Restoration of Autophagic Flux Rescues Oxidative Damage and Mitochondrial Dysfunction to Protect against Intervertebral Disc Degeneration
Identifieur interne : 000766 ( Pmc/Curation ); précédent : 000765; suivant : 000767Restoration of Autophagic Flux Rescues Oxidative Damage and Mitochondrial Dysfunction to Protect against Intervertebral Disc Degeneration
Auteurs : Liang Kang [République populaire de Chine] ; Qian Xiang [République populaire de Chine] ; Shengfeng Zhan [République populaire de Chine] ; Yu Song [République populaire de Chine] ; Kun Wang [République populaire de Chine] ; Kangcheng Zhao [République populaire de Chine] ; Shuai Li [République populaire de Chine] ; Zengwu Shao [République populaire de Chine] ; Cao Yang [République populaire de Chine] ; Yukun Zhang [République populaire de Chine]Source :
- Oxidative Medicine and Cellular Longevity [ 1942-0900 ] ; 2019.
Abstract
Oxidative stress-induced mitochondrial dysfunction and nucleus pulposus (NP) cell apoptosis play crucial roles in the development of intervertebral disc degeneration (IDD). Increasing studies have shown that interventions targeting impaired autophagic flux can maintain cellular homeostasis by relieving oxidative damage. Here, we investigated the effect of curcumin (CUR), a known autophagy activator, on IDD
Url:
DOI: 10.1155/2019/7810320
PubMed: 31976028
PubMed Central: 6954474
Links toward previous steps (curation, corpus...)
- to stream Pmc, to step Corpus: Pour aller vers cette notice dans l'étape Curation :000766
Links to Exploration step
PMC:6954474Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">Restoration of Autophagic Flux Rescues Oxidative Damage and Mitochondrial Dysfunction to Protect against Intervertebral Disc Degeneration</title>
<author><name sortKey="Kang, Liang" sort="Kang, Liang" uniqKey="Kang L" first="Liang" last="Kang">Liang Kang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Xiang, Qian" sort="Xiang, Qian" uniqKey="Xiang Q" first="Qian" last="Xiang">Qian Xiang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Zhan, Shengfeng" sort="Zhan, Shengfeng" uniqKey="Zhan S" first="Shengfeng" last="Zhan">Shengfeng Zhan</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Song, Yu" sort="Song, Yu" uniqKey="Song Y" first="Yu" last="Song">Yu Song</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Wang, Kun" sort="Wang, Kun" uniqKey="Wang K" first="Kun" last="Wang">Kun Wang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Zhao, Kangcheng" sort="Zhao, Kangcheng" uniqKey="Zhao K" first="Kangcheng" last="Zhao">Kangcheng Zhao</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Li, Shuai" sort="Li, Shuai" uniqKey="Li S" first="Shuai" last="Li">Shuai Li</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Shao, Zengwu" sort="Shao, Zengwu" uniqKey="Shao Z" first="Zengwu" last="Shao">Zengwu Shao</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Yang, Cao" sort="Yang, Cao" uniqKey="Yang C" first="Cao" last="Yang">Cao Yang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Zhang, Yukun" sort="Zhang, Yukun" uniqKey="Zhang Y" first="Yukun" last="Zhang">Yukun Zhang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">31976028</idno>
<idno type="pmc">6954474</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6954474</idno>
<idno type="RBID">PMC:6954474</idno>
<idno type="doi">10.1155/2019/7810320</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">000766</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000766</idno>
<idno type="wicri:Area/Pmc/Curation">000766</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000766</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">Restoration of Autophagic Flux Rescues Oxidative Damage and Mitochondrial Dysfunction to Protect against Intervertebral Disc Degeneration</title>
<author><name sortKey="Kang, Liang" sort="Kang, Liang" uniqKey="Kang L" first="Liang" last="Kang">Liang Kang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Xiang, Qian" sort="Xiang, Qian" uniqKey="Xiang Q" first="Qian" last="Xiang">Qian Xiang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Zhan, Shengfeng" sort="Zhan, Shengfeng" uniqKey="Zhan S" first="Shengfeng" last="Zhan">Shengfeng Zhan</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Song, Yu" sort="Song, Yu" uniqKey="Song Y" first="Yu" last="Song">Yu Song</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Wang, Kun" sort="Wang, Kun" uniqKey="Wang K" first="Kun" last="Wang">Kun Wang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Zhao, Kangcheng" sort="Zhao, Kangcheng" uniqKey="Zhao K" first="Kangcheng" last="Zhao">Kangcheng Zhao</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Li, Shuai" sort="Li, Shuai" uniqKey="Li S" first="Shuai" last="Li">Shuai Li</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Shao, Zengwu" sort="Shao, Zengwu" uniqKey="Shao Z" first="Zengwu" last="Shao">Zengwu Shao</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Yang, Cao" sort="Yang, Cao" uniqKey="Yang C" first="Cao" last="Yang">Cao Yang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Zhang, Yukun" sort="Zhang, Yukun" uniqKey="Zhang Y" first="Yukun" last="Zhang">Yukun Zhang</name>
<affiliation wicri:level="1"><nlm:aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022</wicri:regionArea>
</affiliation>
</author>
</analytic>
<series><title level="j">Oxidative Medicine and Cellular Longevity</title>
<idno type="ISSN">1942-0900</idno>
<idno type="eISSN">1942-0994</idno>
<imprint><date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>Oxidative stress-induced mitochondrial dysfunction and nucleus pulposus (NP) cell apoptosis play crucial roles in the development of intervertebral disc degeneration (IDD). Increasing studies have shown that interventions targeting impaired autophagic flux can maintain cellular homeostasis by relieving oxidative damage. Here, we investigated the effect of curcumin (CUR), a known autophagy activator, on IDD <italic>in vitro</italic>
and <italic>in vivo</italic>
. CUR suppressed <italic>tert</italic>
-butyl hydroperoxide- (TBHP-) induced oxidative stress and mitochondrial dysfunction and thereby inhibited human NP cell apoptosis, senescence, and ECM degradation. CUR treatment induced autophagy and enhanced autophagic flux in an AMPK/mTOR/ULK1-dependent manner. Notably, CUR alleviated TBHP-induced interruption of autophagosome-lysosome fusion and impairment of lysosomal function and thus contributed to the restoration of blocked autophagic clearance. These protective effects of CUR in TBHP-stimulated human NP cells resembled the effects produced by the autophagy inducer rapamycin, but the effects were partially eliminated by 3-methyladenine- and compound C-mediated inhibition of autophagy initiation or chloroquine-mediated obstruction of autophagic flux. Lastly, CUR also exerted a protective effect against puncture-induced IDD progression <italic>in vivo</italic>
. Our results showed that suppression of excessive ROS production and mitochondrial dysfunction through enhancement of autophagy coupled with restoration of autophagic flux ameliorated TBHP-induced human NP cell apoptosis, senescence, and ECM degradation. Thus, maintenance of the proper functioning of autophagy represents a promising therapeutic strategy for IDD, and CUR might serve as an effective therapeutic agent for IDD.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Vos, T" uniqKey="Vos T">T. Vos</name>
</author>
<author><name sortKey="Abajobir, A A" uniqKey="Abajobir A">A. A. Abajobir</name>
</author>
<author><name sortKey="Abate, K H" uniqKey="Abate K">K. H. Abate</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kadow, T" uniqKey="Kadow T">T. Kadow</name>
</author>
<author><name sortKey="Sowa, G" uniqKey="Sowa G">G. Sowa</name>
</author>
<author><name sortKey="Vo, N" uniqKey="Vo N">N. Vo</name>
</author>
<author><name sortKey="Kang, J D" uniqKey="Kang J">J. D. Kang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Froud, R" uniqKey="Froud R">R. Froud</name>
</author>
<author><name sortKey="Patterson, S" uniqKey="Patterson S">S. Patterson</name>
</author>
<author><name sortKey="Eldridge, S" uniqKey="Eldridge S">S. Eldridge</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ashley, J W" uniqKey="Ashley J">J. W. Ashley</name>
</author>
<author><name sortKey="Enomoto Iwamoto, M" uniqKey="Enomoto Iwamoto M">M. Enomoto-Iwamoto</name>
</author>
<author><name sortKey="Smith, L J" uniqKey="Smith L">L. J. Smith</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kepler, C K" uniqKey="Kepler C">C. K. Kepler</name>
</author>
<author><name sortKey="Ponnappan, R K" uniqKey="Ponnappan R">R. K. Ponnappan</name>
</author>
<author><name sortKey="Tannoury, C A" uniqKey="Tannoury C">C. A. Tannoury</name>
</author>
<author><name sortKey="Risbud, M V" uniqKey="Risbud M">M. V. Risbud</name>
</author>
<author><name sortKey="Anderson, D G" uniqKey="Anderson D">D. G. Anderson</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Feng, C" uniqKey="Feng C">C. Feng</name>
</author>
<author><name sortKey="Yang, M" uniqKey="Yang M">M. Yang</name>
</author>
<author><name sortKey="Lan, M" uniqKey="Lan M">M. Lan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Feng, C" uniqKey="Feng C">C. Feng</name>
</author>
<author><name sortKey="Zhang, Y" uniqKey="Zhang Y">Y. Zhang</name>
</author>
<author><name sortKey="Yang, M" uniqKey="Yang M">M. Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chen, K" uniqKey="Chen K">K. Chen</name>
</author>
<author><name sortKey="Lv, X" uniqKey="Lv X">X. Lv</name>
</author>
<author><name sortKey="Li, W" uniqKey="Li W">W. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tang, P" uniqKey="Tang P">P. Tang</name>
</author>
<author><name sortKey="Gu, J M" uniqKey="Gu J">J.-M. Gu</name>
</author>
<author><name sortKey="Xie, Z A" uniqKey="Xie Z">Z.-A. Xie</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zheng, K" uniqKey="Zheng K">K. Zheng</name>
</author>
<author><name sortKey="He, Z" uniqKey="He Z">Z. He</name>
</author>
<author><name sortKey="Kitazato, K" uniqKey="Kitazato K">K. Kitazato</name>
</author>
<author><name sortKey="Wang, Y" uniqKey="Wang Y">Y. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author><name sortKey="Wu, W K" uniqKey="Wu W">W. K. Wu</name>
</author>
<author><name sortKey="Xu, W" uniqKey="Xu W">W. Xu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Byun, S" uniqKey="Byun S">S. Byun</name>
</author>
<author><name sortKey="Lee, E" uniqKey="Lee E">E. Lee</name>
</author>
<author><name sortKey="Lee, K W" uniqKey="Lee K">K. W. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Goutas, A" uniqKey="Goutas A">A. Goutas</name>
</author>
<author><name sortKey="Syrrou, C" uniqKey="Syrrou C">C. Syrrou</name>
</author>
<author><name sortKey="Papathanasiou, I" uniqKey="Papathanasiou I">I. Papathanasiou</name>
</author>
<author><name sortKey="Tsezou, A" uniqKey="Tsezou A">A. Tsezou</name>
</author>
<author><name sortKey="Trachana, V" uniqKey="Trachana V">V. Trachana</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chen, D" uniqKey="Chen D">D. Chen</name>
</author>
<author><name sortKey="Xia, D" uniqKey="Xia D">D. Xia</name>
</author>
<author><name sortKey="Pan, Z" uniqKey="Pan Z">Z. Pan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chakraborty, D" uniqKey="Chakraborty D">D. Chakraborty</name>
</author>
<author><name sortKey="Felzen, V" uniqKey="Felzen V">V. Felzen</name>
</author>
<author><name sortKey="Hiebel, C" uniqKey="Hiebel C">C. Hiebel</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mitter, S K" uniqKey="Mitter S">S. K. Mitter</name>
</author>
<author><name sortKey="Song, C" uniqKey="Song C">C. Song</name>
</author>
<author><name sortKey="Qi, X" uniqKey="Qi X">X. Qi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xu, K" uniqKey="Xu K">K. Xu</name>
</author>
<author><name sortKey="Chen, W" uniqKey="Chen W">W. Chen</name>
</author>
<author><name sortKey="Wang, X" uniqKey="Wang X">X. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zheng, G" uniqKey="Zheng G">G. Zheng</name>
</author>
<author><name sortKey="Pan, Z" uniqKey="Pan Z">Z. Pan</name>
</author>
<author><name sortKey="Zhan, Y" uniqKey="Zhan Y">Y. Zhan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gupta, S C" uniqKey="Gupta S">S. C. Gupta</name>
</author>
<author><name sortKey="Patchva, S" uniqKey="Patchva S">S. Patchva</name>
</author>
<author><name sortKey="Koh, W" uniqKey="Koh W">W. Koh</name>
</author>
<author><name sortKey="Aggarwal, B B" uniqKey="Aggarwal B">B. B. Aggarwal</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhao, P" uniqKey="Zhao P">P. Zhao</name>
</author>
<author><name sortKey="Cheng, J" uniqKey="Cheng J">J. Cheng</name>
</author>
<author><name sortKey="Geng, J" uniqKey="Geng J">J. Geng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Villaflores, O B" uniqKey="Villaflores O">O. B. Villaflores</name>
</author>
<author><name sortKey="Chen, Y J" uniqKey="Chen Y">Y.-J. Chen</name>
</author>
<author><name sortKey="Chen, C P" uniqKey="Chen C">C.-P. Chen</name>
</author>
<author><name sortKey="Yeh, J M" uniqKey="Yeh J">J. M. Yeh</name>
</author>
<author><name sortKey="Wu, T Y" uniqKey="Wu T">T. Y. Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Monfoulet, L E" uniqKey="Monfoulet L">L.-E. Monfoulet</name>
</author>
<author><name sortKey="Mercier, S" uniqKey="Mercier S">S. Mercier</name>
</author>
<author><name sortKey="Bayle, D" uniqKey="Bayle D">D. Bayle</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, X" uniqKey="Li X">X. Li</name>
</author>
<author><name sortKey="Feng, K" uniqKey="Feng K">K. Feng</name>
</author>
<author><name sortKey="Li, J" uniqKey="Li J">J. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hashemzaei, M" uniqKey="Hashemzaei M">M. Hashemzaei</name>
</author>
<author><name sortKey="Entezari Heravi, R" uniqKey="Entezari Heravi R">R. Entezari Heravi</name>
</author>
<author><name sortKey="Rezaee, R" uniqKey="Rezaee R">R. Rezaee</name>
</author>
<author><name sortKey="Roohbakhsh, A" uniqKey="Roohbakhsh A">A. Roohbakhsh</name>
</author>
<author><name sortKey="Karimi, G" uniqKey="Karimi G">G. Karimi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Um, M Y" uniqKey="Um M">M. Y. Um</name>
</author>
<author><name sortKey="Hwang, K H" uniqKey="Hwang K">K. H. Hwang</name>
</author>
<author><name sortKey="Ahn, J" uniqKey="Ahn J">J. Ahn</name>
</author>
<author><name sortKey="Ha, T Y" uniqKey="Ha T">T. Y. Ha</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Slamenova, D" uniqKey="Slamenova D">D. Slamenova</name>
</author>
<author><name sortKey="Kozics, K" uniqKey="Kozics K">K. Kozics</name>
</author>
<author><name sortKey="Hunakova, L" uniqKey="Hunakova L">L. Hunakova</name>
</author>
<author><name sortKey="Melusova, M" uniqKey="Melusova M">M. Melusova</name>
</author>
<author><name sortKey="Navarova, J" uniqKey="Navarova J">J. Navarova</name>
</author>
<author><name sortKey="Horvathova, E" uniqKey="Horvathova E">E. Horvathova</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Song, Y" uniqKey="Song Y">Y. Song</name>
</author>
<author><name sortKey="Li, S" uniqKey="Li S">S. Li</name>
</author>
<author><name sortKey="Geng, W" uniqKey="Geng W">W. Geng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author><name sortKey="Kang, Y" uniqKey="Kang Y">Y. Kang</name>
</author>
<author><name sortKey="Huo, T" uniqKey="Huo T">T. Huo</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, M" uniqKey="Li M">M. Li</name>
</author>
<author><name sortKey="Pi, H" uniqKey="Pi H">H. Pi</name>
</author>
<author><name sortKey="Yang, Z" uniqKey="Yang Z">Z. Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chen, Y" uniqKey="Chen Y">Y. Chen</name>
</author>
<author><name sortKey="Zheng, Z" uniqKey="Zheng Z">Z. Zheng</name>
</author>
<author><name sortKey="Wang, J" uniqKey="Wang J">J. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pfirrmann, C W" uniqKey="Pfirrmann C">C. W. Pfirrmann</name>
</author>
<author><name sortKey="Metzdorf, A" uniqKey="Metzdorf A">A. Metzdorf</name>
</author>
<author><name sortKey="Zanetti, M" uniqKey="Zanetti M">M. Zanetti</name>
</author>
<author><name sortKey="Hodler, J" uniqKey="Hodler J">J. Hodler</name>
</author>
<author><name sortKey="Boos, N" uniqKey="Boos N">N. Boos</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mao, H J" uniqKey="Mao H">H. J. Mao</name>
</author>
<author><name sortKey="Chen, Q X" uniqKey="Chen Q">Q. X. Chen</name>
</author>
<author><name sortKey="Han, B" uniqKey="Han B">B. Han</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Walker, B F" uniqKey="Walker B">B. F. Walker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lazary, A" uniqKey="Lazary A">A. Lazary</name>
</author>
<author><name sortKey="Szoverfi, Z" uniqKey="Szoverfi Z">Z. Szoverfi</name>
</author>
<author><name sortKey="Szita, J" uniqKey="Szita J">J. Szita</name>
</author>
<author><name sortKey="Somhegyi, A" uniqKey="Somhegyi A">A. Somhegyi</name>
</author>
<author><name sortKey="Kumin, M" uniqKey="Kumin M">M. Kümin</name>
</author>
<author><name sortKey="Varga, P P" uniqKey="Varga P">P. P. Varga</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wilke, H J" uniqKey="Wilke H">H. J. Wilke</name>
</author>
<author><name sortKey="Urban, J" uniqKey="Urban J">J. Urban</name>
</author>
<author><name sortKey="Kumin, M" uniqKey="Kumin M">M. Kumin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Brinjikji, W" uniqKey="Brinjikji W">W. Brinjikji</name>
</author>
<author><name sortKey="Diehn, F E" uniqKey="Diehn F">F. E. Diehn</name>
</author>
<author><name sortKey="Jarvik, J G" uniqKey="Jarvik J">J. G. Jarvik</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hou, G" uniqKey="Hou G">G. Hou</name>
</author>
<author><name sortKey="Lu, H" uniqKey="Lu H">H. Lu</name>
</author>
<author><name sortKey="Chen, M" uniqKey="Chen M">M. Chen</name>
</author>
<author><name sortKey="Yao, H" uniqKey="Yao H">H. Yao</name>
</author>
<author><name sortKey="Zhao, H" uniqKey="Zhao H">H. Zhao</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yi, X" uniqKey="Yi X">X. Yi</name>
</author>
<author><name sortKey="Guo, W" uniqKey="Guo W">W. Guo</name>
</author>
<author><name sortKey="Shi, Q" uniqKey="Shi Q">Q. Shi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Dimozi, A" uniqKey="Dimozi A">A. Dimozi</name>
</author>
<author><name sortKey="Mavrogonatou, E" uniqKey="Mavrogonatou E">E. Mavrogonatou</name>
</author>
<author><name sortKey="Sklirou, A" uniqKey="Sklirou A">A. Sklirou</name>
</author>
<author><name sortKey="Kletsas, D" uniqKey="Kletsas D">D. Kletsas</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, F" uniqKey="Wang F">F. Wang</name>
</author>
<author><name sortKey="Cai, F" uniqKey="Cai F">F. Cai</name>
</author>
<author><name sortKey="Shi, R" uniqKey="Shi R">R. Shi</name>
</author>
<author><name sortKey="Wang, X H" uniqKey="Wang X">X. H. Wang</name>
</author>
<author><name sortKey="Wu, X T" uniqKey="Wu X">X. T. Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Eyre, D R" uniqKey="Eyre D">D. R. Eyre</name>
</author>
<author><name sortKey="Muir, H" uniqKey="Muir H">H. Muir</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Feng, H" uniqKey="Feng H">H. Feng</name>
</author>
<author><name sortKey="Danfelter, M" uniqKey="Danfelter M">M. Danfelter</name>
</author>
<author><name sortKey="Stromqvist, B" uniqKey="Stromqvist B">B. Strömqvist</name>
</author>
<author><name sortKey="Heineg Rd, D" uniqKey="Heineg Rd D">D. Heinegård</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mizushima, N" uniqKey="Mizushima N">N. Mizushima</name>
</author>
<author><name sortKey="Komatsu, M" uniqKey="Komatsu M">M. Komatsu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jiang, L" uniqKey="Jiang L">L. Jiang</name>
</author>
<author><name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author><name sortKey="Zheng, X" uniqKey="Zheng X">X. Zheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ye, W" uniqKey="Ye W">W. Ye</name>
</author>
<author><name sortKey="Zhu, W" uniqKey="Zhu W">W. Zhu</name>
</author>
<author><name sortKey="Xu, K" uniqKey="Xu K">K. Xu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jiang, W" uniqKey="Jiang W">W. Jiang</name>
</author>
<author><name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author><name sortKey="Hao, J" uniqKey="Hao J">J. Hao</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhang, S J" uniqKey="Zhang S">S.-J. Zhang</name>
</author>
<author><name sortKey="Yang, W" uniqKey="Yang W">W. Yang</name>
</author>
<author><name sortKey="Wang, C" uniqKey="Wang C">C. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chen, J" uniqKey="Chen J">J. Chen</name>
</author>
<author><name sortKey="Xie, J J" uniqKey="Xie J">J. J. Xie</name>
</author>
<author><name sortKey="Jin, M Y" uniqKey="Jin M">M. Y. Jin</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Miyazaki, S" uniqKey="Miyazaki S">S. Miyazaki</name>
</author>
<author><name sortKey="Kakutani, K" uniqKey="Kakutani K">K. Kakutani</name>
</author>
<author><name sortKey="Yurube, T" uniqKey="Yurube T">T. Yurube</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Trujillo, J" uniqKey="Trujillo J">J. Trujillo</name>
</author>
<author><name sortKey="Chirino, Y I" uniqKey="Chirino Y">Y. I. Chirino</name>
</author>
<author><name sortKey="Molina Jij N, E" uniqKey="Molina Jij N E">E. Molina-Jijón</name>
</author>
<author><name sortKey="Anderica Romero, A C" uniqKey="Anderica Romero A">A. C. Andérica-Romero</name>
</author>
<author><name sortKey="Tapia, E" uniqKey="Tapia E">E. Tapia</name>
</author>
<author><name sortKey="Pedraza Chaverri, J" uniqKey="Pedraza Chaverri J">J. Pedraza-Chaverrí</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zhang, N" uniqKey="Zhang N">N. Zhang</name>
</author>
<author><name sortKey="Yan, F" uniqKey="Yan F">F. Yan</name>
</author>
<author><name sortKey="Liang, X" uniqKey="Liang X">X. Liang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lin, S R" uniqKey="Lin S">S. R. Lin</name>
</author>
<author><name sortKey="Fu, Y S" uniqKey="Fu Y">Y. S. Fu</name>
</author>
<author><name sortKey="Tsai, M J" uniqKey="Tsai M">M. J. Tsai</name>
</author>
<author><name sortKey="Cheng, H" uniqKey="Cheng H">H. Cheng</name>
</author>
<author><name sortKey="Weng, C F" uniqKey="Weng C">C. F. Weng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Seo, S U" uniqKey="Seo S">S. U. Seo</name>
</author>
<author><name sortKey="Woo, S M" uniqKey="Woo S">S. M. Woo</name>
</author>
<author><name sortKey="Lee, H S" uniqKey="Lee H">H. S. Lee</name>
</author>
<author><name sortKey="Kim, S H" uniqKey="Kim S">S. H. Kim</name>
</author>
<author><name sortKey="Min, K J" uniqKey="Min K">K. J. Min</name>
</author>
<author><name sortKey="Kwon, T K" uniqKey="Kwon T">T. K. Kwon</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Huang, Z" uniqKey="Huang Z">Z. Huang</name>
</author>
<author><name sortKey="Ye, B" uniqKey="Ye B">B. Ye</name>
</author>
<author><name sortKey="Dai, Z" uniqKey="Dai Z">Z. Dai</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kim, J" uniqKey="Kim J">J. Kim</name>
</author>
<author><name sortKey="Kundu, M" uniqKey="Kundu M">M. Kundu</name>
</author>
<author><name sortKey="Viollet, B" uniqKey="Viollet B">B. Viollet</name>
</author>
<author><name sortKey="Guan, K L" uniqKey="Guan K">K. L. Guan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Egan, D" uniqKey="Egan D">D. Egan</name>
</author>
<author><name sortKey="Kim, J" uniqKey="Kim J">J. Kim</name>
</author>
<author><name sortKey="Shaw, R J" uniqKey="Shaw R">R. J. Shaw</name>
</author>
<author><name sortKey="Guan, K L" uniqKey="Guan K">K. L. Guan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jiang, S" uniqKey="Jiang S">S. Jiang</name>
</author>
<author><name sortKey="Li, T" uniqKey="Li T">T. Li</name>
</author>
<author><name sortKey="Ji, T" uniqKey="Ji T">T. Ji</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, C" uniqKey="Wang C">C. Wang</name>
</author>
<author><name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author><name sortKey="Teng, Z" uniqKey="Teng Z">Z. Teng</name>
</author>
<author><name sortKey="Zhang, T" uniqKey="Zhang T">T. Zhang</name>
</author>
<author><name sortKey="Li, Y" uniqKey="Li Y">Y. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xiao, K" uniqKey="Xiao K">K. Xiao</name>
</author>
<author><name sortKey="Jiang, J" uniqKey="Jiang J">J. Jiang</name>
</author>
<author><name sortKey="Guan, C" uniqKey="Guan C">C. Guan</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chi, C" uniqKey="Chi C">C. Chi</name>
</author>
<author><name sortKey="Leonard, A" uniqKey="Leonard A">A. Leonard</name>
</author>
<author><name sortKey="Knight, W E" uniqKey="Knight W">W. E. Knight</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ma, X" uniqKey="Ma X">X. Ma</name>
</author>
<author><name sortKey="Liu, H" uniqKey="Liu H">H. Liu</name>
</author>
<author><name sortKey="Foyil, S R" uniqKey="Foyil S">S. R. Foyil</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Poillet Perez, L" uniqKey="Poillet Perez L">L. Poillet-Perez</name>
</author>
<author><name sortKey="Despouy, G" uniqKey="Despouy G">G. Despouy</name>
</author>
<author><name sortKey="Delage Mourroux, R" uniqKey="Delage Mourroux R">R. Delage-Mourroux</name>
</author>
<author><name sortKey="Boyer Guittaut, M" uniqKey="Boyer Guittaut M">M. Boyer-Guittaut</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Abrahams, S" uniqKey="Abrahams S">S. Abrahams</name>
</author>
<author><name sortKey="Haylett, W L" uniqKey="Haylett W">W. L. Haylett</name>
</author>
<author><name sortKey="Johnson, G" uniqKey="Johnson G">G. Johnson</name>
</author>
<author><name sortKey="Carr, J A" uniqKey="Carr J">J. A. Carr</name>
</author>
<author><name sortKey="Bardien, S" uniqKey="Bardien S">S. Bardien</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">Oxid Med Cell Longev</journal-id>
<journal-id journal-id-type="iso-abbrev">Oxid Med Cell Longev</journal-id>
<journal-id journal-id-type="publisher-id">OMCL</journal-id>
<journal-title-group><journal-title>Oxidative Medicine and Cellular Longevity</journal-title>
</journal-title-group>
<issn pub-type="ppub">1942-0900</issn>
<issn pub-type="epub">1942-0994</issn>
<publisher><publisher-name>Hindawi</publisher-name>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">31976028</article-id>
<article-id pub-id-type="pmc">6954474</article-id>
<article-id pub-id-type="doi">10.1155/2019/7810320</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Research Article</subject>
</subj-group>
</article-categories>
<title-group><article-title>Restoration of Autophagic Flux Rescues Oxidative Damage and Mitochondrial Dysfunction to Protect against Intervertebral Disc Degeneration</article-title>
</title-group>
<contrib-group><contrib contrib-type="author"><name><surname>Kang</surname>
<given-names>Liang</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author"><contrib-id contrib-id-type="orcid" authenticated="false">https://orcid.org/0000-0003-3466-0536</contrib-id>
<name><surname>Xiang</surname>
<given-names>Qian</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Zhan</surname>
<given-names>Shengfeng</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Song</surname>
<given-names>Yu</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Wang</surname>
<given-names>Kun</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Zhao</surname>
<given-names>Kangcheng</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Li</surname>
<given-names>Shuai</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Shao</surname>
<given-names>Zengwu</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author"><name><surname>Yang</surname>
<given-names>Cao</given-names>
</name>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
<contrib contrib-type="author" corresp="yes"><contrib-id contrib-id-type="orcid" authenticated="false">https://orcid.org/0000-0003-4487-9988</contrib-id>
<name><surname>Zhang</surname>
<given-names>Yukun</given-names>
</name>
<email>zhangyukuncom@126.com</email>
<xref ref-type="aff" rid="I1"></xref>
</contrib>
</contrib-group>
<aff id="I1">Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China</aff>
<author-notes><fn fn-type="other"><p>Academic Editor: Nageswara Madamanchi</p>
</fn>
</author-notes>
<pub-date pub-type="collection"><year>2019</year>
</pub-date>
<pub-date pub-type="epub"><day>30</day>
<month>12</month>
<year>2019</year>
</pub-date>
<volume>2019</volume>
<elocation-id>7810320</elocation-id>
<history><date date-type="received"><day>13</day>
<month>6</month>
<year>2019</year>
</date>
<date date-type="rev-recd"><day>7</day>
<month>9</month>
<year>2019</year>
</date>
<date date-type="accepted"><day>26</day>
<month>11</month>
<year>2019</year>
</date>
</history>
<permissions><copyright-statement>Copyright © 2019 Liang Kang et al.</copyright-statement>
<copyright-year>2019</copyright-year>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
</license>
</permissions>
<abstract><p>Oxidative stress-induced mitochondrial dysfunction and nucleus pulposus (NP) cell apoptosis play crucial roles in the development of intervertebral disc degeneration (IDD). Increasing studies have shown that interventions targeting impaired autophagic flux can maintain cellular homeostasis by relieving oxidative damage. Here, we investigated the effect of curcumin (CUR), a known autophagy activator, on IDD <italic>in vitro</italic>
and <italic>in vivo</italic>
. CUR suppressed <italic>tert</italic>
-butyl hydroperoxide- (TBHP-) induced oxidative stress and mitochondrial dysfunction and thereby inhibited human NP cell apoptosis, senescence, and ECM degradation. CUR treatment induced autophagy and enhanced autophagic flux in an AMPK/mTOR/ULK1-dependent manner. Notably, CUR alleviated TBHP-induced interruption of autophagosome-lysosome fusion and impairment of lysosomal function and thus contributed to the restoration of blocked autophagic clearance. These protective effects of CUR in TBHP-stimulated human NP cells resembled the effects produced by the autophagy inducer rapamycin, but the effects were partially eliminated by 3-methyladenine- and compound C-mediated inhibition of autophagy initiation or chloroquine-mediated obstruction of autophagic flux. Lastly, CUR also exerted a protective effect against puncture-induced IDD progression <italic>in vivo</italic>
. Our results showed that suppression of excessive ROS production and mitochondrial dysfunction through enhancement of autophagy coupled with restoration of autophagic flux ameliorated TBHP-induced human NP cell apoptosis, senescence, and ECM degradation. Thus, maintenance of the proper functioning of autophagy represents a promising therapeutic strategy for IDD, and CUR might serve as an effective therapeutic agent for IDD.</p>
</abstract>
<funding-group><award-group><funding-source>Fundamental Research Funds for the Central Universities</funding-source>
<award-id>2017KFYXJJ248</award-id>
</award-group>
<award-group><funding-source>National Natural Science Foundation of China</funding-source>
<award-id>81772391</award-id>
</award-group>
</funding-group>
</article-meta>
</front>
<floats-group><fig id="fig1" orientation="portrait" position="float"><label>Figure 1</label>
<caption><p>CUR attenuates TBHP-induced death in human NP cells. (a) The chemical structure of CUR. (b, c) CCK-8 assay was used to determine the cytotoxic effects of CUR on human NP cells by treating the cells with various concentrations of CUR for durations of 24 h and 48 h. (d) The viability of the human NP cells treated with different concentrations of TBHP for 24 h was determined by the CCK-8 assay. (e) The results of the CCK-8 assay performed on CUR-pretreated human NP cells induced by TBHP. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01, <sup>∗</sup>
<italic>P</italic>
< 0.05, <italic>n</italic>
= 3.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.001"></graphic>
</fig>
<fig id="fig2" orientation="portrait" position="float"><label>Figure 2</label>
<caption><p>CUR treatment inhibits TBHP-induced apoptosis and senescence in human NP cells. (a, b) Annexin V-APC/7-AAD staining results showing the rate of apoptosis in human NP cells. (c–i) The protein levels of mitochondrial Cyt-c, cytoplasmic Cyt-c, Bax, Bcl-2, cleaved caspase-3, and cleaved caspase-9 in human NP cells were measured by western blotting. (j, k) Immunofluorescence staining of cleaved caspase-3 in human NP cells. Scale bar: 20 <italic>μ</italic>
m. (l–o) After the indicated treatment, cells were washed and then cultured under normal conditions for the indicated time. (l, m) After 24 h, the level of p16 protein in the human NP cells was measured by western blotting. (n, o) After 3 days, the SA-<italic>β</italic>
-gal staining assay was performed in the human NP cells. Scale bar: 100 <italic>μ</italic>
m. (p, q) Cell proliferation was detected by EdU staining under a fluorescence microscope, and the positive cells were quantitated. Scale bar: 50 <italic>μ</italic>
m. GAPDH was used as an internal control. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01, <sup>∗</sup>
<italic>P</italic>
< 0.05, <italic>n</italic>
= 3.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.002"></graphic>
</fig>
<fig id="fig3" orientation="portrait" position="float"><label>Figure 3</label>
<caption><p>CUR treatment alleviates TBHP-induced degradation of the ECM in the human NP cells. (a–f) The mRNA expression levels of type II collagen, aggrecan, MMP-3, MMP-13, ADAMTS-4, and ADAMTS-5 in the human NP cells were measured by qRT-PCR. (g–m) The protein levels of type II collagen, aggrecan, MMP-3, MMP-13, ADAMTS-4, and ADAMTS-5 in the human NP cells were measured by western blotting. (n–q) Immunofluorescence staining of type II collagen and MMP-13 in the human NP cells. Scale bar: 20 <italic>μ</italic>
m. GAPDH was used as an internal control. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01, <sup>∗</sup>
<italic>P</italic>
< 0.05, <italic>n</italic>
= 3.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.003"></graphic>
</fig>
<fig id="fig4" orientation="portrait" position="float"><label>Figure 4</label>
<caption><p>CUR treatment alleviates TBHP-mediated oxidative stress and mitochondrial dysfunction in the human NP cells. (a, b) The ROS levels in the human NP cells were detected using the fluorescent probe DHE and measured by flow cytometry. (c, d) Intracellular MDA levels and SOD activity in the human NP cells. (e, f) Mitochondrial membrane potential was detected by JC-1 staining and measured by flow cytometry. (g) An assessment of mPTP opening in the human NP cells. (h) Intracellular ATP levels in the human NP cells. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01, <sup>∗</sup>
<italic>P</italic>
< 0.05, <italic>n</italic>
= 3.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.004"></graphic>
</fig>
<fig id="fig5" orientation="portrait" position="float"><label>Figure 5</label>
<caption><p>CUR treatment induces autophagy and promotes autophagic flux in the human NP cells. (a–d) The protein levels of LC3, Beclin-1, and p62 in the human NP cells were measured by western blotting. The human NP cells were treated with different concentrations of CUR (0, 5, 10, 15, 20, and 25 <italic>μ</italic>
M) for 24 h or treated with 25 <italic>μ</italic>
M CUR for different times (0, 6, 12, 18, 24, and 30 h). (e–g) The protein levels of LC3 and p62 in the human NP cells that were pretreated with or without CQ (10 <italic>μ</italic>
M) for 2 h and then treated with different concentrations of CUR for 24 h. (h, i) Immunofluorescence staining of LC3 in the human NP cells. Scale bar: 20 <italic>μ</italic>
m. GAPDH was used as an internal control. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01, <sup>∗</sup>
<italic>P</italic>
< 0.05, <italic>n</italic>
= 3.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.005"></graphic>
</fig>
<fig id="fig6" orientation="portrait" position="float"><label>Figure 6</label>
<caption><p>AMPK/mTOR/ULK1 pathway is involved in CUR-triggered activation of autophagy in the human NP cells. (a–d) The levels of AMPK, p-AMPK, mTOR, p-mTOR, ULK1, and p-ULK1 proteins in the human NP cells were measured by western blotting. (e–j) The levels of AMPK, p-AMPK, mTOR, p-mTOR, ULK1, p-ULK1, LC3, Beclin-1, and p62 proteins in the human NP cells that were treated as indicated. CC refers to compound C. (k, l) Immunofluorescence staining of LC3 in human NP cells. Scale bar: 20 <italic>μ</italic>
m. GAPDH was used as an internal control. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01, <sup>∗</sup>
<italic>P</italic>
< 0.05, <italic>n</italic>
= 3.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.006"></graphic>
</fig>
<fig id="fig7" orientation="portrait" position="float"><label>Figure 7</label>
<caption><p>CUR treatment restores defective autophagic flux in the human NP cells subjected to TBHP. (a–d) The levels of LC3 and p62 proteins in the human NP cells were measured by western blotting. (e, f) Representative images of the human NP cells expressing mRFP-GFP-LC3 were obtained by confocal microscopy. Scale bar: 10 <italic>μ</italic>
m. (g, h) The colocalization of LC3 and LAMP1 was examined by confocal microscopy. Scale bar: 10 <italic>μ</italic>
m. (i, j) LAMP2 protein level in the human NP cells was evaluated by western blotting. (k, l) The activity of CTSB and CTSD in the human NP cells. (m, n) Lysosomal pH of human NP cells was determined by LysoSensor Green DND-189 staining. Scale bar: 20 <italic>μ</italic>
m. GAPDH was used as an internal control. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01, <sup>∗</sup>
<italic>P</italic>
< 0.05, <italic>n</italic>
= 3.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.007"></graphic>
</fig>
<fig id="fig8" orientation="portrait" position="float"><label>Figure 8</label>
<caption><p>CUR treatment inhibits TBHP-induced apoptosis and senescence in the human NP cells by facilitating autophagic flux. (a–c) The protein levels of LC3and p62 in the human NP cells were measured by western blotting. (d, e) Annexin V-APC/7-AAD staining results showing the apoptosis rate of the human NP cells. (f–l) The expression of mitochondrial Cyt-c, cytoplasmic Cyt-c, Bax, Bcl-2, cleaved caspase-3, and cleaved caspase-9 proteins was measured by western blotting. (f, m–o) Cells were treated as indicated in the legend of Figures <xref ref-type="fig" rid="fig2">2(l)</xref>
–<xref ref-type="fig" rid="fig2">2(o)</xref>
. (f, m) The expression of p16 protein was measured by western blotting. (n, o) SA-<italic>β</italic>
-gal staining assay was performed in the human NP cells. Scale bar: 100 <italic>μ</italic>
m. GAPDH was used as an internal control. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01 versus control group. <sup>##</sup>
<italic>P</italic>
< 0.01 versus TBHP group. <sup>&&</sup>
<italic>P</italic>
< 0.01, <sup>&</sup>
<italic>P</italic>
< 0.05 versus TBHP+CUR group, <italic>n</italic>
= 3.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.008"></graphic>
</fig>
<fig id="fig9" orientation="portrait" position="float"><label>Figure 9</label>
<caption><p>CUR treatment inhibits TBHP-induced ECM degradation, oxidative stresses, and mitochondrial dysfunction by facilitating autophagic flux. (a–g) The protein levels of type II collagen, aggrecan, MMP-3, MMP-13, ADAMTS-4, and ADAMTS-5 in the human NP cells were measured by western blotting. (h, i) The ROS levels were detected using the fluorescent probe DHE and measured by flow cytometry. (j) Intracellular MDA levels in the human NP cells. (k, l) Mitochondrial membrane potential was detected by JC-1 staining and measured by flow cytometry. (m) An assessment of mPTP opening in the human NP cells. (n) Intracellular ATP levels in the human NP cells. GAPDH was used as an internal control. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01 versus control group. <sup>##</sup>
<italic>P</italic>
< 0.01 versus TBHP group. <sup>&&</sup>
<italic>P</italic>
< 0.01, <sup>&</sup>
<italic>P</italic>
< 0.05 versus TBHP+CUR group, <italic>n</italic>
= 3.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.009"></graphic>
</fig>
<fig id="fig10" orientation="portrait" position="float"><label>Figure 10</label>
<caption><p>CUR treatment ameliorates rat IDD <italic>in vivo</italic>
. (a) The discs from the tails of rats obtained from different treatment groups were examined using MRI at T2-weighted signal (white arrows). (b, c) HE and SO staining of the whole rat tail disc. Scale bar: 1 mm. (d) Quantitative analysis of the degree of disc degeneration based on the Pfirrmann grade system using MRI images. (e) The histological scores of the tail discs according to the histological grading scale. (f–h) The levels of type II collagen, aggrecan, MMP-13, ADAMTS-4, ADAMTS-5, LC3, p62, and cleaved caspase-3 proteins in the disc samples obtained from the rat models were measured by western blotting. (i) Immunohistochemical staining showing the expression of type II collagen, MMP-13, LC3, p62, and cleaved-caspase3 proteins in the disc samples of the rat model. (j) The content of H<sub>2</sub>
O<sub>2</sub>
in the disc samples. Scale bar: 40 <italic>μ</italic>
m. GAPDH was used as an internal control. Data are represented as the mean ± SD. <sup>∗∗</sup>
<italic>P</italic>
< 0.01, <sup>∗</sup>
<italic>P</italic>
< 0.05, <italic>n</italic>
= 6.</p>
</caption>
<graphic xlink:href="OMCL2019-7810320.010"></graphic>
</fig>
<table-wrap id="tab1" orientation="portrait" position="float"><label>Table 1</label>
<caption><p>Sequences of primers used for qRT-PCR.</p>
</caption>
<table frame="hsides" rules="groups"><thead><tr><th align="left" rowspan="2" colspan="1">Gene</th>
<th align="center" colspan="2" rowspan="1">Oligonucleotide sequence</th>
<th align="center" rowspan="2" colspan="1">Product size (bp)</th>
</tr>
<tr><th align="center" rowspan="1" colspan="1">Forward (5′–3′)</th>
<th align="center" rowspan="1" colspan="1">Reverse (5′–3′)</th>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1">Type II collagen</td>
<td align="center" rowspan="1" colspan="1">AGAACTGGTGGAGCAGCAAGA</td>
<td align="center" rowspan="1" colspan="1">AGCAGGCGTAGGAAGGTCAT</td>
<td align="center" rowspan="1" colspan="1">142</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Aggrecan</td>
<td align="center" rowspan="1" colspan="1">TGAGCGGCAGCACTTTGAC</td>
<td align="center" rowspan="1" colspan="1">TGAGTACAGGAGGCTTGAGG</td>
<td align="center" rowspan="1" colspan="1">287</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">MMP3</td>
<td align="center" rowspan="1" colspan="1">TTCCTTGGATTGGAGGTGAC</td>
<td align="center" rowspan="1" colspan="1">AGCCTGGAGAATGTGAGTGG</td>
<td align="center" rowspan="1" colspan="1">248</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">MMP13</td>
<td align="center" rowspan="1" colspan="1">CCCAACCCTAAACATCCAA</td>
<td align="center" rowspan="1" colspan="1">AAACAGCTCCGCATCAACC</td>
<td align="center" rowspan="1" colspan="1">147</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">ADAMTS4</td>
<td align="center" rowspan="1" colspan="1">ACCCAAGCATCCGCAATC</td>
<td align="center" rowspan="1" colspan="1">TGCCCACATCAGCCATAC</td>
<td align="center" rowspan="1" colspan="1">246</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">ADAMTS5</td>
<td align="center" rowspan="1" colspan="1">GACAGTTCAAAGCCAAAGACC</td>
<td align="center" rowspan="1" colspan="1">TTTCCTTCGTGGCAGAGT</td>
<td align="center" rowspan="1" colspan="1">204</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">GAPDH</td>
<td align="center" rowspan="1" colspan="1">TCAAGAAGGTGGTGAAGCAGG</td>
<td align="center" rowspan="1" colspan="1">TCAAAGGTGGAGGAGTGGGT</td>
<td align="center" rowspan="1" colspan="1">115</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Sante/explor/ChloroquineV1/Data/Pmc/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000766 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd -nk 000766 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Sante |area= ChloroquineV1 |flux= Pmc |étape= Curation |type= RBID |clé= PMC:6954474 |texte= Restoration of Autophagic Flux Rescues Oxidative Damage and Mitochondrial Dysfunction to Protect against Intervertebral Disc Degeneration }}
Pour générer des pages wiki
HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Curation/RBID.i -Sk "pubmed:31976028" \ | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd \ | NlmPubMed2Wicri -a ChloroquineV1
This area was generated with Dilib version V0.6.33. |