
<phone>+86 025 84395817</phone>
<email>zxbyq@njau.edu.cn</email>
</address>
<xref ref-type="aff" rid="Aff1">1</xref>
<xref ref-type="aff" rid="Aff2">2</xref>
</contrib>
<aff id="Aff1">
<label>1</label>
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Life Sciences,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</aff>
<aff id="Aff2">
<label>2</label>
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0000 9750 7019</institution-id>
<institution-id institution-id-type="GRID">grid.27871.3b</institution-id>
<institution>College of Veterinary medicine,</institution>
<institution>Nanjing Agricultural University,</institution>
</institution-wrap>
Wei gang 1, Nanjing, Jiangsu 210095 People’s Republic of China</aff>
<aff id="Aff3">
<label>3</label>
<institution-wrap>
<institution-id institution-id-type="ISNI">0000 0001 0017 5204</institution-id>
<institution-id institution-id-type="GRID">grid.454840.9</institution-id>
<institution>National Veterinary Product Engineering Research Center, Jiangsu Academy of Agricultural Sciences,</institution>
</institution-wrap>
Nanjing, China</aff>
</contrib-group>
<pub-date pub-type="epub">
<day>8</day>
<month>7</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="pmc-release">
<day>8</day>
<month>7</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="collection">
<year>2019</year>
</pub-date>
<volume>20</volume>
<elocation-id>557</elocation-id>
<history>
<date date-type="received">
<day>26</day>
<month>7</month>
<year>2018</year>
</date>
<date date-type="accepted">
<day>26</day>
<month>6</month>
<year>2019</year>
</date>
</history>
<permissions>
<copyright-statement>© The Author(s). 2019</copyright-statement>
<license license-type="OpenAccess">
<license-p>
<bold>Open Access</bold>
This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<abstract id="Abs1">
<sec>
<title>Background</title>
<p id="Par1">Avian infectious bronchitis virus (IBV) is a major respiratory disease-causing agent in birds that leads to significant losses. Dendritic cells (DCs) are specialised cells responsible for sampling antigens and presenting them to T cells, which also play an essential role in recognising and neutralising viruses. Recent studies have suggested that non-coding RNAs may regulate the functional program of DCs. Expression of host non-coding RNAs changes markedly during infectious bronchitis virus infection, but their role in regulating host immune function has not been explored. Here, microarrays of mRNAs, miRNAs, and lncRNAs were globally performed to analyse how avian DCs respond to IBV.</p>
</sec>
<sec>
<title>Results</title>
<p id="Par2">First, we found that IBV stimulation did not enhance the maturation ability of avian DCs. Interestingly, inactivated IBV was better able than IBV to induce DC maturation and activate lymphocytes. We identified 1093 up-regulated and 845 down-regulated mRNAs in IBV-infected avian DCs. Gene Ontology analysis suggested that cellular macromolecule and protein location (GO-BP) and transcription factor binding (GO-MF) were abundant in IBV-stimulated avian DCs. Meanwhile, pathway analysis indicated that the oxidative phosphorylation and leukocyte transendothelial migration signalling pathways might be activated in the IBV group. Moreover, alteration of microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) was detected in IBV-stimulated avian DCs. In total, 19 significantly altered (7 up and 12 down) miRNAs and 101 (75 up and 26 down) lncRNAs were identified in the IBV-treated group. Further analysis showed that the actin cytoskeleton and MAPK signal pathway were related to the target genes of IBV-stimulated miRNAs. Finally, our study identified 2 TF-microRNA and 53 TF–microRNA–mRNA interactions involving 1 TF, 2 miRNAs, and 53 mRNAs in IBV-stimulated avian DCs.</p>
</sec>
<sec>
<title>Conclusions</title>
<p id="Par3">Our research suggests a new mechanism to explain why IBV actively blocks innate responses needed for inducing immune gene expression and also provides insight into the pathogenic mechanisms of avian IBV.</p>
</sec>
<sec>
<title>Electronic supplementary material</title>
<p>The online version of this article (10.1186/s12864-019-5940-6) contains supplementary material, which is available to authorized users.</p>
</sec>
</abstract>
<kwd-group xml:lang="en">
<title>Keywords</title>
<kwd>Infectious bronchitis virus</kwd>
<kwd>Dendritic cells</kwd>
<kwd>mRNA</kwd>
<kwd>microRNA</kwd>
<kwd>lncRNA</kwd>
</kwd-group>
<funding-group>
<award-group>
<funding-source>
<institution>National Key Research and Development Program of China</institution>
</funding-source>
<award-id>2017YFD500706</award-id>
<principal-award-recipient>
<name>
<surname>Lin</surname>
<given-names>Jian</given-names>
</name>
</principal-award-recipient>
</award-group>
</funding-group>
<funding-group>
<award-group>
<funding-source>
<institution>National Natural Science Grant of P. R. China</institution>
</funding-source>
<award-id>No. 31702197</award-id>
<principal-award-recipient>
<name>
<surname>Lin</surname>
<given-names>Jian</given-names>
</name>
</principal-award-recipient>
</award-group>
</funding-group>
<funding-group>
<award-group>
<funding-source>
<institution>Independent Innovation of Agricultural Sciences Program of Jiangsu Province</institution>
</funding-source>
<award-id>CX (13)5035</award-id>
<principal-award-recipient>
<name>
<surname>Wang</surname>
<given-names>Zhisheng</given-names>
</name>
</principal-award-recipient>
</award-group>
</funding-group>
<funding-group>
<award-group>
<funding-source>
<institution>A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions</institution>
</funding-source>
<award-id>PAPD</award-id>
</award-group>
</funding-group>
<funding-group>
<award-group>
<funding-source>
<institution> the Fundamental Research Funds for the Central Universities </institution>
</funding-source>
<award-id>JCQY201906</award-id>
<award-id>KJQN2018034</award-id>
<principal-award-recipient>
<name>
<surname>Lin</surname>
<given-names>Jian</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Qian</given-names>
</name>
</principal-award-recipient>
</award-group>
</funding-group>
<custom-meta-group>
<custom-meta>
<meta-name>issue-copyright-statement</meta-name>
<meta-value>© The Author(s) 2019</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="Sec1">
<title>Background</title>
<p id="Par4">Avian infectious bronchitis virus (IBV) is a member of the coronaviridiae family that targets both the meat-type and commercial egg-laying chickens. IBV mainly replicates in the epithelial cells of the respiratory tract, causing lower respiratory tract infections in chickens [
<xref ref-type="bibr" rid="CR1">1</xref>
,
<xref ref-type="bibr" rid="CR2">2</xref>
]. The threat of IBV infection is global, as this respiratory virus can cause acute and contagious respiratory infections in poultry, resulting in serious economic losses [
<xref ref-type="bibr" rid="CR3">3</xref>
,
<xref ref-type="bibr" rid="CR4">4</xref>
]. The strategy of reducing IBV infection through vaccination has been recognised as a viable option to control IBV and has been somewhat successful [
<xref ref-type="bibr" rid="CR5">5</xref>
,
<xref ref-type="bibr" rid="CR6">6</xref>
]. The continuing prevalence of IBV might be attributable to divergent IBV subtypes. Despite efficient protection against genetically similar strains, vaccines may not be effective against all subtypes [
<xref ref-type="bibr" rid="CR7">7</xref>
,
<xref ref-type="bibr" rid="CR8">8</xref>
]. Isolated IBV has been associated with proventriculus and kidney lesions [
<xref ref-type="bibr" rid="CR9">9</xref>
]. IBV infections are difficult to control mainly due to poor cross-protection between different types of IBV [
<xref ref-type="bibr" rid="CR10">10</xref>
,
<xref ref-type="bibr" rid="CR11">11</xref>
]. Thus, effective control of IBV infection is still a major challenge for poultry health management.</p>
<p id="Par5">IBV has a large genome and is an obligate intracellular pathogen that exploits the host’s cellular machinery to replicate [
<xref ref-type="bibr" rid="CR12">12</xref>
,
<xref ref-type="bibr" rid="CR13">13</xref>
]. Elucidating the potential cellular interactions between the host immune system and the pathogen will not only provide insights into disease pathogenesis but will also support strategies for preventing IBV infection [
<xref ref-type="bibr" rid="CR10">10</xref>
,
<xref ref-type="bibr" rid="CR14">14</xref>
,
<xref ref-type="bibr" rid="CR15">15</xref>
]. Previous studies of IBV have focussed primarily on Vero cells and avian DF-1 cells [
<xref ref-type="bibr" rid="CR16">16</xref>
,
<xref ref-type="bibr" rid="CR17">17</xref>
] and have rarely involved the function of avian DCs during IBV infection. Avian DCs have the unique ability to induce both innate and acquired immune responses and are mainly identified in the primary and secondary lymphoid organs [
<xref ref-type="bibr" rid="CR18">18</xref>
,
<xref ref-type="bibr" rid="CR19">19</xref>
]. Our previous study illustrated that the TF-microRNA-mRNA regulation loop might mediate the activation of avian DCs stimulated by infectious bursal disease virus (IBDV) [
<xref ref-type="bibr" rid="CR20">20</xref>
].</p>
<p id="Par6">Non-coding RNAs are post-transcriptional regulators that fine-tune the immune response [
<xref ref-type="bibr" rid="CR21">21</xref>
,
<xref ref-type="bibr" rid="CR22">22</xref>
]. Among non-coding RNAs, miRNAs are key regulators of immune responses [
<xref ref-type="bibr" rid="CR23">23</xref>
,
<xref ref-type="bibr" rid="CR24">24</xref>
]. Unsurprisingly, major changes in miRNA expression have been shown to be the underlying mechanism triggering the host immune response [
<xref ref-type="bibr" rid="CR24">24</xref>
]. For example, miR29c was found to enhance the immune function of DCs, whereas miR375 was suggested to attenuate the antigen-presenting ability of mouse DCs [
<xref ref-type="bibr" rid="CR25">25</xref>
,
<xref ref-type="bibr" rid="CR26">26</xref>
]. In addition to evoking an immune response, miRNAs may also shape host–virus interactions and defend against viral infection [
<xref ref-type="bibr" rid="CR27">27</xref>
,
<xref ref-type="bibr" rid="CR28">28</xref>
]. For example, miR674 can target host Mbnl3 to modulate antiviral responses inhibiting H9N2 avian influenza virus replication [
<xref ref-type="bibr" rid="CR29">29</xref>
]. Meanwhile, lncRNAs play essential roles in regulating the defence process against viral infection [
<xref ref-type="bibr" rid="CR21">21</xref>
]. To explore the potential roles of miRNAs and lncRNAs in IBV infection, we first evaluated the ability of IBV to induce chicken and mouse DC maturation and lymphocyte cell activation. Then, microarrays and bioinformatic analysis were performed to reveal the mechanism underlying the IBV response in avian DCs. Our results provide a better mechanism of the interaction between IBV and avian dendritic cells.</p>
</sec>
<sec id="Sec2">
<title>Methods</title>
<sec id="Sec3">
<title>Animal and virus</title>
<p id="Par7">Our mice, including all the 6 to 8 wk. SPF BALB/c or C57BL/6, were purchased from Yang Zhou University (Center Comparative Medical). Whilst 3 to 4 wk. SPF ROSS 308 avian were bought from the Jiangsu Academy of Agricultural Sciences (JAAS) (Nanjing, China). All animals were maintained at an animal facility under pathogen free conditions. IBV strain Massachusetts-41 [
<xref ref-type="bibr" rid="CR30">30</xref>
] containing 1 × 10
<sup>6.6</sup>
EID
<sub>50</sub>
(egg infectious dose) of IBV was kindly provided by Nanjing Tian bang Bio-Industry Co. Ltd. (Nanjing, China). The infectious bronchitis virus was inactive by UV light (260 nm, with in 15 cm) for 4 h and tested for complete loss of the infectivity before using.</p>
</sec>
<sec id="Sec4">
<title>Phenotypic alteration and T-cell proliferation of DCs stimulated by IBV</title>
<sec id="Sec5">
<title>Surface marker analysis of avian bone marrow-derived dendritic cells (BMDCs)</title>
<p id="Par8">Avian bone marrow-derived dendritic cells were obtained from 3 to 4 week-old chicks. All animal experiments were carried out in accordance with the regulations and guidelines of laboratory animals of Nanjing Agriculture University (Nanjing, China). Initially, avians were euthanized by putting the cultured cage of avian into the carbon dioxide sealed tank. Then, femurs and tibias were removed and isolated from the surrounding muscle tissue using sterile instruments (we did not using any anesthesia during the removal of avian femurs and tibias from animals for the avian for the animal has been euthanized). The detail method for isolating avian BMDCs were the same as our previous published manusccript [
<xref ref-type="bibr" rid="CR31">31</xref>
]. Immature avian BMDCs were plated in fresh medium (1 × 10
<sup>6</sup>
cells/ml) and treated with LPS (1 μg/ml, positive control), IBV (EID
<sub>50</sub>
 = 10
<sup>–6.5</sup>
/0.1 ml) and inactivated IBV for 24 h at 37 °C and 5% CO
<sub>2</sub>
. For IBV, cells were incubated at a multiplicity of infection of 1 (MOI = 1) for 24 h. Then, both group were collected, washed and incubated at 4 °C for 30 min with PE-conjugated anti-human CD11c, anti-chicken CD40 (clone: AV79) or CD86 (clone: IAH:F853:AG2) antibody. Cells stained by CD40 and CD86 were then stained by PE-conjugated goat anti-mouse IgG secondary antibody (MultiScience, China) diluted 1: 5000 for another 15 min at room temperature. Cells were washed and analyzed with Fluorescence Activated Cell Sorter (FACS).</p>
</sec>
<sec id="Sec6">
<title>Surface marker analysis of mice BMDCs</title>
<p id="Par9">Immature mice BMDCs were plated in fresh medium (1 × 10
<sup>6</sup>
cells/ml) and treated with LPS, IBV or inactivated IBV for 24 h at 37 °C and 5% CO
<sub>2</sub>
. Cells were collected, washed and incubated at 4 °C for 30 min with following antibody (monoclonal antibodies (anti-mouse CD11c (N418), anti-mouse CD40(1C10), anti-mouse CD86(GL1), anti-mouse MHCII (M5/114.15.2) and anti-mouse CD80 antibody (16-10A1), respectively (eBioscience, USA)), and analyzed by FACS.</p>
</sec>
<sec id="Sec7">
<title>T-cell proliferation assays</title>
<p id="Par10">To further evaluate the antigen presenting function of avian or mouse DCs, mixed lymphocyte reaction (MLR) experiments were performed as previous research. The detail method for isolating avian BMDCs were the same as our previous published manusccript [
<xref ref-type="bibr" rid="CR32">32</xref>
]. The stimulator cells were DCs previously treated with IBV, inactivated IBV or LPS for 24 h. All experiments were performed at least in triplicates. After 3 days of culture in 5% CO
<sub>2</sub>
at 37 °C, cell proliferation was determined by Cell Counting Kit-8 (CCK-8) assay (Beyotime, China). Each well received 20 μL CCK-8 solution and was incubated for 2 h at 37 °C before absorbance measurement at 450 nm. The Stimulation Index was calculated as references.</p>
</sec>
</sec>
<sec id="Sec8">
<title>Microarrays analyses of mRNAs, microRNAs and lncRNAs</title>
<p id="Par11">Cultured avian BMDCs were randomly divided into either control or IBV-stimulated groups. For IBV stimulated group, cells were incubated at a multiplicity of infection of 1 (MOI = 1) for 12 h. Each group consisted of three wells of BMDCs from three chickens. Total RNA and microRNA were separately isolated using the RNeasy Total RNA Isolation Kit (QIAGEN, Germany). The avian microarray (containing mRNA and lncRNA, RiboArray™ Custom Array (A10000–1-90)) was hybridised. Approximately 3900 lncRNAs and 15,081 mRNAs are detected using the mRNA microarray. In each microarray, we have three replication per slide. Also, we have used the microRNA array (A10000–1-40) to detect the experssion of microRNA. Approximately 991 microRNAs are detected using the microRNA microarray Raw data were normalized using the RMA method [
<xref ref-type="bibr" rid="CR20">20</xref>
,
<xref ref-type="bibr" rid="CR33">33</xref>
].</p>
<sec id="Sec9">
<title>Identification and bioinformatics analyses of differentially expressed mRNAs</title>
<p id="Par12">Differentially expressed (DE) mRNAs between control avian DCs group and IBV stimulated group were determined with a cut off of at least 2-fold change and a
<italic>P</italic>
value less than 0.01. Such genes were subject to GO categorization, KEGG (Kyoto Encyclopedia of Genes and Genomes) and BioCartapathway analyses. Analyses were performed with DAVID (the Database for Annotation, Visualization and Integrated Discovery) by using an independent list of differentially-expressed genes.</p>
</sec>
<sec id="Sec10">
<title>Identification of differentially expressed microRNAs and its target prediction and bioinformatics analyses</title>
<p id="Par13">DE microRNAs were chosen with a cut off of at least 2-fold change and a
<italic>p</italic>
value less than 0.05. Potential targets of these microRNAs were predicted using the microRNA target prediction and functional study database (miRDB) and TargetScan. Taking the intersection of these two predictions, we obtain the optimal potential target genes. To further understand the potential functions of microRNA - target genes, GO categorization and pathway analysis were assigned using the DAVID gene annotation tool.</p>
</sec>
<sec id="Sec11">
<title>Identification of differentially expressed lncRNAs and its association analyses with differentially expressed mRNAs</title>
<p id="Par14">DE lncRNAs between IBV stimulated group and control group were first chosen with a cut off of at least 2-fold change and a
<italic>P</italic>
value less than 0.01. Since transcriptional regulation by lncRNAs could work either in cis or trans model, we then predicted the cis and trans target gene of difference expressed lncRNAs as previous published manuscript [
<xref ref-type="bibr" rid="CR34">34</xref>
]. To further classifly lncRNA trans-target genes, the RNAplex program (RNAplex < − 100) was then used to identify possible trans-target genes of the lncRNAs. Thirdly, the Pearson correlation coefficient absolute value over 0.9 together with P value less than 0.01 were used to predict the lncRNA’s co-expression target genes. Finally, the lncRNAs and co-expression genes relationship networks were drawn using Cytoscape software [
<xref ref-type="bibr" rid="CR35">35</xref>
].</p>
</sec>
</sec>
<sec id="Sec12">
<title>QRT-PCR confirmation of mRNAs, microRNAs and lncRNAs microarrays result</title>
<p id="Par15">Based on our microarrays results, we selected representative mRNAs, microRNAs and lncRNAs for validating. For real-time PCR, 7500 Real-Time PCR System (ABI) and SYBR Green Master (Takara) were used. Each sample and negative controls had at least three technical replicates. GAPDH, β-actin and 5S rRNA were amplified under the same conditions as internal controls. The relatives fold change was calculated based on the -ΔΔct method [
<xref ref-type="bibr" rid="CR36">36</xref>
].</p>
</sec>
<sec id="Sec13">
<title>Construction of TF (transcription factor)-microRNA-mRNA regulatory loops</title>
<p id="Par16">TF-microRNA-mRNA loops, representing putative regulatory mechanisms, were constructed based on the microRNA target prediction and functional study database (miRDB) and ChIPBase. We first used ChIPBase to construct TF-microRNA regulatory networks [
<xref ref-type="bibr" rid="CR37">37</xref>
]. Considering differentially expressed microRNAs in IBV stimulated DCs, we defined the microRNAs promoter region from the 5 kb upstream to 1 kb downstream region. Then, we extracted TF and microRNA target genes information from ChIPBase. Moreover, we constructed TF-microRNA-mRNAs regulation loops and visualized with cytoscape.</p>
</sec>
<sec id="Sec14">
<title>Statistical analyses</title>
<p id="Par17">All our data are expressed as the mean ± standard error. Statistical analyses were performed using GraphPad Prism 5 software. Pairwise comparisons were performed using an unpaired two-tailed Student t test. Multiple groups were compared by one-way ANOVA followed with Tukey’s multiple comparison tests.
<italic>P</italic>
values less than 0.05 were considered to be statistically significant. FlowJo software was selected for the analyzing of our FACS data.</p>
</sec>
</sec>
<sec id="Sec15">
<title>Results</title>
<sec id="Sec16">
<title>Activation of avian or mouse bone marrow-derived dendritic cells (BMDCs) through IBV stimulation</title>
<p id="Par18">We investigated how IBV stimulation influences the phenotypic alteration and T lymphocyte activation of avian or mouse BMDCs. Initially, we examined phenotypic changes [
<xref ref-type="bibr" rid="CR38">38</xref>
] in avian and mouse DCs stimulated with IBV or inactivated IBV. The fluorescence-activated cell sorting (FACS) results suggested that immature avian BMDCs expressed high levels of cell surface MHC-II (66.5%) and putative CD11c molecules (77.2%), as did immature mouse BMDCs (Fig. 
<xref rid="Fig1" ref-type="fig">1</xref>
a). After IBV stimulation, the surface markers CD40 and CD86 were slightly enhanced in avian BMDCs (Fig.
<xref rid="Fig1" ref-type="fig">1</xref>
b) but did not show a notable increase in mouse BMDCs (Fig.
<xref rid="Fig1" ref-type="fig">1</xref>
e). In contrast, the percentages of CD40 and CD86 in inactivated IBV-stimulated avian BMDCs were significantly higher than those in the IBV-stimulated group (Fig.
<xref rid="Fig1" ref-type="fig">1</xref>
b). Interestingly, the CD40 percentage showed no increase in mouse BMDCs stimulated with IBV (Fig.
<xref rid="Fig1" ref-type="fig">1</xref>
e).
<fig id="Fig1">
<label>Fig. 1</label>
<caption>
<p>Phenotypic alterations and mixed-lymphocyte reactions (MLR) of avian and mouse BMDCs in response to avian infectious bronchitis virus.
<bold>a</bold>
Flow cytometric analysis of the phenotypic alterations of immature avian BMDCs at day 7 showed high levels of CD11c and MHC Class II (Black lines display staining with the indicated antibodies, and grey lines the isotype controls).
<bold>b</bold>
CD40 and CD86 expression of avian BMDCs stimulated by IBV and inactivated IBV (Non-stimulated: immature avian DCs treatment with PBS; LPS: Positive control, immature avian DCs treated with 1 μg/ml LPS; IBV: immature avian DCs stimulated with IBV (MOI = 1); inactivated IBV: immature avian DCs stimulated with inactivated IBV). Shown were representative results of three independent experiments.
<bold>c</bold>
IBV or inactivated IBV-stimulated avian BMDCs induced the proliferation of lymphocyte cells in MLR. The stimulator cells were BMDCs stimulated with PBS, LPS, IBV or inactivated IBV at 37 °C for 24 h. All experiments were performed at least in triplicate. Significant differences between the treated and Non-stimulated groups are expressed as *
<italic>P</italic>
 < 0.05 or **
<italic>P</italic>
 < 0.01, respectively. The significance of the data was determined by one-way ANOVA with Tukey’s multiple comparison test.
<bold>d</bold>
Flow cytometric analysis of the phenotypic alterations of immature mouse BMDCs showed high levels of CD11c and MHC Class II.
<bold>e</bold>
Second and third lines: CD40 and CD86 expression of mouse BMDCs stimulated by IBV and inactivated IBV.
<bold>f</bold>
IBV or inactivated IBV-stimulated mouse BMDCs induced the proliferation of lymphocyte cells in MLR</p>
</caption>
<graphic xlink:href="12864_2019_5940_Fig1_HTML" id="MO1"></graphic>
</fig>
</p>
<p id="Par19">Next, we assessed the ability of avian or mouse BMDCs to stimulate T lymphocytes. As shown in Fig.
<xref rid="Fig1" ref-type="fig">1</xref>
c, inactivated IBV-stimulated avian BMDCs exhibited a significant stimulatory capacity in a mixed lymphocyte reaction (MLR) (
<italic>P</italic>
 < 0.01 or
<italic>P</italic>
 < 0.05) compared to naive or IBV-stimulated avian BMDCs. The maximum response was obtained at a ratio of 1:1 between lymphocytes and BMDCs. However, the IBV-stimulated avian BMDCs did not exhibit enhanced ability to activate T lymphocytes compared with inactivated IBV-stimulated avian BMDCs. Interestingly, the performance in activating T lymphocytes was out of the standard range for both IBV-stimulated and inactivated IBV-stimulated mouse BMDCs.</p>
</sec>
<sec id="Sec17">
<title>Identification and bioinformatic analysis of differentially expressed mRNAs</title>
<p id="Par20">To clarify the potential roles of host factors involved in IBV infection, mRNA expression of avian BMDCs was examined after stimulation with IBV for 12 h. Based on the criteria of at least a two-fold change and a
<italic>P</italic>
value less than 0.01, we identified 293 up-regulated and 251 down-regulated genes in IBV-stimulated avian BMDCs (Fig. 
<xref rid="Fig2" ref-type="fig">2</xref>
a, b and Additional file 
<xref rid="MOESM1" ref-type="media">1</xref>
). Moreover, Gene Ontology (GO) categorisation and pathway analyses of differentially expressed (DE) genes were performed. Cellular macromolecules, the tricarboxylic acid cycle, protein location, and oxidative phosphorylation contributed to the GO biological processes (GO-BP) associated with IBV stimulation (Fig.
<xref rid="Fig2" ref-type="fig">2</xref>
c and Additional file 
<xref rid="MOESM2" ref-type="media">2</xref>
). Meanwhile, GO molecular function (GO-MF) and GO cellular component (GO-CC) analyses identified cytosol and transcription factor binding, respectively. We performed pathway analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG) and BioCarta databases. KEGG analysis showed that genes are significantly differentially regulated in the presence of IBV compared with those in control cells; this is particularly pronounced for oxidative phosphorylation and the T cell receptor and B cell receptor signalling pathways. Based on the BioCarta database, IBV-influenced genes were involved in T cell receptor signalling, FAS signalling, and TNFR2 signalling and played the role of Erk5 in neuronal survival (Fig.
<xref rid="Fig2" ref-type="fig">2</xref>
c and Additional file
<xref rid="MOESM2" ref-type="media">2</xref>
).
<fig id="Fig2">
<label>Fig. 2</label>
<caption>
<p>mRNAs microarray analyses of IBV-stimulated avian BMDCs.
<bold>a</bold>
Volcano plot map of mRNA expression in control and IBV-stimulated avian BMDCs at 12 h post-infection. A comparison of expression data was performed using an XY-scatter plot analysis of the log base two-fold change. Data points shown in red represent significant differentially expressed genes;
<italic>P</italic>
 < 0.01.
<bold>b</bold>
Heat map of differentially expressed mRNAs in IBV-stimulated avian BMDCs. All of the biological replicates were pooled and calculated to identify differentially expressed mRNAs based on a threshold fold change > 2 and
<italic>P</italic>
 < 0.01. The blue and the yellow group represent two groups. The blue one represent control group, with G1 × 1, G1 × 2, G1 × 3 at the bottom. Whilst the yellow one represent IBV-infected DCs, with G2 × 1, G2 × 2, G2 × 3 at the bottom.
<bold>c</bold>
Primary GO categorisation and KEGG pathway analyses based on differentially expressed mRNAs in IBV-stimulated avian BMDCs</p>
</caption>
<graphic xlink:href="12864_2019_5940_Fig2_HTML" id="MO2"></graphic>
</fig>
</p>
</sec>
<sec id="Sec18">
<title>Identification and bioinformatic analysis of differentially expressed miRNAs and their target genes</title>
<p id="Par21">Identification of avian microRNA mechanisms could provide an alternative approach to inhibiting viral infection. Therefore, we studied the influence of IBV infection on global miRNA expression in avian BMDCs. First, we detected 991 conserved microRNAs and identified 19 significantly changed miRNAs (12 down-regulated and 7 up-regulated) in IBV-stimulated avian BMDCs using the criteria of a two-fold or greater change and a
<italic>P</italic>
-value < 0.05 (Fig. 
<xref rid="Fig3" ref-type="fig">3</xref>
d and Additional file 
<xref rid="MOESM3" ref-type="media">3</xref>
). As we know, miRNAs may function by directly silencing or indirectly reducing their target genes. We predicted the potential targets of DE miRNAs using the MicroRNA Target Prediction and Functional Study Database (miRDB) and TargetScan. We forecasted 124 target genes as DE miRNAs based on the predictions of both programs (Additional file
<xref rid="MOESM4" ref-type="media">4</xref>
). To gain insight into their functions, GO annotation of these target genes was performed; it identified the intracellular signalling cascade and phosphorus metabolic processes in GO-BP categories, whereas GO-MF included GTPase regulator activity and small GTPase regulator activity (Fig.
<xref rid="Fig3" ref-type="fig">3</xref>
a). Finally, KEGG pathway analysis based on the predicted target genes indicated that B cell receptors, regulation of the actin cytoskeleton, and MAPK signalling contributed to miRNA target genes with IBV stimulation (Fig.
<xref rid="Fig3" ref-type="fig">3</xref>
b and Additional file 
<xref rid="MOESM5" ref-type="media">5</xref>
). Based on the BioCarta database, the primary pathways associated with IBV infection involved skeletal muscle hypertrophy regulated by AKT/mTOR and ALK in cardiac myocytes (Fig.
<xref rid="Fig3" ref-type="fig">3</xref>
c). The results described above indicated that DE miRNAs play crucial roles in the response to IBV stimulation.
<fig id="Fig3">
<label>Fig. 3</label>
<caption>
<p>MicroRNAs microarray analyses of IBV-stimulated avian BMDCs.
<bold>a</bold>
Primary GO categorisation based on target genes from differentially expressed microRNAs in IBV-stimulated avian BMDCs.
<bold>b</bold>
KEGG pathway analyses based on target genes from differentially expressed microRNAs in IBV-stimulated avian BMDCs.
<bold>c</bold>
BIOCATRA pathway analyses based on target genes from differentially expressed microRNAs in IBV-stimulated avian BMDCs.
<bold>d</bold>
Heat map of differentially expressed microRNAs in IBV-stimulated avian DCs. All of the biological replicates were pooled and calculated to identify differentially expressed microRNAs based on a threshold fold change > 2 and
<italic>P</italic>
 < 0.05. The number 1 in the top represent control group, while the number 2 in the top represent IBV-infected BMDCs</p>
</caption>
<graphic xlink:href="12864_2019_5940_Fig3_HTML" id="MO3"></graphic>
</fig>
</p>
</sec>
<sec id="Sec19">
<title>Identification and bioinformatic analysis of differentially expressed lncRNAs and their targets</title>
<p id="Par22">Long non-coding RNAs (lncRNAs) have recently been identified as regulators of many biological processes, especially in the immune response. Global lncRNA expression levels were evaluated in avian BMDCs stimulated with IBV, and 101 (26 down-regulated, 75 up-regulated) DE lncRNAs were identified among a total of 3900 lncRNAs (Fig. 
<xref rid="Fig4" ref-type="fig">4</xref>
a, b, and Additional file
<xref rid="MOESM5" ref-type="media">5</xref>
). Because lncRNAs function through
<italic>cis-, trans-</italic>
, or co-expression with target genes, we then predicted the potential
<italic>cis, trans</italic>
and co-expressed genes among the DE lncRNAs. We identified 30
<italic>cis</italic>
and 3941
<italic>trans</italic>
targets, as well as 203 co-expressed mRNAs (Additional file
<xref rid="MOESM6" ref-type="media">6</xref>
). The interactions among co-expressed lncRNAs and mRNAs were mapped and are presented in Fig.
<xref rid="Fig4" ref-type="fig">4</xref>
e. Further analyses of the GO categorisation and KEGG pathways were performed based on cis and trans target to illustrate the functions of lncRNAs associated with IBV infection. The results of GO-BP analysis showed positive regulation of coronary vasculature development, cardiac muscle development, and nuclear envelope reassembly (Fig.
<xref rid="Fig4" ref-type="fig">4</xref>
c and Additional file
<xref rid="MOESM7" ref-type="media">7</xref>
). KEGG pathway analysis indicated the peroxisome, phenylalanine, and lysosome signal pathways were associated with IBV infection of avian BMDCs (Fig.
<xref rid="Fig4" ref-type="fig">4</xref>
d and Additional file
<xref rid="MOESM7" ref-type="media">7</xref>
).
<fig id="Fig4">
<label>Fig. 4</label>
<caption>
<p>LncRNA microarray analysis of IBV-stimulated avian BMDCs.
<bold>a</bold>
Volcano plot map of lncRNA expression levels in control avian BMDCs and IBV-stimulated avian BMDCs at 12 h post-infection. A comparison of expression data was performed using XY-scatter plot analysis of the log base two-fold change. Data points shown in red represent significantly differentially expressed genes;
<italic>P</italic>
 < 0.01.
<bold>b</bold>
Heat map of differentially expressed lncRNAs in IBV-stimulated avian BMDCs. All biological replicates were pooled to identify differentially expressed lncRNAs based on a threshold fold change > 2 and
<italic>P</italic>
 < 0.01. The blue and yellow colours represent the two groups, with blue showing the control group, with G1 × 1, G1 × 2, G1 × 3 at the bottom, whereas yellow represents IBV-infected DCs, with G2 × 1, G2 × 2, G2 × 3 at the bottom.
<bold>c</bold>
Primary GO categorisation based on
<italic>cis</italic>
-,
<italic>trans</italic>
-, and co-expressed target genes of differentially expressed lncRNAs in IBV-stimulated avian BMDCs.
<bold>d</bold>
KEGG pathway analysis based on target genes of differentially expressed lncRNAs in IBV-stimulated avian BMDCs.
<bold>e</bold>
Potential interaction network among significantly differentially expressed lncRNAs and target genes, created using Cytoscape (The pink ellipse represents co-expressed lncRNAs, while the yellow hexagon represents co-expressed mRNAs). All biological replicates were pooled to identify differentially expressed lncRNAs based on a threshold fold change > 2 and
<italic>P</italic>
 < 0.01</p>
</caption>
<graphic xlink:href="12864_2019_5940_Fig4_HTML" id="MO4"></graphic>
</fig>
</p>
</sec>
<sec id="Sec20">
<title>Confirmation of microarray results through qRT-PCR</title>
<p id="Par23">To validate the mRNA, microRNA, and lncRNA microarray results, we subjected 13 DE mRNAs and 18 DE miRNAs to quantitative reverse transcription polymerase chain reaction (qRT-PCR) (Tables 
<xref rid="Tab1" ref-type="table">1</xref>
and
<xref rid="Tab2" ref-type="table">2</xref>
). Generally, the qRT-PCR data matched the microarray data, with fold-change values of representative mRNAs and miRNAs in qRT-PCR displaying trends similar to those reflected in the results of microarray analysis. On one hand, the 13 selected mRNAs were primarily associated with leucocyte transendothelial migration signalling pathways. In this pathway, ITK, PLCG2, CXCL12, VCAM1, CLDN1, ZAP70, THY1, and MLLT4 expression levels significantly decreased with IBV stimulation, whereas only IL-6 expression significantly increased in IBV-infected avian BMDCs (Fig. 
<xref rid="Fig5" ref-type="fig">5</xref>
a). On the other hand, among the 18 tested microRNAs, gga-miRlet7g, gga-miR19a, gga-miR1595, gga-miR1624, gga-miR1809, gga-miR2131, gga-miR24, gga-miR106, gga-miR122b, gga-miR1607, gga-miR1462, and gga-miR21 were significantly up-regulated when stimulated with IBV. In contrast, gga-miR1601, gga-miR1816, and gga-miR1694 were significantly down-regulated after IBV stimulation (Fig.
<xref rid="Fig5" ref-type="fig">5</xref>
b).
<table-wrap id="Tab1">
<label>Table 1</label>
<caption>
<p>QRT-PCR primers used in verification of microarrays results</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Gene</th>
<th>Sence</th>
<th>Anti-sence</th>
</tr>
</thead>
<tbody>
<tr>
<td>GAPDH</td>
<td>TGACCACTGTCCATGCCATC</td>
<td>CAGCAGCCTTCACTACCCTC</td>
</tr>
<tr>
<td colspan="3">Leukocyte transendothelial migration</td>
</tr>
<tr>
<td> ITK</td>
<td>tggaagaagaaggccccaat</td>
<td>catcgctccttcacgaatgg</td>
</tr>
<tr>
<td> NFATC2</td>
<td>cagcatcaaaccccatcgag</td>
<td>atctgctgcccatctgaagt</td>
</tr>
<tr>
<td> PIK3R5</td>
<td>gcacttcctaccattgcagg</td>
<td>tcctcctcctcctcttcctc</td>
</tr>
<tr>
<td> PLCG2</td>
<td>gctttgtggctctcagatgg</td>
<td>agcttagggagatgacgagc</td>
</tr>
<tr>
<td> CXCL12</td>
<td>gatgcccctgtcgattcttc</td>
<td>tcctggatccattttagcttgg</td>
</tr>
<tr>
<td> ZAP70</td>
<td>tatggagctacggtgtgacc</td>
<td>aggtgcggattgtgttttcc</td>
</tr>
<tr>
<td> MYL12A</td>
<td>caatggcactgatccggaag</td>
<td>tccatgtttaaggatgcgcg</td>
</tr>
<tr>
<td> CLDN1</td>
<td>ctgtctttggtggcgtgatc</td>
<td>taggatgtttcactccgggg</td>
</tr>
<tr>
<td> VCAM1</td>
<td>gagaaaccgccactgtcatc</td>
<td>tctggccacacaaacaatctc</td>
</tr>
<tr>
<td> MLLT4</td>
<td>taattcctccccagcctgtg</td>
<td>gtactgcagatctctccgct</td>
</tr>
<tr>
<td> THY1</td>
<td>ccaaggacaacaggaagcac</td>
<td>ccttcagctcgcacatgtag</td>
</tr>
<tr>
<td> IL6</td>
<td>acgtcgagtctctgtgctac</td>
<td>ggcactgaaactcctggtct</td>
</tr>
<tr>
<td> NCF2</td>
<td>cacggagggagagggatttt</td>
<td>cattgcccttccaaccagtc</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="Tab2">
<label>Table 2</label>
<caption>
<p>QRT-PCR primers used in verification of avian microRNAs MicroRNA array results</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>MiRNAs</th>
<th>Sence primer</th>
</tr>
</thead>
<tbody>
<tr>
<td>gga-miR-2131-3p</td>
<td>GGTGCTGTTACTGTTCTTCTGATGG</td>
</tr>
<tr>
<td>gga-miR-1462-3p</td>
<td>GTATCTGTCCTTGTGAGCCCCAG</td>
</tr>
<tr>
<td>gga-miR-21-5p</td>
<td>GCGTAGCTTATCAGACTGATGTTGA</td>
</tr>
<tr>
<td>gga-miR-1694</td>
<td>TAATAAAGGAGGACGAGGCTGCGAGC</td>
</tr>
<tr>
<td>gga-miR-1607</td>
<td>AATTAATTATAGGGGCGGGAGGGGTCG</td>
</tr>
<tr>
<td>gga-let-7 g-5p</td>
<td>TGGGTGGGTGAGGTAGTAGTTTGTACAG</td>
</tr>
<tr>
<td>gga-miR-19a-5p</td>
<td>GCGAGTTTTGCATAGTTGCACTAC</td>
</tr>
<tr>
<td>gga-miR-1797</td>
<td>GCTTGGAACTGAGCAGGAACTG</td>
</tr>
<tr>
<td>gga-miR-20a-5p</td>
<td>CGGTAAAGTGCTTATAGTGCAGGTAG</td>
</tr>
<tr>
<td>gga-miR-106-5p</td>
<td>CGGAAAAGTGCTTACAGTGCAGGT</td>
</tr>
<tr>
<td>gga-miR-1595-5p</td>
<td>AAGCACGAGTGTGGTGGAGCTC</td>
</tr>
<tr>
<td>gga-miR-122b</td>
<td>CGGAGTGTGACACTGGTGTTTTT</td>
</tr>
<tr>
<td>gga-miR-1624</td>
<td>TAATACACCGCACTGGCAGGGA</td>
</tr>
<tr>
<td>gga-miR-1809</td>
<td>GTGGGAAGTTTGGCAGAGCAT</td>
</tr>
<tr>
<td>gga-miR-24-3p</td>
<td>TGGCTCAGTTCAGCAGGAACAG</td>
</tr>
<tr>
<td>gga-miR-1816</td>
<td>GTGGGTAGGTTTTGTGGTTTTGTT</td>
</tr>
<tr>
<td>gga-miR-456-3p</td>
<td>GGCAGGCTGGTTAGATGGTTGTC</td>
</tr>
<tr>
<td>gga-miR-1601</td>
<td>AGTGTGAGCAGGTGCAGAGCTG</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="Fig5">
<label>Fig. 5</label>
<caption>
<p>Results of the qPCR analysis of select mRNAs, miRNAs and lncRNAs following stimulation by IBV stimulation (All of the experiments were performed at least in triplicate. Significant differences between the treated and control groups are expressed as *
<italic>P</italic>
 < 0.05 and **
<italic>P</italic>
 < 0.01, respectively)
<bold>a</bold>
Expression levels of mRNAs involved in the leukocyte trans-endothelial migration signal pathway.
<bold>b</bold>
Expression levels of microRNAs qPCR results of the significantly up-regulated or down-regulated microRNAs in the IBV-stimulated group</p>
</caption>
<graphic xlink:href="12864_2019_5940_Fig5_HTML" id="MO5"></graphic>
</fig>
</p>
</sec>
<sec id="Sec21">
<title>Establishment of TF–miRNA–mRNA regulatory loops</title>
<p id="Par24">To better understand how IBV regulates gene expression in avian BMDCs, we constructed transcription factor (TF)–miRNAs and TF–miRNA–mRNA regulatory loops. First, we computed TF-microRNA loops based on 165 TF-microRNA combinations involving 2 TFs and 149 microRNAs (Additional file
<xref rid="MOESM8" ref-type="media">8</xref>
). All of the predicted TF-miRNA regulation loops still need for further validation. Considering the DE miRNAs, we identified two TF-microRNA networks (CCAAT/enhancer-binding protein alpha [CEBPA]-gga-miR-1772 and CEBPA-gga-miR-21-5p) in the IBV-stimulated avian BMDCs (Fig. 
<xref rid="Fig6" ref-type="fig">6</xref>
a). Then, we extracted and constructed the TF and mRNA relationship data from ChIPBase. In total, 21,085 TF-mRNAs pairs were computed, involving 2 TFs and 5987 mRNAs (Additional file
<xref rid="MOESM9" ref-type="media">9</xref>
). Finally, TF-mRNA and miRNA-target mRNA information were combined to produce TF-miRNA-mRNA regulatory networks (Fig.
<xref rid="Fig6" ref-type="fig">6</xref>
b). In total, we identified 53 TF–miRNA–mRNA interactions, which involved 1 TF, 2 miRNAs, and 53 mRNAs in IBV-stimulated avian DCs. For example, ROR1, NRP1, S8, and PTPN2 could be regulated by both CEBPA and miR-1772, whereas miR-1772 could also be modulated by CEBPA. Thus, we constructed the network to link CEBPA-miR-1772-ROR1 (Fig.
<xref rid="Fig6" ref-type="fig">6</xref>
b, Additional file
<xref rid="MOESM10" ref-type="media">10</xref>
).
<fig id="Fig6">
<label>Fig. 6</label>
<caption>
<p>TF–miRNA and TF–miRNA–mRNA regulatory loops in IBV-stimulated avian BMDCs.
<bold>a</bold>
Two TF-miRNA networks involving one TF and two differentially expressed microRNAs were established, with the TF CEBPA binding directly to the promoters of gga-miR1772 and gga-miR21.
<bold>b</bold>
In total, 53 TF-miRNA-mRNA interactions involving 1 TF (CEBPA), 2 differentially expressed microRNAs, and 53 differentially expressed mRNAs (and predicted microRNA targets) for the IBV-stimulated group were summarised. Yellow diamond nodes represent TFs, green rectangle nodes correspond to microRNAs, and violet ovals represent mRNAs</p>
</caption>
<graphic xlink:href="12864_2019_5940_Fig6_HTML" id="MO6"></graphic>
</fig>
</p>
</sec>
</sec>
<sec id="Sec22">
<title>Discussion</title>
<p id="Par25">Avian infectious bronchitis, caused by infectious bronchitis virus, has been identified as an important pathogen in poultry that is characterised by severity and outcomes that make it extremely difficult to control [
<xref ref-type="bibr" rid="CR1">1</xref>
,
<xref ref-type="bibr" rid="CR39">39</xref>
,
<xref ref-type="bibr" rid="CR40">40</xref>
]. IBV primarily replicates in the epithelial cells of the respiratory tract and can affect both meat-type and commercial egg-laying birds [
<xref ref-type="bibr" rid="CR1">1</xref>
,
<xref ref-type="bibr" rid="CR5">5</xref>
]. In this study, host responses against IBV were analysed using microarrays of mRNAs, miRNAs, and lncRNAs. Our study provided information about the molecular pathogenesis and virus–host interactions between IBV and avian BMDCs. Further bioinformatic analysis revealed that the leukocyte transendothelial migration signal pathway might be involved in IBV-infected avian BMDCs. Information obtained herein should provide useful clues for the development of novel preventive or therapeutic strategies against IBV infection.</p>
<sec id="Sec23">
<title>Phenotypic alteration and lymphocyte activation of avian DCs stimulated with IBV</title>
<p id="Par26">The strategy of controlling IBV through vaccination has been partially successful, but various subtypes of IBV still evade vaccines [
<xref ref-type="bibr" rid="CR40">40</xref>
]. DCs change during the maintenance of immune responses, and their maturation is pivotal to the development of immunity against many viruses. The maturation of avian BMDCs is essential to the development of the immune system. Viruses, therefore, have evolved strategies to target this process [
<xref ref-type="bibr" rid="CR41">41</xref>
,
<xref ref-type="bibr" rid="CR42">42</xref>
]. In our studies, IBV-stimulated DCs (including mouse and avian DCs) did not significantly increase their expression of the surface markers CD40 and CD86, indicating that IBV might escape recognition by avian DCs. This phenomenon might be attributed to failed activation of toll-like receptor (TLR) signalling, which is related to the recognition of various dangerous signals [
<xref ref-type="bibr" rid="CR43">43</xref>
,
<xref ref-type="bibr" rid="CR44">44</xref>
]. Previous studies have suggested that the binding of IBV to epithelial cells initiates infection [
<xref ref-type="bibr" rid="CR45">45</xref>
]. Recent studies suggest that the binding progress is sialic acid-dependent and that chicken homologues of the human receptors DC-SIGN and L-SIGN are part of an IBV receptor complex [
<xref ref-type="bibr" rid="CR46">46</xref>
<xref ref-type="bibr" rid="CR48">48</xref>
]. In our study, mRNA microarray results indicated that TLR7, TLR3, and TLR21 were all down-regulated in IBV-stimulated avian DCs. The decreased expression of TLR3 suggested that IBV might be unsuccessfully replicated in avian DCs (Additional file
<xref rid="MOESM11" ref-type="media">11</xref>
). Receptors, such as TLR3 and TLR7, may initiate the local tracheal innate immune response upon IBV recognition [
<xref ref-type="bibr" rid="CR49">49</xref>
,
<xref ref-type="bibr" rid="CR50">50</xref>
]. The accordance of TLR results with surface marker results suggest that IBV successfully escaped recognition by avian DCs. A key role of DCs is to process and present specific antigens to naïve T cells [
<xref ref-type="bibr" rid="CR51">51</xref>
<xref ref-type="bibr" rid="CR53">53</xref>
]. Consistent with the surface marker results, cell proliferation studies found that both IBV-treated avian and mouse DCs failed to stimulate the proliferation of naïve T cells in MLR [
<xref ref-type="bibr" rid="CR54">54</xref>
,
<xref ref-type="bibr" rid="CR55">55</xref>
]. In contrast, inactivated IBV strongly activated the primary T cell, which was correlated with greater expression of the co-stimulatory molecules CD40 and CD86 by inactivated IBV-stimulated DCs. Recent study indicating that host shutoff by IBV plays an important role in antagonizing the host’s innate immune response and demonstrate that 5b is a functional equivalent of nsp1, charge for the host shutoff. These results show that avian DCs react more strongly to inactivated IBV than to IBV in terms of enhanced maturation and ability to activate lymphocytes.</p>
</sec>
<sec id="Sec24">
<title>Roles of microRNAs and lncRNAs during IBV infection</title>
<p id="Par27">Aside from direct gene regulation, miRNAs and lncRNAs also play important roles in regulating the function of DCs. Alteration of cellular microRNA expression levels during viral infection is a component of the host–virus interaction [
<xref ref-type="bibr" rid="CR56">56</xref>
]. Viruses not only influence the expression of microRNAs in infected cells but also encode viral small RNAs that regulate the replication of viruses, as reported for PRRSV and Dengue virus [
<xref ref-type="bibr" rid="CR57">57</xref>
,
<xref ref-type="bibr" rid="CR58">58</xref>
]. Host microRNAs, such as avian miRNAs, might enhance the immune response or be utilised by viruses to assist with their replication. For example, miR140 is a post-transcriptional regulator influencing the expression of SPP1, which plays important roles in the inflammatory response, calcification, organ development, and immune cell function [
<xref ref-type="bibr" rid="CR59">59</xref>
,
<xref ref-type="bibr" rid="CR60">60</xref>
]. Cellular microRNAs (miR-323, miR-491, and miR-654) have also been found to regulate the replication of H1N1 influenza virus by targeting the PB1 gene [
<xref ref-type="bibr" rid="CR61">61</xref>
].</p>
<p id="Par28">In this study, we attempted to determine how miRNAs and lncRNAs, induced by IBV infection, regulate the maturation and antigen presentation of avian DCs. Initially, 991 chicken microRNAs were investigated, and 19 differentially expressed microRNAs were identified in IBV-infected avian DCs. Among these miRNAs, gga-miR-135A, gga-miR-7471, gga-miR-7453, gga-miR-7443, gga-miR-1695, gga-miR-1772, and gga-miR-6669 were significantly up-regulated in IBV-infected avian BMDCs, whereas 12 other gga-microRNAs were down-regulated. Among the microRNAs that decreased, miR-21 was associated with lymphoma development, which might be a possible mechanism of lymphocyte activation [
<xref ref-type="bibr" rid="CR62">62</xref>
,
<xref ref-type="bibr" rid="CR63">63</xref>
]. Recent studies have reported the functions of many gga-miRNAs, including gga-miR-1454, gga-miR-215-5p, gga-miR-3538, gga-miR-2954, and gga-miR-1a-3p [
<xref ref-type="bibr" rid="CR20">20</xref>
,
<xref ref-type="bibr" rid="CR64">64</xref>
,
<xref ref-type="bibr" rid="CR65">65</xref>
]. One of these studies suggested that gga-miR-215-5p exhibited significantly varied expression levels between H9N2-infected and non-infected chicken embryo fibroblasts [
<xref ref-type="bibr" rid="CR65">65</xref>
]. Further bioinformatic analysis to identify the target genes of gga-microRNAs revealed that IBV infection not only impacted the TGF-beta and MAPK signalling pathways but also influenced the T cell receptor and B cell receptor signalling pathways (Fig.
<xref rid="Fig3" ref-type="fig">3</xref>
). Previous research suggested that the complement system was important in T cell activation, as it triggers the antiviral state of neighbouring cells and an influx of T cells to the local tissue [
<xref ref-type="bibr" rid="CR66">66</xref>
]. Several studies have shown that the major histocompatibility complex (MHC) influences susceptibility to IBV infection [
<xref ref-type="bibr" rid="CR67">67</xref>
,
<xref ref-type="bibr" rid="CR68">68</xref>
]. Meanwhile, lncRNAs are involved in defending against viral infection. Transcriptional regulation by lncRNAs can occur in either a
<italic>cis-</italic>
or t
<italic>rans-</italic>
manner. Of the down-regulated lncRNAs, MANBAL and POMT2 were correlated with mannose, which might be a receptor for viral entry [
<xref ref-type="bibr" rid="CR69">69</xref>
,
<xref ref-type="bibr" rid="CR70">70</xref>
]. Mannose-binding lectin (MBL) is involved in the protection of the host against viral infections, such as infections with influenza A virus, hepatitis C virus, and Ebola virus [
<xref ref-type="bibr" rid="CR71">71</xref>
<xref ref-type="bibr" rid="CR73">73</xref>
]. In chickens, MBL serum concentrations have also been associated with IBV infection [
<xref ref-type="bibr" rid="CR4">4</xref>
]. Additionally, we found that
<italic>cis-</italic>
and
<italic>trans-</italic>
targeting genes contribute to the peroxisome, phenylalanine, and lysosome signalling pathways.</p>
</sec>
<sec id="Sec25">
<title>TF-miRNA-mRNA regulatory networks in IBV-stimulated DCs</title>
<p id="Par29">TF-microRNA networks have been previously identified as important components of microRNA regulation mechanisms. Our study identified two TF-microRNA networks in the IBV-stimulated group (CEBPA-gga-miR1772 and CEBPA-gga-miR21). CEBPA is a transcription factor involved in the differentiation of certain blood cells. The encoded protein can interact with CDK2 and CDK4, thereby inhibiting these kinases and causing arrest of growth in cultured cells. Additionally, CEBPA is essential for myeloid lineage commitment and is therefore required for both normal mature granulocyte formation and the development of abnormal acute myeloid leukaemia (AML) [
<xref ref-type="bibr" rid="CR74">74</xref>
,
<xref ref-type="bibr" rid="CR75">75</xref>
]. On the other hand, gga-miR-21 was suggested to inhibit chicken pre-adipocyte proliferation by down-regulating Kruppel-like factor 5 [
<xref ref-type="bibr" rid="CR72">72</xref>
]. This suggests that gga-miR-21 can be regulated as a defence mechanism to fight against viral infection in birds. To further explore the mechanisms involved, we construct TF-microRNA-mRNA networks, which provided insights into the interplays between microRNAs and TF and hinted at the mechanisms underlying the innate cellular response induced by IBV stimulation.</p>
</sec>
</sec>
<sec id="Sec26">
<title>Conclusions</title>
<p id="Par30">In this study, microarray analysis of avian DCs stimulated with IBV provided insight into the mechanisms underlying the innate cellular response induced by IBV. Specifically, the leukocyte transendothelial migration signalling pathway was found to be involved in the regulation of avian DCs stimulated with IBV. Two TF–miRNA networks (CEBPA-gga-miR1772 and CEBPA-gga-miR21) and 53 TF–miRNA–mRNA networks were identified in IBV-stimulated DCs, elucidating host antiviral defences and offering novel preventive strategies against IBV.</p>
</sec>
<sec sec-type="supplementary-material">
<title>Additional files</title>
<sec id="Sec27">
<p>
<supplementary-material content-type="local-data" id="MOESM1">
<media xlink:href="12864_2019_5940_MOESM1_ESM.xls">
<label>Additional file 1:</label>
<caption>
<p>Differentially expressed mRNAs in IBV-stimulated avian BMDCs. (XLS 9410 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM2">
<media xlink:href="12864_2019_5940_MOESM2_ESM.xls">
<label>Additional file 2:</label>
<caption>
<p>GO and KEEG analysis of differentially expressed mRNAs in IBV-stimulated avian BMDCs. (XLS 208 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM3">
<media xlink:href="12864_2019_5940_MOESM3_ESM.xls">
<label>Additional file 3:</label>
<caption>
<p>Differentially expressed miRNAs in IBV-stimulated avian BMDCs. (XLS 394 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM4">
<media xlink:href="12864_2019_5940_MOESM4_ESM.xls">
<label>Additional file 4:</label>
<caption>
<p>The target gene of differentially expressed miRNAs in IBV-stimulated avian BMDCs and their GO and KEEG analysis. (XLS 223 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM5">
<media xlink:href="12864_2019_5940_MOESM5_ESM.xlsx">
<label>Additional file 5:</label>
<caption>
<p>Differentially expressed LncRNAs in IBV-stimulated avian BMDCs. (XLSX 30 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM6">
<media xlink:href="12864_2019_5940_MOESM6_ESM.xls">
<label>Additional file 6:</label>
<caption>
<p>The cis and trans target gene of differentially expressed lncRNAs in IBV-stimulated avian BMDCs. (XLS 517 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM7">
<media xlink:href="12864_2019_5940_MOESM7_ESM.xls">
<label>Additional file 7:</label>
<caption>
<p>GO and KEEG analysis of differentially expressed lncRNAs target in IBV-stimulated avian BMDCs. (XLS 458 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM8">
<media xlink:href="12864_2019_5940_MOESM8_ESM.txt">
<label>Additional file 8:</label>
<caption>
<p>microRNA and TF invloved in TF-microRNA loops. (TXT 21 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM9">
<media xlink:href="12864_2019_5940_MOESM9_ESM.xls">
<label>Additional file 9:</label>
<caption>
<p>TF and mRNA invloved in TF-mRNAs pairs. (XLS 902 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM10">
<media xlink:href="12864_2019_5940_MOESM10_ESM.xls">
<label>Additional file 10:</label>
<caption>
<p>Selected TF-miRNA-mRNA loops. (XLS 22 kb)</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="MOESM11">
<media xlink:href="12864_2019_5940_MOESM11_ESM.xlsx">
<label>Additional file 11:</label>
<caption>
<p>TLR family invloved in IBV-stimulated avian BMDCs. (XLSX 10 kb)</p>
</caption>
</media>
</supplementary-material>
</p>
</sec>
</sec>
</body>
<back>
<fn-group>
<fn>
<p>
<bold>Publisher’s Note</bold>
</p>
<p>Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.</p>
</fn>
<fn>
<p>Co-first author Jian Lin and Zhisheng Wang</p>
</fn>
</fn-group>
<ack>
<title>Acknowledgements</title>
<p>Authors would like to thank Prof. Daxin Peng (Yangzhou University and Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses) for their insightful suggestions.</p>
</ack>
<notes notes-type="author-contribution">
<title>Authors’ contributions</title>
<p>JL design and carried out the molecular genetic studies, bio-information analyses and microRNA related data analyses and manuscript drafting. ZW developed avian dendritic cells and performed research concerned lncRNA and microRNA relevant part. JW performed the bio-information studies. QY is the principal investigator of the project, who conceived the study, participated in its design and helped to draft the manuscript. All authors read and approved the final manuscript.</p>
</notes>
<notes notes-type="funding-information">
<title>Funding</title>
<p>This work was supported by the National Key Research and Development Program of China (2017YFD500706), the Fundamental Research Funds for the Central Universities (JCQY201906), the National Natural Science Grant of P. R. China (No. 31702197), the Fundamental Research Funds for the Central Universities (KJQN2018034) and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Independent Innovation of Agricultural Sciences Program of Jiangsu Province (CX (13)5035).</p>
</notes>
<notes notes-type="data-availability">
<title>Availability of data and materials</title>
<p>The authors had to send and upload the microarrays data into the Gene Expression Omnibus (GEO;
<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE100802">https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE100802</ext-link>
.) and has been assigned provisional series accession GSE100802.</p>
</notes>
<notes>
<title>Ethics approval and consent to participate</title>
<p id="Par48">This study was approved by the Ethics Committee for Animal Experiments of the College of Life Science, Nanjing Agricultural University. All animal care and use were conducted in strict accordance with the Animal Research Committee Guidelines of the College of Life Science, Nanjing Agricultural University.</p>
</notes>
<notes>
<title>Consent for publication</title>
<p id="Par49">Not applicable.</p>
</notes>
<notes notes-type="COI-statement">
<title>Competing interests</title>
<p id="Par50">The authors of this editorial have no competing interest to declare. The authors have no other relevant affiliations or financial involvement in any organization or entity with a financial interest in or financial competing with the subject matter or materials discussed in the manuscript apart from those disclosed.</p>
</notes>
<glossary>
<title>Abbreviations</title>
<def-list>
<def-item>
<term>3’UTR</term>
<def>
<p id="Par31">Three prime untranslated region</p>
</def>
</def-item>
<def-item>
<term>BMDCs</term>
<def>
<p id="Par32">Bone marrow dendritic cells</p>
</def>
</def-item>
<def-item>
<term>BP</term>
<def>
<p id="Par33">Biological process</p>
</def>
</def-item>
<def-item>
<term>CC</term>
<def>
<p id="Par34">Cellular component</p>
</def>
</def-item>
<def-item>
<term>DAVID</term>
<def>
<p id="Par35">The Database for Annotation, Visualization and Integrated Discovery</p>
</def>
</def-item>
<def-item>
<term>DCs</term>
<def>
<p id="Par36">Dendritic cells</p>
</def>
</def-item>
<def-item>
<term>FACS</term>
<def>
<p id="Par37">Fluorescence Activated Cell Sorter</p>
</def>
</def-item>
<def-item>
<term>GM-CSF</term>
<def>
<p id="Par38">Granulocyte colony-stimulating factor</p>
</def>
</def-item>
<def-item>
<term>GO</term>
<def>
<p id="Par39">Gene ontology</p>
</def>
</def-item>
<def-item>
<term>IBV</term>
<def>
<p id="Par40">Infectious bronchitis virus</p>
</def>
</def-item>
<def-item>
<term>JAAS</term>
<def>
<p id="Par41">Jiangsu Academy of Agricultural Sciences</p>
</def>
</def-item>
<def-item>
<term>KEGG</term>
<def>
<p id="Par42">Kyoto Encyclopedia of Genes and Genomes</p>
</def>
</def-item>
<def-item>
<term>lncRNA</term>
<def>
<p id="Par43">Long non-coding RNA</p>
</def>
</def-item>
<def-item>
<term>MAPK</term>
<def>
<p id="Par44">Mitogen-activated protein kinases</p>
</def>
</def-item>
<def-item>
<term>MHC-II</term>
<def>
<p id="Par45">Major histocompatibility complex class II</p>
</def>
</def-item>
<def-item>
<term>TF</term>
<def>
<p id="Par46">Transcription factor</p>
</def>
</def-item>
</def-list>
</glossary>
<ref-list id="Bib1">
<title>References</title>
<ref id="CR1">
<label>1.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bande</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Arshad</surname>
<given-names>SS</given-names>
</name>
<name>
<surname>Omar</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Hair-Bejo</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Mahmuda</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Nair</surname>
<given-names>V</given-names>
</name>
</person-group>
<article-title>Global distributions and strain diversity of avian infectious bronchitis virus: a review</article-title>
<source>Anim Health Res Rev</source>
<year>2017</year>
<volume>18</volume>
<issue>1</issue>
<fpage>70</fpage>
<lpage>83</lpage>
<pub-id pub-id-type="pmid">28776490</pub-id>
</element-citation>
</ref>
<ref id="CR2">
<label>2.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marandino</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Tomas</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Panzera</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Greif</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Parodi-Talice</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Hernandez</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Techera</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Hernandez</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Perez</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>Whole-genome characterization of Uruguayan strains of avian infectious bronchitis virus reveals extensive recombination between the two major south American lineages</article-title>
<source>Infect, Genet Evol</source>
<year>2017</year>
<volume>54</volume>
<fpage>245</fpage>
<lpage>250</lpage>
<pub-id pub-id-type="pmid">28705717</pub-id>
</element-citation>
</ref>
<ref id="CR3">
<label>3.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Smith</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Sadeyen</surname>
<given-names>JR</given-names>
</name>
<name>
<surname>Cavanagh</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Kaiser</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Burt</surname>
<given-names>DW</given-names>
</name>
</person-group>
<article-title>The early immune response to infection of chickens with infectious bronchitis virus (IBV) in susceptible and resistant birds</article-title>
<source>BMC Vet Res</source>
<year>2015</year>
<volume>11</volume>
<fpage>256</fpage>
<pub-id pub-id-type="pmid">26452558</pub-id>
</element-citation>
</ref>
<ref id="CR4">
<label>4.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kjaerup</surname>
<given-names>RM</given-names>
</name>
<name>
<surname>Dalgaard</surname>
<given-names>TS</given-names>
</name>
<name>
<surname>Norup</surname>
<given-names>LR</given-names>
</name>
<name>
<surname>Hamzic</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Sorensen</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Juul-Madsen</surname>
<given-names>HR</given-names>
</name>
</person-group>
<article-title>Characterization of cellular and humoral immune responses after IBV infection in chicken lines differing in MBL serum concentration</article-title>
<source>Viral Immunol</source>
<year>2014</year>
<volume>27</volume>
<issue>10</issue>
<fpage>529</fpage>
<lpage>542</lpage>
<pub-id pub-id-type="pmid">25343382</pub-id>
</element-citation>
</ref>
<ref id="CR5">
<label>5.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Britton</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Armesto</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Cavanagh</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Keep</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Modification of the avian coronavirus infectious bronchitis virus for vaccine development</article-title>
<source>Bioengineered Bugs</source>
<year>2012</year>
<volume>3</volume>
<issue>2</issue>
<fpage>114</fpage>
<lpage>119</lpage>
<pub-id pub-id-type="pmid">22179147</pub-id>
</element-citation>
</ref>
<ref id="CR6">
<label>6.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Habibi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Karimi</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Langeroudi</surname>
<given-names>AG</given-names>
</name>
<name>
<surname>Ghafouri</surname>
<given-names>SA</given-names>
</name>
<name>
<surname>Hashemzadeh</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Farahani</surname>
<given-names>RK</given-names>
</name>
<name>
<surname>Maghsoudloo</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Abdollahi</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Seifouri</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Combination of H120 and 1/96 avian infectious bronchitis virus vaccine strains protect chickens against challenge with IS/1494/06 (variant 2)-like infectious bronchitis virus</article-title>
<source>Acta Virol</source>
<year>2017</year>
<volume>61</volume>
<issue>2</issue>
<fpage>150</fpage>
<lpage>160</lpage>
<pub-id pub-id-type="pmid">28523921</pub-id>
</element-citation>
</ref>
<ref id="CR7">
<label>7.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ndegwa</surname>
<given-names>EN</given-names>
</name>
<name>
<surname>Toro</surname>
<given-names>H</given-names>
</name>
<name>
<surname>van Santen</surname>
<given-names>VL</given-names>
</name>
</person-group>
<article-title>Comparison of vaccine subpopulation selection, viral loads, vaccine virus persistence in trachea and cloaca, and mucosal antibody responses after vaccination with two different Arkansas Delmarva poultry industry -derived infectious bronchitis virus vaccines</article-title>
<source>Avian Dis</source>
<year>2014</year>
<volume>58</volume>
<issue>1</issue>
<fpage>102</fpage>
<lpage>110</lpage>
<pub-id pub-id-type="pmid">24758121</pub-id>
</element-citation>
</ref>
<ref id="CR8">
<label>8.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Okino</surname>
<given-names>CH</given-names>
</name>
<name>
<surname>Alessi</surname>
<given-names>AC</given-names>
</name>
<name>
<surname>Montassier Mde</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Rosa</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Montassier</surname>
<given-names>HJ</given-names>
</name>
</person-group>
<article-title>Humoral and cell-mediated immune responses to different doses of attenuated vaccine against avian infectious bronchitis virus</article-title>
<source>Viral Immunol</source>
<year>2013</year>
<volume>26</volume>
<issue>4</issue>
<fpage>259</fpage>
<lpage>267</lpage>
<pub-id pub-id-type="pmid">23865943</pub-id>
</element-citation>
</ref>
<ref id="CR9">
<label>9.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ambali</surname>
<given-names>AG</given-names>
</name>
<name>
<surname>Jones</surname>
<given-names>RC</given-names>
</name>
</person-group>
<article-title>Early pathogenesis in chicks of infection with an enterotropic strain of infectious bronchitis virus</article-title>
<source>Avian Dis</source>
<year>1990</year>
<volume>34</volume>
<issue>4</issue>
<fpage>809</fpage>
<lpage>817</lpage>
<pub-id pub-id-type="pmid">2177973</pub-id>
</element-citation>
</ref>
<ref id="CR10">
<label>10.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cavanagh</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Casais</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Armesto</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hodgson</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Izadkhasti</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Davies</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Tarpey</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Britton</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Manipulation of the infectious bronchitis coronavirus genome for vaccine development and analysis of the accessory proteins</article-title>
<source>Vaccine</source>
<year>2007</year>
<volume>25</volume>
<issue>30</issue>
<fpage>5558</fpage>
<lpage>5562</lpage>
<pub-id pub-id-type="pmid">17416443</pub-id>
</element-citation>
</ref>
<ref id="CR11">
<label>11.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Juul-Madsen</surname>
<given-names>HR</given-names>
</name>
<name>
<surname>Norup</surname>
<given-names>LR</given-names>
</name>
<name>
<surname>Jorgensen</surname>
<given-names>PH</given-names>
</name>
<name>
<surname>Handberg</surname>
<given-names>KJ</given-names>
</name>
<name>
<surname>Wattrang</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Dalgaard</surname>
<given-names>TS</given-names>
</name>
</person-group>
<article-title>Crosstalk between innate and adaptive immune responses to infectious bronchitis virus after vaccination and challenge of chickens varying in serum mannose-binding lectin concentrations</article-title>
<source>Vaccine</source>
<year>2011</year>
<volume>29</volume>
<issue>51</issue>
<fpage>9499</fpage>
<lpage>9507</lpage>
<pub-id pub-id-type="pmid">22008821</pub-id>
</element-citation>
</ref>
<ref id="CR12">
<label>12.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Genome characterization, antigenicity and pathogenicity of a novel infectious bronchitis virus type isolated from South China</article-title>
<source>Infect Genet Evol</source>
<year>2017</year>
<volume>54</volume>
<fpage>437</fpage>
<lpage>446</lpage>
<pub-id pub-id-type="pmid">28800976</pub-id>
</element-citation>
</ref>
<ref id="CR13">
<label>13.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zou</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Complete genome sequence of a novel infectious bronchitis virus strain circulating in China with a distinct S gene</article-title>
<source>Virus Genes</source>
<year>2014</year>
<volume>49</volume>
<issue>1</issue>
<fpage>152</fpage>
<lpage>156</lpage>
<pub-id pub-id-type="pmid">24682939</pub-id>
</element-citation>
</ref>
<ref id="CR14">
<label>14.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Amarasinghe</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Abdul-Cader</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>Nazir</surname>
<given-names>S</given-names>
</name>
<name>
<surname>De Silva</surname>
<given-names>SU</given-names>
</name>
<name>
<surname>van der Meer</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Cork</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>Gomis</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Abdul-Careem</surname>
<given-names>MF</given-names>
</name>
</person-group>
<article-title>Infectious bronchitis corona virus establishes productive infection in avian macrophages interfering with selected antimicrobial functions</article-title>
<source>PLoS One</source>
<year>2017</year>
<volume>12</volume>
<issue>8</issue>
<fpage>e0181801</fpage>
<pub-id pub-id-type="pmid">28763472</pub-id>
</element-citation>
</ref>
<ref id="CR15">
<label>15.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ammayappan</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Vakharia</surname>
<given-names>VN</given-names>
</name>
</person-group>
<article-title>Complete nucleotide analysis of the structural genome of the infectious bronchitis virus strain md27 reveals its mosaic nature</article-title>
<source>Viruses</source>
<year>2009</year>
<volume>1</volume>
<issue>3</issue>
<fpage>1166</fpage>
<lpage>1177</lpage>
<pub-id pub-id-type="pmid">21994587</pub-id>
</element-citation>
</ref>
<ref id="CR16">
<label>16.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alonso-Caplen</surname>
<given-names>FV</given-names>
</name>
<name>
<surname>Matsuoka</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Wilcox</surname>
<given-names>GE</given-names>
</name>
<name>
<surname>Compans</surname>
<given-names>RW</given-names>
</name>
</person-group>
<article-title>Replication and morphogenesis of avian coronavirus in Vero cells and their inhibition by monensin</article-title>
<source>Virus Res</source>
<year>1984</year>
<volume>1</volume>
<issue>2</issue>
<fpage>153</fpage>
<lpage>167</lpage>
<pub-id pub-id-type="pmid">6099655</pub-id>
</element-citation>
</ref>
<ref id="CR17">
<label>17.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Qi</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Pei</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
</person-group>
<article-title>Comparative study of the replication of infectious bursal disease virus in DF-1 cell line and chicken embryo fibroblasts evaluated by a new real-time RT-PCR</article-title>
<source>J Virol Methods</source>
<year>2009</year>
<volume>157</volume>
<issue>2</issue>
<fpage>205</fpage>
<lpage>210</lpage>
<pub-id pub-id-type="pmid">19186190</pub-id>
</element-citation>
</ref>
<ref id="CR18">
<label>18.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jauregui-Zuniga</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Pedraza-Escalona</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Espino-Solis</surname>
<given-names>GP</given-names>
</name>
<name>
<surname>Quintero-Hernandez</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Olvera-Rodriguez</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Diaz-Salinas</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Lopez</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Possani</surname>
<given-names>LD</given-names>
</name>
</person-group>
<article-title>Targeting antigens to Dec-205 on dendritic cells induces a higher immune response in chickens: hemagglutinin of avian influenza virus example</article-title>
<source>Res Vet Sci</source>
<year>2017</year>
<volume>111</volume>
<fpage>55</fpage>
<lpage>62</lpage>
<pub-id pub-id-type="pmid">27987414</pub-id>
</element-citation>
</ref>
<ref id="CR19">
<label>19.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nagy</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Bodi</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Olah</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Avian dendritic cells: phenotype and ontogeny in lymphoid organs</article-title>
<source>Dev Comp Immunol</source>
<year>2016</year>
<volume>58</volume>
<fpage>47</fpage>
<lpage>59</lpage>
<pub-id pub-id-type="pmid">26751596</pub-id>
</element-citation>
</ref>
<ref id="CR20">
<label>20.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q</given-names>
</name>
</person-group>
<article-title>Genome-wide profiling of chicken dendritic cell response to infectious bursal disease</article-title>
<source>BMC Genomics</source>
<year>2016</year>
<volume>17</volume>
<issue>1</issue>
<fpage>878</fpage>
<pub-id pub-id-type="pmid">27816055</pub-id>
</element-citation>
</ref>
<ref id="CR21">
<label>21.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seo</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Taniuchi</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Regulation of hematopoiesis and immune responses by long non-coding RNAs</article-title>
<source>Int Immunol</source>
<year>2017</year>
<volume>29</volume>
<issue>4</issue>
<fpage>165</fpage>
<lpage>172</lpage>
<pub-id pub-id-type="pmid">28444293</pub-id>
</element-citation>
</ref>
<ref id="CR22">
<label>22.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tarifeno-Saldivia</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Valenzuela-Miranda</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Gallardo-Escarate</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>In the shadow: the emerging role of long non-coding RNAs in the immune response of Atlantic salmon</article-title>
<source>Dev Comp Immunol</source>
<year>2017</year>
<volume>73</volume>
<fpage>193</fpage>
<lpage>205</lpage>
<pub-id pub-id-type="pmid">28373064</pub-id>
</element-citation>
</ref>
<ref id="CR23">
<label>23.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Lai</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Transcriptome-microRNA analysis of Sarcoptes scabiei and host immune response</article-title>
<source>PLoS One</source>
<year>2017</year>
<volume>12</volume>
<issue>5</issue>
<fpage>e0177733</fpage>
<pub-id pub-id-type="pmid">28542251</pub-id>
</element-citation>
</ref>
<ref id="CR24">
<label>24.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Robertson</surname>
<given-names>Sarah A.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Bihong</given-names>
</name>
<name>
<surname>Chan</surname>
<given-names>Honyueng</given-names>
</name>
<name>
<surname>Sharkey</surname>
<given-names>David J.</given-names>
</name>
<name>
<surname>Barry</surname>
<given-names>Simon C.</given-names>
</name>
<name>
<surname>Fullston</surname>
<given-names>Tod</given-names>
</name>
<name>
<surname>Schjenken</surname>
<given-names>John E.</given-names>
</name>
</person-group>
<article-title>MicroRNA regulation of immune events at conception</article-title>
<source>Molecular Reproduction and Development</source>
<year>2017</year>
<volume>84</volume>
<issue>9</issue>
<fpage>914</fpage>
<lpage>925</lpage>
<pub-id pub-id-type="pmid">28452160</pub-id>
</element-citation>
</ref>
<ref id="CR25">
<label>25.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>YT</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>KY</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q</given-names>
</name>
</person-group>
<article-title>H9N2 avian influenza virus enhances the immune responses of BMDCs by down-regulating miR29c</article-title>
<source>Vaccine</source>
<year>2017</year>
<volume>35</volume>
<issue>5</issue>
<fpage>729</fpage>
<lpage>737</lpage>
<pub-id pub-id-type="pmid">28063705</pub-id>
</element-citation>
</ref>
<ref id="CR26">
<label>26.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Tu</surname>
<given-names>CZ</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>KY</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q</given-names>
</name>
</person-group>
<article-title>H9N2 avian influenza virus protein PB1 enhances the immune responses of bone marrow-derived dendritic cells by Down-regulating miR375</article-title>
<source>Front Microbiol</source>
<year>2017</year>
<volume>8</volume>
<fpage>287</fpage>
<pub-id pub-id-type="pmid">28382020</pub-id>
</element-citation>
</ref>
<ref id="CR27">
<label>27.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rosenberger</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Podyminogin</surname>
<given-names>RL</given-names>
</name>
<name>
<surname>Diercks</surname>
<given-names>AH</given-names>
</name>
<name>
<surname>Treuting</surname>
<given-names>PM</given-names>
</name>
<name>
<surname>Peschon</surname>
<given-names>JJ</given-names>
</name>
<name>
<surname>Rodriguez</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Gundapuneni</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Weiss</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Aderem</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>miR-144 attenuates the host response to influenza virus by targeting the TRAF6-IRF7 signaling axis</article-title>
<source>PLoS Pathog</source>
<year>2017</year>
<volume>13</volume>
<issue>4</issue>
<fpage>e1006305</fpage>
<pub-id pub-id-type="pmid">28380049</pub-id>
</element-citation>
</ref>
<ref id="CR28">
<label>28.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Lv</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Hou</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>X</given-names>
</name>
</person-group>
<article-title>Genome-wide identification of turnip mosaic virus-responsive microRNAs in non-heading Chinese cabbage by high-throughput sequencing</article-title>
<source>Gene</source>
<year>2015</year>
<volume>571</volume>
<issue>2</issue>
<fpage>178</fpage>
<lpage>187</lpage>
<pub-id pub-id-type="pmid">26115771</pub-id>
</element-citation>
</ref>
<ref id="CR29">
<label>29.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>YT</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q</given-names>
</name>
</person-group>
<article-title>MiR674 inhibits the neuraminidase-stimulated immune response on dendritic cells via down-regulated Mbnl3</article-title>
<source>Oncotarget</source>
<year>2016</year>
<volume>7</volume>
<issue>31</issue>
<fpage>48978</fpage>
<lpage>48994</lpage>
<pub-id pub-id-type="pmid">27285980</pub-id>
</element-citation>
</ref>
<ref id="CR30">
<label>30.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lucio</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>Fabricant J:tissue tropism of three cloacal isolates and Massachusetts strain of infectious bronchitis virus</article-title>
<source>Avian Dis</source>
<year>1990</year>
<volume>34</volume>
<issue>4</issue>
<fpage>865</fpage>
<lpage>870</lpage>
<pub-id pub-id-type="pmid">2177974</pub-id>
</element-citation>
</ref>
<ref id="CR31">
<label>31.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fu</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>HH</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>QH</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q</given-names>
</name>
</person-group>
<article-title>The stimulatory effect of different CpG oligonucleotides on the maturation of chicken bone marrow-derived dendritic cells</article-title>
<source>Poult Sci</source>
<year>2014</year>
<volume>93</volume>
<fpage>63</fpage>
<lpage>69</lpage>
<pub-id pub-id-type="pmid">24570424</pub-id>
</element-citation>
</ref>
<ref id="CR32">
<label>32.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yin</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Qin</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q</given-names>
</name>
</person-group>
<article-title>CpG DNA assists the whole inactivated H9N2 influenza virus in crossing the intestinal epithelial barriers via transepithelial uptake of dendritic cell dendrites</article-title>
<source>Mucosal Immunol</source>
<year>2015</year>
<volume>8</volume>
<issue>4</issue>
<fpage>799</fpage>
<lpage>814</lpage>
<pub-id pub-id-type="pmid">25492476</pub-id>
</element-citation>
</ref>
<ref id="CR33">
<label>33.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takashi</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Tatsuya</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Integration of pre-normalized microarray data using quantile correction</article-title>
<source>Bioinformation</source>
<year>2011</year>
<volume>5</volume>
<issue>9</issue>
<fpage>382</fpage>
<lpage>385</lpage>
<pub-id pub-id-type="pmid">21383905</pub-id>
</element-citation>
</ref>
<ref id="CR34">
<label>34.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peng</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Shan</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Duan: Genome-wide analyses of long noncoding RNA expression profiles in lung adenocarcinoma</article-title>
<source>Sci Rep</source>
<year>2017</year>
<volume>10</volume>
<issue>7(1)</issue>
<fpage>15331</fpage>
</element-citation>
</ref>
<ref id="CR35">
<label>35.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shannon</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Markiel</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Ozier</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Baliga</surname>
<given-names>NS</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>JT</given-names>
</name>
<name>
<surname>Ramage</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Amin</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Schwikowski</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Ideker</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Cytoscape: a software environment for integrated models of biomolecular interaction networks</article-title>
<source>Genome Res</source>
<year>2003</year>
<volume>13</volume>
<issue>11</issue>
<fpage>2498</fpage>
<lpage>2504</lpage>
<pub-id pub-id-type="pmid">14597658</pub-id>
</element-citation>
</ref>
<ref id="CR36">
<label>36.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cyplik</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Schmidt</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Szulc</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Marecik</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Lisiecki</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Heipieper</surname>
<given-names>HJ</given-names>
</name>
<name>
<surname>Owsianiak</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Vainshtein</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Chrzanowski</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Relative quantitative PCR to assess bacterial community dynamics during biodegradation of diesel and biodiesel fuels under various aeration conditions</article-title>
<source>Bioresour Technol</source>
<year>2011</year>
<volume>102</volume>
<issue>6</issue>
<fpage>4347</fpage>
<lpage>4352</lpage>
<pub-id pub-id-type="pmid">21239170</pub-id>
</element-citation>
</ref>
<ref id="CR37">
<label>37.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Qu</surname>
<given-names>LH</given-names>
</name>
</person-group>
<article-title>ChIPBase: a database for decoding the transcriptional regulation of long non-coding RNA and microRNA genes from ChIP-Seq data</article-title>
<source>Nucleic Acids Res</source>
<year>2013</year>
<volume>41</volume>
<issue>Database issue</issue>
<fpage>D177</fpage>
<lpage>D187</lpage>
<pub-id pub-id-type="pmid">23161675</pub-id>
</element-citation>
</ref>
<ref id="CR38">
<label>38.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Banchereau</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Briere</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Caux</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Davoust</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Lebecque</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>YJ</given-names>
</name>
<name>
<surname>Pulendran</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Palucka</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Immunobiology of dendritic cells</article-title>
<source>Annu Rev Immunol</source>
<year>2000</year>
<volume>18</volume>
<fpage>767</fpage>
<lpage>811</lpage>
<pub-id pub-id-type="pmid">10837075</pub-id>
</element-citation>
</ref>
<ref id="CR39">
<label>39.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Quinteros</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>SW</given-names>
</name>
<name>
<surname>Markham</surname>
<given-names>PF</given-names>
</name>
<name>
<surname>Noormohammadi</surname>
<given-names>AH</given-names>
</name>
<name>
<surname>Hartley</surname>
<given-names>CA</given-names>
</name>
<name>
<surname>Legione</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Coppo</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Vaz</surname>
<given-names>PK</given-names>
</name>
<name>
<surname>Browning</surname>
<given-names>GF</given-names>
</name>
</person-group>
<article-title>Full genome analysis of Australian infectious bronchitis viruses suggests frequent recombination events between vaccine strains and multiple phylogenetically distant avian coronaviruses of unknown origin</article-title>
<source>Vet Microbiol</source>
<year>2016</year>
<volume>197</volume>
<fpage>27</fpage>
<lpage>38</lpage>
<pub-id pub-id-type="pmid">27938680</pub-id>
</element-citation>
</ref>
<ref id="CR40">
<label>40.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bande</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Arshad</surname>
<given-names>SS</given-names>
</name>
<name>
<surname>Omar</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Bejo</surname>
<given-names>MH</given-names>
</name>
<name>
<surname>Abubakar</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>Abba</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Pathogenesis and diagnostic approaches of avian infectious bronchitis</article-title>
<source>Adv Virol</source>
<year>2016</year>
<volume>2016</volume>
<fpage>4621659</fpage>
<pub-id pub-id-type="pmid">26955391</pub-id>
</element-citation>
</ref>
<ref id="CR41">
<label>41.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Real-Time</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>Emergence of a novel swineorigin influenza a (H1N1) virus in humans</article-title>
<source>N Engl J Med</source>
<year>2009</year>
<volume>360</volume>
<fpage>2605</fpage>
<lpage>2615</lpage>
<pub-id pub-id-type="pmid">19423869</pub-id>
</element-citation>
</ref>
<ref id="CR42">
<label>42.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rouse</surname>
<given-names>BT</given-names>
</name>
<name>
<surname>Sehrawat</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Immunity and immunopathology to viruses: what decides the outcome?</article-title>
<source>Nat Rev Immunol</source>
<year>2010</year>
<volume>10</volume>
<issue>7</issue>
<fpage>514</fpage>
<lpage>526</lpage>
<pub-id pub-id-type="pmid">20577268</pub-id>
</element-citation>
</ref>
<ref id="CR43">
<label>43.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cardinaud</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Urrutia</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Rouers</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Coulon</surname>
<given-names>PG</given-names>
</name>
<name>
<surname>Kervevan</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Richetta</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Bet</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Maze</surname>
<given-names>EA</given-names>
</name>
<name>
<surname>Larsen</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Iglesias</surname>
<given-names>MC</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Triggering of TLR-3, −4, NOD2, and DC-SIGN reduces viral replication and increases T-cell activation capacity of HIV-infected human dendritic cells</article-title>
<source>Eur J Immunol</source>
<year>2017</year>
<volume>47</volume>
<issue>5</issue>
<fpage>818</fpage>
<lpage>829</lpage>
<pub-id pub-id-type="pmid">28266028</pub-id>
</element-citation>
</ref>
<ref id="CR44">
<label>44.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Palucka</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Banchereau</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>How dendritic cells and microbes interact to elicit or subvert protective immune responses</article-title>
<source>Curr Opin Immunol</source>
<year>2002</year>
<volume>14</volume>
<issue>4</issue>
<fpage>420</fpage>
<lpage>431</lpage>
<pub-id pub-id-type="pmid">12088675</pub-id>
</element-citation>
</ref>
<ref id="CR45">
<label>45.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seifi</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Boroomand</surname>
<given-names>Z</given-names>
</name>
</person-group>
<article-title>Ultrastructural study of the trachea in experimentally infected broilers with IBV serotype 4/91</article-title>
<source>Slov Vet Res</source>
<year>2015</year>
<volume>52</volume>
<issue>1</issue>
<fpage>15</fpage>
<lpage>21</lpage>
</element-citation>
</ref>
<ref id="CR46">
<label>46.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Winter</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Herrler</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Neumann</surname>
<given-names>U</given-names>
</name>
</person-group>
<article-title>Infection of the tracheal epithelium by infectious bronchitis virus is sialic acid dependent</article-title>
<source>Microbes Infect</source>
<year>2008</year>
<volume>10</volume>
<issue>4</issue>
<fpage>367</fpage>
<lpage>373</lpage>
<pub-id pub-id-type="pmid">18396435</pub-id>
</element-citation>
</ref>
<ref id="CR47">
<label>47.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abd El Rahman</surname>
<given-names>S</given-names>
</name>
<name>
<surname>El-Kenawy</surname>
<given-names>AA</given-names>
</name>
<name>
<surname>Neumann</surname>
<given-names>U</given-names>
</name>
<name>
<surname>Herrler</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Winter</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Comparative analysis of the sialic acid binding activity and the tropism for the respiratory epithelium of four different strains of avian infectious bronchitis virus</article-title>
<source>Avian Pathol</source>
<year>2009</year>
<volume>38</volume>
<issue>1</issue>
<fpage>41</fpage>
<lpage>45</lpage>
<pub-id pub-id-type="pmid">19156578</pub-id>
</element-citation>
</ref>
<ref id="CR48">
<label>48.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Buckles</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Whittaker</surname>
<given-names>GR</given-names>
</name>
</person-group>
<article-title>Expression of the C-type lectins DC-SIGN or L-SIGN alters host cell susceptibility for the avian coronavirus, infectious bronchitis virus</article-title>
<source>Vet Microbiol</source>
<year>2012</year>
<volume>157</volume>
<issue>3–4</issue>
<fpage>285</fpage>
<lpage>293</lpage>
<pub-id pub-id-type="pmid">22340967</pub-id>
</element-citation>
</ref>
<ref id="CR49">
<label>49.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Rosa</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>DG</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
</person-group>
<article-title>Molecular mechanisms of primary and secondary mucosal immunity using avian infectious bronchitis virus as a model system</article-title>
<source>Vet Immunol Immunopathol</source>
<year>2008</year>
<volume>121</volume>
<issue>3–4</issue>
<fpage>332</fpage>
<lpage>343</lpage>
<pub-id pub-id-type="pmid">17983666</pub-id>
</element-citation>
</ref>
<ref id="CR50">
<label>50.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Rosa</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Oliverira</surname>
<given-names>HN</given-names>
</name>
<name>
<surname>Rosa</surname>
<given-names>GJ</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Travnicek</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Girshick</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Transcriptome of local innate and adaptive immunity during early phase of infectious bronchitis viral infection</article-title>
<source>Viral Immunol</source>
<year>2006</year>
<volume>19</volume>
<issue>4</issue>
<fpage>768</fpage>
<lpage>774</lpage>
<pub-id pub-id-type="pmid">17201672</pub-id>
</element-citation>
</ref>
<ref id="CR51">
<label>51.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname>
<given-names>Erick</given-names>
</name>
<name>
<surname>Dang</surname>
<given-names>Eric V.</given-names>
</name>
<name>
<surname>McDonald</surname>
<given-names>Jeffrey G.</given-names>
</name>
<name>
<surname>Cyster</surname>
<given-names>Jason G.</given-names>
</name>
</person-group>
<article-title>Distinct oxysterol requirements for positioning naïve and activated dendritic cells in the spleen</article-title>
<source>Science Immunology</source>
<year>2017</year>
<volume>2</volume>
<issue>10</issue>
<fpage>eaal5237</fpage>
<pub-id pub-id-type="pmid">28738017</pub-id>
</element-citation>
</ref>
<ref id="CR52">
<label>52.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maggi</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Schinnerling</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Pesce</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Hilkens</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Catalan</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Aguillon</surname>
<given-names>JC</given-names>
</name>
</person-group>
<article-title>Dexamethasone and Monophosphoryl lipid A-modulated dendritic cells promote antigen-specific Tolerogenic properties on naive and memory CD4+ T cells</article-title>
<source>Front Immunol</source>
<year>2016</year>
<volume>7</volume>
<fpage>359</fpage>
<pub-id pub-id-type="pmid">27698654</pub-id>
</element-citation>
</ref>
<ref id="CR53">
<label>53.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sato</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Honda</surname>
<given-names>SI</given-names>
</name>
<name>
<surname>Shibuya</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Shibuya</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Improved protocol for the isolation of naive follicular dendritic cells</article-title>
<source>Mol Immunol</source>
<year>2016</year>
<volume>78</volume>
<fpage>140</fpage>
<lpage>145</lpage>
<pub-id pub-id-type="pmid">27639061</pub-id>
</element-citation>
</ref>
<ref id="CR54">
<label>54.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Groux</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Role of dendritic cells in the generation of regulatory T cells</article-title>
<source>Seminars in Immunology</source>
<year>2004</year>
<volume>16</volume>
<issue>2</issue>
<fpage>99</fpage>
<lpage>106</lpage>
<pub-id pub-id-type="pmid">15036233</pub-id>
</element-citation>
</ref>
<ref id="CR55">
<label>55.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Beckebaum</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Cicinnati</surname>
<given-names>VR</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Ferencik</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Frilling</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Grosse-Wilde</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Broelsch</surname>
<given-names>CE</given-names>
</name>
<name>
<surname>Gerken</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Hepatitis B virus-induced defect of monocyte-derived dendritic cells leads to impaired T helper type 1 response in vitro: mechanisms for viral immune escape</article-title>
<source>Immunology</source>
<year>2003</year>
<volume>109</volume>
<issue>4</issue>
<fpage>487</fpage>
<lpage>495</lpage>
<pub-id pub-id-type="pmid">12871214</pub-id>
</element-citation>
</ref>
<ref id="CR56">
<label>56.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Umbach</surname>
<given-names>JL</given-names>
</name>
<name>
<surname>Cullen</surname>
<given-names>BR</given-names>
</name>
</person-group>
<article-title>The role of RNAi and microRNAs in animal virus replication and antiviral immunity</article-title>
<source>Genes Dev</source>
<year>2009</year>
<volume>23</volume>
<issue>10</issue>
<fpage>1151</fpage>
<lpage>1164</lpage>
<pub-id pub-id-type="pmid">19451215</pub-id>
</element-citation>
</ref>
<ref id="CR57">
<label>57.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Hou</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Jia</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>EM</given-names>
</name>
<etal></etal>
</person-group>
<article-title>MicroRNA-like viral small RNA from porcine reproductive and respiratory syndrome virus negatively regulates viral replication by targeting the viral nonstructural protein 2</article-title>
<source>Oncotarget</source>
<year>2016</year>
<volume>7</volume>
<issue>50</issue>
<fpage>82902</fpage>
<lpage>82920</lpage>
<pub-id pub-id-type="pmid">27769040</pub-id>
</element-citation>
</ref>
<ref id="CR58">
<label>58.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miesen</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Ivens</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Buck</surname>
<given-names>AH</given-names>
</name>
<name>
<surname>van Rij</surname>
<given-names>RP</given-names>
</name>
</person-group>
<article-title>Small RNA profiling in dengue virus 2-infected Aedes Mosquito cells reveals viral piRNAs and novel host miRNAs</article-title>
<source>PLoS Negl Trop Dis</source>
<year>2016</year>
<volume>10</volume>
<issue>2</issue>
<fpage>e0004452</fpage>
<pub-id pub-id-type="pmid">26914027</pub-id>
</element-citation>
</ref>
<ref id="CR59">
<label>59.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Duru</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Gernapudi</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Wolfson</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Lo</surname>
<given-names>PK</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Q</given-names>
</name>
</person-group>
<article-title>Loss of miR-140 is a key risk factor for radiation-induced lung fibrosis through reprogramming fibroblasts and macrophages</article-title>
<source>Sci Rep</source>
<year>2016</year>
<volume>6</volume>
<fpage>39572</fpage>
<pub-id pub-id-type="pmid">27996039</pub-id>
</element-citation>
</ref>
<ref id="CR60">
<label>60.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dong</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Teng</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Chai</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>MiR-140-3p suppressed cell growth and invasion by downregulating the expression of ATP8A1 in non-small cell lung cancer</article-title>
<source>Tumour Biol</source>
<year>2016</year>
<volume>37</volume>
<issue>3</issue>
<fpage>2973</fpage>
<lpage>2985</lpage>
<pub-id pub-id-type="pmid">26415732</pub-id>
</element-citation>
</ref>
<ref id="CR61">
<label>61.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>W</given-names>
</name>
</person-group>
<article-title>Cellular microRNAs inhibit replication of the H1N1 influenza a virus in infected cells</article-title>
<source>J Virol</source>
<year>2010</year>
<volume>84</volume>
<issue>17</issue>
<fpage>8849</fpage>
<lpage>8860</lpage>
<pub-id pub-id-type="pmid">20554777</pub-id>
</element-citation>
</ref>
<ref id="CR62">
<label>62.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Qiao</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>Gga-miR-21 inhibits chicken pre-adipocyte proliferation in part by down-regulating Kruppel-like factor 5</article-title>
<source>Poult Sci</source>
<year>2017</year>
<volume>96</volume>
<issue>1</issue>
<fpage>200</fpage>
<lpage>210</lpage>
<pub-id pub-id-type="pmid">27587730</pub-id>
</element-citation>
</ref>
<ref id="CR63">
<label>63.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>YS</given-names>
</name>
<name>
<surname>Ouyang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>QX</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>XL</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>XX</given-names>
</name>
<name>
<surname>Bi</surname>
<given-names>ZW</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>YQ</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>XM</given-names>
</name>
</person-group>
<article-title>Overexpression of microRNA gga-miR-21 in chicken fibroblasts suppresses replication of infectious bursal disease virus through inhibiting VP1 translation</article-title>
<source>Antivir Res</source>
<year>2013</year>
<volume>100</volume>
<issue>1</issue>
<fpage>196</fpage>
<lpage>201</lpage>
<pub-id pub-id-type="pmid">23954191</pub-id>
</element-citation>
</ref>
<ref id="CR64">
<label>64.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Brahmakshatriya</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Lupiani</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Reddy</surname>
<given-names>SM</given-names>
</name>
<name>
<surname>Yoon</surname>
<given-names>BJ</given-names>
</name>
<name>
<surname>Gunaratne</surname>
<given-names>PH</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach</article-title>
<source>BMC Genomics</source>
<year>2009</year>
<volume>10</volume>
<fpage>512</fpage>
<pub-id pub-id-type="pmid">19891781</pub-id>
</element-citation>
</ref>
<ref id="CR65">
<label>65.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peng</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>QS</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>ZH</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>HJ</given-names>
</name>
<name>
<surname>Zhan</surname>
<given-names>CY</given-names>
</name>
<name>
<surname>Xiang</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>MicroRNAs in avian influenza virus H9N2-infected and non-infected chicken embryo fibroblasts</article-title>
<source>Genet Mol Res</source>
<year>2015</year>
<volume>14</volume>
<issue>3</issue>
<fpage>9081</fpage>
<lpage>9091</lpage>
<pub-id pub-id-type="pmid">26345840</pub-id>
</element-citation>
</ref>
<ref id="CR66">
<label>66.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kemper</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Atkinson</surname>
<given-names>JP</given-names>
</name>
</person-group>
<article-title>T-cell regulation: with complements from innate immunity</article-title>
<source>Nat Rev Immunol</source>
<year>2007</year>
<volume>7</volume>
<issue>1</issue>
<fpage>9</fpage>
<lpage>18</lpage>
<pub-id pub-id-type="pmid">17170757</pub-id>
</element-citation>
</ref>
<ref id="CR67">
<label>67.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Banat</surname>
<given-names>GR</given-names>
</name>
<name>
<surname>Tkalcic</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Dzielawa</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Jackwood</surname>
<given-names>MW</given-names>
</name>
<name>
<surname>Saggese</surname>
<given-names>MD</given-names>
</name>
<name>
<surname>Yates</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Kopulos</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Briles</surname>
<given-names>WE</given-names>
</name>
<name>
<surname>Collisson</surname>
<given-names>EW</given-names>
</name>
</person-group>
<article-title>Association of the chicken MHC B haplotypes with resistance to avian coronavirus</article-title>
<source>Dev Comp Immunol</source>
<year>2013</year>
<volume>39</volume>
<issue>4</issue>
<fpage>430</fpage>
<lpage>437</lpage>
<pub-id pub-id-type="pmid">23178407</pub-id>
</element-citation>
</ref>
<ref id="CR68">
<label>68.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bacon</surname>
<given-names>LD</given-names>
</name>
<name>
<surname>Hunter</surname>
<given-names>DB</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>HM</given-names>
</name>
<name>
<surname>Brand</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Etches</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>Retrospective evidence that the MHC (B haplotype) of chickens influences genetic resistance to attenuated infectious bronchitis vaccine strains in chickens</article-title>
<source>Avian pathol</source>
<year>2004</year>
<volume>33</volume>
<issue>6</issue>
<fpage>605</fpage>
<lpage>609</lpage>
<pub-id pub-id-type="pmid">15763730</pub-id>
</element-citation>
</ref>
<ref id="CR69">
<label>69.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Izumi</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Koga</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Takamura</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Makabe</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Nagai</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Urata</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Harada</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hirata</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Hirota</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Fujii</surname>
<given-names>T</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Mannose receptor is highly expressed by peritoneal dendritic cells in endometriosis</article-title>
<source>Fertil Steril</source>
<year>2017</year>
<volume>107</volume>
<issue>1</issue>
<fpage>167</fpage>
<lpage>173</lpage>
<pub-id pub-id-type="pmid">27793384</pub-id>
</element-citation>
</ref>
<ref id="CR70">
<label>70.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lo</surname>
<given-names>YL</given-names>
</name>
<name>
<surname>Liou</surname>
<given-names>GG</given-names>
</name>
<name>
<surname>Lyu</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Hsiao</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hsu</surname>
<given-names>TL</given-names>
</name>
<name>
<surname>Wong</surname>
<given-names>CH</given-names>
</name>
</person-group>
<article-title>Dengue virus infection is through a cooperative interaction between a mannose receptor and CLEC5A on macrophage as a multivalent hetero-complex</article-title>
<source>PLoS One</source>
<year>2016</year>
<volume>11</volume>
<issue>11</issue>
<fpage>e0166474</fpage>
<pub-id pub-id-type="pmid">27832191</pub-id>
</element-citation>
</ref>
<ref id="CR71">
<label>71.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chang</surname>
<given-names>WC</given-names>
</name>
<name>
<surname>White</surname>
<given-names>MR</given-names>
</name>
<name>
<surname>Moyo</surname>
<given-names>P</given-names>
</name>
<name>
<surname>McClear</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Thiel</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Hartshorn</surname>
<given-names>KL</given-names>
</name>
<name>
<surname>Takahashi</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Lack of the pattern recognition molecule mannose-binding lectin increases susceptibility to influenza a virus infection</article-title>
<source>BMC Immunol</source>
<year>2010</year>
<volume>11</volume>
<fpage>64</fpage>
<pub-id pub-id-type="pmid">21182784</pub-id>
</element-citation>
</ref>
<ref id="CR72">
<label>72.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Michelow</surname>
<given-names>IC</given-names>
</name>
<name>
<surname>Lear</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Scully</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Prugar</surname>
<given-names>LI</given-names>
</name>
<name>
<surname>Longley</surname>
<given-names>CB</given-names>
</name>
<name>
<surname>Yantosca</surname>
<given-names>LM</given-names>
</name>
<name>
<surname>Ji</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Karpel</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Brudner</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Takahashi</surname>
<given-names>K</given-names>
</name>
<etal></etal>
</person-group>
<article-title>High-dose mannose-binding lectin therapy for Ebola virus infection</article-title>
<source>J Infect Dis</source>
<year>2011</year>
<volume>203</volume>
<issue>2</issue>
<fpage>175</fpage>
<lpage>179</lpage>
<pub-id pub-id-type="pmid">21288816</pub-id>
</element-citation>
</ref>
<ref id="CR73">
<label>73.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brown</surname>
<given-names>KS</given-names>
</name>
<name>
<surname>Keogh</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Owsianka</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Adair</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Patel</surname>
<given-names>AH</given-names>
</name>
<name>
<surname>Arnold</surname>
<given-names>JN</given-names>
</name>
<name>
<surname>Ball</surname>
<given-names>JK</given-names>
</name>
<name>
<surname>Sim</surname>
<given-names>RB</given-names>
</name>
<name>
<surname>Tarr</surname>
<given-names>AW</given-names>
</name>
<name>
<surname>Hickling</surname>
<given-names>TP</given-names>
</name>
</person-group>
<article-title>Specific interaction of hepatitis C virus glycoproteins with mannan binding lectin inhibits virus entry</article-title>
<source>Protein Cell</source>
<year>2010</year>
<volume>1</volume>
<issue>7</issue>
<fpage>664</fpage>
<lpage>674</lpage>
<pub-id pub-id-type="pmid">21203938</pub-id>
</element-citation>
</ref>
<ref id="CR74">
<label>74.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tawana</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Rio-Machin</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Preudhomme</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Fitzgibbon</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Familial CEBPA-mutated acute myeloid leukemia</article-title>
<source>Semin Hematol</source>
<year>2017</year>
<volume>54</volume>
<issue>2</issue>
<fpage>87</fpage>
<lpage>93</lpage>
<pub-id pub-id-type="pmid">28637622</pub-id>
</element-citation>
</ref>
<ref id="CR75">
<label>75.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname>
<given-names>WQ</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>JN</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>YH</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>JW</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>W</given-names>
</name>
</person-group>
<article-title>recent advances of research on CEBPA mutation in acute myeloid leukemia</article-title>
<source>Zhongguo shi yan xue ye xue za zhi</source>
<year>2015</year>
<volume>23</volume>
<issue>6</issue>
<fpage>1791</fpage>
<lpage>1795</lpage>
<pub-id pub-id-type="pmid">26708912</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Sante/explor/CovidV2/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000200 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000200 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Sante
   |area=    CovidV2
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     PMC:6615177
   |texte=   Microarray analysis of infectious bronchitis virus infection of chicken primary dendritic cells
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i   -Sk "pubmed:31286855" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd   \
       | NlmPubMed2Wicri -a CovidV2 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Sat Mar 28 17:51:24 2020. Site generation: Sun Jan 31 15:35:48 2021