Serveur d'exploration Chloroquine

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Silencing of PARP2 Blocks Autophagic Degradation

Identifieur interne : 000044 ( Pmc/Checkpoint ); précédent : 000043; suivant : 000045

Silencing of PARP2 Blocks Autophagic Degradation

Auteurs : Laura Jank ; Zsanett Sári ; Tünde Kovács ; Gréta Kis ; Magdolna Szánt ; Mikl S Antal ; Gábor Juhász [Hongrie] ; Péter Bai [Hongrie]

Source :

RBID : PMC:7072353

Abstract

Poly(ADP-Ribose) polymerases (PARPs) are enzymes that metabolize NAD+. PARP1 and PARP10 were previously implicated in the regulation of autophagy. Here we showed that cytosolic electron-dense particles appear in the cytoplasm of C2C12 myoblasts in which PARP2 is silenced by shRNA. The cytosolic electron-dense bodies resemble autophagic vesicles and, in line with that, we observed an increased number of LC3-positive and Lysotracker-stained vesicles. Silencing of PARP2 did not influence the maximal number of LC3-positive vesicles seen upon chloroquine treatment or serum starvation, suggesting that the absence of PARP2 inhibits autophagic breakdown. Silencing of PARP2 inhibited the activity of AMP-activated kinase (AMPK) and the mammalian target of rapamycin complex 2 (mTORC2). Treatment of PARP2-silenced C2C12 cells with AICAR, an AMPK activator, nicotinamide-riboside (an NAD+ precursor), or EX-527 (a SIRT1 inhibitor) decreased the number of LC3-positive vesicles cells to similar levels as in control (scPARP2) cells, suggesting that these pathways inhibit autophagic flux upon PARP2 silencing. We observed a similar increase in the number of LC3 vesicles in primary PARP2 knockout murine embryonic fibroblasts. We provided evidence that the enzymatic activity of PARP2 is important in regulating autophagy. Finally, we showed that the silencing of PARP2 induces myoblast differentiation. Taken together, PARP2 is a positive regulator of autophagic breakdown in mammalian transformed cells and its absence blocks the progression of autophagy.


Url:
DOI: 10.3390/cells9020380
PubMed: 32046043
PubMed Central: 7072353


Affiliations:


Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:7072353

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Silencing of PARP2 Blocks Autophagic Degradation</title>
<author>
<name sortKey="Jank, Laura" sort="Jank, Laura" uniqKey="Jank L" first="Laura" last="Jank">Laura Jank</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sari, Zsanett" sort="Sari, Zsanett" uniqKey="Sari Z" first="Zsanett" last="Sári">Zsanett Sári</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kovacs, Tunde" sort="Kovacs, Tunde" uniqKey="Kovacs T" first="Tünde" last="Kovács">Tünde Kovács</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kis, Greta" sort="Kis, Greta" uniqKey="Kis G" first="Gréta" last="Kis">Gréta Kis</name>
<affiliation>
<nlm:aff id="af2-cells-09-00380">Department of Anatomy, Histology and Embryology, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>greta@anat.med.unideb.hu</email>
(G.K.);
<email>antal@anat.med.unideb.hu</email>
(M.A.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Szant, Magdolna" sort="Szant, Magdolna" uniqKey="Szant M" first="Magdolna" last="Szánt">Magdolna Szánt</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Antal, Mikl S" sort="Antal, Mikl S" uniqKey="Antal M" first="Mikl S" last="Antal">Mikl S Antal</name>
<affiliation>
<nlm:aff id="af2-cells-09-00380">Department of Anatomy, Histology and Embryology, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>greta@anat.med.unideb.hu</email>
(G.K.);
<email>antal@anat.med.unideb.hu</email>
(M.A.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Juhasz, Gabor" sort="Juhasz, Gabor" uniqKey="Juhasz G" first="Gábor" last="Juhász">Gábor Juhász</name>
<affiliation>
<nlm:aff id="af3-cells-09-00380">Institute of Genetics, Biological Research Centre, H-6726 Szeged, Hungary;
<email>gabor.juhasz@ttk.elte.hu</email>
</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af4-cells-09-00380">Department of Anatomy, Cell and Developmental Biology, Eötvös Loránd University, H-1117 Budapest, Hungary</nlm:aff>
<country xml:lang="fr">Hongrie</country>
<wicri:regionArea>Department of Anatomy, Cell and Developmental Biology, Eötvös Loránd University, H-1117 Budapest</wicri:regionArea>
<wicri:noRegion>H-1117 Budapest</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Bai, Peter" sort="Bai, Peter" uniqKey="Bai P" first="Péter" last="Bai">Péter Bai</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-cells-09-00380">MTA-DE Lendület Laboratory of Cellular Metabolism, H-4032 Debrecen, Hungary</nlm:aff>
<country xml:lang="fr">Hongrie</country>
<wicri:regionArea>MTA-DE Lendület Laboratory of Cellular Metabolism, H-4032 Debrecen</wicri:regionArea>
<wicri:noRegion>H-4032 Debrecen</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af6-cells-09-00380">Research Center for Molecular Medicine, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary</nlm:aff>
<country xml:lang="fr">Hongrie</country>
<wicri:regionArea>Research Center for Molecular Medicine, Faculty of Medicine, University of Debrecen, H-4032 Debrecen</wicri:regionArea>
<wicri:noRegion>H-4032 Debrecen</wicri:noRegion>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">32046043</idno>
<idno type="pmc">7072353</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7072353</idno>
<idno type="RBID">PMC:7072353</idno>
<idno type="doi">10.3390/cells9020380</idno>
<date when="2020">2020</date>
<idno type="wicri:Area/Pmc/Corpus">000482</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000482</idno>
<idno type="wicri:Area/Pmc/Curation">000482</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000482</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000044</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000044</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Silencing of PARP2 Blocks Autophagic Degradation</title>
<author>
<name sortKey="Jank, Laura" sort="Jank, Laura" uniqKey="Jank L" first="Laura" last="Jank">Laura Jank</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sari, Zsanett" sort="Sari, Zsanett" uniqKey="Sari Z" first="Zsanett" last="Sári">Zsanett Sári</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kovacs, Tunde" sort="Kovacs, Tunde" uniqKey="Kovacs T" first="Tünde" last="Kovács">Tünde Kovács</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kis, Greta" sort="Kis, Greta" uniqKey="Kis G" first="Gréta" last="Kis">Gréta Kis</name>
<affiliation>
<nlm:aff id="af2-cells-09-00380">Department of Anatomy, Histology and Embryology, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>greta@anat.med.unideb.hu</email>
(G.K.);
<email>antal@anat.med.unideb.hu</email>
(M.A.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Szant, Magdolna" sort="Szant, Magdolna" uniqKey="Szant M" first="Magdolna" last="Szánt">Magdolna Szánt</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Antal, Mikl S" sort="Antal, Mikl S" uniqKey="Antal M" first="Mikl S" last="Antal">Mikl S Antal</name>
<affiliation>
<nlm:aff id="af2-cells-09-00380">Department of Anatomy, Histology and Embryology, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>greta@anat.med.unideb.hu</email>
(G.K.);
<email>antal@anat.med.unideb.hu</email>
(M.A.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Juhasz, Gabor" sort="Juhasz, Gabor" uniqKey="Juhasz G" first="Gábor" last="Juhász">Gábor Juhász</name>
<affiliation>
<nlm:aff id="af3-cells-09-00380">Institute of Genetics, Biological Research Centre, H-6726 Szeged, Hungary;
<email>gabor.juhasz@ttk.elte.hu</email>
</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af4-cells-09-00380">Department of Anatomy, Cell and Developmental Biology, Eötvös Loránd University, H-1117 Budapest, Hungary</nlm:aff>
<country xml:lang="fr">Hongrie</country>
<wicri:regionArea>Department of Anatomy, Cell and Developmental Biology, Eötvös Loránd University, H-1117 Budapest</wicri:regionArea>
<wicri:noRegion>H-1117 Budapest</wicri:noRegion>
</affiliation>
</author>
<author>
<name sortKey="Bai, Peter" sort="Bai, Peter" uniqKey="Bai P" first="Péter" last="Bai">Péter Bai</name>
<affiliation>
<nlm:aff id="af1-cells-09-00380">Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af5-cells-09-00380">MTA-DE Lendület Laboratory of Cellular Metabolism, H-4032 Debrecen, Hungary</nlm:aff>
<country xml:lang="fr">Hongrie</country>
<wicri:regionArea>MTA-DE Lendület Laboratory of Cellular Metabolism, H-4032 Debrecen</wicri:regionArea>
<wicri:noRegion>H-4032 Debrecen</wicri:noRegion>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af6-cells-09-00380">Research Center for Molecular Medicine, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary</nlm:aff>
<country xml:lang="fr">Hongrie</country>
<wicri:regionArea>Research Center for Molecular Medicine, Faculty of Medicine, University of Debrecen, H-4032 Debrecen</wicri:regionArea>
<wicri:noRegion>H-4032 Debrecen</wicri:noRegion>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Cells</title>
<idno type="eISSN">2073-4409</idno>
<imprint>
<date when="2020">2020</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>Poly(ADP-Ribose) polymerases (PARPs) are enzymes that metabolize NAD
<sup>+</sup>
. PARP1 and PARP10 were previously implicated in the regulation of autophagy. Here we showed that cytosolic electron-dense particles appear in the cytoplasm of C2C12 myoblasts in which PARP2 is silenced by shRNA. The cytosolic electron-dense bodies resemble autophagic vesicles and, in line with that, we observed an increased number of LC3-positive and Lysotracker-stained vesicles. Silencing of PARP2 did not influence the maximal number of LC3-positive vesicles seen upon chloroquine treatment or serum starvation, suggesting that the absence of PARP2 inhibits autophagic breakdown. Silencing of PARP2 inhibited the activity of AMP-activated kinase (AMPK) and the mammalian target of rapamycin complex 2 (mTORC2). Treatment of PARP2-silenced C2C12 cells with AICAR, an AMPK activator, nicotinamide-riboside (an NAD
<sup>+</sup>
precursor), or EX-527 (a SIRT1 inhibitor) decreased the number of LC3-positive vesicles cells to similar levels as in control (scPARP2) cells, suggesting that these pathways inhibit autophagic flux upon PARP2 silencing. We observed a similar increase in the number of LC3 vesicles in primary PARP2 knockout murine embryonic fibroblasts. We provided evidence that the enzymatic activity of PARP2 is important in regulating autophagy. Finally, we showed that the silencing of PARP2 induces myoblast differentiation. Taken together, PARP2 is a positive regulator of autophagic breakdown in mammalian transformed cells and its absence blocks the progression of autophagy.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ame, J C" uniqKey="Ame J">J.C. Ame</name>
</author>
<author>
<name sortKey="Rolli, V" uniqKey="Rolli V">V. Rolli</name>
</author>
<author>
<name sortKey="Schreiber, V" uniqKey="Schreiber V">V. Schreiber</name>
</author>
<author>
<name sortKey="Niedergang, C" uniqKey="Niedergang C">C. Niedergang</name>
</author>
<author>
<name sortKey="Apiou, F" uniqKey="Apiou F">F. Apiou</name>
</author>
<author>
<name sortKey="Decker, P" uniqKey="Decker P">P. Decker</name>
</author>
<author>
<name sortKey="Muller, S" uniqKey="Muller S">S. Muller</name>
</author>
<author>
<name sortKey="Hoger, T" uniqKey="Hoger T">T. Hoger</name>
</author>
<author>
<name sortKey="Menissier De Murcia, J" uniqKey="Menissier De Murcia J">J. Menissier-de Murcia</name>
</author>
<author>
<name sortKey="De Murcia, G" uniqKey="De Murcia G">G. de Murcia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Leger, K" uniqKey="Leger K">K. Leger</name>
</author>
<author>
<name sortKey="Bar, D" uniqKey="Bar D">D. Bar</name>
</author>
<author>
<name sortKey="Savic, N" uniqKey="Savic N">N. Savic</name>
</author>
<author>
<name sortKey="Santoro, R" uniqKey="Santoro R">R. Santoro</name>
</author>
<author>
<name sortKey="Hottiger, M O" uniqKey="Hottiger M">M.O. Hottiger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Szanto, M" uniqKey="Szanto M">M. Szanto</name>
</author>
<author>
<name sortKey="Brunyanszki, A" uniqKey="Brunyanszki A">A. Brunyánszki</name>
</author>
<author>
<name sortKey="Kiss, B" uniqKey="Kiss B">B. Kiss</name>
</author>
<author>
<name sortKey="Nagy, L" uniqKey="Nagy L">L. Nagy</name>
</author>
<author>
<name sortKey="Gergely, P" uniqKey="Gergely P">P. Gergely</name>
</author>
<author>
<name sortKey="Virag, L" uniqKey="Virag L">L. Virag</name>
</author>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Szanto, M" uniqKey="Szanto M">M. Szanto</name>
</author>
<author>
<name sortKey="Rutkai, I" uniqKey="Rutkai I">I. Rutkai</name>
</author>
<author>
<name sortKey="Hegedus, C" uniqKey="Hegedus C">C. Hegedus</name>
</author>
<author>
<name sortKey="Czikora, A" uniqKey="Czikora A">A. Czikora</name>
</author>
<author>
<name sortKey="Rozsahegyi, M" uniqKey="Rozsahegyi M">M. Rozsahegyi</name>
</author>
<author>
<name sortKey="Kiss, B" uniqKey="Kiss B">B. Kiss</name>
</author>
<author>
<name sortKey="Virag, L" uniqKey="Virag L">L. Virag</name>
</author>
<author>
<name sortKey="Gergely, P" uniqKey="Gergely P">P. Gergely</name>
</author>
<author>
<name sortKey="Toth, A" uniqKey="Toth A">A. Toth</name>
</author>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schreiber, V" uniqKey="Schreiber V">V. Schreiber</name>
</author>
<author>
<name sortKey="Ame, J C" uniqKey="Ame J">J.C. Ame</name>
</author>
<author>
<name sortKey="Dolle, P" uniqKey="Dolle P">P. Dolle</name>
</author>
<author>
<name sortKey="Schultz, I" uniqKey="Schultz I">I. Schultz</name>
</author>
<author>
<name sortKey="Rinaldi, B" uniqKey="Rinaldi B">B. Rinaldi</name>
</author>
<author>
<name sortKey="Fraulob, V" uniqKey="Fraulob V">V. Fraulob</name>
</author>
<author>
<name sortKey="Menissier De Murcia, J" uniqKey="Menissier De Murcia J">J. Menissier-de Murcia</name>
</author>
<author>
<name sortKey="De Murcia, G" uniqKey="De Murcia G">G. de Murcia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
<author>
<name sortKey="Nagy, L" uniqKey="Nagy L">L. Nagy</name>
</author>
<author>
<name sortKey="Fodor, T" uniqKey="Fodor T">T. Fodor</name>
</author>
<author>
<name sortKey="Liaudet, L" uniqKey="Liaudet L">L. Liaudet</name>
</author>
<author>
<name sortKey="Pacher, P" uniqKey="Pacher P">P. Pacher</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gupte, R" uniqKey="Gupte R">R. Gupte</name>
</author>
<author>
<name sortKey="Liu, Z" uniqKey="Liu Z">Z. Liu</name>
</author>
<author>
<name sortKey="Kraus, W L" uniqKey="Kraus W">W.L. Kraus</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ryu, K W" uniqKey="Ryu K">K.W. Ryu</name>
</author>
<author>
<name sortKey="Nandu, T" uniqKey="Nandu T">T. Nandu</name>
</author>
<author>
<name sortKey="Kim, J" uniqKey="Kim J">J. Kim</name>
</author>
<author>
<name sortKey="Challa, S" uniqKey="Challa S">S. Challa</name>
</author>
<author>
<name sortKey="Deberardinis, R J" uniqKey="Deberardinis R">R.J. DeBerardinis</name>
</author>
<author>
<name sortKey="Kraus, W L" uniqKey="Kraus W">W.L. Kraus</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Levine, B" uniqKey="Levine B">B. Levine</name>
</author>
<author>
<name sortKey="Kroemer, G" uniqKey="Kroemer G">G. Kroemer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bhattacharjee, A" uniqKey="Bhattacharjee A">A. Bhattacharjee</name>
</author>
<author>
<name sortKey="Szabo, A" uniqKey="Szabo A">A. Szabo</name>
</author>
<author>
<name sortKey="Csizmadia, T" uniqKey="Csizmadia T">T. Csizmadia</name>
</author>
<author>
<name sortKey="Laczko Dobos, H" uniqKey="Laczko Dobos H">H. Laczko-Dobos</name>
</author>
<author>
<name sortKey="Juhasz, G" uniqKey="Juhasz G">G. Juhasz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Klionsky, D J" uniqKey="Klionsky D">D.J. Klionsky</name>
</author>
<author>
<name sortKey="Abdelmohsen, K" uniqKey="Abdelmohsen K">K. Abdelmohsen</name>
</author>
<author>
<name sortKey="Abe, A" uniqKey="Abe A">A. Abe</name>
</author>
<author>
<name sortKey="Abedin, M J" uniqKey="Abedin M">M.J. Abedin</name>
</author>
<author>
<name sortKey="Abeliovich, H" uniqKey="Abeliovich H">H. Abeliovich</name>
</author>
<author>
<name sortKey="Acevedo Arozena, A" uniqKey="Acevedo Arozena A">A. Acevedo Arozena</name>
</author>
<author>
<name sortKey="Adachi, H" uniqKey="Adachi H">H. Adachi</name>
</author>
<author>
<name sortKey="Adams, C M" uniqKey="Adams C">C.M. Adams</name>
</author>
<author>
<name sortKey="Adams, P D" uniqKey="Adams P">P.D. Adams</name>
</author>
<author>
<name sortKey="Adeli, K" uniqKey="Adeli K">K. Adeli</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Martinez Outschoorn, U E" uniqKey="Martinez Outschoorn U">U.E. Martinez-Outschoorn</name>
</author>
<author>
<name sortKey="Peiris Pages, M" uniqKey="Peiris Pages M">M. Peiris-Pages</name>
</author>
<author>
<name sortKey="Pestell, R G" uniqKey="Pestell R">R.G. Pestell</name>
</author>
<author>
<name sortKey="Sotgia, F" uniqKey="Sotgia F">F. Sotgia</name>
</author>
<author>
<name sortKey="Lisanti, M P" uniqKey="Lisanti M">M.P. Lisanti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Quan, W" uniqKey="Quan W">W. Quan</name>
</author>
<author>
<name sortKey="Lee, M S" uniqKey="Lee M">M.S. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Singh, R" uniqKey="Singh R">R. Singh</name>
</author>
<author>
<name sortKey="Cuervo, A M" uniqKey="Cuervo A">A.M. Cuervo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kleine, H" uniqKey="Kleine H">H. Kleine</name>
</author>
<author>
<name sortKey="Herrmann, A" uniqKey="Herrmann A">A. Herrmann</name>
</author>
<author>
<name sortKey="Lamark, T" uniqKey="Lamark T">T. Lamark</name>
</author>
<author>
<name sortKey="Forst, A H" uniqKey="Forst A">A.H. Forst</name>
</author>
<author>
<name sortKey="Verheugd, P" uniqKey="Verheugd P">P. Verheugd</name>
</author>
<author>
<name sortKey="Luscher Firzlaff, J" uniqKey="Luscher Firzlaff J">J. Luscher-Firzlaff</name>
</author>
<author>
<name sortKey="Lippok, B" uniqKey="Lippok B">B. Lippok</name>
</author>
<author>
<name sortKey="Feijs, K L" uniqKey="Feijs K">K.L. Feijs</name>
</author>
<author>
<name sortKey="Herzog, N" uniqKey="Herzog N">N. Herzog</name>
</author>
<author>
<name sortKey="Kremmer, E" uniqKey="Kremmer E">E. Kremmer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Munoz Gamez, J A" uniqKey="Munoz Gamez J">J.A. Munoz-Gamez</name>
</author>
<author>
<name sortKey="Rodriguez Vargas, J M" uniqKey="Rodriguez Vargas J">J.M. Rodriguez-Vargas</name>
</author>
<author>
<name sortKey="Quiles Perez, R" uniqKey="Quiles Perez R">R. Quiles-Perez</name>
</author>
<author>
<name sortKey="Aguilar Quesada, R" uniqKey="Aguilar Quesada R">R. Aguilar-Quesada</name>
</author>
<author>
<name sortKey="Martin Oliva, D" uniqKey="Martin Oliva D">D. Martin-Oliva</name>
</author>
<author>
<name sortKey="De Murcia, G" uniqKey="De Murcia G">G. de Murcia</name>
</author>
<author>
<name sortKey="Menissier De Murcia, J" uniqKey="Menissier De Murcia J">J. Menissier de Murcia</name>
</author>
<author>
<name sortKey="Almendros, A" uniqKey="Almendros A">A. Almendros</name>
</author>
<author>
<name sortKey="Ruiz De Almodovar, M" uniqKey="Ruiz De Almodovar M">M. Ruiz de Almodovar</name>
</author>
<author>
<name sortKey="Oliver, F J" uniqKey="Oliver F">F.J. Oliver</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rodriguez Vargas, J M" uniqKey="Rodriguez Vargas J">J.M. Rodriguez-Vargas</name>
</author>
<author>
<name sortKey="Ruiz Magana, M J" uniqKey="Ruiz Magana M">M.J. Ruiz-Magana</name>
</author>
<author>
<name sortKey="Ruiz Ruiz, C" uniqKey="Ruiz Ruiz C">C. Ruiz-Ruiz</name>
</author>
<author>
<name sortKey="Majuelos Melguizo, J" uniqKey="Majuelos Melguizo J">J. Majuelos-Melguizo</name>
</author>
<author>
<name sortKey="Peralta Leal, A" uniqKey="Peralta Leal A">A. Peralta-Leal</name>
</author>
<author>
<name sortKey="Rodriguez, M I" uniqKey="Rodriguez M">M.I. Rodriguez</name>
</author>
<author>
<name sortKey="Munoz Gamez, J A" uniqKey="Munoz Gamez J">J.A. Munoz-Gamez</name>
</author>
<author>
<name sortKey="De Almodovar, M R" uniqKey="De Almodovar M">M.R. de Almodovar</name>
</author>
<author>
<name sortKey="Siles, E" uniqKey="Siles E">E. Siles</name>
</author>
<author>
<name sortKey="Rivas, A L" uniqKey="Rivas A">A.L. Rivas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rodriguez Vargas, J M" uniqKey="Rodriguez Vargas J">J.M. Rodriguez-Vargas</name>
</author>
<author>
<name sortKey="Rodriguez, M I" uniqKey="Rodriguez M">M.I. Rodriguez</name>
</author>
<author>
<name sortKey="Majuelos Melguizo, J" uniqKey="Majuelos Melguizo J">J. Majuelos-Melguizo</name>
</author>
<author>
<name sortKey="Garcia Diaz, A" uniqKey="Garcia Diaz A">A. Garcia-Diaz</name>
</author>
<author>
<name sortKey="Gonzalez Flores, A" uniqKey="Gonzalez Flores A">A. Gonzalez-Flores</name>
</author>
<author>
<name sortKey="Lopez Rivas, A" uniqKey="Lopez Rivas A">A. Lopez-Rivas</name>
</author>
<author>
<name sortKey="Virag, L" uniqKey="Virag L">L. Virag</name>
</author>
<author>
<name sortKey="Illuzzi, G" uniqKey="Illuzzi G">G. Illuzzi</name>
</author>
<author>
<name sortKey="Schreiber, V" uniqKey="Schreiber V">V. Schreiber</name>
</author>
<author>
<name sortKey="Dantzer, F" uniqKey="Dantzer F">F. Dantzer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Santiago O Arrill, J M" uniqKey="Santiago O Arrill J">J.M. Santiago-O’Farrill</name>
</author>
<author>
<name sortKey="Weroha, S J" uniqKey="Weroha S">S.J. Weroha</name>
</author>
<author>
<name sortKey="Hou, X" uniqKey="Hou X">X. Hou</name>
</author>
<author>
<name sortKey="Oberg, A L" uniqKey="Oberg A">A.L. Oberg</name>
</author>
<author>
<name sortKey="Heinzen, E P" uniqKey="Heinzen E">E.P. Heinzen</name>
</author>
<author>
<name sortKey="Maurer, M J" uniqKey="Maurer M">M.J. Maurer</name>
</author>
<author>
<name sortKey="Pang, L" uniqKey="Pang L">L. Pang</name>
</author>
<author>
<name sortKey="Rask, P" uniqKey="Rask P">P. Rask</name>
</author>
<author>
<name sortKey="Amaravadi, R K" uniqKey="Amaravadi R">R.K. Amaravadi</name>
</author>
<author>
<name sortKey="Becker, S E" uniqKey="Becker S">S.E. Becker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y. Liu</name>
</author>
<author>
<name sortKey="Song, H" uniqKey="Song H">H. Song</name>
</author>
<author>
<name sortKey="Song, H" uniqKey="Song H">H. Song</name>
</author>
<author>
<name sortKey="Feng, X" uniqKey="Feng X">X. Feng</name>
</author>
<author>
<name sortKey="Zhou, C" uniqKey="Zhou C">C. Zhou</name>
</author>
<author>
<name sortKey="Huo, Z" uniqKey="Huo Z">Z. Huo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zai, W" uniqKey="Zai W">W. Zai</name>
</author>
<author>
<name sortKey="Chen, W" uniqKey="Chen W">W. Chen</name>
</author>
<author>
<name sortKey="Han, Y" uniqKey="Han Y">Y. Han</name>
</author>
<author>
<name sortKey="Wu, Z" uniqKey="Wu Z">Z. Wu</name>
</author>
<author>
<name sortKey="Fan, J" uniqKey="Fan J">J. Fan</name>
</author>
<author>
<name sortKey="Zhang, X" uniqKey="Zhang X">X. Zhang</name>
</author>
<author>
<name sortKey="Luan, J" uniqKey="Luan J">J. Luan</name>
</author>
<author>
<name sortKey="Tang, S" uniqKey="Tang S">S. Tang</name>
</author>
<author>
<name sortKey="Jin, X" uniqKey="Jin X">X. Jin</name>
</author>
<author>
<name sortKey="Fu, X" uniqKey="Fu X">X. Fu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xu, L" uniqKey="Xu L">L. Xu</name>
</author>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J. Liu</name>
</author>
<author>
<name sortKey="Chen, Y" uniqKey="Chen Y">Y. Chen</name>
</author>
<author>
<name sortKey="Yun, L" uniqKey="Yun L">L. Yun</name>
</author>
<author>
<name sortKey="Chen, S" uniqKey="Chen S">S. Chen</name>
</author>
<author>
<name sortKey="Zhou, K" uniqKey="Zhou K">K. Zhou</name>
</author>
<author>
<name sortKey="Lai, B" uniqKey="Lai B">B. Lai</name>
</author>
<author>
<name sortKey="Song, L" uniqKey="Song L">L. Song</name>
</author>
<author>
<name sortKey="Yang, H" uniqKey="Yang H">H. Yang</name>
</author>
<author>
<name sortKey="Liang, H" uniqKey="Liang H">H. Liang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, W" uniqKey="Liu W">W. Liu</name>
</author>
<author>
<name sortKey="Dai, N" uniqKey="Dai N">N. Dai</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y. Wang</name>
</author>
<author>
<name sortKey="Xu, C" uniqKey="Xu C">C. Xu</name>
</author>
<author>
<name sortKey="Zhao, H" uniqKey="Zhao H">H. Zhao</name>
</author>
<author>
<name sortKey="Xia, P" uniqKey="Xia P">P. Xia</name>
</author>
<author>
<name sortKey="Gu, J" uniqKey="Gu J">J. Gu</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X. Liu</name>
</author>
<author>
<name sortKey="Bian, J" uniqKey="Bian J">J. Bian</name>
</author>
<author>
<name sortKey="Yuan, Y" uniqKey="Yuan Y">Y. Yuan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhou, Z R" uniqKey="Zhou Z">Z.R. Zhou</name>
</author>
<author>
<name sortKey="Zhu, X D" uniqKey="Zhu X">X.D. Zhu</name>
</author>
<author>
<name sortKey="Zhao, W" uniqKey="Zhao W">W. Zhao</name>
</author>
<author>
<name sortKey="Qu, S" uniqKey="Qu S">S. Qu</name>
</author>
<author>
<name sortKey="Su, F" uniqKey="Su F">F. Su</name>
</author>
<author>
<name sortKey="Huang, S T" uniqKey="Huang S">S.T. Huang</name>
</author>
<author>
<name sortKey="Ma, J L" uniqKey="Ma J">J.L. Ma</name>
</author>
<author>
<name sortKey="Li, X Y" uniqKey="Li X">X.Y. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, J" uniqKey="Kim J">J. Kim</name>
</author>
<author>
<name sortKey="Lim, W" uniqKey="Lim W">W. Lim</name>
</author>
<author>
<name sortKey="Kim, S" uniqKey="Kim S">S. Kim</name>
</author>
<author>
<name sortKey="Jeon, S" uniqKey="Jeon S">S. Jeon</name>
</author>
<author>
<name sortKey="Hui, Z" uniqKey="Hui Z">Z. Hui</name>
</author>
<author>
<name sortKey="Ni, K" uniqKey="Ni K">K. Ni</name>
</author>
<author>
<name sortKey="Kim, C" uniqKey="Kim C">C. Kim</name>
</author>
<author>
<name sortKey="Im, Y" uniqKey="Im Y">Y. Im</name>
</author>
<author>
<name sortKey="Choi, H" uniqKey="Choi H">H. Choi</name>
</author>
<author>
<name sortKey="Kim, O" uniqKey="Kim O">O. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X. Wang</name>
</author>
<author>
<name sortKey="Tu, W" uniqKey="Tu W">W. Tu</name>
</author>
<author>
<name sortKey="Chen, D" uniqKey="Chen D">D. Chen</name>
</author>
<author>
<name sortKey="Fu, J" uniqKey="Fu J">J. Fu</name>
</author>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J. Wang</name>
</author>
<author>
<name sortKey="Shao, C" uniqKey="Shao C">C. Shao</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Meng, Y Y" uniqKey="Meng Y">Y.Y. Meng</name>
</author>
<author>
<name sortKey="Wu, C W" uniqKey="Wu C">C.W. Wu</name>
</author>
<author>
<name sortKey="Yu, B" uniqKey="Yu B">B. Yu</name>
</author>
<author>
<name sortKey="Li, H" uniqKey="Li H">H. Li</name>
</author>
<author>
<name sortKey="Chen, M" uniqKey="Chen M">M. Chen</name>
</author>
<author>
<name sortKey="Qi, G X" uniqKey="Qi G">G.X. Qi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Son, Y O" uniqKey="Son Y">Y.O. Son</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X. Wang</name>
</author>
<author>
<name sortKey="Hitron, J A" uniqKey="Hitron J">J.A. Hitron</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z. Zhang</name>
</author>
<author>
<name sortKey="Cheng, S" uniqKey="Cheng S">S. Cheng</name>
</author>
<author>
<name sortKey="Budhraja, A" uniqKey="Budhraja A">A. Budhraja</name>
</author>
<author>
<name sortKey="Ding, S" uniqKey="Ding S">S. Ding</name>
</author>
<author>
<name sortKey="Lee, J C" uniqKey="Lee J">J.C. Lee</name>
</author>
<author>
<name sortKey="Shi, X" uniqKey="Shi X">X. Shi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Heged S, C" uniqKey="Heged S C">C. Hegedűs</name>
</author>
<author>
<name sortKey="Boros, G" uniqKey="Boros G">G. Boros</name>
</author>
<author>
<name sortKey="Fidrus, E" uniqKey="Fidrus E">E. Fidrus</name>
</author>
<author>
<name sortKey="Kis, G N" uniqKey="Kis G">G.N. Kis</name>
</author>
<author>
<name sortKey="Antal, M" uniqKey="Antal M">M. Antal</name>
</author>
<author>
<name sortKey="Juhasz, T" uniqKey="Juhasz T">T. Juhász</name>
</author>
<author>
<name sortKey="Janka, E A" uniqKey="Janka E">E.A. Janka</name>
</author>
<author>
<name sortKey="Jank, L" uniqKey="Jank L">L. Jankó</name>
</author>
<author>
<name sortKey="Paragh, G" uniqKey="Paragh G">G. Paragh</name>
</author>
<author>
<name sortKey="Emri, G" uniqKey="Emri G">G. Emri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
<author>
<name sortKey="Canto, C" uniqKey="Canto C">C. Canto</name>
</author>
<author>
<name sortKey="Brunyanszki, A" uniqKey="Brunyanszki A">A. Brunyanszki</name>
</author>
<author>
<name sortKey="Huber, A" uniqKey="Huber A">A. Huber</name>
</author>
<author>
<name sortKey="Szanto, M" uniqKey="Szanto M">M. Szanto</name>
</author>
<author>
<name sortKey="Cen, Y" uniqKey="Cen Y">Y. Cen</name>
</author>
<author>
<name sortKey="Yamamoto, H" uniqKey="Yamamoto H">H. Yamamoto</name>
</author>
<author>
<name sortKey="Houten, S M" uniqKey="Houten S">S.M. Houten</name>
</author>
<author>
<name sortKey="Kiss, B" uniqKey="Kiss B">B. Kiss</name>
</author>
<author>
<name sortKey="Oudart, H" uniqKey="Oudart H">H. Oudart</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
<author>
<name sortKey="Houten, S M" uniqKey="Houten S">S.M. Houten</name>
</author>
<author>
<name sortKey="Huber, A" uniqKey="Huber A">A. Huber</name>
</author>
<author>
<name sortKey="Schreiber, V" uniqKey="Schreiber V">V. Schreiber</name>
</author>
<author>
<name sortKey="Watanabe, M" uniqKey="Watanabe M">M. Watanabe</name>
</author>
<author>
<name sortKey="Kiss, B" uniqKey="Kiss B">B. Kiss</name>
</author>
<author>
<name sortKey="De Murcia, G" uniqKey="De Murcia G">G. de Murcia</name>
</author>
<author>
<name sortKey="Auwerx, J" uniqKey="Auwerx J">J. Auwerx</name>
</author>
<author>
<name sortKey="Menissier De Murcia, J" uniqKey="Menissier De Murcia J">J. Menissier-de Murcia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rueden, C T" uniqKey="Rueden C">C.T. Rueden</name>
</author>
<author>
<name sortKey="Schindelin, J" uniqKey="Schindelin J">J. Schindelin</name>
</author>
<author>
<name sortKey="Hiner, M C" uniqKey="Hiner M">M.C. Hiner</name>
</author>
<author>
<name sortKey="Dezonia, B E" uniqKey="Dezonia B">B.E. DeZonia</name>
</author>
<author>
<name sortKey="Walter, A E" uniqKey="Walter A">A.E. Walter</name>
</author>
<author>
<name sortKey="Arena, E T" uniqKey="Arena E">E.T. Arena</name>
</author>
<author>
<name sortKey="Eliceiri, K W" uniqKey="Eliceiri K">K.W. Eliceiri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nagy, L" uniqKey="Nagy L">L. Nagy</name>
</author>
<author>
<name sortKey="Marton, J" uniqKey="Marton J">J. Marton</name>
</author>
<author>
<name sortKey="Vida, A" uniqKey="Vida A">A. Vida</name>
</author>
<author>
<name sortKey="Kis, G" uniqKey="Kis G">G. Kis</name>
</author>
<author>
<name sortKey="Bokor, E" uniqKey="Bokor E">E. Bokor</name>
</author>
<author>
<name sortKey="Kun, S" uniqKey="Kun S">S. Kun</name>
</author>
<author>
<name sortKey="Gonczi, M" uniqKey="Gonczi M">M. Gonczi</name>
</author>
<author>
<name sortKey="Docsa, T" uniqKey="Docsa T">T. Docsa</name>
</author>
<author>
<name sortKey="Toth, A" uniqKey="Toth A">A. Toth</name>
</author>
<author>
<name sortKey="Antal, M" uniqKey="Antal M">M. Antal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ng, F" uniqKey="Ng F">F. Ng</name>
</author>
<author>
<name sortKey="Tang, B L" uniqKey="Tang B">B.L. Tang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lee, I H" uniqKey="Lee I">I.H. Lee</name>
</author>
<author>
<name sortKey="Cao, L" uniqKey="Cao L">L. Cao</name>
</author>
<author>
<name sortKey="Mostoslavsky, R" uniqKey="Mostoslavsky R">R. Mostoslavsky</name>
</author>
<author>
<name sortKey="Lombard, D B" uniqKey="Lombard D">D.B. Lombard</name>
</author>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J. Liu</name>
</author>
<author>
<name sortKey="Bruns, N E" uniqKey="Bruns N">N.E. Bruns</name>
</author>
<author>
<name sortKey="Tsokos, M" uniqKey="Tsokos M">M. Tsokos</name>
</author>
<author>
<name sortKey="Alt, F W" uniqKey="Alt F">F.W. Alt</name>
</author>
<author>
<name sortKey="Finkel, T" uniqKey="Finkel T">T. Finkel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mohamed, J S" uniqKey="Mohamed J">J.S. Mohamed</name>
</author>
<author>
<name sortKey="Hajira, A" uniqKey="Hajira A">A. Hajira</name>
</author>
<author>
<name sortKey="Pardo, P S" uniqKey="Pardo P">P.S. Pardo</name>
</author>
<author>
<name sortKey="Boriek, A M" uniqKey="Boriek A">A.M. Boriek</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lagouge, M" uniqKey="Lagouge M">M. Lagouge</name>
</author>
<author>
<name sortKey="Argmann, C" uniqKey="Argmann C">C. Argmann</name>
</author>
<author>
<name sortKey="Gerhart Hines, Z" uniqKey="Gerhart Hines Z">Z. Gerhart-Hines</name>
</author>
<author>
<name sortKey="Meziane, H" uniqKey="Meziane H">H. Meziane</name>
</author>
<author>
<name sortKey="Lerin, C" uniqKey="Lerin C">C. Lerin</name>
</author>
<author>
<name sortKey="Daussin, F" uniqKey="Daussin F">F. Daussin</name>
</author>
<author>
<name sortKey="Messadeq, N" uniqKey="Messadeq N">N. Messadeq</name>
</author>
<author>
<name sortKey="Milne, J" uniqKey="Milne J">J. Milne</name>
</author>
<author>
<name sortKey="Lambert, P" uniqKey="Lambert P">P. Lambert</name>
</author>
<author>
<name sortKey="Elliott, P" uniqKey="Elliott P">P. Elliott</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kauppinen, T M" uniqKey="Kauppinen T">T.M. Kauppinen</name>
</author>
<author>
<name sortKey="Gan, L" uniqKey="Gan L">L. Gan</name>
</author>
<author>
<name sortKey="Swanson, R A" uniqKey="Swanson R">R.A. Swanson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Menissier De Murcia, J" uniqKey="Menissier De Murcia J">J. Menissier-de Murcia</name>
</author>
<author>
<name sortKey="Ricoul, M" uniqKey="Ricoul M">M. Ricoul</name>
</author>
<author>
<name sortKey="Tartier, L" uniqKey="Tartier L">L. Tartier</name>
</author>
<author>
<name sortKey="Niedergang, C" uniqKey="Niedergang C">C. Niedergang</name>
</author>
<author>
<name sortKey="Huber, A" uniqKey="Huber A">A. Huber</name>
</author>
<author>
<name sortKey="Dantzer, F" uniqKey="Dantzer F">F. Dantzer</name>
</author>
<author>
<name sortKey="Schreiber, V" uniqKey="Schreiber V">V. Schreiber</name>
</author>
<author>
<name sortKey="Ame, J C" uniqKey="Ame J">J.C. Ame</name>
</author>
<author>
<name sortKey="Dierich, A" uniqKey="Dierich A">A. Dierich</name>
</author>
<author>
<name sortKey="Lemeur, M" uniqKey="Lemeur M">M. LeMeur</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
<author>
<name sortKey="Canto, C" uniqKey="Canto C">C. Canto</name>
</author>
<author>
<name sortKey="Oudart, H" uniqKey="Oudart H">H. Oudart</name>
</author>
<author>
<name sortKey="Brunyanszki, A" uniqKey="Brunyanszki A">A. Brunyanszki</name>
</author>
<author>
<name sortKey="Cen, Y" uniqKey="Cen Y">Y. Cen</name>
</author>
<author>
<name sortKey="Thomas, C" uniqKey="Thomas C">C. Thomas</name>
</author>
<author>
<name sortKey="Yamamoto, H" uniqKey="Yamamoto H">H. Yamamoto</name>
</author>
<author>
<name sortKey="Huber, A" uniqKey="Huber A">A. Huber</name>
</author>
<author>
<name sortKey="Kiss, B" uniqKey="Kiss B">B. Kiss</name>
</author>
<author>
<name sortKey="Houtkooper, R H" uniqKey="Houtkooper R">R.H. Houtkooper</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wahlberg, E" uniqKey="Wahlberg E">E. Wahlberg</name>
</author>
<author>
<name sortKey="Karlberg, T" uniqKey="Karlberg T">T. Karlberg</name>
</author>
<author>
<name sortKey="Kouznetsova, E" uniqKey="Kouznetsova E">E. Kouznetsova</name>
</author>
<author>
<name sortKey="Markova, N" uniqKey="Markova N">N. Markova</name>
</author>
<author>
<name sortKey="Macchiarulo, A" uniqKey="Macchiarulo A">A. Macchiarulo</name>
</author>
<author>
<name sortKey="Thorsell, A G" uniqKey="Thorsell A">A.G. Thorsell</name>
</author>
<author>
<name sortKey="Pol, E" uniqKey="Pol E">E. Pol</name>
</author>
<author>
<name sortKey="Frostell, A" uniqKey="Frostell A">A. Frostell</name>
</author>
<author>
<name sortKey="Ekblad, T" uniqKey="Ekblad T">T. Ekblad</name>
</author>
<author>
<name sortKey="Oncu, D" uniqKey="Oncu D">D. Oncu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Oliver, A W" uniqKey="Oliver A">A.W. Oliver</name>
</author>
<author>
<name sortKey="Ame, J C" uniqKey="Ame J">J.C. Ame</name>
</author>
<author>
<name sortKey="Roe, S M" uniqKey="Roe S">S.M. Roe</name>
</author>
<author>
<name sortKey="Good, V" uniqKey="Good V">V. Good</name>
</author>
<author>
<name sortKey="De Murcia, G" uniqKey="De Murcia G">G. de Murcia</name>
</author>
<author>
<name sortKey="Pearl, L H" uniqKey="Pearl L">L.H. Pearl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Szant, M" uniqKey="Szant M">M. Szántó</name>
</author>
<author>
<name sortKey="Brunyanszki, A" uniqKey="Brunyanszki A">A. Brunyánszki</name>
</author>
<author>
<name sortKey="Marton, J" uniqKey="Marton J">J. Márton</name>
</author>
<author>
<name sortKey="Vamosi, G" uniqKey="Vamosi G">G. Vámosi</name>
</author>
<author>
<name sortKey="Nagy, L" uniqKey="Nagy L">L. Nagy</name>
</author>
<author>
<name sortKey="Fodor, T" uniqKey="Fodor T">T. Fodor</name>
</author>
<author>
<name sortKey="Kiss, B" uniqKey="Kiss B">B. Kiss</name>
</author>
<author>
<name sortKey="Virag, L" uniqKey="Virag L">L. Virag</name>
</author>
<author>
<name sortKey="Gergely, P" uniqKey="Gergely P">P. Gergely</name>
</author>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roper, S J" uniqKey="Roper S">S.J. Roper</name>
</author>
<author>
<name sortKey="Chrysanthou, S" uniqKey="Chrysanthou S">S. Chrysanthou</name>
</author>
<author>
<name sortKey="Senner, C E" uniqKey="Senner C">C.E. Senner</name>
</author>
<author>
<name sortKey="Sienerth, A" uniqKey="Sienerth A">A. Sienerth</name>
</author>
<author>
<name sortKey="Gnan, S" uniqKey="Gnan S">S. Gnan</name>
</author>
<author>
<name sortKey="Murray, A" uniqKey="Murray A">A. Murray</name>
</author>
<author>
<name sortKey="Masutani, M" uniqKey="Masutani M">M. Masutani</name>
</author>
<author>
<name sortKey="Latos, P" uniqKey="Latos P">P. Latos</name>
</author>
<author>
<name sortKey="Hemberger, M" uniqKey="Hemberger M">M. Hemberger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Farres, J" uniqKey="Farres J">J. Farres</name>
</author>
<author>
<name sortKey="Martin Caballero, J" uniqKey="Martin Caballero J">J. Martin-Caballero</name>
</author>
<author>
<name sortKey="Martinez, C" uniqKey="Martinez C">C. Martinez</name>
</author>
<author>
<name sortKey="Lozano, J J" uniqKey="Lozano J">J.J. Lozano</name>
</author>
<author>
<name sortKey="Llacuna, L" uniqKey="Llacuna L">L. Llacuna</name>
</author>
<author>
<name sortKey="Ampurdanes, C" uniqKey="Ampurdanes C">C. Ampurdanes</name>
</author>
<author>
<name sortKey="Ruiz Herguido, C" uniqKey="Ruiz Herguido C">C. Ruiz-Herguido</name>
</author>
<author>
<name sortKey="Dantzer, F" uniqKey="Dantzer F">F. Dantzer</name>
</author>
<author>
<name sortKey="Schreiber, V" uniqKey="Schreiber V">V. Schreiber</name>
</author>
<author>
<name sortKey="Villunger, A" uniqKey="Villunger A">A. Villunger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Farres, J" uniqKey="Farres J">J. Farres</name>
</author>
<author>
<name sortKey="Llacuna, L" uniqKey="Llacuna L">L. Llacuna</name>
</author>
<author>
<name sortKey="Martin Caballero, J" uniqKey="Martin Caballero J">J. Martin-Caballero</name>
</author>
<author>
<name sortKey="Martinez, C" uniqKey="Martinez C">C. Martinez</name>
</author>
<author>
<name sortKey="Lozano, J J" uniqKey="Lozano J">J.J. Lozano</name>
</author>
<author>
<name sortKey="Ampurdanes, C" uniqKey="Ampurdanes C">C. Ampurdanes</name>
</author>
<author>
<name sortKey="Lopez Contreras, A J" uniqKey="Lopez Contreras A">A.J. Lopez-Contreras</name>
</author>
<author>
<name sortKey="Florensa, L" uniqKey="Florensa L">L. Florensa</name>
</author>
<author>
<name sortKey="Navarro, J" uniqKey="Navarro J">J. Navarro</name>
</author>
<author>
<name sortKey="Ottina, E" uniqKey="Ottina E">E. Ottina</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yelamos, J" uniqKey="Yelamos J">J. Yelamos</name>
</author>
<author>
<name sortKey="Monreal, Y" uniqKey="Monreal Y">Y. Monreal</name>
</author>
<author>
<name sortKey="Saenz, L" uniqKey="Saenz L">L. Saenz</name>
</author>
<author>
<name sortKey="Aguado, E" uniqKey="Aguado E">E. Aguado</name>
</author>
<author>
<name sortKey="Schreiber, V" uniqKey="Schreiber V">V. Schreiber</name>
</author>
<author>
<name sortKey="Mota, R" uniqKey="Mota R">R. Mota</name>
</author>
<author>
<name sortKey="Fuente, T" uniqKey="Fuente T">T. Fuente</name>
</author>
<author>
<name sortKey="Minguela, A" uniqKey="Minguela A">A. Minguela</name>
</author>
<author>
<name sortKey="Parrilla, P" uniqKey="Parrilla P">P. Parrilla</name>
</author>
<author>
<name sortKey="De Murcia, G" uniqKey="De Murcia G">G. de Murcia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vida, A" uniqKey="Vida A">A. Vida</name>
</author>
<author>
<name sortKey="Abdul Rahman, O" uniqKey="Abdul Rahman O">O. Abdul-Rahman</name>
</author>
<author>
<name sortKey="Miko, E" uniqKey="Miko E">E. Miko</name>
</author>
<author>
<name sortKey="Brunyanszki, A" uniqKey="Brunyanszki A">A. Brunyanszki</name>
</author>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nozaki, T" uniqKey="Nozaki T">T. Nozaki</name>
</author>
<author>
<name sortKey="Fujimori, H" uniqKey="Fujimori H">H. Fujimori</name>
</author>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J. Wang</name>
</author>
<author>
<name sortKey="Suzuki, H" uniqKey="Suzuki H">H. Suzuki</name>
</author>
<author>
<name sortKey="Imai, H" uniqKey="Imai H">H. Imai</name>
</author>
<author>
<name sortKey="Watanabe, M" uniqKey="Watanabe M">M. Watanabe</name>
</author>
<author>
<name sortKey="Ohura, K" uniqKey="Ohura K">K. Ohura</name>
</author>
<author>
<name sortKey="Masutani, M" uniqKey="Masutani M">M. Masutani</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Luo, X" uniqKey="Luo X">X. Luo</name>
</author>
<author>
<name sortKey="Ryu, K W" uniqKey="Ryu K">K.W. Ryu</name>
</author>
<author>
<name sortKey="Kim, D S" uniqKey="Kim D">D.S. Kim</name>
</author>
<author>
<name sortKey="Nandu, T" uniqKey="Nandu T">T. Nandu</name>
</author>
<author>
<name sortKey="Medina, C J" uniqKey="Medina C">C.J. Medina</name>
</author>
<author>
<name sortKey="Gupte, R" uniqKey="Gupte R">R. Gupte</name>
</author>
<author>
<name sortKey="Gibson, B A" uniqKey="Gibson B">B.A. Gibson</name>
</author>
<author>
<name sortKey="Soccio, R E" uniqKey="Soccio R">R.E. Soccio</name>
</author>
<author>
<name sortKey="Yu, Y" uniqKey="Yu Y">Y. Yu</name>
</author>
<author>
<name sortKey="Gupta, R K" uniqKey="Gupta R">R.K. Gupta</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, T" uniqKey="Zhang T">T. Zhang</name>
</author>
<author>
<name sortKey="Berrocal, J G" uniqKey="Berrocal J">J.G. Berrocal</name>
</author>
<author>
<name sortKey="Yao, J" uniqKey="Yao J">J. Yao</name>
</author>
<author>
<name sortKey="Dumond, M E" uniqKey="Dumond M">M.E. DuMond</name>
</author>
<author>
<name sortKey="Krishnakumar, R" uniqKey="Krishnakumar R">R. Krishnakumar</name>
</author>
<author>
<name sortKey="Ruhl, D D" uniqKey="Ruhl D">D.D. Ruhl</name>
</author>
<author>
<name sortKey="Ryu, K W" uniqKey="Ryu K">K.W. Ryu</name>
</author>
<author>
<name sortKey="Gamble, M J" uniqKey="Gamble M">M.J. Gamble</name>
</author>
<author>
<name sortKey="Kraus, W L" uniqKey="Kraus W">W.L. Kraus</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hu, B" uniqKey="Hu B">B. Hu</name>
</author>
<author>
<name sortKey="Wu, Z" uniqKey="Wu Z">Z. Wu</name>
</author>
<author>
<name sortKey="Hergert, P" uniqKey="Hergert P">P. Hergert</name>
</author>
<author>
<name sortKey="Henke, C A" uniqKey="Henke C">C.A. Henke</name>
</author>
<author>
<name sortKey="Bitterman, P B" uniqKey="Bitterman P">P.B. Bitterman</name>
</author>
<author>
<name sortKey="Phan, S H" uniqKey="Phan S">S.H. Phan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Butler, A J" uniqKey="Butler A">A.J. Butler</name>
</author>
<author>
<name sortKey="Ordahl, C P" uniqKey="Ordahl C">C.P. Ordahl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vyas, D R" uniqKey="Vyas D">D.R. Vyas</name>
</author>
<author>
<name sortKey="Mccarthy, J J" uniqKey="Mccarthy J">J.J. McCarthy</name>
</author>
<author>
<name sortKey="Tsika, G L" uniqKey="Tsika G">G.L. Tsika</name>
</author>
<author>
<name sortKey="Tsika, R W" uniqKey="Tsika R">R.W. Tsika</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chacon Cabrera, A" uniqKey="Chacon Cabrera A">A. Chacon-Cabrera</name>
</author>
<author>
<name sortKey="Fermoselle, C" uniqKey="Fermoselle C">C. Fermoselle</name>
</author>
<author>
<name sortKey="Salmela, I" uniqKey="Salmela I">I. Salmela</name>
</author>
<author>
<name sortKey="Yelamos, J" uniqKey="Yelamos J">J. Yelamos</name>
</author>
<author>
<name sortKey="Barreiro, E" uniqKey="Barreiro E">E. Barreiro</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liang, J" uniqKey="Liang J">J. Liang</name>
</author>
<author>
<name sortKey="Zeng, Z" uniqKey="Zeng Z">Z. Zeng</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y. Zhang</name>
</author>
<author>
<name sortKey="Chen, N" uniqKey="Chen N">N. Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Margeta, M" uniqKey="Margeta M">M. Margeta</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yelamos, J" uniqKey="Yelamos J">J. Yelamos</name>
</author>
<author>
<name sortKey="Schreiber, V" uniqKey="Schreiber V">V. Schreiber</name>
</author>
<author>
<name sortKey="Dantzer, F" uniqKey="Dantzer F">F. Dantzer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kutuzov, M M" uniqKey="Kutuzov M">M.M. Kutuzov</name>
</author>
<author>
<name sortKey="Khodyreva, S N" uniqKey="Khodyreva S">S.N. Khodyreva</name>
</author>
<author>
<name sortKey="Ilina, E S" uniqKey="Ilina E">E.S. Ilina</name>
</author>
<author>
<name sortKey="Sukhanova, M V" uniqKey="Sukhanova M">M.V. Sukhanova</name>
</author>
<author>
<name sortKey="Ame, J C" uniqKey="Ame J">J.C. Ame</name>
</author>
<author>
<name sortKey="Lavrik, O I" uniqKey="Lavrik O">O.I. Lavrik</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sukhanova, M V" uniqKey="Sukhanova M">M.V. Sukhanova</name>
</author>
<author>
<name sortKey="Abrakhi, S" uniqKey="Abrakhi S">S. Abrakhi</name>
</author>
<author>
<name sortKey="Joshi, V" uniqKey="Joshi V">V. Joshi</name>
</author>
<author>
<name sortKey="Pastre, D" uniqKey="Pastre D">D. Pastre</name>
</author>
<author>
<name sortKey="Kutuzov, M M" uniqKey="Kutuzov M">M.M. Kutuzov</name>
</author>
<author>
<name sortKey="Anarbaev, R O" uniqKey="Anarbaev R">R.O. Anarbaev</name>
</author>
<author>
<name sortKey="Curmi, P A" uniqKey="Curmi P">P.A. Curmi</name>
</author>
<author>
<name sortKey="Hamon, L" uniqKey="Hamon L">L. Hamon</name>
</author>
<author>
<name sortKey="Lavrik, O I" uniqKey="Lavrik O">O.I. Lavrik</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Haenni, S S" uniqKey="Haenni S">S.S. Haenni</name>
</author>
<author>
<name sortKey="Hassa, P O" uniqKey="Hassa P">P.O. Hassa</name>
</author>
<author>
<name sortKey="Altmeyer, M" uniqKey="Altmeyer M">M. Altmeyer</name>
</author>
<author>
<name sortKey="Fey, M" uniqKey="Fey M">M. Fey</name>
</author>
<author>
<name sortKey="Imhof, R" uniqKey="Imhof R">R. Imhof</name>
</author>
<author>
<name sortKey="Hottiger, M O" uniqKey="Hottiger M">M.O. Hottiger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Marton, J" uniqKey="Marton J">J. Marton</name>
</author>
<author>
<name sortKey="Peter, M" uniqKey="Peter M">M. Peter</name>
</author>
<author>
<name sortKey="Balogh, G" uniqKey="Balogh G">G. Balogh</name>
</author>
<author>
<name sortKey="Bodi, B" uniqKey="Bodi B">B. Bodi</name>
</author>
<author>
<name sortKey="Vida, A" uniqKey="Vida A">A. Vida</name>
</author>
<author>
<name sortKey="Szanto, M" uniqKey="Szanto M">M. Szanto</name>
</author>
<author>
<name sortKey="Bojcsuk, D" uniqKey="Bojcsuk D">D. Bojcsuk</name>
</author>
<author>
<name sortKey="Janko, L" uniqKey="Janko L">L. Janko</name>
</author>
<author>
<name sortKey="Bhattoa, H P" uniqKey="Bhattoa H">H.P. Bhattoa</name>
</author>
<author>
<name sortKey="Gombos, I" uniqKey="Gombos I">I. Gombos</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, L" uniqKey="Zhang L">L. Zhang</name>
</author>
<author>
<name sortKey="Zou, J" uniqKey="Zou J">J. Zou</name>
</author>
<author>
<name sortKey="Chai, E" uniqKey="Chai E">E. Chai</name>
</author>
<author>
<name sortKey="Qi, Y" uniqKey="Qi Y">Y. Qi</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zheng, G D" uniqKey="Zheng G">G.D. Zheng</name>
</author>
<author>
<name sortKey="Hu, P J" uniqKey="Hu P">P.J. Hu</name>
</author>
<author>
<name sortKey="Chao, Y X" uniqKey="Chao Y">Y.X. Chao</name>
</author>
<author>
<name sortKey="Zhou, Y" uniqKey="Zhou Y">Y. Zhou</name>
</author>
<author>
<name sortKey="Yang, X J" uniqKey="Yang X">X.J. Yang</name>
</author>
<author>
<name sortKey="Chen, B Z" uniqKey="Chen B">B.Z. Chen</name>
</author>
<author>
<name sortKey="Yu, X Y" uniqKey="Yu X">X.Y. Yu</name>
</author>
<author>
<name sortKey="Cai, Y" uniqKey="Cai Y">Y. Cai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sun, Q" uniqKey="Sun Q">Q. Sun</name>
</author>
<author>
<name sortKey="Gatie, M I I" uniqKey="Gatie M">M.I.I. Gatie</name>
</author>
<author>
<name sortKey="Kelly, G M" uniqKey="Kelly G">G.M. Kelly</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
<author>
<name sortKey="Canto, C" uniqKey="Canto C">C. Canto</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vida, A" uniqKey="Vida A">A. Vida</name>
</author>
<author>
<name sortKey="Marton, J" uniqKey="Marton J">J. Marton</name>
</author>
<author>
<name sortKey="Miko, E" uniqKey="Miko E">E. Miko</name>
</author>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhou, J" uniqKey="Zhou J">J. Zhou</name>
</author>
<author>
<name sortKey="Ng, S" uniqKey="Ng S">S. Ng</name>
</author>
<author>
<name sortKey="Huang, Q" uniqKey="Huang Q">Q. Huang</name>
</author>
<author>
<name sortKey="Wu, Y T" uniqKey="Wu Y">Y.T. Wu</name>
</author>
<author>
<name sortKey="Li, Z" uniqKey="Li Z">Z. Li</name>
</author>
<author>
<name sortKey="Yao, S Q" uniqKey="Yao S">S.Q. Yao</name>
</author>
<author>
<name sortKey="Shen, H M" uniqKey="Shen H">H.M. Shen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, Z T" uniqKey="Chen Z">Z.T. Chen</name>
</author>
<author>
<name sortKey="Zhao, W" uniqKey="Zhao W">W. Zhao</name>
</author>
<author>
<name sortKey="Qu, S" uniqKey="Qu S">S. Qu</name>
</author>
<author>
<name sortKey="Li, L" uniqKey="Li L">L. Li</name>
</author>
<author>
<name sortKey="Lu, X D" uniqKey="Lu X">X.D. Lu</name>
</author>
<author>
<name sortKey="Su, F" uniqKey="Su F">F. Su</name>
</author>
<author>
<name sortKey="Liang, Z G" uniqKey="Liang Z">Z.G. Liang</name>
</author>
<author>
<name sortKey="Guo, S Y" uniqKey="Guo S">S.Y. Guo</name>
</author>
<author>
<name sortKey="Zhu, X D" uniqKey="Zhu X">X.D. Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ethier, C" uniqKey="Ethier C">C. Ethier</name>
</author>
<author>
<name sortKey="Tardif, M" uniqKey="Tardif M">M. Tardif</name>
</author>
<author>
<name sortKey="Arul, L" uniqKey="Arul L">L. Arul</name>
</author>
<author>
<name sortKey="Poirier, G G" uniqKey="Poirier G">G.G. Poirier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lee, H R" uniqKey="Lee H">H.R. Lee</name>
</author>
<author>
<name sortKey="Gupta, M K" uniqKey="Gupta M">M.K. Gupta</name>
</author>
<author>
<name sortKey="Kim, D H" uniqKey="Kim D">D.H. Kim</name>
</author>
<author>
<name sortKey="Hwang, J H" uniqKey="Hwang J">J.H. Hwang</name>
</author>
<author>
<name sortKey="Kwon, B" uniqKey="Kwon B">B. Kwon</name>
</author>
<author>
<name sortKey="Lee, H T" uniqKey="Lee H">H.T. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mateu Jimenez, M" uniqKey="Mateu Jimenez M">M. Mateu-Jimenez</name>
</author>
<author>
<name sortKey="Cucarull Martinez, B" uniqKey="Cucarull Martinez B">B. Cucarull-Martinez</name>
</author>
<author>
<name sortKey="Yelamos, J" uniqKey="Yelamos J">J. Yelamos</name>
</author>
<author>
<name sortKey="Barreiro, E" uniqKey="Barreiro E">E. Barreiro</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arun, B" uniqKey="Arun B">B. Arun</name>
</author>
<author>
<name sortKey="Akar, U" uniqKey="Akar U">U. Akar</name>
</author>
<author>
<name sortKey="Gutierrez Barrera, A M" uniqKey="Gutierrez Barrera A">A.M. Gutierrez-Barrera</name>
</author>
<author>
<name sortKey="N, G" uniqKey="N G">G. N</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cant, C" uniqKey="Cant C">C. Cantó</name>
</author>
<author>
<name sortKey="Sauve, A" uniqKey="Sauve A">A. Sauve</name>
</author>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hwang, J W" uniqKey="Hwang J">J.W. Hwang</name>
</author>
<author>
<name sortKey="Chung, S" uniqKey="Chung S">S. Chung</name>
</author>
<author>
<name sortKey="Sundar, I K" uniqKey="Sundar I">I.K. Sundar</name>
</author>
<author>
<name sortKey="Yao, H" uniqKey="Yao H">H. Yao</name>
</author>
<author>
<name sortKey="Arunachalam, G" uniqKey="Arunachalam G">G. Arunachalam</name>
</author>
<author>
<name sortKey="Mcburney, M W" uniqKey="Mcburney M">M.W. McBurney</name>
</author>
<author>
<name sortKey="Rahman, I" uniqKey="Rahman I">I. Rahman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shin, B H" uniqKey="Shin B">B.H. Shin</name>
</author>
<author>
<name sortKey="Shin, B H" uniqKey="Shin B">B.H. Shin</name>
</author>
<author>
<name sortKey="Lim, Y" uniqKey="Lim Y">Y. Lim</name>
</author>
<author>
<name sortKey="Oh, H J" uniqKey="Oh H">H.J. Oh</name>
</author>
<author>
<name sortKey="Park, S M" uniqKey="Park S">S.M. Park</name>
</author>
<author>
<name sortKey="Lee, S K" uniqKey="Lee S">S.K. Lee</name>
</author>
<author>
<name sortKey="Ahnn, J" uniqKey="Ahnn J">J. Ahnn</name>
</author>
<author>
<name sortKey="Kim, D H" uniqKey="Kim D">D.H. Kim</name>
</author>
<author>
<name sortKey="Song, W K" uniqKey="Song W">W.K. Song</name>
</author>
<author>
<name sortKey="Kwak, T H" uniqKey="Kwak T">T.H. Kwak</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hardie, D G" uniqKey="Hardie D">D.G. Hardie</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lampada, A" uniqKey="Lampada A">A. Lampada</name>
</author>
<author>
<name sortKey="O Rey, J" uniqKey="O Rey J">J. O’Prey</name>
</author>
<author>
<name sortKey="Szabadkai, G" uniqKey="Szabadkai G">G. Szabadkai</name>
</author>
<author>
<name sortKey="Ryan, K M" uniqKey="Ryan K">K.M. Ryan</name>
</author>
<author>
<name sortKey="Hochhauser, D" uniqKey="Hochhauser D">D. Hochhauser</name>
</author>
<author>
<name sortKey="Salomoni, P" uniqKey="Salomoni P">P. Salomoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bernard, M" uniqKey="Bernard M">M. Bernard</name>
</author>
<author>
<name sortKey="Dieude, M" uniqKey="Dieude M">M. Dieude</name>
</author>
<author>
<name sortKey="Yang, B" uniqKey="Yang B">B. Yang</name>
</author>
<author>
<name sortKey="Hamelin, K" uniqKey="Hamelin K">K. Hamelin</name>
</author>
<author>
<name sortKey="Underwood, K" uniqKey="Underwood K">K. Underwood</name>
</author>
<author>
<name sortKey="Hebert, M J" uniqKey="Hebert M">M.J. Hebert</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arias, E" uniqKey="Arias E">E. Arias</name>
</author>
<author>
<name sortKey="Koga, H" uniqKey="Koga H">H. Koga</name>
</author>
<author>
<name sortKey="Diaz, A" uniqKey="Diaz A">A. Diaz</name>
</author>
<author>
<name sortKey="Mocholi, E" uniqKey="Mocholi E">E. Mocholi</name>
</author>
<author>
<name sortKey="Patel, B" uniqKey="Patel B">B. Patel</name>
</author>
<author>
<name sortKey="Cuervo, A M" uniqKey="Cuervo A">A.M. Cuervo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dhar, S K" uniqKey="Dhar S">S.K. Dhar</name>
</author>
<author>
<name sortKey="Bakthavatchalu, V" uniqKey="Bakthavatchalu V">V. Bakthavatchalu</name>
</author>
<author>
<name sortKey="Dhar, B" uniqKey="Dhar B">B. Dhar</name>
</author>
<author>
<name sortKey="Chen, J" uniqKey="Chen J">J. Chen</name>
</author>
<author>
<name sortKey="Tadahide, I" uniqKey="Tadahide I">I. Tadahide</name>
</author>
<author>
<name sortKey="Zhu, H" uniqKey="Zhu H">H. Zhu</name>
</author>
<author>
<name sortKey="Gao, T" uniqKey="Gao T">T. Gao</name>
</author>
<author>
<name sortKey="Clair, D K S" uniqKey="Clair D">D.K.S. Clair</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Canto, C" uniqKey="Canto C">C. Canto</name>
</author>
<author>
<name sortKey="Houtkooper, R H" uniqKey="Houtkooper R">R.H. Houtkooper</name>
</author>
<author>
<name sortKey="Pirinen, E" uniqKey="Pirinen E">E. Pirinen</name>
</author>
<author>
<name sortKey="Youn, D Y" uniqKey="Youn D">D.Y. Youn</name>
</author>
<author>
<name sortKey="Oosterveer, M H" uniqKey="Oosterveer M">M.H. Oosterveer</name>
</author>
<author>
<name sortKey="Cen, Y" uniqKey="Cen Y">Y. Cen</name>
</author>
<author>
<name sortKey="Fernandez Marcos, P J" uniqKey="Fernandez Marcos P">P.J. Fernandez-Marcos</name>
</author>
<author>
<name sortKey="Yamamoto, H" uniqKey="Yamamoto H">H. Yamamoto</name>
</author>
<author>
<name sortKey="Andreux, P A" uniqKey="Andreux P">P.A. Andreux</name>
</author>
<author>
<name sortKey="Cettour Rose, P" uniqKey="Cettour Rose P">P. Cettour-Rose</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vannini, N" uniqKey="Vannini N">N. Vannini</name>
</author>
<author>
<name sortKey="Campos, V" uniqKey="Campos V">V. Campos</name>
</author>
<author>
<name sortKey="Girotra, M" uniqKey="Girotra M">M. Girotra</name>
</author>
<author>
<name sortKey="Trachsel, V" uniqKey="Trachsel V">V. Trachsel</name>
</author>
<author>
<name sortKey="Rojas Sutterlin, S" uniqKey="Rojas Sutterlin S">S. Rojas-Sutterlin</name>
</author>
<author>
<name sortKey="Tratwal, J" uniqKey="Tratwal J">J. Tratwal</name>
</author>
<author>
<name sortKey="Ragusa, S" uniqKey="Ragusa S">S. Ragusa</name>
</author>
<author>
<name sortKey="Stefanidis, E" uniqKey="Stefanidis E">E. Stefanidis</name>
</author>
<author>
<name sortKey="Ryu, D" uniqKey="Ryu D">D. Ryu</name>
</author>
<author>
<name sortKey="Rainer, P Y" uniqKey="Rainer P">P.Y. Rainer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hipkiss, A R" uniqKey="Hipkiss A">A.R. Hipkiss</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Huber, A" uniqKey="Huber A">A. Huber</name>
</author>
<author>
<name sortKey="Bai, P" uniqKey="Bai P">P. Bai</name>
</author>
<author>
<name sortKey="Menissier De Murcia, J" uniqKey="Menissier De Murcia J">J. Menissier-de Murcia</name>
</author>
<author>
<name sortKey="De Murcia, G" uniqKey="De Murcia G">G. de Murcia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vaziri, H" uniqKey="Vaziri H">H. Vaziri</name>
</author>
<author>
<name sortKey="Dessain, S K" uniqKey="Dessain S">S.K. Dessain</name>
</author>
<author>
<name sortKey="Eaton, E N" uniqKey="Eaton E">E.N. Eaton</name>
</author>
<author>
<name sortKey="Imai, S I" uniqKey="Imai S">S.I. Imai</name>
</author>
<author>
<name sortKey="Frye, R A" uniqKey="Frye R">R.A. Frye</name>
</author>
<author>
<name sortKey="Pandita, T K" uniqKey="Pandita T">T.K. Pandita</name>
</author>
<author>
<name sortKey="Guarente, L" uniqKey="Guarente L">L. Guarente</name>
</author>
<author>
<name sortKey="Weinberg, R A" uniqKey="Weinberg R">R.A. Weinberg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, X" uniqKey="Li X">X. Li</name>
</author>
<author>
<name sortKey="Klaus, J A" uniqKey="Klaus J">J.A. Klaus</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
<author>
<name sortKey="Xu, Z" uniqKey="Xu Z">Z. Xu</name>
</author>
<author>
<name sortKey="Kibler, K K" uniqKey="Kibler K">K.K. Kibler</name>
</author>
<author>
<name sortKey="Andrabi, S A" uniqKey="Andrabi S">S.A. Andrabi</name>
</author>
<author>
<name sortKey="Rao, K" uniqKey="Rao K">K. Rao</name>
</author>
<author>
<name sortKey="Yang, Z J" uniqKey="Yang Z">Z.J. Yang</name>
</author>
<author>
<name sortKey="Dawson, T M" uniqKey="Dawson T">T.M. Dawson</name>
</author>
<author>
<name sortKey="Dawson, V L" uniqKey="Dawson V">V.L. Dawson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kofler, J" uniqKey="Kofler J">J. Kofler</name>
</author>
<author>
<name sortKey="Otsuka, T" uniqKey="Otsuka T">T. Otsuka</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z. Zhang</name>
</author>
<author>
<name sortKey="Noppens, R" uniqKey="Noppens R">R. Noppens</name>
</author>
<author>
<name sortKey="Grafe, M R" uniqKey="Grafe M">M.R. Grafe</name>
</author>
<author>
<name sortKey="Koh, D W" uniqKey="Koh D">D.W. Koh</name>
</author>
<author>
<name sortKey="Dawson, V L" uniqKey="Dawson V">V.L. Dawson</name>
</author>
<author>
<name sortKey="Menisser De Murcia, J" uniqKey="Menisser De Murcia J">J. Menisser-de Murcia</name>
</author>
<author>
<name sortKey="Hurn, P D" uniqKey="Hurn P">P.D. Hurn</name>
</author>
<author>
<name sortKey="Traystman, R J" uniqKey="Traystman R">R.J. Traystman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Czarny, P" uniqKey="Czarny P">P. Czarny</name>
</author>
<author>
<name sortKey="Pawlowska, E" uniqKey="Pawlowska E">E. Pawlowska</name>
</author>
<author>
<name sortKey="Bialkowska Warzecha, J" uniqKey="Bialkowska Warzecha J">J. Bialkowska-Warzecha</name>
</author>
<author>
<name sortKey="Kaarniranta, K" uniqKey="Kaarniranta K">K. Kaarniranta</name>
</author>
<author>
<name sortKey="Blasiak, J" uniqKey="Blasiak J">J. Blasiak</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gueguen, Y" uniqKey="Gueguen Y">Y. Gueguen</name>
</author>
<author>
<name sortKey="Bontemps, A" uniqKey="Bontemps A">A. Bontemps</name>
</author>
<author>
<name sortKey="Ebrahimian, T G" uniqKey="Ebrahimian T">T.G. Ebrahimian</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Cells</journal-id>
<journal-id journal-id-type="iso-abbrev">Cells</journal-id>
<journal-id journal-id-type="publisher-id">cells</journal-id>
<journal-title-group>
<journal-title>Cells</journal-title>
</journal-title-group>
<issn pub-type="epub">2073-4409</issn>
<publisher>
<publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">32046043</article-id>
<article-id pub-id-type="pmc">7072353</article-id>
<article-id pub-id-type="doi">10.3390/cells9020380</article-id>
<article-id pub-id-type="publisher-id">cells-09-00380</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Silencing of PARP2 Blocks Autophagic Degradation</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Jankó</surname>
<given-names>Laura</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-09-00380">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sári</surname>
<given-names>Zsanett</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-09-00380">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kovács</surname>
<given-names>Tünde</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-09-00380">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kis</surname>
<given-names>Gréta</given-names>
</name>
<xref ref-type="aff" rid="af2-cells-09-00380">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Szántó</surname>
<given-names>Magdolna</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-09-00380">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0002-2457-7387</contrib-id>
<name>
<surname>Antal</surname>
<given-names>Miklós</given-names>
</name>
<xref ref-type="aff" rid="af2-cells-09-00380">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Juhász</surname>
<given-names>Gábor</given-names>
</name>
<xref ref-type="aff" rid="af3-cells-09-00380">3</xref>
<xref ref-type="aff" rid="af4-cells-09-00380">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bai</surname>
<given-names>Péter</given-names>
</name>
<xref ref-type="aff" rid="af1-cells-09-00380">1</xref>
<xref ref-type="aff" rid="af5-cells-09-00380">5</xref>
<xref ref-type="aff" rid="af6-cells-09-00380">6</xref>
<xref rid="c1-cells-09-00380" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<aff id="af1-cells-09-00380">
<label>1</label>
Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>janko.laura@med.unideb.hu</email>
(L.J.);
<email>sari.zsanett@med.unideb.hu</email>
(Z.S.);
<email>kovacs.tunde@med.unideb.hu</email>
(T.K.);
<email>mszanto@med.unideb.hu</email>
(M.S.)</aff>
<aff id="af2-cells-09-00380">
<label>2</label>
Department of Anatomy, Histology and Embryology, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary;
<email>greta@anat.med.unideb.hu</email>
(G.K.);
<email>antal@anat.med.unideb.hu</email>
(M.A.)</aff>
<aff id="af3-cells-09-00380">
<label>3</label>
Institute of Genetics, Biological Research Centre, H-6726 Szeged, Hungary;
<email>gabor.juhasz@ttk.elte.hu</email>
</aff>
<aff id="af4-cells-09-00380">
<label>4</label>
Department of Anatomy, Cell and Developmental Biology, Eötvös Loránd University, H-1117 Budapest, Hungary</aff>
<aff id="af5-cells-09-00380">
<label>5</label>
MTA-DE Lendület Laboratory of Cellular Metabolism, H-4032 Debrecen, Hungary</aff>
<aff id="af6-cells-09-00380">
<label>6</label>
Research Center for Molecular Medicine, Faculty of Medicine, University of Debrecen, H-4032 Debrecen, Hungary</aff>
<author-notes>
<corresp id="c1-cells-09-00380">
<label>*</label>
Correspondence:
<email>baip@med.unideb.hu</email>
; Tel.: +36-52-412-345; Fax: +36-52-412-566</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>07</day>
<month>2</month>
<year>2020</year>
</pub-date>
<pub-date pub-type="collection">
<month>2</month>
<year>2020</year>
</pub-date>
<volume>9</volume>
<issue>2</issue>
<elocation-id>380</elocation-id>
<history>
<date date-type="received">
<day>20</day>
<month>1</month>
<year>2020</year>
</date>
<date date-type="accepted">
<day>04</day>
<month>2</month>
<year>2020</year>
</date>
</history>
<permissions>
<copyright-statement>© 2020 by the authors.</copyright-statement>
<copyright-year>2020</copyright-year>
<license license-type="open-access">
<license-p>Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<p>Poly(ADP-Ribose) polymerases (PARPs) are enzymes that metabolize NAD
<sup>+</sup>
. PARP1 and PARP10 were previously implicated in the regulation of autophagy. Here we showed that cytosolic electron-dense particles appear in the cytoplasm of C2C12 myoblasts in which PARP2 is silenced by shRNA. The cytosolic electron-dense bodies resemble autophagic vesicles and, in line with that, we observed an increased number of LC3-positive and Lysotracker-stained vesicles. Silencing of PARP2 did not influence the maximal number of LC3-positive vesicles seen upon chloroquine treatment or serum starvation, suggesting that the absence of PARP2 inhibits autophagic breakdown. Silencing of PARP2 inhibited the activity of AMP-activated kinase (AMPK) and the mammalian target of rapamycin complex 2 (mTORC2). Treatment of PARP2-silenced C2C12 cells with AICAR, an AMPK activator, nicotinamide-riboside (an NAD
<sup>+</sup>
precursor), or EX-527 (a SIRT1 inhibitor) decreased the number of LC3-positive vesicles cells to similar levels as in control (scPARP2) cells, suggesting that these pathways inhibit autophagic flux upon PARP2 silencing. We observed a similar increase in the number of LC3 vesicles in primary PARP2 knockout murine embryonic fibroblasts. We provided evidence that the enzymatic activity of PARP2 is important in regulating autophagy. Finally, we showed that the silencing of PARP2 induces myoblast differentiation. Taken together, PARP2 is a positive regulator of autophagic breakdown in mammalian transformed cells and its absence blocks the progression of autophagy.</p>
</abstract>
<kwd-group>
<kwd>PARP2</kwd>
<kwd>ARTD2</kwd>
<kwd>autophagy</kwd>
<kwd>LC3</kwd>
<kwd>AMPK</kwd>
<kwd>mTOR</kwd>
<kwd>PARP</kwd>
<kwd>nicotinamide-riboside</kwd>
<kwd>SIRT1</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="cells-09-00380-f001" orientation="portrait" position="float">
<label>Figure 1</label>
<caption>
<p>Validation of PARP2 silencing in stably-transfected C2C12 cells. PARP2 expression was assessed in scPARP2 and shPARP2 cells by Western blotting (
<italic>n</italic>
= 3). *** represents statistically significant differences between the scPARP2 and shPARP2 cells at
<italic>p</italic>
< 0.001.</p>
</caption>
<graphic xlink:href="cells-09-00380-g001"></graphic>
</fig>
<fig id="cells-09-00380-f002" orientation="portrait" position="float">
<label>Figure 2</label>
<caption>
<p>Cytosolic electron-dense particles appear in PARP2-silenced cells. scPARP2 and shPARP2 C2C12 cells were analyzed by electron microscopy (
<italic>n</italic>
= 1, counted cells: 50/50). Red arrows and the insert picture show the cytosolic electron-dense particles in shPARP2 cells, which were absent in scPARP2 cells. Cytosolic electron-dense particles were counted in cells and data was plotted. *** represents statistically significant differences between the scPARP2 and shPARP2 cells at
<italic>p</italic>
< 0.001. Average ± SD is plotted. As cytosolic electron-dense bodies were absent in the scPARP2 cells, the value for the chart is 0 with no standard deviation.</p>
</caption>
<graphic xlink:href="cells-09-00380-g002"></graphic>
</fig>
<fig id="cells-09-00380-f003" orientation="portrait" position="float">
<label>Figure 3</label>
<caption>
<p>Silencing of PAPR2 increases the level of LC3. (
<bold>A</bold>
) In scPARP2 and shPARP2 C2C12 cells, LC3 expression was analyzed by Western blotting (
<italic>n</italic>
= 3). (
<bold>B</bold>
) PARP2 was transiently silenced in C2C12 cells using two different siRNAs (
<italic>n</italic>
= 3). Cells were transfected with siRNAs for 48 h, then PARP2 and LC3 levels were determined by Western blotting. (
<bold>C</bold>
) LC3+DAPI immunofluorescence was performed in scPARP2 and shPARP2 C2C12 and in C2C12 cells where PARP2 was transiently silenced (
<italic>n</italic>
= 3). Alexa Fluor 488-linked LC3 specific antibody was used and the nuclei were visualized using DAPI and vesicles were counted. Representative images are presented in the figure. *, **, and *** represent statistically significant differences between the indicated groups at
<italic>p</italic>
< 0.05,
<italic>p</italic>
< 0.01 and,
<italic>p</italic>
< 0.001, respectively. For the determination, ANOVA test was used followed by Dunnett’s post hoc test. NEG–Negative control, where cells were transfected with non-specific control siRNA.</p>
</caption>
<graphic xlink:href="cells-09-00380-g003"></graphic>
</fig>
<fig id="cells-09-00380-f004" orientation="portrait" position="float">
<label>Figure 4</label>
<caption>
<p>Silencing of PARP2 increases the number of acidic lysosomes. scPARP2 and shPARP2 C2C12 cells were stained with LysoTracker Deep Red (
<italic>n</italic>
= 3, counted cells: 100/100). LysoTracker Deep Red was assessed in confocal microscopy experiments and vesicles were counted. Representative images are presented in the figure. *** represent statistically significant differences between the indicated groups at
<italic>p</italic>
< 0.001.</p>
</caption>
<graphic xlink:href="cells-09-00380-g004"></graphic>
</fig>
<fig id="cells-09-00380-f005" orientation="portrait" position="float">
<label>Figure 5</label>
<caption>
<p>Chloroquine and serum starvation induce LC3 expression in scPARP2 and shPARP2 cells to the same extent. scPARP2 and shPARP2 C2C12 cells were treated with 25 µM chloroquine for 2 h or serum-starved for 12 h. LC3 expression was assessed in confocal microscopy experiments. Alexa Fluor 488-linked LC3 specific antibody was used and the nuclei were visualized using DAPI, vesicles were counted. Representative images are presented on the figure. ## and ### represent statistically significant differences between the control and chloroquine-treated or control and serum-starved cells at
<italic>p</italic>
< 0.01 or
<italic>p</italic>
< 0.001, respectively. *** represent statistically significant differences between the scPARP2 and shPARP2 cells at
<italic>p</italic>
< 0.001. For the determination of statistical significance ANOVA test was used followed by Tukey’s post hoc test.</p>
</caption>
<graphic xlink:href="cells-09-00380-g005"></graphic>
</fig>
<fig id="cells-09-00380-f006" orientation="portrait" position="float">
<label>Figure 6</label>
<caption>
<p>Inhibition of AMPK and cellular NAD
<sup>+</sup>
level modulate autophagy in a PARP2-dependent fashion. (
<bold>A</bold>
) In scPARP2 and shPARP2 C2C12 cells, the change of AMPK, phospho-AMPK, p70 S6 kinase, phospho-p70 S6 kinase, Akt, and phospho-Akt expression were analyzed by Western blotting (
<italic>n</italic>
= 3). (
<bold>B</bold>
) scPARP2 and shPARP2 C2C12 cells were treated with 1 mM AICAR, 20 nM rapamycin (rapa), 1 µM olaparib (olap), or 500 µM nicotinamide-riboside (NR) for 24 h. LC3 expression was assessed in confocal microscopy experiments. Alexa Fluor 488-linked LC3 specific antibody was used and the nuclei were visualized using DAPI and vesicles were counted. Representative images are presented in the figure. ## and ### represent statistically significant differences between the control and treated cells at
<italic>p</italic>
< 0.01 and
<italic>p</italic>
< 0.001, respectively. *, ** and *** represent statistically significant differences between the scPARP2 and shPARP2 cells at
<italic>p</italic>
< 0.05,
<italic>p</italic>
< 0.01 and
<italic>p</italic>
< 0.001. For the determination of statistical significance, ANOVA test was used followed by Tukey’s post hoc test.</p>
</caption>
<graphic xlink:href="cells-09-00380-g006"></graphic>
</fig>
<fig id="cells-09-00380-f007" orientation="portrait" position="float">
<label>Figure 7</label>
<caption>
<p>SIRT1 activation is a key determinant of the PARP2-mediated inhibition of autophagy. (
<bold>A</bold>
) scPARP2 and shPARP2 C2C12 cells were treated with 50 µM resveratrol or 25 µM EX-527 for 24 h (
<italic>n</italic>
= 3). LC3 expression was assessed by confocal microscopy. Alexa Fluor 488-linked LC3 specific antibody was used and the nuclei were visualized using DAPI and vesicles were counted. Representative images are presented on the figure. (
<bold>B</bold>
,
<bold>C</bold>
) SIRT1 was transiently silenced in scPARP2 and shPARP2 C2C12 cells using siRNA targeting SIRT1 (
<italic>n</italic>
= 3). Cells were transfected with siRNA for 48 h, then LC3 expression was assessed in confocal microscopy experiments and the protein level of SIRT1 was detected by Western blotting. Alexa Fluor 488-inked LC3 specific antibody was used and the nuclei were visualized using DAPI. Representative images are presented in the figure. Cells were scored as described in Materials and Methods. # and ### represent statistically significant differences between the control and treated cells at
<italic>p</italic>
< 0.05 and
<italic>p</italic>
< 0.001, respectively. *** represent statistically significant differences between the scPARP2 and shPARP2 cells at
<italic>p</italic>
< 0.001. For the determination of statistical significance, ANOVA test was used followed by Tukey’s post hoc test.</p>
</caption>
<graphic xlink:href="cells-09-00380-g007"></graphic>
</fig>
<fig id="cells-09-00380-f008" orientation="portrait" position="float">
<label>Figure 8</label>
<caption>
<p>Increased autophagy upon acute PARP2 silencing. PARP2 was transiently silenced in C2C12 cells using siRNA targeting PARP2 (
<italic>n</italic>
= 3). Cells were transfected with siRNA for 48 h, treated with 1 mM AICAR, 500 µM nicotinamide-riboside (NR), and 25 µM EX-527 for 24 h, then LC3 expression was assessed by confocal microscopy. Alexa Fluor 488-linked LC3 specific antibody was used and the nuclei were visualized using DAPI and vesicles were counted. #, ## and ### represent statistically significant differences between the control and treated cells at
<italic>p</italic>
< 0.05,
<italic>p</italic>
< 0.01 or
<italic>p</italic>
< 0.001, respectively. *, **, and *** represent statistically significant differences between the scPARP2 and shPARP2 cells at
<italic>p</italic>
< 0.05,
<italic>p</italic>
< 0.01, and
<italic>p</italic>
< 0.001, respectively. For the determination of statistical significance, ANOVA test was used followed by Tukey’s post hoc test.</p>
</caption>
<graphic xlink:href="cells-09-00380-g008"></graphic>
</fig>
<fig id="cells-09-00380-f009" orientation="portrait" position="float">
<label>Figure 9</label>
<caption>
<p>The number of LC3-positive vesicles in primary PARP2 knockout MEF cells. A total of 15,000 cells from the indicated primary MEF cells were seeded and were stained for Alexa Fluor 488-linked LC3 specific antibody and the nuclei with DAPI. Vesicles were counted. Representative images are presented in the figure. *** represents statistically significant differences between the PARP2
<sup>+/+</sup>
and PARP2
<sup></sup>
<sup>/−</sup>
MEF cells at
<italic>p</italic>
< 0.001. For the determination of statistical significance, ANOVA test was used followed by Dunnett’s post hoc test. The different numbers represent different MEF clones.</p>
</caption>
<graphic xlink:href="cells-09-00380-g009"></graphic>
</fig>
<fig id="cells-09-00380-f010" orientation="portrait" position="float">
<label>Figure 10</label>
<caption>
<p>The silencing of PARP2 modulates cellular PARylation under chloroquine treatment and fasting. scPARP2 and shPARP2 cells were treated with chloroquine (25 µM 2 h) or were fasted for 12 h. Then cells were lysed and lysates were separated by PAGE and were subjected to Western blotting using anti-PAR antibody. Experiments were repeated three times; a representative blot is shown.</p>
</caption>
<graphic xlink:href="cells-09-00380-g010"></graphic>
</fig>
<fig id="cells-09-00380-f011" orientation="portrait" position="float">
<label>Figure 11</label>
<caption>
<p>PARP2 enzymatic activity modulates the energy sensors involved in the regulation of autophagy. A total of 200,000 scPARP2 and shPARP2 C2C12 cells were seeded in 6-well plates that were treated with olaparib (olap, 1 µM) and PJ34 (3 µM) for 24 h. Cellular proteins were separated by SDS-PAGE and were blotted and probed with the antibodies indicated on panels (
<bold>A</bold>
<bold>C</bold>
). Bands were subjected to densitometry. Experiments were repeated three times; a representative blot is shown.</p>
</caption>
<graphic xlink:href="cells-09-00380-g011"></graphic>
</fig>
<fig id="cells-09-00380-f012" orientation="portrait" position="float">
<label>Figure 12</label>
<caption>
<p>Silencing of PARP2 supports myogenic differentiation. A total of 20,000 scPARP2 and shPARP2 C2C12 cells were seeded in 24-well plates that were differentiated for 4 days then (
<bold>A</bold>
) LC3-positive vesicles were assessed by immunofluorescence, (
<bold>B</bold>
) actin cytoskeleton was stained by Texas Red-X Phalloidin+DAPI, and (
<bold>C</bold>
) the expression of a set of myogenic genes were assessed by RT-qPCR. On panel B 100/100 cells were scored for the structure of actin cytoskeleton as diffuse, transient, and strong cortical staining. *** represent statistical difference between scPARP2 and shPARP2 cells at
<italic>p</italic>
< 0.001 on panel A. ** represent statistical difference between scPARP2 and shPARP2 cells in terms of actin morphology at
<italic>p</italic>
< 0.01 on panel B. In panel C, ### represents statistically significant differences between the scPARP2 and shPARP2 cells at
<italic>p</italic>
< 0.001. * and ** represent statistically significant differences between the control and differentiated cells at
<italic>p</italic>
< 0.05 and
<italic>p</italic>
< 0.01, respectively. For the determination of statistical significance, ANOVA test was used followed by Tukey’s post hoc test on panels A and C, while on panel B chi square test was applied.</p>
</caption>
<graphic xlink:href="cells-09-00380-g012"></graphic>
</fig>
<table-wrap id="cells-09-00380-t001" orientation="portrait" position="float">
<object-id pub-id-type="pii">cells-09-00380-t001_Table 1</object-id>
<label>Table 1</label>
<caption>
<p>The source of key chemicals used in the study.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Chemical</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Company</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Catalog Number</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Concentration</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Length of Treatment</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">chloroquine</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Sigma-Aldrich</td>
<td align="center" valign="middle" rowspan="1" colspan="1">C6628</td>
<td align="center" valign="middle" rowspan="1" colspan="1">25 µM</td>
<td align="center" valign="middle" rowspan="1" colspan="1">2 h</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">AICAR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Santa Cruz BT</td>
<td align="center" valign="middle" rowspan="1" colspan="1">sc-200659A</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1 mM</td>
<td align="center" valign="middle" rowspan="1" colspan="1">24 h</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">rapamycin</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Cayman Chemical</td>
<td align="center" valign="middle" rowspan="1" colspan="1">13346</td>
<td align="center" valign="middle" rowspan="1" colspan="1">20 nM</td>
<td align="center" valign="middle" rowspan="1" colspan="1">24 h</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">olaparib</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Selleckchem</td>
<td align="center" valign="middle" rowspan="1" colspan="1">S1060</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1 µM</td>
<td align="center" valign="middle" rowspan="1" colspan="1">24 h</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">NR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ChromaDex</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" rowspan="1" colspan="1">500 µM</td>
<td align="center" valign="middle" rowspan="1" colspan="1">24 h</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">resveratrol</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Sigma-Aldrich</td>
<td align="center" valign="middle" rowspan="1" colspan="1">R5010</td>
<td align="center" valign="middle" rowspan="1" colspan="1">50 µM</td>
<td align="center" valign="middle" rowspan="1" colspan="1">24 h</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">EX-527</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Selleckchem</td>
<td align="center" valign="middle" rowspan="1" colspan="1">S1541</td>
<td align="center" valign="middle" rowspan="1" colspan="1">25 µM</td>
<td align="center" valign="middle" rowspan="1" colspan="1">24 h</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">PJ34</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">Sigma-Aldrich</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">P4365</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">3 µM</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">24 h</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>AICAR—5-Aminoimidazole-4-carboxamide ribonucleotide, NR—nicotinamide-riboside.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="cells-09-00380-t002" orientation="portrait" position="float">
<object-id pub-id-type="pii">cells-09-00380-t002_Table 2</object-id>
<label>Table 2</label>
<caption>
<p>Antibodies used in the study.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Antibody</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Company</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Dilution</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">LC3A/B Alexa Fluor 488 Conjugate</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Cell Signaling Technology, 13082</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:50</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">LC3A/B</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Cell Signaling Technology, 12741</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:1000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">PARP2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Enzo Life Sciences,
<break></break>
ALX-210-899-R100</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:2000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">SIRT1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">EMD Millipore, 07-131</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:1000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">AMPKα</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Cell Signaling Technology, 5832</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:1000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Phospho-AMPKα (Thr172)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Cell Signaling Technology, 2535</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:1000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">p70 S6 Kinase</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Sigma-Aldrich, SAB4502691</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:1000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Phospho-p70 S6 Kinase (Thr389)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Cell Signaling Technology, 9205</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:1000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Akt</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Cell Signaling Technology, 9272</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:1000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Phospho-Akt (Ser473)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Cell Signaling Technology, 4060</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:1000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Poly(ADP-ribose)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Enzo Life Sciences,
<break></break>
BML-SA216-0100</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:1000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Anti-mouse IgG, HRP-linked</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Sigma-Aldrich, A9044</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:2000</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Anti-rabbit IgG, HRP-linked</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Cell Signaling Technology, 7074</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1:2000</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">Anti-β-actin-Peroxidase</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">Sigma-Aldrich, A3854</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">1:20,000</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="cells-09-00380-t003" orientation="portrait" position="float">
<object-id pub-id-type="pii">cells-09-00380-t003_Table 3</object-id>
<label>Table 3</label>
<caption>
<p>Primers used in the study.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Gene Name</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Forward Primer</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Reverse Primer</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Myf5</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GACACAGCTTCCCTCTCTCCAG</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ACGTATTCTGCCCAGCTTGTCT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">MyoD1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GCTTTGAGAGATCGACTGCAGC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TGTCCTTTCTTTGGGGCTGGAT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Mef2a</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CTCCCCGTGATAGAATGACCCC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GGTCACTGCCATCATAGGAGCT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Mef2d</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GTGTTTACAAGGGATCAGCGCC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGAGCTCCAAATGTGAAGCCCT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Mef2c</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ACGATTCAGTAGGTCACAGCCC</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CTGTTATGGCTGGACACTGGGA</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">cyclophilin</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TGGAGAGCACCAAGACAGACA</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TGCCGGAGTCGACAATGAT</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">36B4</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">AGATTCGGGATATGCTGTTGG</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">AAAGCCTGGAAGAAGGAGGTC</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>Hongrie</li>
</country>
</list>
<tree>
<noCountry>
<name sortKey="Antal, Mikl S" sort="Antal, Mikl S" uniqKey="Antal M" first="Mikl S" last="Antal">Mikl S Antal</name>
<name sortKey="Jank, Laura" sort="Jank, Laura" uniqKey="Jank L" first="Laura" last="Jank">Laura Jank</name>
<name sortKey="Kis, Greta" sort="Kis, Greta" uniqKey="Kis G" first="Gréta" last="Kis">Gréta Kis</name>
<name sortKey="Kovacs, Tunde" sort="Kovacs, Tunde" uniqKey="Kovacs T" first="Tünde" last="Kovács">Tünde Kovács</name>
<name sortKey="Sari, Zsanett" sort="Sari, Zsanett" uniqKey="Sari Z" first="Zsanett" last="Sári">Zsanett Sári</name>
<name sortKey="Szant, Magdolna" sort="Szant, Magdolna" uniqKey="Szant M" first="Magdolna" last="Szánt">Magdolna Szánt</name>
</noCountry>
<country name="Hongrie">
<noRegion>
<name sortKey="Juhasz, Gabor" sort="Juhasz, Gabor" uniqKey="Juhasz G" first="Gábor" last="Juhász">Gábor Juhász</name>
</noRegion>
<name sortKey="Bai, Peter" sort="Bai, Peter" uniqKey="Bai P" first="Péter" last="Bai">Péter Bai</name>
<name sortKey="Bai, Peter" sort="Bai, Peter" uniqKey="Bai P" first="Péter" last="Bai">Péter Bai</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/ChloroquineV1/Data/Pmc/Checkpoint
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000044 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd -nk 000044 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    ChloroquineV1
   |flux=    Pmc
   |étape=   Checkpoint
   |type=    RBID
   |clé=     PMC:7072353
   |texte=   Silencing of PARP2 Blocks Autophagic Degradation
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Checkpoint/RBID.i   -Sk "pubmed:32046043" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Checkpoint/biblio.hfd   \
       | NlmPubMed2Wicri -a ChloroquineV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Wed Mar 25 22:43:59 2020. Site generation: Sun Jan 31 12:44:45 2021