Serveur d'exploration Covid

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

A Melting Curve-Based Multiplex RT-qPCR Assay for Simultaneous Detection of Four Human Coronaviruses

Identifieur interne : 000591 ( Ncbi/Merge ); précédent : 000590; suivant : 000592

A Melting Curve-Based Multiplex RT-qPCR Assay for Simultaneous Detection of Four Human Coronaviruses

Auteurs : Zhenzhou Wan [République populaire de Chine] ; Ya An Zhang ; Zhixiang He ; Jia Liu ; Ke Lan ; Yihong Hu ; Chiyu Zhang

Source :

RBID : PMC:5133880

Abstract

Human coronaviruses HCoV-OC43, HCoV-229E, HCoV-NL63 and HCoV-HKU1 are common respiratory viruses associated with acute respiratory infection. They have a global distribution. Rapid and accurate diagnosis of HCoV infection is important for the management and treatment of hospitalized patients with HCoV infection. Here, we developed a melting curve-based multiplex RT-qPCR assay for simultaneous detection of the four HCoVs. In the assay, SYTO 9 was used to replace SYBR Green I as the fluorescent dye, and GC-modified primers were designed to improve the melting temperature (Tm) of the specific amplicon. The four HCoVs were clearly distinguished by characteristic melting peaks in melting curve analysis. The detection sensitivity of the assay was 3 × 102 copies for HCoV-OC43, and 3 × 101 copies for HCoV-NL63, HCoV-229E and HCoV-HKU1 per 30 μL reaction. Clinical evaluation and sequencing confirmation demonstrated that the assay was specific and reliable. The assay represents a sensitive and reliable method for diagnosis of HCoV infection in clinical samples.


Url:
DOI: 10.3390/ijms17111880
PubMed: 27886052
PubMed Central: 5133880

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:5133880

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">A Melting Curve-Based Multiplex RT-qPCR Assay for Simultaneous Detection of Four Human Coronaviruses</title>
<author>
<name sortKey="Wan, Zhenzhou" sort="Wan, Zhenzhou" uniqKey="Wan Z" first="Zhenzhou" last="Wan">Zhenzhou Wan</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-ijms-17-01880">Medical Laboratory of Taizhou Fourth People’s Hospital, Taizhou 225300, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Medical Laboratory of Taizhou Fourth People’s Hospital, Taizhou 225300</wicri:regionArea>
<wicri:noRegion>Taizhou 225300</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Ya An" sort="Zhang, Ya An" uniqKey="Zhang Y" first="Ya An" last="Zhang">Ya An Zhang</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="He, Zhixiang" sort="He, Zhixiang" uniqKey="He Z" first="Zhixiang" last="He">Zhixiang He</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Liu, Jia" sort="Liu, Jia" uniqKey="Liu J" first="Jia" last="Liu">Jia Liu</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lan, Ke" sort="Lan, Ke" uniqKey="Lan K" first="Ke" last="Lan">Ke Lan</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hu, Yihong" sort="Hu, Yihong" uniqKey="Hu Y" first="Yihong" last="Hu">Yihong Hu</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Chiyu" sort="Zhang, Chiyu" uniqKey="Zhang C" first="Chiyu" last="Zhang">Chiyu Zhang</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">27886052</idno>
<idno type="pmc">5133880</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5133880</idno>
<idno type="RBID">PMC:5133880</idno>
<idno type="doi">10.3390/ijms17111880</idno>
<date when="2016">2016</date>
<idno type="wicri:Area/Pmc/Corpus">000605</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000605</idno>
<idno type="wicri:Area/Pmc/Curation">000605</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000605</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000303</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000303</idno>
<idno type="wicri:Area/Ncbi/Merge">000591</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">A Melting Curve-Based Multiplex RT-qPCR Assay for Simultaneous Detection of Four Human Coronaviruses</title>
<author>
<name sortKey="Wan, Zhenzhou" sort="Wan, Zhenzhou" uniqKey="Wan Z" first="Zhenzhou" last="Wan">Zhenzhou Wan</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-ijms-17-01880">Medical Laboratory of Taizhou Fourth People’s Hospital, Taizhou 225300, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Medical Laboratory of Taizhou Fourth People’s Hospital, Taizhou 225300</wicri:regionArea>
<wicri:noRegion>Taizhou 225300</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Ya An" sort="Zhang, Ya An" uniqKey="Zhang Y" first="Ya An" last="Zhang">Ya An Zhang</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="He, Zhixiang" sort="He, Zhixiang" uniqKey="He Z" first="Zhixiang" last="He">Zhixiang He</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Liu, Jia" sort="Liu, Jia" uniqKey="Liu J" first="Jia" last="Liu">Jia Liu</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lan, Ke" sort="Lan, Ke" uniqKey="Lan K" first="Ke" last="Lan">Ke Lan</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hu, Yihong" sort="Hu, Yihong" uniqKey="Hu Y" first="Yihong" last="Hu">Yihong Hu</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Chiyu" sort="Zhang, Chiyu" uniqKey="Zhang C" first="Chiyu" last="Zhang">Chiyu Zhang</name>
<affiliation>
<nlm:aff id="af1-ijms-17-01880">Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">International Journal of Molecular Sciences</title>
<idno type="eISSN">1422-0067</idno>
<imprint>
<date when="2016">2016</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Human coronaviruses HCoV-OC43, HCoV-229E, HCoV-NL63 and HCoV-HKU1 are common respiratory viruses associated with acute respiratory infection. They have a global distribution. Rapid and accurate diagnosis of HCoV infection is important for the management and treatment of hospitalized patients with HCoV infection. Here, we developed a melting curve-based multiplex RT-qPCR assay for simultaneous detection of the four HCoVs. In the assay, SYTO 9 was used to replace SYBR Green I as the fluorescent dye, and GC-modified primers were designed to improve the melting temperature (Tm) of the specific amplicon. The four HCoVs were clearly distinguished by characteristic melting peaks in melting curve analysis. The detection sensitivity of the assay was 3 × 10
<sup>2</sup>
copies for HCoV-OC43, and 3 × 10
<sup>1</sup>
copies for HCoV-NL63, HCoV-229E and HCoV-HKU1 per 30 μL reaction. Clinical evaluation and sequencing confirmation demonstrated that the assay was specific and reliable. The assay represents a sensitive and reliable method for diagnosis of HCoV infection in clinical samples.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Pyrc, K" uniqKey="Pyrc K">K. Pyrc</name>
</author>
<author>
<name sortKey="Jebbink, M F" uniqKey="Jebbink M">M.F. Jebbink</name>
</author>
<author>
<name sortKey="Berkhout, B" uniqKey="Berkhout B">B. Berkhout</name>
</author>
<author>
<name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L. van der Hoek</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Su, S" uniqKey="Su S">S. Su</name>
</author>
<author>
<name sortKey="Wong, G" uniqKey="Wong G">G. Wong</name>
</author>
<author>
<name sortKey="Shi, W" uniqKey="Shi W">W. Shi</name>
</author>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J. Liu</name>
</author>
<author>
<name sortKey="Lai, A C" uniqKey="Lai A">A.C. Lai</name>
</author>
<author>
<name sortKey="Zhou, J" uniqKey="Zhou J">J. Zhou</name>
</author>
<author>
<name sortKey="Liu, W" uniqKey="Liu W">W. Liu</name>
</author>
<author>
<name sortKey="Bi, Y" uniqKey="Bi Y">Y. Bi</name>
</author>
<author>
<name sortKey="Gao, G F" uniqKey="Gao G">G.F. Gao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hamre, D" uniqKey="Hamre D">D. Hamre</name>
</author>
<author>
<name sortKey="Procknow, J J" uniqKey="Procknow J">J.J. Procknow</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mcintosh, K" uniqKey="Mcintosh K">K. McIntosh</name>
</author>
<author>
<name sortKey="Dees, J H" uniqKey="Dees J">J.H. Dees</name>
</author>
<author>
<name sortKey="Becker, W B" uniqKey="Becker W">W.B. Becker</name>
</author>
<author>
<name sortKey="Kapikian, A Z" uniqKey="Kapikian A">A.Z. Kapikian</name>
</author>
<author>
<name sortKey="Chanock, R M" uniqKey="Chanock R">R.M. Chanock</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author>
<name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author>
<name sortKey="Chu, C M" uniqKey="Chu C">C.M. Chu</name>
</author>
<author>
<name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author>
<name sortKey="Tsoi, H W" uniqKey="Tsoi H">H.W. Tsoi</name>
</author>
<author>
<name sortKey="Huang, Y" uniqKey="Huang Y">Y. Huang</name>
</author>
<author>
<name sortKey="Wong, B H" uniqKey="Wong B">B.H. Wong</name>
</author>
<author>
<name sortKey="Poon, R W" uniqKey="Poon R">R.W. Poon</name>
</author>
<author>
<name sortKey="Cai, J J" uniqKey="Cai J">J.J. Cai</name>
</author>
<author>
<name sortKey="Luk, W K" uniqKey="Luk W">W.K. Luk</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L. Van der Hoek</name>
</author>
<author>
<name sortKey="Pyrc, K" uniqKey="Pyrc K">K. Pyrc</name>
</author>
<author>
<name sortKey="Jebbink, M F" uniqKey="Jebbink M">M.F. Jebbink</name>
</author>
<author>
<name sortKey="Vermeulen Oost, W" uniqKey="Vermeulen Oost W">W. Vermeulen-Oost</name>
</author>
<author>
<name sortKey="Berkhout, R J" uniqKey="Berkhout R">R.J. Berkhout</name>
</author>
<author>
<name sortKey="Wolthers, K C" uniqKey="Wolthers K">K.C. Wolthers</name>
</author>
<author>
<name sortKey="Wertheim Van Dillen, P M" uniqKey="Wertheim Van Dillen P">P.M. Wertheim-van Dillen</name>
</author>
<author>
<name sortKey="Kaandorp, J" uniqKey="Kaandorp J">J. Kaandorp</name>
</author>
<author>
<name sortKey="Spaargaren, J" uniqKey="Spaargaren J">J. Spaargaren</name>
</author>
<author>
<name sortKey="Berkhout, B" uniqKey="Berkhout B">B. Berkhout</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Drosten, C" uniqKey="Drosten C">C. Drosten</name>
</author>
<author>
<name sortKey="Gunther, S" uniqKey="Gunther S">S. Gunther</name>
</author>
<author>
<name sortKey="Preiser, W" uniqKey="Preiser W">W. Preiser</name>
</author>
<author>
<name sortKey="Van Der Werf, S" uniqKey="Van Der Werf S">S. van der Werf</name>
</author>
<author>
<name sortKey="Brodt, H R" uniqKey="Brodt H">H.R. Brodt</name>
</author>
<author>
<name sortKey="Becker, S" uniqKey="Becker S">S. Becker</name>
</author>
<author>
<name sortKey="Rabenau, H" uniqKey="Rabenau H">H. Rabenau</name>
</author>
<author>
<name sortKey="Panning, M" uniqKey="Panning M">M. Panning</name>
</author>
<author>
<name sortKey="Kolesnikova, L" uniqKey="Kolesnikova L">L. Kolesnikova</name>
</author>
<author>
<name sortKey="Fouchier, R A" uniqKey="Fouchier R">R.A. Fouchier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ksiazek, T G" uniqKey="Ksiazek T">T.G. Ksiazek</name>
</author>
<author>
<name sortKey="Erdman, D" uniqKey="Erdman D">D. Erdman</name>
</author>
<author>
<name sortKey="Goldsmith, C S" uniqKey="Goldsmith C">C.S. Goldsmith</name>
</author>
<author>
<name sortKey="Zaki, S R" uniqKey="Zaki S">S.R. Zaki</name>
</author>
<author>
<name sortKey="Peret, T" uniqKey="Peret T">T. Peret</name>
</author>
<author>
<name sortKey="Emery, S" uniqKey="Emery S">S. Emery</name>
</author>
<author>
<name sortKey="Tong, S" uniqKey="Tong S">S. Tong</name>
</author>
<author>
<name sortKey="Urbani, C" uniqKey="Urbani C">C. Urbani</name>
</author>
<author>
<name sortKey="Comer, J A" uniqKey="Comer J">J.A. Comer</name>
</author>
<author>
<name sortKey="Lim, W" uniqKey="Lim W">W. Lim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Raj, V S" uniqKey="Raj V">V.S. Raj</name>
</author>
<author>
<name sortKey="Osterhaus, A D" uniqKey="Osterhaus A">A.D. Osterhaus</name>
</author>
<author>
<name sortKey="Fouchier, R A" uniqKey="Fouchier R">R.A. Fouchier</name>
</author>
<author>
<name sortKey="Haagmans, B L" uniqKey="Haagmans B">B.L. Haagmans</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, Y W" uniqKey="Zhang Y">Y.W. Zhang</name>
</author>
<author>
<name sortKey="Yuan, L C" uniqKey="Yuan L">L.C. Yuan</name>
</author>
<author>
<name sortKey="Zhang, Y M" uniqKey="Zhang Y">Y.M. Zhang</name>
</author>
<author>
<name sortKey="Zhang, X P" uniqKey="Zhang X">X.P. Zhang</name>
</author>
<author>
<name sortKey="Zheng, M H" uniqKey="Zheng M">M.H. Zheng</name>
</author>
<author>
<name sortKey="Kyaw, M H" uniqKey="Kyaw M">M.H. Kyaw</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lepiller, Q" uniqKey="Lepiller Q">Q. Lepiller</name>
</author>
<author>
<name sortKey="Barth, H" uniqKey="Barth H">H. Barth</name>
</author>
<author>
<name sortKey="Lefebvre, F" uniqKey="Lefebvre F">F. Lefebvre</name>
</author>
<author>
<name sortKey="Herbrecht, R" uniqKey="Herbrecht R">R. Herbrecht</name>
</author>
<author>
<name sortKey="Lutz, P" uniqKey="Lutz P">P. Lutz</name>
</author>
<author>
<name sortKey="Kessler, R" uniqKey="Kessler R">R. Kessler</name>
</author>
<author>
<name sortKey="Fafi Kremer, S" uniqKey="Fafi Kremer S">S. Fafi-Kremer</name>
</author>
<author>
<name sortKey="Stoll Keller, F" uniqKey="Stoll Keller F">F. Stoll-Keller</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gaunt, E R" uniqKey="Gaunt E">E.R. Gaunt</name>
</author>
<author>
<name sortKey="Hardie, A" uniqKey="Hardie A">A. Hardie</name>
</author>
<author>
<name sortKey="Claas, E C J" uniqKey="Claas E">E.C.J. Claas</name>
</author>
<author>
<name sortKey="Simmonds, P" uniqKey="Simmonds P">P. Simmonds</name>
</author>
<author>
<name sortKey="Templeton, K E" uniqKey="Templeton K">K.E. Templeton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Matoba, Y" uniqKey="Matoba Y">Y. Matoba</name>
</author>
<author>
<name sortKey="Abiko, C" uniqKey="Abiko C">C. Abiko</name>
</author>
<author>
<name sortKey="Ikeda, T" uniqKey="Ikeda T">T. Ikeda</name>
</author>
<author>
<name sortKey="Aoki, Y" uniqKey="Aoki Y">Y. Aoki</name>
</author>
<author>
<name sortKey="Suzuki, Y" uniqKey="Suzuki Y">Y. Suzuki</name>
</author>
<author>
<name sortKey="Yahagi, K" uniqKey="Yahagi K">K. Yahagi</name>
</author>
<author>
<name sortKey="Matsuzaki, Y" uniqKey="Matsuzaki Y">Y. Matsuzaki</name>
</author>
<author>
<name sortKey="Itagaki, T" uniqKey="Itagaki T">T. Itagaki</name>
</author>
<author>
<name sortKey="Katsushima, F" uniqKey="Katsushima F">F. Katsushima</name>
</author>
<author>
<name sortKey="Katsushima, Y" uniqKey="Katsushima Y">Y. Katsushima</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wevers, B A" uniqKey="Wevers B">B.A. Wevers</name>
</author>
<author>
<name sortKey="Van Der Hoek, L" uniqKey="Van Der Hoek L">L. van der Hoek</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pene, F" uniqKey="Pene F">F. Pene</name>
</author>
<author>
<name sortKey="Merlat, A" uniqKey="Merlat A">A. Merlat</name>
</author>
<author>
<name sortKey="Vabret, A" uniqKey="Vabret A">A. Vabret</name>
</author>
<author>
<name sortKey="Rozenberg, F" uniqKey="Rozenberg F">F. Rozenberg</name>
</author>
<author>
<name sortKey="Buzyn, A" uniqKey="Buzyn A">A. Buzyn</name>
</author>
<author>
<name sortKey="Dreyfus, F" uniqKey="Dreyfus F">F. Dreyfus</name>
</author>
<author>
<name sortKey="Cariou, A" uniqKey="Cariou A">A. Cariou</name>
</author>
<author>
<name sortKey="Freymuth, F" uniqKey="Freymuth F">F. Freymuth</name>
</author>
<author>
<name sortKey="Lebon, P" uniqKey="Lebon P">P. Lebon</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Oosterhof, L" uniqKey="Oosterhof L">L. Oosterhof</name>
</author>
<author>
<name sortKey="Christensen, C B" uniqKey="Christensen C">C.B. Christensen</name>
</author>
<author>
<name sortKey="Sengelov, H" uniqKey="Sengelov H">H. Sengelov</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Geller, C" uniqKey="Geller C">C. Geller</name>
</author>
<author>
<name sortKey="Varbanov, M" uniqKey="Varbanov M">M. Varbanov</name>
</author>
<author>
<name sortKey="Duval, R E" uniqKey="Duval R">R.E. Duval</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lehmann, C" uniqKey="Lehmann C">C. Lehmann</name>
</author>
<author>
<name sortKey="Wolf, H" uniqKey="Wolf H">H. Wolf</name>
</author>
<author>
<name sortKey="Xu, J" uniqKey="Xu J">J. Xu</name>
</author>
<author>
<name sortKey="Zhao, Q" uniqKey="Zhao Q">Q. Zhao</name>
</author>
<author>
<name sortKey="Shao, Y" uniqKey="Shao Y">Y. Shao</name>
</author>
<author>
<name sortKey="Motz, M" uniqKey="Motz M">M. Motz</name>
</author>
<author>
<name sortKey="Lindner, P" uniqKey="Lindner P">P. Lindner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mcintosh, K" uniqKey="Mcintosh K">K. McIntosh</name>
</author>
<author>
<name sortKey="Mcquillin, J" uniqKey="Mcquillin J">J. McQuillin</name>
</author>
<author>
<name sortKey="Reed, S E" uniqKey="Reed S">S.E. Reed</name>
</author>
<author>
<name sortKey="Gardner, P S" uniqKey="Gardner P">P.S. Gardner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Meyer, B" uniqKey="Meyer B">B. Meyer</name>
</author>
<author>
<name sortKey="Drosten, C" uniqKey="Drosten C">C. Drosten</name>
</author>
<author>
<name sortKey="Muller, M A" uniqKey="Muller M">M.A. Muller</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rovida, F" uniqKey="Rovida F">F. Rovida</name>
</author>
<author>
<name sortKey="Percivalle, E" uniqKey="Percivalle E">E. Percivalle</name>
</author>
<author>
<name sortKey="Zavattoni, M" uniqKey="Zavattoni M">M. Zavattoni</name>
</author>
<author>
<name sortKey="Torsellini, M" uniqKey="Torsellini M">M. Torsellini</name>
</author>
<author>
<name sortKey="Sarasini, A" uniqKey="Sarasini A">A. Sarasini</name>
</author>
<author>
<name sortKey="Campanini, G" uniqKey="Campanini G">G. Campanini</name>
</author>
<author>
<name sortKey="Paolucci, S" uniqKey="Paolucci S">S. Paolucci</name>
</author>
<author>
<name sortKey="Baldanti, F" uniqKey="Baldanti F">F. Baldanti</name>
</author>
<author>
<name sortKey="Revello, M G" uniqKey="Revello M">M.G. Revello</name>
</author>
<author>
<name sortKey="Gerna, G" uniqKey="Gerna G">G. Gerna</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author>
<name sortKey="Chan, J F" uniqKey="Chan J">J.F. Chan</name>
</author>
<author>
<name sortKey="Tse, H" uniqKey="Tse H">H. Tse</name>
</author>
<author>
<name sortKey="Chen, H" uniqKey="Chen H">H. Chen</name>
</author>
<author>
<name sortKey="Lau, C C" uniqKey="Lau C">C.C. Lau</name>
</author>
<author>
<name sortKey="Cai, J P" uniqKey="Cai J">J.P. Cai</name>
</author>
<author>
<name sortKey="Tsang, A K" uniqKey="Tsang A">A.K. Tsang</name>
</author>
<author>
<name sortKey="Xiao, X" uniqKey="Xiao X">X. Xiao</name>
</author>
<author>
<name sortKey="To, K K" uniqKey="To K">K.K. To</name>
</author>
<author>
<name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chan, K H" uniqKey="Chan K">K.H. Chan</name>
</author>
<author>
<name sortKey="Cheng, V C" uniqKey="Cheng V">V.C. Cheng</name>
</author>
<author>
<name sortKey="Woo, P C" uniqKey="Woo P">P.C. Woo</name>
</author>
<author>
<name sortKey="Lau, S K" uniqKey="Lau S">S.K. Lau</name>
</author>
<author>
<name sortKey="Poon, L L" uniqKey="Poon L">L.L. Poon</name>
</author>
<author>
<name sortKey="Guan, Y" uniqKey="Guan Y">Y. Guan</name>
</author>
<author>
<name sortKey="Seto, W H" uniqKey="Seto W">W.H. Seto</name>
</author>
<author>
<name sortKey="Yuen, K Y" uniqKey="Yuen K">K.Y. Yuen</name>
</author>
<author>
<name sortKey="Peiris, J S" uniqKey="Peiris J">J.S. Peiris</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Elden, L J" uniqKey="Van Elden L">L.J. Van Elden</name>
</author>
<author>
<name sortKey="Van Kraaij, M G" uniqKey="Van Kraaij M">M.G. van Kraaij</name>
</author>
<author>
<name sortKey="Nijhuis, M" uniqKey="Nijhuis M">M. Nijhuis</name>
</author>
<author>
<name sortKey="Hendriksen, K A" uniqKey="Hendriksen K">K.A. Hendriksen</name>
</author>
<author>
<name sortKey="Dekker, A W" uniqKey="Dekker A">A.W. Dekker</name>
</author>
<author>
<name sortKey="Rozenberg Arska, M" uniqKey="Rozenberg Arska M">M. Rozenberg-Arska</name>
</author>
<author>
<name sortKey="Van Loon, A M" uniqKey="Van Loon A">A.M. van Loon</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W. Wang</name>
</author>
<author>
<name sortKey="Ren, P" uniqKey="Ren P">P. Ren</name>
</author>
<author>
<name sortKey="Sheng, J" uniqKey="Sheng J">J. Sheng</name>
</author>
<author>
<name sortKey="Mardy, S" uniqKey="Mardy S">S. Mardy</name>
</author>
<author>
<name sortKey="Yan, H" uniqKey="Yan H">H. Yan</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
<author>
<name sortKey="Hou, L" uniqKey="Hou L">L. Hou</name>
</author>
<author>
<name sortKey="Vabret, A" uniqKey="Vabret A">A. Vabret</name>
</author>
<author>
<name sortKey="Buchy, P" uniqKey="Buchy P">P. Buchy</name>
</author>
<author>
<name sortKey="Freymuth, F" uniqKey="Freymuth F">F. Freymuth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Choudhary, M L" uniqKey="Choudhary M">M.L. Choudhary</name>
</author>
<author>
<name sortKey="Anand, S P" uniqKey="Anand S">S.P. Anand</name>
</author>
<author>
<name sortKey="Heydari, M" uniqKey="Heydari M">M. Heydari</name>
</author>
<author>
<name sortKey="Rane, G" uniqKey="Rane G">G. Rane</name>
</author>
<author>
<name sortKey="Potdar, V A" uniqKey="Potdar V">V.A. Potdar</name>
</author>
<author>
<name sortKey="Chadha, M S" uniqKey="Chadha M">M.S. Chadha</name>
</author>
<author>
<name sortKey="Mishra, A C" uniqKey="Mishra A">A.C. Mishra</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Malhotra, B" uniqKey="Malhotra B">B. Malhotra</name>
</author>
<author>
<name sortKey="Swamy, M A" uniqKey="Swamy M">M.A. Swamy</name>
</author>
<author>
<name sortKey="Reddy, P V" uniqKey="Reddy P">P.V. Reddy</name>
</author>
<author>
<name sortKey="Kumar, N" uniqKey="Kumar N">N. Kumar</name>
</author>
<author>
<name sortKey="Tiwari, J K" uniqKey="Tiwari J">J.K. Tiwari</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cho, C H" uniqKey="Cho C">C.H. Cho</name>
</author>
<author>
<name sortKey="Lee, C K" uniqKey="Lee C">C.K. Lee</name>
</author>
<author>
<name sortKey="Nam, M H" uniqKey="Nam M">M.H. Nam</name>
</author>
<author>
<name sortKey="Yoon, S Y" uniqKey="Yoon S">S.Y. Yoon</name>
</author>
<author>
<name sortKey="Lim, C S" uniqKey="Lim C">C.S. Lim</name>
</author>
<author>
<name sortKey="Cho, Y" uniqKey="Cho Y">Y. Cho</name>
</author>
<author>
<name sortKey="Kim, Y K" uniqKey="Kim Y">Y.K. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jansen, R R" uniqKey="Jansen R">R.R. Jansen</name>
</author>
<author>
<name sortKey="Schinkel, J" uniqKey="Schinkel J">J. Schinkel</name>
</author>
<author>
<name sortKey="Koekkoek, S" uniqKey="Koekkoek S">S. Koekkoek</name>
</author>
<author>
<name sortKey="Pajkrt, D" uniqKey="Pajkrt D">D. Pajkrt</name>
</author>
<author>
<name sortKey="Beld, M" uniqKey="Beld M">M. Beld</name>
</author>
<author>
<name sortKey="De Jong, M D" uniqKey="De Jong M">M.D. de Jong</name>
</author>
<author>
<name sortKey="Molenkamp, R" uniqKey="Molenkamp R">R. Molenkamp</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jung, Y J" uniqKey="Jung Y">Y.J. Jung</name>
</author>
<author>
<name sortKey="Kwon, H J" uniqKey="Kwon H">H.J. Kwon</name>
</author>
<author>
<name sortKey="Huh, H J" uniqKey="Huh H">H.J. Huh</name>
</author>
<author>
<name sortKey="Ki, C S" uniqKey="Ki C">C.S. Ki</name>
</author>
<author>
<name sortKey="Lee, N Y" uniqKey="Lee N">N.Y. Lee</name>
</author>
<author>
<name sortKey="Kim, J W" uniqKey="Kim J">J.W. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jevsnik, M" uniqKey="Jevsnik M">M. Jevsnik</name>
</author>
<author>
<name sortKey="Steyer, A" uniqKey="Steyer A">A. Steyer</name>
</author>
<author>
<name sortKey="Zrim, T" uniqKey="Zrim T">T. Zrim</name>
</author>
<author>
<name sortKey="Pokorn, M" uniqKey="Pokorn M">M. Pokorn</name>
</author>
<author>
<name sortKey="Mrvic, T" uniqKey="Mrvic T">T. Mrvic</name>
</author>
<author>
<name sortKey="Grosek, S" uniqKey="Grosek S">S. Grosek</name>
</author>
<author>
<name sortKey="Strle, F" uniqKey="Strle F">F. Strle</name>
</author>
<author>
<name sortKey="Lusa, L" uniqKey="Lusa L">L. Lusa</name>
</author>
<author>
<name sortKey="Petrovec, M" uniqKey="Petrovec M">M. Petrovec</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Elden, L J" uniqKey="Van Elden L">L.J. Van Elden</name>
</author>
<author>
<name sortKey="Van Loon, A M" uniqKey="Van Loon A">A.M. van Loon</name>
</author>
<author>
<name sortKey="Van Alphen, F" uniqKey="Van Alphen F">F. van Alphen</name>
</author>
<author>
<name sortKey="Hendriksen, K A" uniqKey="Hendriksen K">K.A. Hendriksen</name>
</author>
<author>
<name sortKey="Hoepelman, A I" uniqKey="Hoepelman A">A.I. Hoepelman</name>
</author>
<author>
<name sortKey="Van Kraaij, M G" uniqKey="Van Kraaij M">M.G. van Kraaij</name>
</author>
<author>
<name sortKey="Oosterheert, J J" uniqKey="Oosterheert J">J.J. Oosterheert</name>
</author>
<author>
<name sortKey="Schipper, P" uniqKey="Schipper P">P. Schipper</name>
</author>
<author>
<name sortKey="Schuurman, R" uniqKey="Schuurman R">R. Schuurman</name>
</author>
<author>
<name sortKey="Nijhuis, M" uniqKey="Nijhuis M">M. Nijhuis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Souza, T B" uniqKey="Souza T">T.B. Souza</name>
</author>
<author>
<name sortKey="Lozer, D M" uniqKey="Lozer D">D.M. Lozer</name>
</author>
<author>
<name sortKey="Kitagawa, S M" uniqKey="Kitagawa S">S.M. Kitagawa</name>
</author>
<author>
<name sortKey="Spano, L C" uniqKey="Spano L">L.C. Spano</name>
</author>
<author>
<name sortKey="Silva, N P" uniqKey="Silva N">N.P. Silva</name>
</author>
<author>
<name sortKey="Scaletsky, I C" uniqKey="Scaletsky I">I.C. Scaletsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, J U" uniqKey="Kim J">J.U. Kim</name>
</author>
<author>
<name sortKey="Cha, C H" uniqKey="Cha C">C.H. Cha</name>
</author>
<author>
<name sortKey="An, H K" uniqKey="An H">H.K. An</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C. Zhang</name>
</author>
<author>
<name sortKey="Niu, P" uniqKey="Niu P">P. Niu</name>
</author>
<author>
<name sortKey="Hong, Y" uniqKey="Hong Y">Y. Hong</name>
</author>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J. Wang</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
<author>
<name sortKey="Ma, X" uniqKey="Ma X">X. Ma</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Monis, P T" uniqKey="Monis P">P.T. Monis</name>
</author>
<author>
<name sortKey="Giglio, S" uniqKey="Giglio S">S. Giglio</name>
</author>
<author>
<name sortKey="Saint, C P" uniqKey="Saint C">C.P. Saint</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J. Liu</name>
</author>
<author>
<name sortKey="Mu, Y" uniqKey="Mu Y">Y. Mu</name>
</author>
<author>
<name sortKey="Dong, W" uniqKey="Dong W">W. Dong</name>
</author>
<author>
<name sortKey="Yao, F" uniqKey="Yao F">F. Yao</name>
</author>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L. Wang</name>
</author>
<author>
<name sortKey="Yan, H" uniqKey="Yan H">H. Yan</name>
</author>
<author>
<name sortKey="Lan, K" uniqKey="Lan K">K. Lan</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dong, W" uniqKey="Dong W">W. Dong</name>
</author>
<author>
<name sortKey="Chen, Q" uniqKey="Chen Q">Q. Chen</name>
</author>
<author>
<name sortKey="Hu, Y" uniqKey="Hu Y">Y. Hu</name>
</author>
<author>
<name sortKey="He, D" uniqKey="He D">D. He</name>
</author>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J. Liu</name>
</author>
<author>
<name sortKey="Yan, H" uniqKey="Yan H">H. Yan</name>
</author>
<author>
<name sortKey="Lan, K" uniqKey="Lan K">K. Lan</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kibbe, W A" uniqKey="Kibbe W">W.A. Kibbe</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Int J Mol Sci</journal-id>
<journal-id journal-id-type="iso-abbrev">Int J Mol Sci</journal-id>
<journal-id journal-id-type="publisher-id">ijms</journal-id>
<journal-title-group>
<journal-title>International Journal of Molecular Sciences</journal-title>
</journal-title-group>
<issn pub-type="epub">1422-0067</issn>
<publisher>
<publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">27886052</article-id>
<article-id pub-id-type="pmc">5133880</article-id>
<article-id pub-id-type="doi">10.3390/ijms17111880</article-id>
<article-id pub-id-type="publisher-id">ijms-17-01880</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>A Melting Curve-Based Multiplex RT-qPCR Assay for Simultaneous Detection of Four Human Coronaviruses</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wan</surname>
<given-names>Zhenzhou</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-01880">1</xref>
<xref ref-type="aff" rid="af2-ijms-17-01880">2</xref>
<xref ref-type="author-notes" rid="fn1-ijms-17-01880"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Ya’nan</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-01880">1</xref>
<xref ref-type="author-notes" rid="fn1-ijms-17-01880"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>He</surname>
<given-names>Zhixiang</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-01880">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Jia</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-01880">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lan</surname>
<given-names>Ke</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-01880">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hu</surname>
<given-names>Yihong</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-01880">1</xref>
<xref rid="c1-ijms-17-01880" ref-type="corresp">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Chiyu</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-17-01880">1</xref>
<xref rid="c1-ijms-17-01880" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<contrib-group>
<contrib contrib-type="editor">
<name>
<surname>Bustin</surname>
<given-names>Stephen A.</given-names>
</name>
<role>Academic Editor</role>
</contrib>
</contrib-group>
<aff id="af1-ijms-17-01880">
<label>1</label>
Pathogen Diagnostic Center, CAS Key Laboratory of Molecular Virology & Immunology, Institute Pasteur of Shanghai, Chinese Academy of Sciences, Shanghai 200025, China;
<email>wanlv@126.com</email>
(Z.W.);
<email>13901433616@139.com</email>
(Y.Z.);
<email>kevin2003xzyz@163.com</email>
(Z.H.);
<email>liujia02@sibs.ac.cn</email>
(J.L.);
<email>lanke@sibs.ac.cn</email>
(K.L.)</aff>
<aff id="af2-ijms-17-01880">
<label>2</label>
Medical Laboratory of Taizhou Fourth People’s Hospital, Taizhou 225300, China</aff>
<author-notes>
<corresp id="c1-ijms-17-01880">
<label>*</label>
Correspondence:
<email>yhhu@ips.ac.cn</email>
(Y.H.);
<email>zhangcy1999@ips.ac.cn</email>
(C.Z.); Tel.: +86-21-5492-3052 (Y.H.); +86-21-5492-3051 (C.Z.)</corresp>
<fn id="fn1-ijms-17-01880">
<label></label>
<p>These authors contributed equally to this study.</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>23</day>
<month>11</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="collection">
<month>11</month>
<year>2016</year>
</pub-date>
<volume>17</volume>
<issue>11</issue>
<elocation-id>1880</elocation-id>
<history>
<date date-type="received">
<day>21</day>
<month>7</month>
<year>2016</year>
</date>
<date date-type="accepted">
<day>01</day>
<month>11</month>
<year>2016</year>
</date>
</history>
<permissions>
<copyright-statement>© 2016 by the authors; licensee MDPI, Basel, Switzerland.</copyright-statement>
<copyright-year>2016</copyright-year>
<license>
<license-p>
<pmc-comment>CREATIVE COMMONS</pmc-comment>
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<p>Human coronaviruses HCoV-OC43, HCoV-229E, HCoV-NL63 and HCoV-HKU1 are common respiratory viruses associated with acute respiratory infection. They have a global distribution. Rapid and accurate diagnosis of HCoV infection is important for the management and treatment of hospitalized patients with HCoV infection. Here, we developed a melting curve-based multiplex RT-qPCR assay for simultaneous detection of the four HCoVs. In the assay, SYTO 9 was used to replace SYBR Green I as the fluorescent dye, and GC-modified primers were designed to improve the melting temperature (Tm) of the specific amplicon. The four HCoVs were clearly distinguished by characteristic melting peaks in melting curve analysis. The detection sensitivity of the assay was 3 × 10
<sup>2</sup>
copies for HCoV-OC43, and 3 × 10
<sup>1</sup>
copies for HCoV-NL63, HCoV-229E and HCoV-HKU1 per 30 μL reaction. Clinical evaluation and sequencing confirmation demonstrated that the assay was specific and reliable. The assay represents a sensitive and reliable method for diagnosis of HCoV infection in clinical samples.</p>
</abstract>
<kwd-group>
<kwd>human coronaviruses</kwd>
<kwd>melting curve</kwd>
<kwd>multiplex quantitative RT-PCR (RT-qPCR)</kwd>
<kwd>SYTO 9</kwd>
<kwd>melting temperature (Tm)</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="ijms-17-01880-f001" position="float">
<label>Figure 1</label>
<caption>
<p>Melting curves of four HCoVs using the multiplex RT-qPCR assay. (
<bold>A</bold>
) The melting curves generated using first set of primers of each HCoV; (
<bold>B</bold>
) Improvement of Tm value of OC43 amplicon using GC-modified HCoV-OC43 primers; (
<bold>C</bold>
) The melting curves generated using the optimized primer sets with GC-modified HCoV-OC43 primers for four HCoVs.</p>
</caption>
<graphic xlink:href="ijms-17-01880-g001"></graphic>
</fig>
<fig id="ijms-17-01880-f002" position="float">
<label>Figure 2</label>
<caption>
<p>Specificity of the multiplex RT-qPCR assay. (
<bold>A</bold>
) Amplification curves of 13 common respiratory viruses; (
<bold>B</bold>
) Melting curves of 13 common respiratory viruses. NTC, non-template control.</p>
</caption>
<graphic xlink:href="ijms-17-01880-g002"></graphic>
</fig>
<fig id="ijms-17-01880-f003" position="float">
<label>Figure 3</label>
<caption>
<p>Sensitivity of the multiplex RT-qPCR assay using serially diluted RNA stocks. PDs, primer dimers; NTC, non-template control.</p>
</caption>
<graphic xlink:href="ijms-17-01880-g003"></graphic>
</fig>
<table-wrap id="ijms-17-01880-t001" position="float">
<object-id pub-id-type="pii">ijms-17-01880-t001_Table 1</object-id>
<label>Table 1</label>
<caption>
<p>Primer information for the detection of four HCoVs based on melting curve analysis.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Coronavirus</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Primer Set</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Primer Name</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Sequence (5′-3′)</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Amplicon Size (bps)</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Theoretical Tm (°C)</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Actual Tm (°C)</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="6" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">HCoV-229E</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<underline>set1</underline>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">229E-F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TGAAGATGCTTGTACTGTGGCT</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">513</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">84.16</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">83.39</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">229E-R</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CTGTCATGTTGCTCATGGGG</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">set2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">229E-F2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGATGCTTGTACTGTGGCTTCT</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">506</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">84.15</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">83.48</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">229E-R2</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CATGTTGCTCATGGGGGAGC</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">set3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">229E-F3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TGCTTGTACTGTGGCTTCTTTG</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">505</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">84.11</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">83.52</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">229E-R3</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">GTCATGTTGCTCATGGGGGAG</td>
</tr>
<tr>
<td rowspan="6" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">HCoV-OC43</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<underline>set1</underline>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">OC43-F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ATGTCAATACCCCGGCTGAC</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">191</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">84.97</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">83.96</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">OC43-R</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">GGCTCTACTACGCGATCCTG</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">set2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">OC43-F2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CTATCTGGGAACAGGACCGC</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">122</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">82.46</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">83.24</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">OC43-R2</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">TTGGGTCCCGATCGACAATG</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">set3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">OC43-F3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ATTGTCGATCGGGACCCAAG</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">132</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">82.58</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">82.32</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">OC43-R3</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">TGTGCGCGAAGTAGATCTGG</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">HCoV-NL63</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<underline>set1</underline>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">NL63-F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GATAACCAGTCGAAGTCACCTAGTTC</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">255</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">81.84</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">81.10</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">NL63-R</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">ATTAGGAATCAATTCAGCAAGCTGTG</td>
</tr>
<tr>
<td rowspan="6" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">HCoV-HKU1</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<underline>set1</underline>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">HKU1-F</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGGCTCAGGAAGGTCTGCTT</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">261</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">81.44</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">80.00</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">HKU1-R</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">TTAGGAGTTCGCTTTTGGCGA</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">set2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">HKU1-F2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGAGGCAGAAAAACCCAACCTA</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">374</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">83.04</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">83.05</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">HKU1-R2</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">TCCCTTGACGAAACATCGGA</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">set3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">HKU1-F3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGGCAGAAAAACCCAACCTAA</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">371</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">83.00</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">82.75</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">HKU1-R3</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CCCTTGACGAAACATCGGAG</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>HCoVs: The human coronaviruses; Tm: melting temperature. Underlines indicate the primer sets that were selected in the detection group.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>République populaire de Chine</li>
</country>
</list>
<tree>
<noCountry>
<name sortKey="He, Zhixiang" sort="He, Zhixiang" uniqKey="He Z" first="Zhixiang" last="He">Zhixiang He</name>
<name sortKey="Hu, Yihong" sort="Hu, Yihong" uniqKey="Hu Y" first="Yihong" last="Hu">Yihong Hu</name>
<name sortKey="Lan, Ke" sort="Lan, Ke" uniqKey="Lan K" first="Ke" last="Lan">Ke Lan</name>
<name sortKey="Liu, Jia" sort="Liu, Jia" uniqKey="Liu J" first="Jia" last="Liu">Jia Liu</name>
<name sortKey="Zhang, Chiyu" sort="Zhang, Chiyu" uniqKey="Zhang C" first="Chiyu" last="Zhang">Chiyu Zhang</name>
<name sortKey="Zhang, Ya An" sort="Zhang, Ya An" uniqKey="Zhang Y" first="Ya An" last="Zhang">Ya An Zhang</name>
</noCountry>
<country name="République populaire de Chine">
<noRegion>
<name sortKey="Wan, Zhenzhou" sort="Wan, Zhenzhou" uniqKey="Wan Z" first="Zhenzhou" last="Wan">Zhenzhou Wan</name>
</noRegion>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Sante/explor/CovidV1/Data/Ncbi/Merge
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000591 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd -nk 000591 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Sante
   |area=    CovidV1
   |flux=    Ncbi
   |étape=   Merge
   |type=    RBID
   |clé=     PMC:5133880
   |texte=   A Melting Curve-Based Multiplex RT-qPCR Assay for Simultaneous Detection of Four Human Coronaviruses
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/RBID.i   -Sk "pubmed:27886052" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd   \
       | NlmPubMed2Wicri -a CovidV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Fri Mar 27 18:14:15 2020. Site generation: Sun Jan 31 15:15:08 2021