Serveur d'exploration Chloroquine

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells

Identifieur interne : 000406 ( Pmc/Curation ); précédent : 000405; suivant : 000407

Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells

Auteurs : Bianhong Hu ; Wenjuan Song ; Yujie Tang ; Mingyan Shi ; Huixia Li ; Debing Yu

Source :

RBID : PMC:6826480

Abstract

Simple Summary

The process of mammary gland involution during the early is accomplished by both apoptosis and autophagy. Chemerin, a novel adipocytokine, plays a pivotal role in immune response and lipid metabolism, which was involved in the regulation of programmed cell death. This study focused on the relationship between autophagy and apoptosis in the presence of Chemerin in bovine mammary epithelial cells (BMECs). The results indicated that Chemerin could activate the complete autophagy process and induce apoptotic cascade in BMECs. The addition of Chloroquine (CQ), an inhibitor of autophagy, prompted Chemerin to have more obvious effects on apoptosis-related factors, which suggests that Chemerin-induced autophagy involves the intrinsic apoptotic pathway of BMECs. We found that the pro-apoptotic potential of Chemerin is further enhanced under conditions in which autophagy is effectively inhibited. Thus, exploring the role of autophagy and apoptosis on the involution of mammary epithelial cells will undoubtedly be of great importance in productivity improvement of dairy animals.

Abstract

Involution of the mammary gland is a complex process controlled by various endocrine hormones and cytokine. As a novel adipocytokine, Chemerin not only plays a pivotal role in physiological and pathological processes such as immune response and lipid metabolism, but is also involved in the regulation of programmed cell death, including autophagy and apoptosis. The purpose of the present study was to elucidate whether autophagy and apoptosis of bovine mammary epithelial cells (BMECs) was triggered by Chemerin. BMECs were cultured and treated with Chemerin in vitro. The expression of autophagosome-forming marker, microtubule-associated protein 1 light chain 3 II (LC3-II) and sequestosome-1 (SQSTM 1, best known as p62), a substrate of autophagosome degradation were detected. The result showed that Chemerin significantly decreased the expression of p62 and markedly induced the conversion of LC3-I to LC3-II. The ratio of Bcl2-associated X and B-cell lymphoma-2 (Bax/Bcl-2) and the activity of caspase-3 were up-regulated after being treated by Chemerin, and the apoptotic rate was also significantly increased. These results suggested that Chemerin promoted the occurrence of autophagy and apoptosis in BMECs. Chloroquine (CQ), which is an inhibitor of autophagy. To explore effects of Chemerin on apoptosis, we prevented Chemerin-induced autophagy by pre-adding CQ in BMECs. Interestingly, this part of the experiment helped us find that all effects of Chemerin on apoptosis of BMECs could be enhanced with the inhibition of autophagy. Our study demonstrates that Chemerin-induced autophagy and apoptosis are mutually regulated in BMECs, but the specific mechanism remains to be further researched.


Url:
DOI: 10.3390/ani9100848
PubMed: 31640289
PubMed Central: 6826480

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:6826480

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells</title>
<author>
<name sortKey="Hu, Bianhong" sort="Hu, Bianhong" uniqKey="Hu B" first="Bianhong" last="Hu">Bianhong Hu</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Song, Wenjuan" sort="Song, Wenjuan" uniqKey="Song W" first="Wenjuan" last="Song">Wenjuan Song</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tang, Yujie" sort="Tang, Yujie" uniqKey="Tang Y" first="Yujie" last="Tang">Yujie Tang</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Shi, Mingyan" sort="Shi, Mingyan" uniqKey="Shi M" first="Mingyan" last="Shi">Mingyan Shi</name>
<affiliation>
<nlm:aff id="af2-animals-09-00848">College of Life Science, Luoyang Normal University, Luoyang 471934, China;
<email>smy2003@sina.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Huixia" sort="Li, Huixia" uniqKey="Li H" first="Huixia" last="Li">Huixia Li</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yu, Debing" sort="Yu, Debing" uniqKey="Yu D" first="Debing" last="Yu">Debing Yu</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">31640289</idno>
<idno type="pmc">6826480</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6826480</idno>
<idno type="RBID">PMC:6826480</idno>
<idno type="doi">10.3390/ani9100848</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">000406</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000406</idno>
<idno type="wicri:Area/Pmc/Curation">000406</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000406</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells</title>
<author>
<name sortKey="Hu, Bianhong" sort="Hu, Bianhong" uniqKey="Hu B" first="Bianhong" last="Hu">Bianhong Hu</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Song, Wenjuan" sort="Song, Wenjuan" uniqKey="Song W" first="Wenjuan" last="Song">Wenjuan Song</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tang, Yujie" sort="Tang, Yujie" uniqKey="Tang Y" first="Yujie" last="Tang">Yujie Tang</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Shi, Mingyan" sort="Shi, Mingyan" uniqKey="Shi M" first="Mingyan" last="Shi">Mingyan Shi</name>
<affiliation>
<nlm:aff id="af2-animals-09-00848">College of Life Science, Luoyang Normal University, Luoyang 471934, China;
<email>smy2003@sina.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Huixia" sort="Li, Huixia" uniqKey="Li H" first="Huixia" last="Li">Huixia Li</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yu, Debing" sort="Yu, Debing" uniqKey="Yu D" first="Debing" last="Yu">Debing Yu</name>
<affiliation>
<nlm:aff id="af1-animals-09-00848">College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Animals : an Open Access Journal from MDPI</title>
<idno type="eISSN">2076-2615</idno>
<imprint>
<date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Simple Summary</title>
<p>The process of mammary gland involution during the early is accomplished by both apoptosis and autophagy. Chemerin, a novel adipocytokine, plays a pivotal role in immune response and lipid metabolism, which was involved in the regulation of programmed cell death. This study focused on the relationship between autophagy and apoptosis in the presence of Chemerin in bovine mammary epithelial cells (BMECs). The results indicated that Chemerin could activate the complete autophagy process and induce apoptotic cascade in BMECs. The addition of Chloroquine (CQ), an inhibitor of autophagy, prompted Chemerin to have more obvious effects on apoptosis-related factors, which suggests that Chemerin-induced autophagy involves the intrinsic apoptotic pathway of BMECs. We found that the pro-apoptotic potential of Chemerin is further enhanced under conditions in which autophagy is effectively inhibited. Thus, exploring the role of autophagy and apoptosis on the involution of mammary epithelial cells will undoubtedly be of great importance in productivity improvement of dairy animals. </p>
</sec>
<sec>
<title>Abstract</title>
<p>Involution of the mammary gland is a complex process controlled by various endocrine hormones and cytokine. As a novel adipocytokine, Chemerin not only plays a pivotal role in physiological and pathological processes such as immune response and lipid metabolism, but is also involved in the regulation of programmed cell death, including autophagy and apoptosis. The purpose of the present study was to elucidate whether autophagy and apoptosis of bovine mammary epithelial cells (BMECs) was triggered by Chemerin. BMECs were cultured and treated with Chemerin in vitro. The expression of autophagosome-forming marker, microtubule-associated protein 1 light chain 3 II (LC3-II) and sequestosome-1 (SQSTM 1, best known as p62), a substrate of autophagosome degradation were detected. The result showed that Chemerin significantly decreased the expression of p62 and markedly induced the conversion of LC3-I to LC3-II. The ratio of Bcl2-associated X and B-cell lymphoma-2 (Bax/Bcl-2) and the activity of caspase-3 were up-regulated after being treated by Chemerin, and the apoptotic rate was also significantly increased. These results suggested that Chemerin promoted the occurrence of autophagy and apoptosis in BMECs. Chloroquine (CQ), which is an inhibitor of autophagy. To explore effects of Chemerin on apoptosis, we prevented Chemerin-induced autophagy by pre-adding CQ in BMECs. Interestingly, this part of the experiment helped us find that all effects of Chemerin on apoptosis of BMECs could be enhanced with the inhibition of autophagy. Our study demonstrates that Chemerin-induced autophagy and apoptosis are mutually regulated in BMECs, but the specific mechanism remains to be further researched.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Walker, N I" uniqKey="Walker N">N.I. Walker</name>
</author>
<author>
<name sortKey="Bennett, R E" uniqKey="Bennett R">R.E. Bennett</name>
</author>
<author>
<name sortKey="Kerr, J F" uniqKey="Kerr J">J.F. Kerr</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Warri, A" uniqKey="Warri A">A. Warri</name>
</author>
<author>
<name sortKey="Cook, K L" uniqKey="Cook K">K.L. Cook</name>
</author>
<author>
<name sortKey="Hu, R" uniqKey="Hu R">R. Hu</name>
</author>
<author>
<name sortKey="Jin, L" uniqKey="Jin L">L. Jin</name>
</author>
<author>
<name sortKey="Zwart, A" uniqKey="Zwart A">A. Zwart</name>
</author>
<author>
<name sortKey="Soto Pantoja, D R" uniqKey="Soto Pantoja D">D.R. Soto-Pantoja</name>
</author>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J. Liu</name>
</author>
<author>
<name sortKey="Finkel, T" uniqKey="Finkel T">T. Finkel</name>
</author>
<author>
<name sortKey="Clarke, R" uniqKey="Clarke R">R. Clarke</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jeong, J" uniqKey="Jeong J">J. Jeong</name>
</author>
<author>
<name sortKey="Kim, W" uniqKey="Kim W">W. Kim</name>
</author>
<author>
<name sortKey="Hens, J" uniqKey="Hens J">J. Hens</name>
</author>
<author>
<name sortKey="Dann, P" uniqKey="Dann P">P. Dann</name>
</author>
<author>
<name sortKey="Schedin, P" uniqKey="Schedin P">P. Schedin</name>
</author>
<author>
<name sortKey="Friedman, P A" uniqKey="Friedman P">P.A. Friedman</name>
</author>
<author>
<name sortKey="Wysolmerski, J J" uniqKey="Wysolmerski J">J.J. Wysolmerski</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sobolewska, A" uniqKey="Sobolewska A">A. Sobolewska</name>
</author>
<author>
<name sortKey="Gajewska, M" uniqKey="Gajewska M">M. Gajewska</name>
</author>
<author>
<name sortKey="Zarzynska, J" uniqKey="Zarzynska J">J. Zarzynska</name>
</author>
<author>
<name sortKey="Gajkowska, B" uniqKey="Gajkowska B">B. Gajkowska</name>
</author>
<author>
<name sortKey="Motyl, T" uniqKey="Motyl T">T. Motyl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yonezawa, T" uniqKey="Yonezawa T">T. Yonezawa</name>
</author>
<author>
<name sortKey="Yonekura, S" uniqKey="Yonekura S">S. Yonekura</name>
</author>
<author>
<name sortKey="Kobayashi, Y" uniqKey="Kobayashi Y">Y. Kobayashi</name>
</author>
<author>
<name sortKey="Hagino, A" uniqKey="Hagino A">A. Hagino</name>
</author>
<author>
<name sortKey="Katoh, K" uniqKey="Katoh K">K. Katoh</name>
</author>
<author>
<name sortKey="Obara, Y" uniqKey="Obara Y">Y. Obara</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shi, H" uniqKey="Shi H">H. Shi</name>
</author>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L. Wang</name>
</author>
<author>
<name sortKey="Luo, J" uniqKey="Luo J">J. Luo</name>
</author>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J. Liu</name>
</author>
<author>
<name sortKey="Loor, J J" uniqKey="Loor J">J.J. Loor</name>
</author>
<author>
<name sortKey="Liu, H" uniqKey="Liu H">H. Liu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y. Zhang</name>
</author>
<author>
<name sortKey="Zhang, L" uniqKey="Zhang L">L. Zhang</name>
</author>
<author>
<name sortKey="Gao, J" uniqKey="Gao J">J. Gao</name>
</author>
<author>
<name sortKey="Wen, L" uniqKey="Wen L">L. Wen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chiu, C C" uniqKey="Chiu C">C.C. Chiu</name>
</author>
<author>
<name sortKey="Yeh, T H" uniqKey="Yeh T">T.H. Yeh</name>
</author>
<author>
<name sortKey="Chen, R S" uniqKey="Chen R">R.S. Chen</name>
</author>
<author>
<name sortKey="Chen, H C" uniqKey="Chen H">H.C. Chen</name>
</author>
<author>
<name sortKey="Huang, Y Z" uniqKey="Huang Y">Y.Z. Huang</name>
</author>
<author>
<name sortKey="Weng, Y H" uniqKey="Weng Y">Y.H. Weng</name>
</author>
<author>
<name sortKey="Cheng, Y C" uniqKey="Cheng Y">Y.C. Cheng</name>
</author>
<author>
<name sortKey="Liu, Y C" uniqKey="Liu Y">Y.C. Liu</name>
</author>
<author>
<name sortKey="Cheng, A J" uniqKey="Cheng A">A.J. Cheng</name>
</author>
<author>
<name sortKey="Lu, Y C" uniqKey="Lu Y">Y.C. Lu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mizushima, N" uniqKey="Mizushima N">N. Mizushima</name>
</author>
<author>
<name sortKey="Yoshimori, T" uniqKey="Yoshimori T">T. Yoshimori</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lee, H M" uniqKey="Lee H">H.M. Lee</name>
</author>
<author>
<name sortKey="Shin, D M" uniqKey="Shin D">D.M. Shin</name>
</author>
<author>
<name sortKey="Yuk, J M" uniqKey="Yuk J">J.M. Yuk</name>
</author>
<author>
<name sortKey="Shi, G" uniqKey="Shi G">G. Shi</name>
</author>
<author>
<name sortKey="Choi, D K" uniqKey="Choi D">D.K. Choi</name>
</author>
<author>
<name sortKey="Lee, S H" uniqKey="Lee S">S.H. Lee</name>
</author>
<author>
<name sortKey="Huang, S M" uniqKey="Huang S">S.M. Huang</name>
</author>
<author>
<name sortKey="Kim, J M" uniqKey="Kim J">J.M. Kim</name>
</author>
<author>
<name sortKey="Kim, C D" uniqKey="Kim C">C.D. Kim</name>
</author>
<author>
<name sortKey="Lee, J H" uniqKey="Lee J">J.H. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Motyl, T" uniqKey="Motyl T">T. Motyl</name>
</author>
<author>
<name sortKey="Gajewska, M" uniqKey="Gajewska M">M. Gajewska</name>
</author>
<author>
<name sortKey="Zarzynska, J" uniqKey="Zarzynska J">J. Zarzynska</name>
</author>
<author>
<name sortKey="Sobolewska, A" uniqKey="Sobolewska A">A. Sobolewska</name>
</author>
<author>
<name sortKey="Gajkowska, B" uniqKey="Gajkowska B">B. Gajkowska</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dutta, D" uniqKey="Dutta D">D. Dutta</name>
</author>
<author>
<name sortKey="Xu, J" uniqKey="Xu J">J. Xu</name>
</author>
<author>
<name sortKey="Kim, J S" uniqKey="Kim J">J.S. Kim</name>
</author>
<author>
<name sortKey="Dunn, W A" uniqKey="Dunn W">W.A. Dunn</name>
</author>
<author>
<name sortKey="Leeuwenburgh, C" uniqKey="Leeuwenburgh C">C. Leeuwenburgh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mizushima, N" uniqKey="Mizushima N">N. Mizushima</name>
</author>
<author>
<name sortKey="Komatsu, M" uniqKey="Komatsu M">M. Komatsu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shacka, J J" uniqKey="Shacka J">J.J. Shacka</name>
</author>
<author>
<name sortKey="Klocke, B J" uniqKey="Klocke B">B.J. Klocke</name>
</author>
<author>
<name sortKey="Roth, K A" uniqKey="Roth K">K.A. Roth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Goralski, K B" uniqKey="Goralski K">K.B. Goralski</name>
</author>
<author>
<name sortKey="Mccarthy, T C" uniqKey="Mccarthy T">T.C. McCarthy</name>
</author>
<author>
<name sortKey="Hanniman, E A" uniqKey="Hanniman E">E.A. Hanniman</name>
</author>
<author>
<name sortKey="Zabel, B A" uniqKey="Zabel B">B.A. Zabel</name>
</author>
<author>
<name sortKey="Butcher, E C" uniqKey="Butcher E">E.C. Butcher</name>
</author>
<author>
<name sortKey="Parlee, S D" uniqKey="Parlee S">S.D. Parlee</name>
</author>
<author>
<name sortKey="Muruganandan, S" uniqKey="Muruganandan S">S. Muruganandan</name>
</author>
<author>
<name sortKey="Sinal, C J" uniqKey="Sinal C">C.J. Sinal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brunetti, L" uniqKey="Brunetti L">L. Brunetti</name>
</author>
<author>
<name sortKey="Orlando, G" uniqKey="Orlando G">G. Orlando</name>
</author>
<author>
<name sortKey="Ferrante, C" uniqKey="Ferrante C">C. Ferrante</name>
</author>
<author>
<name sortKey="Recinella, L" uniqKey="Recinella L">L. Recinella</name>
</author>
<author>
<name sortKey="Leone, S" uniqKey="Leone S">S. Leone</name>
</author>
<author>
<name sortKey="Chiavaroli, A" uniqKey="Chiavaroli A">A. Chiavaroli</name>
</author>
<author>
<name sortKey="Di Nisio, C" uniqKey="Di Nisio C">C. Di Nisio</name>
</author>
<author>
<name sortKey="Shohreh, R" uniqKey="Shohreh R">R. Shohreh</name>
</author>
<author>
<name sortKey="Manippa, F" uniqKey="Manippa F">F. Manippa</name>
</author>
<author>
<name sortKey="Ricciuti, A" uniqKey="Ricciuti A">A. Ricciuti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wong, C K" uniqKey="Wong C">C.K. Wong</name>
</author>
<author>
<name sortKey="Zhang, J P" uniqKey="Zhang J">J.P. Zhang</name>
</author>
<author>
<name sortKey="Ip, W K" uniqKey="Ip W">W.K. Ip</name>
</author>
<author>
<name sortKey="Lam, C W" uniqKey="Lam C">C.W. Lam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pensa, S" uniqKey="Pensa S">S. Pensa</name>
</author>
<author>
<name sortKey="Lloyd Lewis, B" uniqKey="Lloyd Lewis B">B. Lloyd-Lewis</name>
</author>
<author>
<name sortKey="Sargeant, T J" uniqKey="Sargeant T">T.J. Sargeant</name>
</author>
<author>
<name sortKey="Resemann, H K" uniqKey="Resemann H">H.K. Resemann</name>
</author>
<author>
<name sortKey="Kahn, C R" uniqKey="Kahn C">C.R. Kahn</name>
</author>
<author>
<name sortKey="Watson, C J" uniqKey="Watson C">C.J. Watson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jovanovic Tucovic, M" uniqKey="Jovanovic Tucovic M">M. Jovanovic-Tucovic</name>
</author>
<author>
<name sortKey="Harhaji Trajkovic, L" uniqKey="Harhaji Trajkovic L">L. Harhaji-Trajkovic</name>
</author>
<author>
<name sortKey="Dulovic, M" uniqKey="Dulovic M">M. Dulovic</name>
</author>
<author>
<name sortKey="Tovilovic Kovacevic, G" uniqKey="Tovilovic Kovacevic G">G. Tovilovic-Kovacevic</name>
</author>
<author>
<name sortKey="Zogovic, N" uniqKey="Zogovic N">N. Zogovic</name>
</author>
<author>
<name sortKey="Jeremic, M" uniqKey="Jeremic M">M. Jeremic</name>
</author>
<author>
<name sortKey="Mandic, M" uniqKey="Mandic M">M. Mandic</name>
</author>
<author>
<name sortKey="Kostic, V" uniqKey="Kostic V">V. Kostic</name>
</author>
<author>
<name sortKey="Trajkovic, V" uniqKey="Trajkovic V">V. Trajkovic</name>
</author>
<author>
<name sortKey="Markovic, I" uniqKey="Markovic I">I. Markovic</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Suzuki, Y" uniqKey="Suzuki Y">Y. Suzuki</name>
</author>
<author>
<name sortKey="Haga, S" uniqKey="Haga S">S. Haga</name>
</author>
<author>
<name sortKey="Katoh, D" uniqKey="Katoh D">D. Katoh</name>
</author>
<author>
<name sortKey="So, K H" uniqKey="So K">K.H. So</name>
</author>
<author>
<name sortKey="Choi, K C" uniqKey="Choi K">K.C. Choi</name>
</author>
<author>
<name sortKey="Jung, U S" uniqKey="Jung U">U.S. Jung</name>
</author>
<author>
<name sortKey="Lee, H G" uniqKey="Lee H">H.G. Lee</name>
</author>
<author>
<name sortKey="Katoh, K" uniqKey="Katoh K">K. Katoh</name>
</author>
<author>
<name sortKey="Roh, S G" uniqKey="Roh S">S.G. Roh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xie, Q" uniqKey="Xie Q">Q. Xie</name>
</author>
<author>
<name sortKey="Deng, Y" uniqKey="Deng Y">Y. Deng</name>
</author>
<author>
<name sortKey="Huang, C" uniqKey="Huang C">C. Huang</name>
</author>
<author>
<name sortKey="Liu, P" uniqKey="Liu P">P. Liu</name>
</author>
<author>
<name sortKey="Yang, Y" uniqKey="Yang Y">Y. Yang</name>
</author>
<author>
<name sortKey="Shen, W" uniqKey="Shen W">W. Shen</name>
</author>
<author>
<name sortKey="Gao, P" uniqKey="Gao P">P. Gao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y. Li</name>
</author>
<author>
<name sortKey="Chang, Y" uniqKey="Chang Y">Y. Chang</name>
</author>
<author>
<name sortKey="Ye, N" uniqKey="Ye N">N. Ye</name>
</author>
<author>
<name sortKey="Dai, D" uniqKey="Dai D">D. Dai</name>
</author>
<author>
<name sortKey="Chen, Y" uniqKey="Chen Y">Y. Chen</name>
</author>
<author>
<name sortKey="Zhang, N" uniqKey="Zhang N">N. Zhang</name>
</author>
<author>
<name sortKey="Sun, G" uniqKey="Sun G">G. Sun</name>
</author>
<author>
<name sortKey="Sun, Y" uniqKey="Sun Y">Y. Sun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Thangarajan, S" uniqKey="Thangarajan S">S. Thangarajan</name>
</author>
<author>
<name sortKey="Vedagiri, A" uniqKey="Vedagiri A">A. Vedagiri</name>
</author>
<author>
<name sortKey="Somasundaram, S" uniqKey="Somasundaram S">S. Somasundaram</name>
</author>
<author>
<name sortKey="Sakthimanogaran, R" uniqKey="Sakthimanogaran R">R. Sakthimanogaran</name>
</author>
<author>
<name sortKey="Murugesan, M" uniqKey="Murugesan M">M. Murugesan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Coelho, D" uniqKey="Coelho D">D. Coelho</name>
</author>
<author>
<name sortKey="Holl, V" uniqKey="Holl V">V. Holl</name>
</author>
<author>
<name sortKey="Weltin, D" uniqKey="Weltin D">D. Weltin</name>
</author>
<author>
<name sortKey="Lacornerie, T" uniqKey="Lacornerie T">T. Lacornerie</name>
</author>
<author>
<name sortKey="Magnenet, P" uniqKey="Magnenet P">P. Magnenet</name>
</author>
<author>
<name sortKey="Dufour, P" uniqKey="Dufour P">P. Dufour</name>
</author>
<author>
<name sortKey="Bischoff, P" uniqKey="Bischoff P">P. Bischoff</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shu, B" uniqKey="Shu B">B. Shu</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
<author>
<name sortKey="Jiang, Z" uniqKey="Jiang Z">Z. Jiang</name>
</author>
<author>
<name sortKey="Cui, G" uniqKey="Cui G">G. Cui</name>
</author>
<author>
<name sortKey="Veeran, S" uniqKey="Veeran S">S. Veeran</name>
</author>
<author>
<name sortKey="Zhong, G" uniqKey="Zhong G">G. Zhong</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Marino, G" uniqKey="Marino G">G. Marino</name>
</author>
<author>
<name sortKey="Niso Santano, M" uniqKey="Niso Santano M">M. Niso-Santano</name>
</author>
<author>
<name sortKey="Baehrecke, E H" uniqKey="Baehrecke E">E.H. Baehrecke</name>
</author>
<author>
<name sortKey="Kroemer, G" uniqKey="Kroemer G">G. Kroemer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jiao, G" uniqKey="Jiao G">G. Jiao</name>
</author>
<author>
<name sortKey="Ren, T" uniqKey="Ren T">T. Ren</name>
</author>
<author>
<name sortKey="Guo, W" uniqKey="Guo W">W. Guo</name>
</author>
<author>
<name sortKey="Ren, C" uniqKey="Ren C">C. Ren</name>
</author>
<author>
<name sortKey="Yang, K" uniqKey="Yang K">K. Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, D" uniqKey="Liu D">D. Liu</name>
</author>
<author>
<name sortKey="Yang, Y" uniqKey="Yang Y">Y. Yang</name>
</author>
<author>
<name sortKey="Liu, Q" uniqKey="Liu Q">Q. Liu</name>
</author>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sui, X" uniqKey="Sui X">X. Sui</name>
</author>
<author>
<name sortKey="Chen, R" uniqKey="Chen R">R. Chen</name>
</author>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z. Wang</name>
</author>
<author>
<name sortKey="Huang, Z" uniqKey="Huang Z">Z. Huang</name>
</author>
<author>
<name sortKey="Kong, N" uniqKey="Kong N">N. Kong</name>
</author>
<author>
<name sortKey="Zhang, M" uniqKey="Zhang M">M. Zhang</name>
</author>
<author>
<name sortKey="Han, W" uniqKey="Han W">W. Han</name>
</author>
<author>
<name sortKey="Lou, F" uniqKey="Lou F">F. Lou</name>
</author>
<author>
<name sortKey="Yang, J" uniqKey="Yang J">J. Yang</name>
</author>
<author>
<name sortKey="Zhang, Q" uniqKey="Zhang Q">Q. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mauthe, M" uniqKey="Mauthe M">M. Mauthe</name>
</author>
<author>
<name sortKey="Orhon, I" uniqKey="Orhon I">I. Orhon</name>
</author>
<author>
<name sortKey="Rocchi, C" uniqKey="Rocchi C">C. Rocchi</name>
</author>
<author>
<name sortKey="Zhou, X" uniqKey="Zhou X">X. Zhou</name>
</author>
<author>
<name sortKey="Luhr, M" uniqKey="Luhr M">M. Luhr</name>
</author>
<author>
<name sortKey="Hijlkema, K J" uniqKey="Hijlkema K">K.J. Hijlkema</name>
</author>
<author>
<name sortKey="Coppes, R P" uniqKey="Coppes R">R.P. Coppes</name>
</author>
<author>
<name sortKey="Engedal, N" uniqKey="Engedal N">N. Engedal</name>
</author>
<author>
<name sortKey="Mari, M" uniqKey="Mari M">M. Mari</name>
</author>
<author>
<name sortKey="Reggiori, F" uniqKey="Reggiori F">F. Reggiori</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Singh, K" uniqKey="Singh K">K. Singh</name>
</author>
<author>
<name sortKey="Sharma, A" uniqKey="Sharma A">A. Sharma</name>
</author>
<author>
<name sortKey="Mir, M C" uniqKey="Mir M">M.C. Mir</name>
</author>
<author>
<name sortKey="Drazba, J A" uniqKey="Drazba J">J.A. Drazba</name>
</author>
<author>
<name sortKey="Heston, W D" uniqKey="Heston W">W.D. Heston</name>
</author>
<author>
<name sortKey="Magi Galluzzi, C" uniqKey="Magi Galluzzi C">C. Magi-Galluzzi</name>
</author>
<author>
<name sortKey="Hansel, D" uniqKey="Hansel D">D. Hansel</name>
</author>
<author>
<name sortKey="Rubin, B P" uniqKey="Rubin B">B.P. Rubin</name>
</author>
<author>
<name sortKey="Klein, E A" uniqKey="Klein E">E.A. Klein</name>
</author>
<author>
<name sortKey="Almasan, A" uniqKey="Almasan A">A. Almasan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cai, N" uniqKey="Cai N">N. Cai</name>
</author>
<author>
<name sortKey="Zhao, X" uniqKey="Zhao X">X. Zhao</name>
</author>
<author>
<name sortKey="Jing, Y" uniqKey="Jing Y">Y. Jing</name>
</author>
<author>
<name sortKey="Sun, K" uniqKey="Sun K">K. Sun</name>
</author>
<author>
<name sortKey="Jiao, S" uniqKey="Jiao S">S. Jiao</name>
</author>
<author>
<name sortKey="Chen, X" uniqKey="Chen X">X. Chen</name>
</author>
<author>
<name sortKey="Yang, H" uniqKey="Yang H">H. Yang</name>
</author>
<author>
<name sortKey="Zhou, Y" uniqKey="Zhou Y">Y. Zhou</name>
</author>
<author>
<name sortKey="Wei, L" uniqKey="Wei L">L. Wei</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Animals (Basel)</journal-id>
<journal-id journal-id-type="iso-abbrev">Animals (Basel)</journal-id>
<journal-id journal-id-type="publisher-id">animals</journal-id>
<journal-title-group>
<journal-title>Animals : an Open Access Journal from MDPI</journal-title>
</journal-title-group>
<issn pub-type="epub">2076-2615</issn>
<publisher>
<publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">31640289</article-id>
<article-id pub-id-type="pmc">6826480</article-id>
<article-id pub-id-type="doi">10.3390/ani9100848</article-id>
<article-id pub-id-type="publisher-id">animals-09-00848</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Hu</surname>
<given-names>Bianhong</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-09-00848">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Song</surname>
<given-names>Wenjuan</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-09-00848">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tang</surname>
<given-names>Yujie</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-09-00848">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Shi</surname>
<given-names>Mingyan</given-names>
</name>
<xref ref-type="aff" rid="af2-animals-09-00848">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Huixia</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-09-00848">1</xref>
<xref rid="c1-animals-09-00848" ref-type="corresp">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yu</surname>
<given-names>Debing</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-09-00848">1</xref>
<xref rid="c1-animals-09-00848" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<aff id="af1-animals-09-00848">
<label>1</label>
College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China;
<email>2016105010@njau.edu.cn</email>
(B.H.);
<email>2017105079@njau.edu.cn</email>
(W.S.);
<email>2018105010@njau.edu.cn</email>
(Y.T.)</aff>
<aff id="af2-animals-09-00848">
<label>2</label>
College of Life Science, Luoyang Normal University, Luoyang 471934, China;
<email>smy2003@sina.com</email>
</aff>
<author-notes>
<corresp id="c1-animals-09-00848">
<label>*</label>
Correspondence:
<email>lihuixia@njau.edu.cn</email>
(H.L.);
<email>yudebing@njau.edu.cn</email>
(D.Y.); Tel.: +86-25-8439-5314 (H.L.); Fax: +86-25-8439-5314 (D.Y.)</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>21</day>
<month>10</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="collection">
<month>10</month>
<year>2019</year>
</pub-date>
<volume>9</volume>
<issue>10</issue>
<elocation-id>848</elocation-id>
<history>
<date date-type="received">
<day>09</day>
<month>9</month>
<year>2019</year>
</date>
<date date-type="accepted">
<day>16</day>
<month>10</month>
<year>2019</year>
</date>
</history>
<permissions>
<copyright-statement>© 2019 by the authors.</copyright-statement>
<copyright-year>2019</copyright-year>
<license license-type="open-access">
<license-p>Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Simple Summary</title>
<p>The process of mammary gland involution during the early is accomplished by both apoptosis and autophagy. Chemerin, a novel adipocytokine, plays a pivotal role in immune response and lipid metabolism, which was involved in the regulation of programmed cell death. This study focused on the relationship between autophagy and apoptosis in the presence of Chemerin in bovine mammary epithelial cells (BMECs). The results indicated that Chemerin could activate the complete autophagy process and induce apoptotic cascade in BMECs. The addition of Chloroquine (CQ), an inhibitor of autophagy, prompted Chemerin to have more obvious effects on apoptosis-related factors, which suggests that Chemerin-induced autophagy involves the intrinsic apoptotic pathway of BMECs. We found that the pro-apoptotic potential of Chemerin is further enhanced under conditions in which autophagy is effectively inhibited. Thus, exploring the role of autophagy and apoptosis on the involution of mammary epithelial cells will undoubtedly be of great importance in productivity improvement of dairy animals. </p>
</sec>
<sec>
<title>Abstract</title>
<p>Involution of the mammary gland is a complex process controlled by various endocrine hormones and cytokine. As a novel adipocytokine, Chemerin not only plays a pivotal role in physiological and pathological processes such as immune response and lipid metabolism, but is also involved in the regulation of programmed cell death, including autophagy and apoptosis. The purpose of the present study was to elucidate whether autophagy and apoptosis of bovine mammary epithelial cells (BMECs) was triggered by Chemerin. BMECs were cultured and treated with Chemerin in vitro. The expression of autophagosome-forming marker, microtubule-associated protein 1 light chain 3 II (LC3-II) and sequestosome-1 (SQSTM 1, best known as p62), a substrate of autophagosome degradation were detected. The result showed that Chemerin significantly decreased the expression of p62 and markedly induced the conversion of LC3-I to LC3-II. The ratio of Bcl2-associated X and B-cell lymphoma-2 (Bax/Bcl-2) and the activity of caspase-3 were up-regulated after being treated by Chemerin, and the apoptotic rate was also significantly increased. These results suggested that Chemerin promoted the occurrence of autophagy and apoptosis in BMECs. Chloroquine (CQ), which is an inhibitor of autophagy. To explore effects of Chemerin on apoptosis, we prevented Chemerin-induced autophagy by pre-adding CQ in BMECs. Interestingly, this part of the experiment helped us find that all effects of Chemerin on apoptosis of BMECs could be enhanced with the inhibition of autophagy. Our study demonstrates that Chemerin-induced autophagy and apoptosis are mutually regulated in BMECs, but the specific mechanism remains to be further researched.</p>
</sec>
</abstract>
<kwd-group>
<kwd>autophagy</kwd>
<kwd>apoptosis</kwd>
<kwd>Chemerin</kwd>
<kwd>bovine mammary epithelial cells</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="animals-09-00848-f001" orientation="portrait" position="float">
<label>Figure 1</label>
<caption>
<p>The culture of bovine mammary epithelial cells (BMECs) and the immunofluorescence of cytokeratin-18 in vitro. It was proven that the cells were bovine mammary epithelial cells. (
<bold>A</bold>
) Morphology of BMECs. (
<bold>B</bold>
) The BMECs were inoculated into the cell slide, and the keratin 18 immunofluorescence staining was performed. A green positive reaction was observed around the blue nucleus. Detection of nuclei by 4’, 6-diamidino-2-phenylindole (DAPI) staining (blue). (
<bold>C</bold>
) Detection of cytokeratin-18 protein (green) by immunofluorescence staining. (
<bold>D</bold>
) Merged picture of (
<bold>B</bold>
) and (
<bold>C</bold>
).</p>
</caption>
<graphic xlink:href="animals-09-00848-g001"></graphic>
</fig>
<fig id="animals-09-00848-f002" orientation="portrait" position="float">
<label>Figure 2</label>
<caption>
<p>Chemerin promotes autophagy of BMECs. Cells were exposed to the culture medium with 0.1μg/mL Chemerin form 24 h. (
<bold>A</bold>
) LC3 protein distribution was detected by immunofluorescence staining. (
<bold>B</bold>
) The average fluorescence intensity of LC3 was determined in three randomly selected fields of view by Image J software. (
<bold>C</bold>
) Messenger RNA (mRNA) expression of sequestosome-1 (
<italic>SQSTM 1</italic>
, best known as
<italic>p62</italic>
) profiling. (
<bold>D</bold>
) Protein expression of LC3 and p62 was evaluated by Western blot. (
<bold>E</bold>
) The fluorescence intensity of protein was assayed by Image J software. All data were expressed as means ± SEM, with each treatment performed in triplicate. A single asterisk indicates a statistical difference (
<italic>p</italic>
< 0.05), and a double asterisk indicates a statistical difference (
<italic>p</italic>
< 0.01) when compared with control.</p>
</caption>
<graphic xlink:href="animals-09-00848-g002"></graphic>
</fig>
<fig id="animals-09-00848-f003" orientation="portrait" position="float">
<label>Figure 3</label>
<caption>
<p>Chemerin-induced BMECs apoptosis in BMECs. Cells were stimulated with Chemerin for 24 h. (
<bold>A</bold>
) Analysis of apoptosis via flow cytometry. (
<bold>B</bold>
) Percent apoptosis was determined in Q2 + Q3. (
<bold>C</bold>
) The ratio of Bcl2-associated X and B-cell lymphoma-2 (
<italic>Bax/Bcl-2</italic>
) was analyzed by qRT-PCR. The real-time PCR results were analyzed using a 2
<sup>−△△ct</sup>
model. (
<bold>D</bold>
) Protein expression of Bax/Bcl-2 and cleaved-caspase-3 were evaluated by Western blot. (
<bold>E</bold>
) Image J software was used to quantify the apoptosis-related protein levels. All data are expressed as means ± SEM, with each treatment performed in triplicate. A single asterisk indicates a statistical difference (
<italic>p</italic>
< 0.05), and a double asterisk indicates a statistical difference (
<italic>p</italic>
< 0.01) when compared with the control.</p>
</caption>
<graphic xlink:href="animals-09-00848-g003"></graphic>
</fig>
<fig id="animals-09-00848-f004" orientation="portrait" position="float">
<label>Figure 4</label>
<caption>
<p>Chloroquine (CQ) inhibits Chemerin-induced autophagy in BMECs. The BMECs were treated with 10 μmol/L CQ for 2 h and then incubated with 0.1 μg/mL Chemerin for 24 h. (
<bold>A</bold>
) p62 protein expression was observed by confocal microscopy in different treatment groups. (
<bold>B</bold>
) The average fluorescence intensity of p62 was quantified in different treatment groups. (
<bold>C</bold>
) mRNA expression of
<italic>p62</italic>
was detected by qRT-PCR in different treatment groups. The real-time PCR results were analyzed using a 2
<sup>−△△ct</sup>
model. (
<bold>D</bold>
) LC3 and p62 expression were analyzed by Western blot in different treatment groups. (
<bold>E</bold>
) Densitometric analysis of proteins in (
<bold>D</bold>
) by Image J software. All data are expressed as means ± SEM, with each treatment performed in triplicate. A single asterisk indicates a statistical difference (
<italic>p</italic>
< 0.05), and a double asterisk indicates a statistically significant difference (
<italic>p</italic>
< 0.01) when compared with the control. A single ampersand indicates a statistical difference (
<italic>p</italic>
< 0.05), and a double ampersand indicates a statistical difference (
<italic>p</italic>
< 0.01) when compared with the Chemerin-treatment group.</p>
</caption>
<graphic xlink:href="animals-09-00848-g004a"></graphic>
<graphic xlink:href="animals-09-00848-g004b"></graphic>
</fig>
<fig id="animals-09-00848-f005" orientation="portrait" position="float">
<label>Figure 5</label>
<caption>
<p>
<bold>Inhibition of autophagy promotes apoptosis induced by Chemerin in BMECs.</bold>
Cells were incubated in CQ-containing medium for 2 h before exposuring to the medium with 0.1 μg/mL Chemerin for 24 h. (
<bold>A</bold>
) Apoptosis was detected by Annexin V-PE/7-ADD staining. (
<bold>B</bold>
) Cells apoptosis rate were analyzed in Q2 + Q3. (
<bold>C</bold>
) mRNA expressions of
<italic>Bax/Bcl-2</italic>
were detected by qRT-PCR analysis. The real-time PCR results were analyzed by a 2
<sup>−△△ct</sup>
model. (
<bold>D</bold>
) The protein expression of Bcl2-associated X and B-cell lymphoma-2 (Bax/Bcl-2) and cleaved-caspase-3 were examined by Western blot. (
<bold>E</bold>
) Quantification of the apoptosis-associated proteins were analyzed in (
<bold>D</bold>
). All data were expressed as means ± S.E.M, with each treatment performed in triplicate. A single asterisk indicated a statistical difference (
<italic>p</italic>
< 0.05), and a double asterisk indicated a statistical difference compared with control (
<italic>p</italic>
< 0.01). A single ampersand indicated a statistical difference (
<italic>p</italic>
< 0.05), and a double ampersand indicated a statistical difference when compared with the Chemerin-treatment group (
<italic>p</italic>
< 0.01).</p>
</caption>
<graphic xlink:href="animals-09-00848-g005"></graphic>
</fig>
<fig id="animals-09-00848-f006" orientation="portrait" position="float">
<label>Figure 6</label>
<caption>
<p>A schematic illustration of the role of Chemerin in BMECs. Chemerin induced autophagy through promoting degradation of p62 and conversion of LC3I to LC3II. Chemerin also induced apoptosis by up-regulation of the Bax/Bcl-2 and activating caspase-3. In addition, there was a complex interplay between apoptosis and autophagy under Chemerin treatment, CQ pretreatment could effectively inhibit autophagy and aggravate apoptosis.</p>
</caption>
<graphic xlink:href="animals-09-00848-g006"></graphic>
</fig>
<table-wrap id="animals-09-00848-t001" orientation="portrait" position="float">
<object-id pub-id-type="pii">animals-09-00848-t001_Table 1</object-id>
<label>Table 1</label>
<caption>
<p>Primer sequences for qRT-PCR.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Genes</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Forward (5′–3′)</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Reverse (5′–3′)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p62</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ATTGAGCCAGCTCAGGCTGT</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CTGGCTGGAAGTCAGGCTGT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>Bax</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CCAGCAAACTGGTGCTCAAGG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGCCGCTCTCGAAGGAAGTC</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>Bcl-2</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGCATCGCCCTGTGGATGAC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CAGCCTCCGTTGTCCTGGAT</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>GAPDH</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">AAGGTCGGAGTGAACR</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CGTTCTCTGCCTTGACTGTG</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<italic>P62</italic>
: Sequestosome 1, an autophagy selective substrate.
<italic>Bax</italic>
: BCL2-Associated X Protein, plays a role in the mitochondrial apoptotic process.
<italic>Bcl-2</italic>
: B-cell lymphoma-2, a cancer gene that inhibits apoptosis.
<italic>GAPDH</italic>
: glyceraldehyde-3-phosphate dehydrogenase, an internal reference gene.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/ChloroquineV1/Data/Pmc/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000406 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd -nk 000406 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    ChloroquineV1
   |flux=    Pmc
   |étape=   Curation
   |type=    RBID
   |clé=     PMC:6826480
   |texte=   Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Curation/RBID.i   -Sk "pubmed:31640289" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd   \
       | NlmPubMed2Wicri -a ChloroquineV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Wed Mar 25 22:43:59 2020. Site generation: Sun Jan 31 12:44:45 2021