Serveur d'exploration Chloroquine

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Margatoxin mitigates CCl4-induced hepatic fibrosis in mice via macrophage polarization, cytokine secretion and STAT signaling

Identifieur interne : 000601 ( Pmc/Curation ); précédent : 000600; suivant : 000602

Margatoxin mitigates CCl4-induced hepatic fibrosis in mice via macrophage polarization, cytokine secretion and STAT signaling

Auteurs : Bao-Ming Wu ; Jun-Da Liu [République populaire de Chine] ; Yuan-Hai Li [République populaire de Chine] ; Jun Li

Source :

RBID : PMC:6889929

Abstract

A number of macrophage phenotypes have been previously identified as crucial regulators in the progression of hepatic fibrosis (HF). Cytokines from macrophages or Kupffer cells (KCs) have also been identified to be important regulators in HF. Blocking Kv1.3 in models of HF, regulating macrophage polarization and cytokine secretion have not yet been assessed as potential treatments options for this condition. In the current study, a model of carbon tetrachloride (CCl4)-induced HF was established and examined the effects of margatoxin (MgTX; an inhibitor of Kv1.3) on HF. Hematoxylin and eosin, Masson's trichrome and immunohistochemistry staining were performed to determine whether MgTX can alleviate liver fibrosis. To elucidate the mechanisms through which MgTX attenuates liver injury, reverse transcription-quantitative PCR and western blot analysis were used to detect polarized macrophage markers in RAW264.7 cells and cytokines were examined using ELISA. Furthermore, macrophage polarization signal transducer and activator of transcription (STAT) signaling, which is associated with macrophage polarization, was identified in RAW264.7 cells. The results revealed that MgTX protected the mice from CCl4-induced liver fibrosis. Furthermore, MgTX decreased the expression of M1 phenotype biomarkers, and increased the expression of M2 phenotype biomarkers in CCl4-induced HF. Additionally, the production of pro-inflammatory cytokines was decreased and interleukin-10 production was increased in the serum of mice with HF injected with MgTX. Furthermore, MgTX was found to regulate the expression of M1 markers by suppressing p-STAT1 activity and increasing the expression of M2 markers by promoting p-STAT6 activity. On the whole, the findings of this study demonstrate that MgTX is able to alleviate CCl4-induced HF in mice, possibly via macrophage polarization, cytokine secretion and STAT signaling.


Url:
DOI: 10.3892/ijmm.2019.4395
PubMed: 31746414
PubMed Central: 6889929

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:6889929

Curation

No country items

Bao-Ming Wu
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
Bao-Ming Wu
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
Bao-Ming Wu
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
Jun-Da Liu
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
Jun-Da Liu
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
Jun-Da Liu
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
Yuan-Hai Li
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
Yuan-Hai Li
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
Yuan-Hai Li
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
Jun Li
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
Jun Li
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
Jun Li
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Margatoxin mitigates CCl4-induced hepatic fibrosis in mice via macrophage polarization, cytokine secretion and STAT signaling</title>
<author>
<name sortKey="Wu, Bao Ming" sort="Wu, Bao Ming" uniqKey="Wu B" first="Bao-Ming" last="Wu">Bao-Ming Wu</name>
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
</author>
<author>
<name sortKey="Liu, Jun Da" sort="Liu, Jun Da" uniqKey="Liu J" first="Jun-Da" last="Liu">Jun-Da Liu</name>
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Li, Yuan Hai" sort="Li, Yuan Hai" uniqKey="Li Y" first="Yuan-Hai" last="Li">Yuan-Hai Li</name>
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Li, Jun" sort="Li, Jun" uniqKey="Li J" first="Jun" last="Li">Jun Li</name>
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">31746414</idno>
<idno type="pmc">6889929</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6889929</idno>
<idno type="RBID">PMC:6889929</idno>
<idno type="doi">10.3892/ijmm.2019.4395</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">000601</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000601</idno>
<idno type="wicri:Area/Pmc/Curation">000601</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000601</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Margatoxin mitigates CCl4-induced hepatic fibrosis in mice via macrophage polarization, cytokine secretion and STAT signaling</title>
<author>
<name sortKey="Wu, Bao Ming" sort="Wu, Bao Ming" uniqKey="Wu B" first="Bao-Ming" last="Wu">Bao-Ming Wu</name>
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
</author>
<author>
<name sortKey="Liu, Jun Da" sort="Liu, Jun Da" uniqKey="Liu J" first="Jun-Da" last="Liu">Jun-Da Liu</name>
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Li, Yuan Hai" sort="Li, Yuan Hai" uniqKey="Li Y" first="Yuan-Hai" last="Li">Yuan-Hai Li</name>
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-ijmm-45-01-0103">The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</nlm:aff>
<country xml:lang="fr" wicri:curation="lc">République populaire de Chine</country>
<wicri:regionArea>The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Li, Jun" sort="Li, Jun" uniqKey="Li J" first="Jun" last="Li">Jun Li</name>
<affiliation>
<nlm:aff id="af1-ijmm-45-01-0103">School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af2-ijmm-45-01-0103">The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</nlm:aff>
<wicri:noCountry code="subfield">Ministry of Education</wicri:noCountry>
</affiliation>
<affiliation>
<nlm:aff id="af3-ijmm-45-01-0103">Institute for Liver Diseases of Anhui Medical University</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-ijmm-45-01-0103">Anhui Institute of Innovative Drugs, Anhui Medical University</nlm:aff>
<wicri:noCountry code="subfield">Anhui Medical University</wicri:noCountry>
</affiliation>
</author>
</analytic>
<series>
<title level="j">International Journal of Molecular Medicine</title>
<idno type="ISSN">1107-3756</idno>
<idno type="eISSN">1791-244X</idno>
<imprint>
<date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>A number of macrophage phenotypes have been previously identified as crucial regulators in the progression of hepatic fibrosis (HF). Cytokines from macrophages or Kupffer cells (KCs) have also been identified to be important regulators in HF. Blocking Kv1.3 in models of HF, regulating macrophage polarization and cytokine secretion have not yet been assessed as potential treatments options for this condition. In the current study, a model of carbon tetrachloride (CCl4)-induced HF was established and examined the effects of margatoxin (MgTX; an inhibitor of Kv1.3) on HF. Hematoxylin and eosin, Masson's trichrome and immunohistochemistry staining were performed to determine whether MgTX can alleviate liver fibrosis. To elucidate the mechanisms through which MgTX attenuates liver injury, reverse transcription-quantitative PCR and western blot analysis were used to detect polarized macrophage markers in RAW264.7 cells and cytokines were examined using ELISA. Furthermore, macrophage polarization signal transducer and activator of transcription (STAT) signaling, which is associated with macrophage polarization, was identified in RAW264.7 cells. The results revealed that MgTX protected the mice from CCl4-induced liver fibrosis. Furthermore, MgTX decreased the expression of M1 phenotype biomarkers, and increased the expression of M2 phenotype biomarkers in CCl4-induced HF. Additionally, the production of pro-inflammatory cytokines was decreased and interleukin-10 production was increased in the serum of mice with HF injected with MgTX. Furthermore, MgTX was found to regulate the expression of M1 markers by suppressing p-STAT1 activity and increasing the expression of M2 markers by promoting p-STAT6 activity. On the whole, the findings of this study demonstrate that MgTX is able to alleviate CCl4-induced HF in mice, possibly via macrophage polarization, cytokine secretion and STAT signaling.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Mederacke, I" uniqKey="Mederacke I">I Mederacke</name>
</author>
<author>
<name sortKey="Hsu, Cc" uniqKey="Hsu C">CC Hsu</name>
</author>
<author>
<name sortKey="Troeger, Js" uniqKey="Troeger J">JS Troeger</name>
</author>
<author>
<name sortKey="Huebener, P" uniqKey="Huebener P">P Huebener</name>
</author>
<author>
<name sortKey="Mu, X" uniqKey="Mu X">X Mu</name>
</author>
<author>
<name sortKey="Dapito, Dh" uniqKey="Dapito D">DH Dapito</name>
</author>
<author>
<name sortKey="Pradere, Jp" uniqKey="Pradere J">JP Pradere</name>
</author>
<author>
<name sortKey="Schwabe, Rf" uniqKey="Schwabe R">RF Schwabe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zheng, Z" uniqKey="Zheng Z">Z Zheng</name>
</author>
<author>
<name sortKey="Xu, X" uniqKey="Xu X">X Xu</name>
</author>
<author>
<name sortKey="Zhang, X" uniqKey="Zhang X">X Zhang</name>
</author>
<author>
<name sortKey="Wang, A" uniqKey="Wang A">A Wang</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C Zhang</name>
</author>
<author>
<name sortKey="Huttemann, M" uniqKey="Huttemann M">M Hüttemann</name>
</author>
<author>
<name sortKey="Grossman, Li" uniqKey="Grossman L">LI Grossman</name>
</author>
<author>
<name sortKey="Chen, Lc" uniqKey="Chen L">LC Chen</name>
</author>
<author>
<name sortKey="Rajagopalan, S" uniqKey="Rajagopalan S">S Rajagopalan</name>
</author>
<author>
<name sortKey="Sun, Q" uniqKey="Sun Q">Q Sun</name>
</author>
<author>
<name sortKey="Zhang, K" uniqKey="Zhang K">K Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Czaja, Aj" uniqKey="Czaja A">AJ Czaja</name>
</author>
<author>
<name sortKey="Carpenter, Ha" uniqKey="Carpenter H">HA Carpenter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schuppan, D" uniqKey="Schuppan D">D Schuppan</name>
</author>
<author>
<name sortKey="Kim, Yo" uniqKey="Kim Y">YO Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Duffield, Js" uniqKey="Duffield J">JS Duffield</name>
</author>
<author>
<name sortKey="Forbes, Sj" uniqKey="Forbes S">SJ Forbes</name>
</author>
<author>
<name sortKey="Constandinou, Cm" uniqKey="Constandinou C">CM Constandinou</name>
</author>
<author>
<name sortKey="Clay, S" uniqKey="Clay S">S Clay</name>
</author>
<author>
<name sortKey="Partolina, M" uniqKey="Partolina M">M Partolina</name>
</author>
<author>
<name sortKey="Vuthoori, S" uniqKey="Vuthoori S">S Vuthoori</name>
</author>
<author>
<name sortKey="Wu, S" uniqKey="Wu S">S Wu</name>
</author>
<author>
<name sortKey="Lang, R" uniqKey="Lang R">R Lang</name>
</author>
<author>
<name sortKey="Iredale, Jp" uniqKey="Iredale J">JP Iredale</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ramachandran, P" uniqKey="Ramachandran P">P Ramachandran</name>
</author>
<author>
<name sortKey="Iredale, Jp" uniqKey="Iredale J">JP Iredale</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chawla, A" uniqKey="Chawla A">A Chawla</name>
</author>
<author>
<name sortKey="Nguyen, Kd" uniqKey="Nguyen K">KD Nguyen</name>
</author>
<author>
<name sortKey="Goh, Yp" uniqKey="Goh Y">YP Goh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mosser, Dm" uniqKey="Mosser D">DM Mosser</name>
</author>
<author>
<name sortKey="Edwards, Jp" uniqKey="Edwards J">JP Edwards</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gundra, Um" uniqKey="Gundra U">UM Gundra</name>
</author>
<author>
<name sortKey="Girgis, Nm" uniqKey="Girgis N">NM Girgis</name>
</author>
<author>
<name sortKey="Gonzalez, Ma" uniqKey="Gonzalez M">MA Gonzalez</name>
</author>
<author>
<name sortKey="San Tang, M" uniqKey="San Tang M">M San Tang</name>
</author>
<author>
<name sortKey="Van Der Zande, Hjp" uniqKey="Van Der Zande H">HJP Van Der Zande</name>
</author>
<author>
<name sortKey="Lin, Jd" uniqKey="Lin J">JD Lin</name>
</author>
<author>
<name sortKey="Ouimet, M" uniqKey="Ouimet M">M Ouimet</name>
</author>
<author>
<name sortKey="Ma, Lj" uniqKey="Ma L">LJ Ma</name>
</author>
<author>
<name sortKey="Poles, J" uniqKey="Poles J">J Poles</name>
</author>
<author>
<name sortKey="Vozhilla, N" uniqKey="Vozhilla N">N Vozhilla</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Borthwick, La" uniqKey="Borthwick L">LA Borthwick</name>
</author>
<author>
<name sortKey="Suwara, Mi" uniqKey="Suwara M">MI Suwara</name>
</author>
<author>
<name sortKey="Carnell, Sc" uniqKey="Carnell S">SC Carnell</name>
</author>
<author>
<name sortKey="Green, Nj" uniqKey="Green N">NJ Green</name>
</author>
<author>
<name sortKey="Mahida, R" uniqKey="Mahida R">R Mahida</name>
</author>
<author>
<name sortKey="Dixon, D" uniqKey="Dixon D">D Dixon</name>
</author>
<author>
<name sortKey="Gillespie, Cs" uniqKey="Gillespie C">CS Gillespie</name>
</author>
<author>
<name sortKey="Cartwright, Tn" uniqKey="Cartwright T">TN Cartwright</name>
</author>
<author>
<name sortKey="Horabin, J" uniqKey="Horabin J">J Horabin</name>
</author>
<author>
<name sortKey="Walker, A" uniqKey="Walker A">A Walker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gordon, S" uniqKey="Gordon S">S Gordon</name>
</author>
<author>
<name sortKey="Martinez, Fo" uniqKey="Martinez F">FO Martinez</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Murray, Pj" uniqKey="Murray P">PJ Murray</name>
</author>
<author>
<name sortKey="Allen, Je" uniqKey="Allen J">JE Allen</name>
</author>
<author>
<name sortKey="Biswas, Sk" uniqKey="Biswas S">SK Biswas</name>
</author>
<author>
<name sortKey="Fisher, Ea" uniqKey="Fisher E">EA Fisher</name>
</author>
<author>
<name sortKey="Gilroy, Dw" uniqKey="Gilroy D">DW Gilroy</name>
</author>
<author>
<name sortKey="Goerdt, S" uniqKey="Goerdt S">S Goerdt</name>
</author>
<author>
<name sortKey="Gordon, S" uniqKey="Gordon S">S Gordon</name>
</author>
<author>
<name sortKey="Hamilton, Ja" uniqKey="Hamilton J">JA Hamilton</name>
</author>
<author>
<name sortKey="Ivashkiv, Lb" uniqKey="Ivashkiv L">LB Ivashkiv</name>
</author>
<author>
<name sortKey="Lawrence, T" uniqKey="Lawrence T">T Lawrence</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sica, A" uniqKey="Sica A">A Sica</name>
</author>
<author>
<name sortKey="Invernizzi, P" uniqKey="Invernizzi P">P Invernizzi</name>
</author>
<author>
<name sortKey="Mantovani, A" uniqKey="Mantovani A">A Mantovani</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Heymann, F" uniqKey="Heymann F">F Heymann</name>
</author>
<author>
<name sortKey="Trautwein, C" uniqKey="Trautwein C">C Trautwein</name>
</author>
<author>
<name sortKey="Tacke, F" uniqKey="Tacke F">F Tacke</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Murray, Pj" uniqKey="Murray P">PJ Murray</name>
</author>
<author>
<name sortKey="Wynn, Ta" uniqKey="Wynn T">TA Wynn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chiaramonte, Mg" uniqKey="Chiaramonte M">MG Chiaramonte</name>
</author>
<author>
<name sortKey="Donaldson, Dd" uniqKey="Donaldson D">DD Donaldson</name>
</author>
<author>
<name sortKey="Cheever, Aw" uniqKey="Cheever A">AW Cheever</name>
</author>
<author>
<name sortKey="Wynn, Ta" uniqKey="Wynn T">TA Wynn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kaviratne, M" uniqKey="Kaviratne M">M Kaviratne</name>
</author>
<author>
<name sortKey="Hesse, M" uniqKey="Hesse M">M Hesse</name>
</author>
<author>
<name sortKey="Leusink, M" uniqKey="Leusink M">M Leusink</name>
</author>
<author>
<name sortKey="Cheever, Aw" uniqKey="Cheever A">AW Cheever</name>
</author>
<author>
<name sortKey="Davies, Sj" uniqKey="Davies S">SJ Davies</name>
</author>
<author>
<name sortKey="Mckerrow, Jh" uniqKey="Mckerrow J">JH McKerrow</name>
</author>
<author>
<name sortKey="Wakefield, Lm" uniqKey="Wakefield L">LM Wakefield</name>
</author>
<author>
<name sortKey="Letterio, Jj" uniqKey="Letterio J">JJ Letterio</name>
</author>
<author>
<name sortKey="Wynn, Ta" uniqKey="Wynn T">TA Wynn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mckenzie, Gj" uniqKey="Mckenzie G">GJ McKenzie</name>
</author>
<author>
<name sortKey="Bancroft, A" uniqKey="Bancroft A">A Bancroft</name>
</author>
<author>
<name sortKey="Grencis, Rk" uniqKey="Grencis R">RK Grencis</name>
</author>
<author>
<name sortKey="Mckenzie, An" uniqKey="Mckenzie A">AN McKenzie</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mckenzie, Gj" uniqKey="Mckenzie G">GJ McKenzie</name>
</author>
<author>
<name sortKey="Fallon, Pg" uniqKey="Fallon P">PG Fallon</name>
</author>
<author>
<name sortKey="Emson, Cl" uniqKey="Emson C">CL Emson</name>
</author>
<author>
<name sortKey="Grencis, Rk" uniqKey="Grencis R">RK Grencis</name>
</author>
<author>
<name sortKey="Mckenzie, An" uniqKey="Mckenzie A">AN McKenzie</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mackenzie, Ab" uniqKey="Mackenzie A">AB Mackenzie</name>
</author>
<author>
<name sortKey="Chirakkal, H" uniqKey="Chirakkal H">H Chirakkal</name>
</author>
<author>
<name sortKey="North, Ra" uniqKey="North R">RA North</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kazama, I" uniqKey="Kazama I">I Kazama</name>
</author>
<author>
<name sortKey="Maruyama, Y" uniqKey="Maruyama Y">Y Maruyama</name>
</author>
<author>
<name sortKey="Murata, Y" uniqKey="Murata Y">Y Murata</name>
</author>
<author>
<name sortKey="Sano, M" uniqKey="Sano M">M Sano</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Toldi, G" uniqKey="Toldi G">G Toldi</name>
</author>
<author>
<name sortKey="Bajnok, A" uniqKey="Bajnok A">A Bajnok</name>
</author>
<author>
<name sortKey="Dobi, D" uniqKey="Dobi D">D Dobi</name>
</author>
<author>
<name sortKey="Kaposi, A" uniqKey="Kaposi A">A Kaposi</name>
</author>
<author>
<name sortKey="Kovacs, L" uniqKey="Kovacs L">L Kovács</name>
</author>
<author>
<name sortKey="Vasarhelyi, B" uniqKey="Vasarhelyi B">B Vásárhelyi</name>
</author>
<author>
<name sortKey="Balog, A" uniqKey="Balog A">A Balog</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Beeton, C" uniqKey="Beeton C">C Beeton</name>
</author>
<author>
<name sortKey="Wulff, H" uniqKey="Wulff H">H Wulff</name>
</author>
<author>
<name sortKey="Standifer, Ne" uniqKey="Standifer N">NE Standifer</name>
</author>
<author>
<name sortKey="Azam, P" uniqKey="Azam P">P Azam</name>
</author>
<author>
<name sortKey="Mullen, Km" uniqKey="Mullen K">KM Mullen</name>
</author>
<author>
<name sortKey="Pennington, Mw" uniqKey="Pennington M">MW Pennington</name>
</author>
<author>
<name sortKey="Kolski Andreaco, A" uniqKey="Kolski Andreaco A">A Kolski-Andreaco</name>
</author>
<author>
<name sortKey="Wei, E" uniqKey="Wei E">E Wei</name>
</author>
<author>
<name sortKey="Grino, A" uniqKey="Grino A">A Grino</name>
</author>
<author>
<name sortKey="Counts, Dr" uniqKey="Counts D">DR Counts</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chi, V" uniqKey="Chi V">V Chi</name>
</author>
<author>
<name sortKey="Pennington, Mw" uniqKey="Pennington M">MW Pennington</name>
</author>
<author>
<name sortKey="Norton, Rs" uniqKey="Norton R">RS Norton</name>
</author>
<author>
<name sortKey="Tarcha, Ej" uniqKey="Tarcha E">EJ Tarcha</name>
</author>
<author>
<name sortKey="Londono, Lm" uniqKey="Londono L">LM Londono</name>
</author>
<author>
<name sortKey="Sims Fahey, B" uniqKey="Sims Fahey B">B Sims-Fahey</name>
</author>
<author>
<name sortKey="Upadhyay, Sk" uniqKey="Upadhyay S">SK Upadhyay</name>
</author>
<author>
<name sortKey="Lakey, Jt" uniqKey="Lakey J">JT Lakey</name>
</author>
<author>
<name sortKey="Iadonato, S" uniqKey="Iadonato S">S Iadonato</name>
</author>
<author>
<name sortKey="Wulff, H" uniqKey="Wulff H">H Wulff</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kazama, I" uniqKey="Kazama I">I Kazama</name>
</author>
<author>
<name sortKey="Maruyama, Y" uniqKey="Maruyama Y">Y Maruyama</name>
</author>
<author>
<name sortKey="Endo, Y" uniqKey="Endo Y">Y Endo</name>
</author>
<author>
<name sortKey="Toyama, H" uniqKey="Toyama H">H Toyama</name>
</author>
<author>
<name sortKey="Ejima, Y" uniqKey="Ejima Y">Y Ejima</name>
</author>
<author>
<name sortKey="Matsubara, M" uniqKey="Matsubara M">M Matsubara</name>
</author>
<author>
<name sortKey="Kurosawa, S" uniqKey="Kurosawa S">S Kurosawa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shao, Pp" uniqKey="Shao P">PP Shao</name>
</author>
<author>
<name sortKey="Liu, Cj" uniqKey="Liu C">CJ Liu</name>
</author>
<author>
<name sortKey="Xu, Q" uniqKey="Xu Q">Q Xu</name>
</author>
<author>
<name sortKey="Zhang, B" uniqKey="Zhang B">B Zhang</name>
</author>
<author>
<name sortKey="Li, Sh" uniqKey="Li S">SH Li</name>
</author>
<author>
<name sortKey="Wu, Y" uniqKey="Wu Y">Y Wu</name>
</author>
<author>
<name sortKey="Sun, Z" uniqKey="Sun Z">Z Sun</name>
</author>
<author>
<name sortKey="Cheng, Lf" uniqKey="Cheng L">LF Cheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moreno, C" uniqKey="Moreno C">C Moreno</name>
</author>
<author>
<name sortKey="Prieto, P" uniqKey="Prieto P">P Prieto</name>
</author>
<author>
<name sortKey="Macias, A" uniqKey="Macias A">Á Macías</name>
</author>
<author>
<name sortKey="Pimentel Santillana, M" uniqKey="Pimentel Santillana M">M Pimentel-Santillana</name>
</author>
<author>
<name sortKey="De La Cruz, A" uniqKey="De La Cruz A">A de la Cruz</name>
</author>
<author>
<name sortKey="Traves, Pg" uniqKey="Traves P">PG Través</name>
</author>
<author>
<name sortKey="Bosca, L" uniqKey="Bosca L">L Boscá</name>
</author>
<author>
<name sortKey="Valenzuela, C" uniqKey="Valenzuela C">C Valenzuela</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Livak, Kj" uniqKey="Livak K">KJ Livak</name>
</author>
<author>
<name sortKey="Schmittgen, Td" uniqKey="Schmittgen T">TD Schmittgen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, Y" uniqKey="Yang Y">Y Yang</name>
</author>
<author>
<name sortKey="Wu, Xq" uniqKey="Wu X">XQ Wu</name>
</author>
<author>
<name sortKey="Li, Wx" uniqKey="Li W">WX Li</name>
</author>
<author>
<name sortKey="Huang, Hm" uniqKey="Huang H">HM Huang</name>
</author>
<author>
<name sortKey="Li, Hd" uniqKey="Li H">HD Li</name>
</author>
<author>
<name sortKey="Pan, Xy" uniqKey="Pan X">XY Pan</name>
</author>
<author>
<name sortKey="Li, Xf" uniqKey="Li X">XF Li</name>
</author>
<author>
<name sortKey="Huang, C" uniqKey="Huang C">C Huang</name>
</author>
<author>
<name sortKey="Meng, Xm" uniqKey="Meng X">XM Meng</name>
</author>
<author>
<name sortKey="Zhang, L" uniqKey="Zhang L">L Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitto, N" uniqKey="Bitto N">N Bitto</name>
</author>
<author>
<name sortKey="Liguori, E" uniqKey="Liguori E">E Liguori</name>
</author>
<author>
<name sortKey="La Mura, V" uniqKey="La Mura V">V La Mura</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Kk" uniqKey="Wang K">KK Wang</name>
</author>
<author>
<name sortKey="Czaja, Aj" uniqKey="Czaja A">AJ Czaja</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nishiguchi, S" uniqKey="Nishiguchi S">S Nishiguchi</name>
</author>
<author>
<name sortKey="Kuroki, T" uniqKey="Kuroki T">T Kuroki</name>
</author>
<author>
<name sortKey="Nakatani, S" uniqKey="Nakatani S">S Nakatani</name>
</author>
<author>
<name sortKey="Morimoto, H" uniqKey="Morimoto H">H Morimoto</name>
</author>
<author>
<name sortKey="Takeda, T" uniqKey="Takeda T">T Takeda</name>
</author>
<author>
<name sortKey="Nakajima, S" uniqKey="Nakajima S">S Nakajima</name>
</author>
<author>
<name sortKey="Shiomi, S" uniqKey="Shiomi S">S Shiomi</name>
</author>
<author>
<name sortKey="Seki, S" uniqKey="Seki S">S Seki</name>
</author>
<author>
<name sortKey="Kobayashi, K" uniqKey="Kobayashi K">K Kobayashi</name>
</author>
<author>
<name sortKey="Otani, S" uniqKey="Otani S">S Otani</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roberts, Sk" uniqKey="Roberts S">SK Roberts</name>
</author>
<author>
<name sortKey="Therneau, Tm" uniqKey="Therneau T">TM Therneau</name>
</author>
<author>
<name sortKey="Czaja, Aj" uniqKey="Czaja A">AJ Czaja</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Singal, Ag" uniqKey="Singal A">AG Singal</name>
</author>
<author>
<name sortKey="Volk, Ml" uniqKey="Volk M">ML Volk</name>
</author>
<author>
<name sortKey="Jensen, D" uniqKey="Jensen D">D Jensen</name>
</author>
<author>
<name sortKey="Di Bisceglie, Am" uniqKey="Di Bisceglie A">AM Di Bisceglie</name>
</author>
<author>
<name sortKey="Schoenfeld, Ps" uniqKey="Schoenfeld P">PS Schoenfeld</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lok, As" uniqKey="Lok A">AS Lok</name>
</author>
<author>
<name sortKey="Everhart, Je" uniqKey="Everhart J">JE Everhart</name>
</author>
<author>
<name sortKey="Wright, Ec" uniqKey="Wright E">EC Wright</name>
</author>
<author>
<name sortKey="Di Bisceglie, Am" uniqKey="Di Bisceglie A">AM Di Bisceglie</name>
</author>
<author>
<name sortKey="Kim, Hy" uniqKey="Kim H">HY Kim</name>
</author>
<author>
<name sortKey="Sterling, Rk" uniqKey="Sterling R">RK Sterling</name>
</author>
<author>
<name sortKey="Everson, Gt" uniqKey="Everson G">GT Everson</name>
</author>
<author>
<name sortKey="Lindsay, Kl" uniqKey="Lindsay K">KL Lindsay</name>
</author>
<author>
<name sortKey="Lee, Wm" uniqKey="Lee W">WM Lee</name>
</author>
<author>
<name sortKey="Bonkovsky, Hl" uniqKey="Bonkovsky H">HL Bonkovsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bruix, J" uniqKey="Bruix J">J Bruix</name>
</author>
<author>
<name sortKey="Poynard, T" uniqKey="Poynard T">T Poynard</name>
</author>
<author>
<name sortKey="Colombo, M" uniqKey="Colombo M">M Colombo</name>
</author>
<author>
<name sortKey="Schiff, E" uniqKey="Schiff E">E Schiff</name>
</author>
<author>
<name sortKey="Burak, K" uniqKey="Burak K">K Burak</name>
</author>
<author>
<name sortKey="Heathcote, Ej" uniqKey="Heathcote E">EJ Heathcote</name>
</author>
<author>
<name sortKey="Berg, T" uniqKey="Berg T">T Berg</name>
</author>
<author>
<name sortKey="Poo, Jl" uniqKey="Poo J">JL Poo</name>
</author>
<author>
<name sortKey="Mello, Cb" uniqKey="Mello C">CB Mello</name>
</author>
<author>
<name sortKey="Guenther, R" uniqKey="Guenther R">R Guenther</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Krenkel, O" uniqKey="Krenkel O">O Krenkel</name>
</author>
<author>
<name sortKey="Tacke, F" uniqKey="Tacke F">F Tacke</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seki, E" uniqKey="Seki E">E Seki</name>
</author>
<author>
<name sortKey="Schwabe, Rf" uniqKey="Schwabe R">RF Schwabe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baeck, C" uniqKey="Baeck C">C Baeck</name>
</author>
<author>
<name sortKey="Wei, X" uniqKey="Wei X">X Wei</name>
</author>
<author>
<name sortKey="Bartneck, M" uniqKey="Bartneck M">M Bartneck</name>
</author>
<author>
<name sortKey="Fech, V" uniqKey="Fech V">V Fech</name>
</author>
<author>
<name sortKey="Heymann, F" uniqKey="Heymann F">F Heymann</name>
</author>
<author>
<name sortKey="Gassler, N" uniqKey="Gassler N">N Gassler</name>
</author>
<author>
<name sortKey="Hittatiya, K" uniqKey="Hittatiya K">K Hittatiya</name>
</author>
<author>
<name sortKey="Eulberg, D" uniqKey="Eulberg D">D Eulberg</name>
</author>
<author>
<name sortKey="Luedde, T" uniqKey="Luedde T">T Luedde</name>
</author>
<author>
<name sortKey="Trautwein, C" uniqKey="Trautwein C">C Trautwein</name>
</author>
<author>
<name sortKey="Tacke, F" uniqKey="Tacke F">F Tacke</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ramachandran, P" uniqKey="Ramachandran P">P Ramachandran</name>
</author>
<author>
<name sortKey="Pellicoro, A" uniqKey="Pellicoro A">A Pellicoro</name>
</author>
<author>
<name sortKey="Vernon, Ma" uniqKey="Vernon M">MA Vernon</name>
</author>
<author>
<name sortKey="Boulter, L" uniqKey="Boulter L">L Boulter</name>
</author>
<author>
<name sortKey="Aucott, Rl" uniqKey="Aucott R">RL Aucott</name>
</author>
<author>
<name sortKey="Ali, A" uniqKey="Ali A">A Ali</name>
</author>
<author>
<name sortKey="Hartland, Sn" uniqKey="Hartland S">SN Hartland</name>
</author>
<author>
<name sortKey="Snowdon, Vk" uniqKey="Snowdon V">VK Snowdon</name>
</author>
<author>
<name sortKey="Cappon, A" uniqKey="Cappon A">A Cappon</name>
</author>
<author>
<name sortKey="Gordon Walker, Tt" uniqKey="Gordon Walker T">TT Gordon-Walker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Madala, Sk" uniqKey="Madala S">SK Madala</name>
</author>
<author>
<name sortKey="Pesce, Jt" uniqKey="Pesce J">JT Pesce</name>
</author>
<author>
<name sortKey="Ramalingam, Tr" uniqKey="Ramalingam T">TR Ramalingam</name>
</author>
<author>
<name sortKey="Wilson, Ms" uniqKey="Wilson M">MS Wilson</name>
</author>
<author>
<name sortKey="Minnicozzi, S" uniqKey="Minnicozzi S">S Minnicozzi</name>
</author>
<author>
<name sortKey="Cheever, Aw" uniqKey="Cheever A">AW Cheever</name>
</author>
<author>
<name sortKey="Thompson, Rw" uniqKey="Thompson R">RW Thompson</name>
</author>
<author>
<name sortKey="Mentink Kane, Mm" uniqKey="Mentink Kane M">MM Mentink-Kane</name>
</author>
<author>
<name sortKey="Wynn, Ta" uniqKey="Wynn T">TA Wynn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Conway, Sj" uniqKey="Conway S">SJ Conway</name>
</author>
<author>
<name sortKey="Izuhara, K" uniqKey="Izuhara K">K Izuhara</name>
</author>
<author>
<name sortKey="Kudo, Y" uniqKey="Kudo Y">Y Kudo</name>
</author>
<author>
<name sortKey="Litvin, J" uniqKey="Litvin J">J Litvin</name>
</author>
<author>
<name sortKey="Markwald, R" uniqKey="Markwald R">R Markwald</name>
</author>
<author>
<name sortKey="Ouyang, G" uniqKey="Ouyang G">G Ouyang</name>
</author>
<author>
<name sortKey="Arron, Jr" uniqKey="Arron J">JR Arron</name>
</author>
<author>
<name sortKey="Holweg, Ct" uniqKey="Holweg C">CT Holweg</name>
</author>
<author>
<name sortKey="Kudo, A" uniqKey="Kudo A">A Kudo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mosher, Df" uniqKey="Mosher D">DF Mosher</name>
</author>
<author>
<name sortKey="Johansson, Mw" uniqKey="Johansson M">MW Johansson</name>
</author>
<author>
<name sortKey="Gillis, Me" uniqKey="Gillis M">ME Gillis</name>
</author>
<author>
<name sortKey="Annis, Ds" uniqKey="Annis D">DS Annis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhao, Xa" uniqKey="Zhao X">XA Zhao</name>
</author>
<author>
<name sortKey="Chen, G" uniqKey="Chen G">G Chen</name>
</author>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y Liu</name>
</author>
<author>
<name sortKey="Chen, Y" uniqKey="Chen Y">Y Chen</name>
</author>
<author>
<name sortKey="Wu, H" uniqKey="Wu H">H Wu</name>
</author>
<author>
<name sortKey="Xiong, Y" uniqKey="Xiong Y">Y Xiong</name>
</author>
<author>
<name sortKey="Wang, G" uniqKey="Wang G">G Wang</name>
</author>
<author>
<name sortKey="Jia, B" uniqKey="Jia B">B Jia</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author>
<name sortKey="Xia, J" uniqKey="Xia J">J Xia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eder, C" uniqKey="Eder C">C Eder</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rutar, M" uniqKey="Rutar M">M Rutar</name>
</author>
<author>
<name sortKey="Natoli, R" uniqKey="Natoli R">R Natoli</name>
</author>
<author>
<name sortKey="Provis, Jm" uniqKey="Provis J">JM Provis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pellicoro, A" uniqKey="Pellicoro A">A Pellicoro</name>
</author>
<author>
<name sortKey="Ramachandran, P" uniqKey="Ramachandran P">P Ramachandran</name>
</author>
<author>
<name sortKey="Iredale, Jp" uniqKey="Iredale J">JP Iredale</name>
</author>
<author>
<name sortKey="Fallowfield, Ja" uniqKey="Fallowfield J">JA Fallowfield</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kruglov, Ea" uniqKey="Kruglov E">EA Kruglov</name>
</author>
<author>
<name sortKey="Nathanson, Ra" uniqKey="Nathanson R">RA Nathanson</name>
</author>
<author>
<name sortKey="Nguyen, T" uniqKey="Nguyen T">T Nguyen</name>
</author>
<author>
<name sortKey="Dranoff, Ja" uniqKey="Dranoff J">JA Dranoff</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rockey, Dc" uniqKey="Rockey D">DC Rockey</name>
</author>
<author>
<name sortKey="Bell, Pd" uniqKey="Bell P">PD Bell</name>
</author>
<author>
<name sortKey="Hill, Ja" uniqKey="Hill J">JA Hill</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chiu, Ys" uniqKey="Chiu Y">YS Chiu</name>
</author>
<author>
<name sortKey="Wei, Cc" uniqKey="Wei C">CC Wei</name>
</author>
<author>
<name sortKey="Lin, Yj" uniqKey="Lin Y">YJ Lin</name>
</author>
<author>
<name sortKey="Hsu, Yh" uniqKey="Hsu Y">YH Hsu</name>
</author>
<author>
<name sortKey="Chang, Ms" uniqKey="Chang M">MS Chang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sziksz, E" uniqKey="Sziksz E">E Sziksz</name>
</author>
<author>
<name sortKey="Pap, D" uniqKey="Pap D">D Pap</name>
</author>
<author>
<name sortKey="Lippai, R" uniqKey="Lippai R">R Lippai</name>
</author>
<author>
<name sortKey="Beres, Nj" uniqKey="Beres N">NJ Béres</name>
</author>
<author>
<name sortKey="Fekete, A" uniqKey="Fekete A">A Fekete</name>
</author>
<author>
<name sortKey="Szab, Aj" uniqKey="Szab A">AJ Szabó</name>
</author>
<author>
<name sortKey="Vannay, A" uniqKey="Vannay A">Á Vannay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Galastri, S" uniqKey="Galastri S">S Galastri</name>
</author>
<author>
<name sortKey="Zamara, E" uniqKey="Zamara E">E Zamara</name>
</author>
<author>
<name sortKey="Milani, S" uniqKey="Milani S">S Milani</name>
</author>
<author>
<name sortKey="Novo, E" uniqKey="Novo E">E Novo</name>
</author>
<author>
<name sortKey="Provenzano, A" uniqKey="Provenzano A">A Provenzano</name>
</author>
<author>
<name sortKey="Delogu, W" uniqKey="Delogu W">W Delogu</name>
</author>
<author>
<name sortKey="Vizzutti, F" uniqKey="Vizzutti F">F Vizzutti</name>
</author>
<author>
<name sortKey="Sutti, S" uniqKey="Sutti S">S Sutti</name>
</author>
<author>
<name sortKey="Locatelli, I" uniqKey="Locatelli I">I Locatelli</name>
</author>
<author>
<name sortKey="Navari, N" uniqKey="Navari N">N Navari</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Khan, Z" uniqKey="Khan Z">Z Khan</name>
</author>
<author>
<name sortKey="Cao, Dy" uniqKey="Cao D">DY Cao</name>
</author>
<author>
<name sortKey="Giani, Jf" uniqKey="Giani J">JF Giani</name>
</author>
<author>
<name sortKey="Bernstein, Ea" uniqKey="Bernstein E">EA Bernstein</name>
</author>
<author>
<name sortKey="Veiras, Lc" uniqKey="Veiras L">LC Veiras</name>
</author>
<author>
<name sortKey="Fuchs, S" uniqKey="Fuchs S">S Fuchs</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author>
<name sortKey="Peng, Z" uniqKey="Peng Z">Z Peng</name>
</author>
<author>
<name sortKey="Kalkum, M" uniqKey="Kalkum M">M Kalkum</name>
</author>
<author>
<name sortKey="Liu, Gy" uniqKey="Liu G">GY Liu</name>
</author>
<author>
<name sortKey="Bernstein, Ke" uniqKey="Bernstein K">KE Bernstein</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ding, N" uniqKey="Ding N">N Ding</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author>
<name sortKey="Dou, C" uniqKey="Dou C">C Dou</name>
</author>
<author>
<name sortKey="Liu, F" uniqKey="Liu F">F Liu</name>
</author>
<author>
<name sortKey="Guan, G" uniqKey="Guan G">G Guan</name>
</author>
<author>
<name sortKey="Wei, K" uniqKey="Wei K">K Wei</name>
</author>
<author>
<name sortKey="Yang, J" uniqKey="Yang J">J Yang</name>
</author>
<author>
<name sortKey="Yang, M" uniqKey="Yang M">M Yang</name>
</author>
<author>
<name sortKey="Tan, J" uniqKey="Tan J">J Tan</name>
</author>
<author>
<name sortKey="Zeng, W" uniqKey="Zeng W">W Zeng</name>
</author>
<author>
<name sortKey="Zhu, C" uniqKey="Zhu C">C Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Darnell, Je" uniqKey="Darnell J">JE Darnell</name>
</author>
<author>
<name sortKey="Kerr, Im" uniqKey="Kerr I">IM Kerr</name>
</author>
<author>
<name sortKey="Stark, Gr" uniqKey="Stark G">GR Stark</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Herbert, Dr" uniqKey="Herbert D">DR Herbert</name>
</author>
<author>
<name sortKey="Holscher, C" uniqKey="Holscher C">C Hölscher</name>
</author>
<author>
<name sortKey="Mohrs, M" uniqKey="Mohrs M">M Mohrs</name>
</author>
<author>
<name sortKey="Arendse, B" uniqKey="Arendse B">B Arendse</name>
</author>
<author>
<name sortKey="Schwegmann, A" uniqKey="Schwegmann A">A Schwegmann</name>
</author>
<author>
<name sortKey="Radwanska, M" uniqKey="Radwanska M">M Radwanska</name>
</author>
<author>
<name sortKey="Leeto, M" uniqKey="Leeto M">M Leeto</name>
</author>
<author>
<name sortKey="Kirsch, R" uniqKey="Kirsch R">R Kirsch</name>
</author>
<author>
<name sortKey="Hall, P" uniqKey="Hall P">P Hall</name>
</author>
<author>
<name sortKey="Mossmann, H" uniqKey="Mossmann H">H Mossmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brombacher, F" uniqKey="Brombacher F">F Brombacher</name>
</author>
<author>
<name sortKey="Arendse, B" uniqKey="Arendse B">B Arendse</name>
</author>
<author>
<name sortKey="Peterson, R" uniqKey="Peterson R">R Peterson</name>
</author>
<author>
<name sortKey="Holscher, A" uniqKey="Holscher A">A Hölscher</name>
</author>
<author>
<name sortKey="Holscher, C" uniqKey="Holscher C">C Hölscher</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Int J Mol Med</journal-id>
<journal-id journal-id-type="iso-abbrev">Int. J. Mol. Med</journal-id>
<journal-id journal-id-type="publisher-id">IJMM</journal-id>
<journal-title-group>
<journal-title>International Journal of Molecular Medicine</journal-title>
</journal-title-group>
<issn pub-type="ppub">1107-3756</issn>
<issn pub-type="epub">1791-244X</issn>
<publisher>
<publisher-name>D.A. Spandidos</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">31746414</article-id>
<article-id pub-id-type="pmc">6889929</article-id>
<article-id pub-id-type="doi">10.3892/ijmm.2019.4395</article-id>
<article-id pub-id-type="publisher-id">ijmm-45-01-0103</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Articles</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Margatoxin mitigates CCl4-induced hepatic fibrosis in mice via macrophage polarization, cytokine secretion and STAT signaling</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wu</surname>
<given-names>Bao-Ming</given-names>
</name>
<xref ref-type="aff" rid="af1-ijmm-45-01-0103">1</xref>
<xref ref-type="aff" rid="af2-ijmm-45-01-0103">2</xref>
<xref ref-type="aff" rid="af3-ijmm-45-01-0103">3</xref>
<xref ref-type="aff" rid="af4-ijmm-45-01-0103">4</xref>
<xref rid="fn1-ijmm-45-01-0103" ref-type="author-notes">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Jun-Da</given-names>
</name>
<xref ref-type="aff" rid="af1-ijmm-45-01-0103">1</xref>
<xref ref-type="aff" rid="af2-ijmm-45-01-0103">2</xref>
<xref ref-type="aff" rid="af3-ijmm-45-01-0103">3</xref>
<xref ref-type="aff" rid="af4-ijmm-45-01-0103">4</xref>
<xref ref-type="aff" rid="af5-ijmm-45-01-0103">5</xref>
<xref rid="fn1-ijmm-45-01-0103" ref-type="author-notes">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Yuan-Hai</given-names>
</name>
<xref ref-type="aff" rid="af1-ijmm-45-01-0103">1</xref>
<xref ref-type="aff" rid="af2-ijmm-45-01-0103">2</xref>
<xref ref-type="aff" rid="af3-ijmm-45-01-0103">3</xref>
<xref ref-type="aff" rid="af4-ijmm-45-01-0103">4</xref>
<xref ref-type="aff" rid="af5-ijmm-45-01-0103">5</xref>
<xref ref-type="corresp" rid="c2-ijmm-45-01-0103"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Jun</given-names>
</name>
<xref ref-type="aff" rid="af1-ijmm-45-01-0103">1</xref>
<xref ref-type="aff" rid="af2-ijmm-45-01-0103">2</xref>
<xref ref-type="aff" rid="af3-ijmm-45-01-0103">3</xref>
<xref ref-type="aff" rid="af4-ijmm-45-01-0103">4</xref>
<xref ref-type="corresp" rid="c1-ijmm-45-01-0103"></xref>
</contrib>
</contrib-group>
<aff id="af1-ijmm-45-01-0103">
<label>1</label>
School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University</aff>
<aff id="af2-ijmm-45-01-0103">
<label>2</label>
The Key Laboratory of Anti-Inflammatory and Immune Medicine, Anhui Medical University, Ministry of Education</aff>
<aff id="af3-ijmm-45-01-0103">
<label>3</label>
Institute for Liver Diseases of Anhui Medical University</aff>
<aff id="af4-ijmm-45-01-0103">
<label>4</label>
Anhui Institute of Innovative Drugs, Anhui Medical University</aff>
<aff id="af5-ijmm-45-01-0103">
<label>5</label>
The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China</aff>
<author-notes>
<corresp id="c1-ijmm-45-01-0103">Correspondence to: Professor Jun Li, School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University, 81 Meishan Road, Hefei, Anhui 230032, P.R. China, E-mail:
<email>lj@ahmu.edu.cn</email>
</corresp>
<corresp id="c2-ijmm-45-01-0103">Professor Yuan-Hai Li, The First Affiliated Hospital of Anhui Medical University, 218 Jixi Road, Hefei, Anhui 230032, P.R. China, E-mail:
<email>liyuanhai-1@163.com</email>
</corresp>
<fn id="fn1-ijmm-45-01-0103" fn-type="equal">
<label>*</label>
<p>Contributed equally</p>
</fn>
</author-notes>
<pub-date pub-type="ppub">
<month>1</month>
<year>2020</year>
</pub-date>
<pub-date pub-type="epub">
<day>04</day>
<month>11</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="pmc-release">
<day>04</day>
<month>11</month>
<year>2019</year>
</pub-date>
<pmc-comment> PMC Release delay is 0 months and 0 days and was based on the . </pmc-comment>
<volume>45</volume>
<issue>1</issue>
<fpage>103</fpage>
<lpage>114</lpage>
<history>
<date date-type="received">
<day>02</day>
<month>5</month>
<year>2019</year>
</date>
<date date-type="accepted">
<day>14</day>
<month>10</month>
<year>2019</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright: © Wu et al.</copyright-statement>
<copyright-year>2020</copyright-year>
<license license-type="open-access">
<license-p>This is an open access article distributed under the terms of the
<ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by-nc-nd/4.0/">Creative Commons Attribution-NonCommercial-NoDerivs License</ext-link>
, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.</license-p>
</license>
</permissions>
<abstract>
<p>A number of macrophage phenotypes have been previously identified as crucial regulators in the progression of hepatic fibrosis (HF). Cytokines from macrophages or Kupffer cells (KCs) have also been identified to be important regulators in HF. Blocking Kv1.3 in models of HF, regulating macrophage polarization and cytokine secretion have not yet been assessed as potential treatments options for this condition. In the current study, a model of carbon tetrachloride (CCl4)-induced HF was established and examined the effects of margatoxin (MgTX; an inhibitor of Kv1.3) on HF. Hematoxylin and eosin, Masson's trichrome and immunohistochemistry staining were performed to determine whether MgTX can alleviate liver fibrosis. To elucidate the mechanisms through which MgTX attenuates liver injury, reverse transcription-quantitative PCR and western blot analysis were used to detect polarized macrophage markers in RAW264.7 cells and cytokines were examined using ELISA. Furthermore, macrophage polarization signal transducer and activator of transcription (STAT) signaling, which is associated with macrophage polarization, was identified in RAW264.7 cells. The results revealed that MgTX protected the mice from CCl4-induced liver fibrosis. Furthermore, MgTX decreased the expression of M1 phenotype biomarkers, and increased the expression of M2 phenotype biomarkers in CCl4-induced HF. Additionally, the production of pro-inflammatory cytokines was decreased and interleukin-10 production was increased in the serum of mice with HF injected with MgTX. Furthermore, MgTX was found to regulate the expression of M1 markers by suppressing p-STAT1 activity and increasing the expression of M2 markers by promoting p-STAT6 activity. On the whole, the findings of this study demonstrate that MgTX is able to alleviate CCl4-induced HF in mice, possibly via macrophage polarization, cytokine secretion and STAT signaling.</p>
</abstract>
<kwd-group>
<kwd>hepatic fibrosis</kwd>
<kwd>margatoxin</kwd>
<kwd>macrophages polarization</kwd>
<kwd>cytokines</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="f1-ijmm-45-01-0103" orientation="portrait" position="float">
<label>Figure 1</label>
<caption>
<p>MgTX (0.4179 mg/kg) ameliorates CCl4-induced HF in C57BL/6J mice. (A) Representative hematoxylin and eosin staining, Masson's staining and Sirius Red staining of liver tissues indicated an incomplete hepatic lobule structure and irregularly arranged hepatic plates. Scattered degeneration, necrosis and numerous inflammatory cells immersed in liver tissue were identified compared with the HF model group treated with MgTX (magnification, ×200; black arrows, fibrosis; green arrows, steatosis; red arrows, inflammatory cell infiltration). (B) Immunohistochemistry and (C) western blot analysis of hepatic fibrosis tissues revealed increased α-SMA and collagen I expression compared with the CCl4-exposed group treated with MgTX.
<sup>*</sup>
P<0.05,
<sup>***</sup>
P<0.001 vs. CCl4;
<sup>#</sup>
P<0.05,
<sup>###</sup>
P<0.001 vs. negative control. Representative views from each group are presented (original magnification, ×20; n=6). MgTX, margatoxin; CCl4, carbon tetrachloride; HF, hepatic fibrosis.</p>
</caption>
<graphic xlink:href="IJMM-45-01-0103-g00"></graphic>
<graphic xlink:href="IJMM-45-01-0103-g01"></graphic>
<graphic xlink:href="IJMM-45-01-0103-g02"></graphic>
</fig>
<fig id="f2-ijmm-45-01-0103" orientation="portrait" position="float">
<label>Figure 2</label>
<caption>
<p>MgTX (0.4179 mg/kg) decreases the expression of HF-associated proteins in C57BL/6J mice with CCl4-induced HF (×200 field). (A) MMP12, MM13 and POSTN were associated with the amount of ECM and collagen. Immunohistochemistry of liver fibrosis tissues revealed MMP12, MM13 and POSTN exhibited increased staining compared with the HF group treated with MgTX.
<sup>*</sup>
P<0.05, CCl4 vs. CCl4 + MgTX group;
<sup>#</sup>
P<0.05, CCl4 vs. N group. (B) CCL2, Kv1.3 and δ-catenin are associated with the migration of macrophages. Immunohistochemistry of liver fibrosis tissues revealed increased staining for CCL2 and Kv1.3 compared with the HF group treated with MgTX.
<sup>*</sup>
P<0.05, CCL4 vs. CCL4 + MgTX group;
<sup>#</sup>
P<0.05, CCL4 vs. N group. n=6. MgTX, margatoxin; HF, hepatic fibrosis; CCl4, carbon tetrachloride; CCL2, C-C motif chemokine ligand 2; MMP, matrix metalloproteinase; POSTN, periostin; ECM, extracellular matrix.</p>
</caption>
<graphic xlink:href="IJMM-45-01-0103-g03"></graphic>
<graphic xlink:href="IJMM-45-01-0103-g04"></graphic>
</fig>
<fig id="f3-ijmm-45-01-0103" orientation="portrait" position="float">
<label>Figure 3</label>
<caption>
<p>MgTX decreases the expression of HF-associated proteins in RAW264.7 cells. To confirm the results of HF-associated proteins from immunohisto-chemistry in RAW264.7 cells, (A) western blot analysis was performed to examine the expression of MMP12, MM13, POSTN, CCL2, Kv1.3 and δ-catenin, which were downregulated by MgTX in the M1 phenotype groups. (B-G) MMP12, MM13, CCL2 and Kv1.3 were upregulated by MgTX in the M2 phenotype groups; however, POSTN and δ-catenin were downregulated by MgTX in the M2 phenotype groups. No significant difference was observed between the control (N) and MgTX groups.
<sup>*</sup>
P<0.05 vs. M1 group;
<sup>#</sup>
P<0.05 vs. M2 group. n=3. MgTX, margatoxin; HF, hepatic fibrosis; MMP, matrix metalloproteinase; POSTN, periostin; CCL2, C-C motif chemokine ligand 2.</p>
</caption>
<graphic xlink:href="IJMM-45-01-0103-g05"></graphic>
</fig>
<fig id="f4-ijmm-45-01-0103" orientation="portrait" position="float">
<label>Figure 4</label>
<caption>
<p>MgTX regulates cytokine secretion
<italic>in vivo</italic>
. A total of 3 different MgTX concentrations were injected into mice via intraperitoneal injection. The cytokines in mouse serum were measured using ELISA kits, MgTX(H):0.41 mg/Kg, MgTX(M):0.14 mg/Kg, MgTX(L):0.04 mg/Kg. (A-F) ELISAs to detect the levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6 and IL-20) in-mouse serum. Cytokine levels of IL-10 were inhibited compared with the HF model group, whereas these levels were increased compared with the HF model group treated with MgTX. The cytokine levels of TGF-β group (n=6) increased in the model group, while there was no significant difference observed in the HF model group treated with MgTX.
<sup>*</sup>
P<0.05 vs. control group;
<sup>#</sup>
P<0.05 vs. model group. n=6. MgTX, margatoxin; TNF-α, tumor necrosis factor-α; IL, interleukin; TGF-β, transforming growth factor-β; HF, hepatic fibrosis.</p>
</caption>
<graphic xlink:href="IJMM-45-01-0103-g06"></graphic>
</fig>
<fig id="f5-ijmm-45-01-0103" orientation="portrait" position="float">
<label>Figure 5</label>
<caption>
<p>MgTX regulates macrophage polarization
<italic>in vitro</italic>
. Reverse transcription-quantitative PCR and western blot analysis were performed to detect the expression of M1 markers and M2 markers in RAW264.7 cells. (A-H) mRNA expression levels of iNOS, CCL2, TNF-α and IL-1β were downregulated by MgTX in M1 phenotype macrophages. mRNA expression levels of IL-10, CD163, Arg-1, MAC-2 were upregulated in M2 phenotype macrophages treated with MgTX compared with M2 phenotype macrophages. (I-Q) protein expression levels of M1 markers (iNOS, CCL2, TNF-α and IL-1β) and protein expression levels of M2 markers (IL-10, CD163, Arg-1, Mrc2) were measured by western blot analysis.
<sup>*</sup>
P<0.05,
<sup>**</sup>
P<0.01, M1 vs. M1 + MgTX group, M2 vs. M2 + MgTX group. control group (N), n=3. MgTX, margatoxin; CCL2, C-C motif chemokine ligand 2; TNF-α, tumor necrosis factor-α; IL, interleukin; CD, cluster of differentiation.</p>
</caption>
<graphic xlink:href="IJMM-45-01-0103-g07"></graphic>
<graphic xlink:href="IJMM-45-01-0103-g08"></graphic>
</fig>
<fig id="f6-ijmm-45-01-0103" orientation="portrait" position="float">
<label>Figure 6</label>
<caption>
<p>MgTX regulates macrophage polarization via the STAT1/STAT6 pathway. MgTX was administered to M1 phenotype macrophages or M2 phenotype macrophages, respectively, and the expression of phosphorylated STAT1/STAT6 was measured using western blot analysis. (A-C) Data are presented as the relative protein expression against control expression without treatment. The phosphorylated levels of STAT1/STAT6 in M1/M2 phenotype macrophages increased significantly compared with the control group, and p-STAT1 expression was downregulated in M1 phenotype macrophages treated with MgTX.
<sup>*</sup>
P<0.05 vs. M1 group;
<sup>##</sup>
P<0.01 vs. control group (N). p-STAT6 was upregulated in M2 phenotype macrophages treated with MgTX.
<sup>**</sup>
P<0.05 vs. M2 group;
<sup>#</sup>
P<0.05 vs. control group. n=3. MgTX, margatoxin.</p>
</caption>
<graphic xlink:href="IJMM-45-01-0103-g09"></graphic>
</fig>
<table-wrap id="tI-ijmm-45-01-0103" orientation="portrait" position="float">
<label>Table I</label>
<caption>
<p>Sequences of primers used for RT-qPCR.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th valign="top" align="left" rowspan="1" colspan="1"></th>
<th valign="top" align="center" rowspan="1" colspan="1">Gene</th>
<th valign="top" align="center" rowspan="1" colspan="1">Amplicon size (bp)</th>
<th valign="top" align="center" rowspan="1" colspan="1">Forward primer (5′→3′)</th>
<th valign="top" align="center" rowspan="1" colspan="1">Reverse primer (5′→3′)</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="9" valign="top" align="left" colspan="1">Mouse</td>
<td valign="top" align="left" rowspan="1" colspan="1">β-actin</td>
<td valign="top" align="center" rowspan="1" colspan="1">120</td>
<td valign="top" align="center" rowspan="1" colspan="1">AGTGTGACGTTGACATCCGT</td>
<td valign="top" align="center" rowspan="1" colspan="1">TGCTAGGAGCCAGAGCAGTA</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">CCL-2</td>
<td valign="top" align="center" rowspan="1" colspan="1">128</td>
<td valign="top" align="center" rowspan="1" colspan="1">AACTGCATCTGCCCTAAGGT</td>
<td valign="top" align="center" rowspan="1" colspan="1">CTGTCACACTGGTCACTCCT</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">Mrc2</td>
<td valign="top" align="center" rowspan="1" colspan="1">83</td>
<td valign="top" align="center" rowspan="1" colspan="1">ACGACTGTGAGACCTTCTGG</td>
<td valign="top" align="center" rowspan="1" colspan="1">CCTCCAGGACAGTGTGGATT</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">IL-10</td>
<td valign="top" align="center" rowspan="1" colspan="1">88</td>
<td valign="top" align="center" rowspan="1" colspan="1">TGCACTACCAAAGCCACAAG</td>
<td valign="top" align="center" rowspan="1" colspan="1">TCAGTAAGAGCAGGCAGCAT</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">Arg-1</td>
<td valign="top" align="center" rowspan="1" colspan="1">135</td>
<td valign="top" align="center" rowspan="1" colspan="1">GCAGTTGGAAGCATCTCTGG</td>
<td valign="top" align="center" rowspan="1" colspan="1">GAGAAAGGACACAGGTTGCC</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">TNF-α</td>
<td valign="top" align="center" rowspan="1" colspan="1">133</td>
<td valign="top" align="center" rowspan="1" colspan="1">GACAGTGACCTGGACTGTGG</td>
<td valign="top" align="center" rowspan="1" colspan="1">TGAGACAGAGGCAACCTGAC</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">IL-1β</td>
<td valign="top" align="center" rowspan="1" colspan="1">98</td>
<td valign="top" align="center" rowspan="1" colspan="1">GAAGAAGAGCCCATCCTCTG</td>
<td valign="top" align="center" rowspan="1" colspan="1">TCATCTCGGAGCCTGTAGTG</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">CD163</td>
<td valign="top" align="center" rowspan="1" colspan="1">94</td>
<td valign="top" align="center" rowspan="1" colspan="1">ATGGGTGGACACAGAATGGT</td>
<td valign="top" align="center" rowspan="1" colspan="1">AGCTCACAGCCACAACAAAG</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">iNOS</td>
<td valign="top" align="center" rowspan="1" colspan="1">143</td>
<td valign="top" align="center" rowspan="1" colspan="1">CCTTGTTCAGCTACGCCTTC</td>
<td valign="top" align="center" rowspan="1" colspan="1">CTTCAGAGTCTGCCCATTGC</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/ChloroquineV1/Data/Pmc/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000601 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd -nk 000601 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    ChloroquineV1
   |flux=    Pmc
   |étape=   Curation
   |type=    RBID
   |clé=     PMC:6889929
   |texte=   Margatoxin mitigates CCl4-induced hepatic fibrosis in mice via macrophage polarization, cytokine secretion and STAT signaling
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Curation/RBID.i   -Sk "pubmed:31746414" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd   \
       | NlmPubMed2Wicri -a ChloroquineV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Wed Mar 25 22:43:59 2020. Site generation: Sun Jan 31 12:44:45 2021