Serveur d'exploration Chloroquine

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Chloroquine Downregulation of Intestinal Autophagy to Alleviate Biological Stress in Early-Weaned Piglets

Identifieur interne : 000F29 ( Ncbi/Merge ); précédent : 000F28; suivant : 000F30

Chloroquine Downregulation of Intestinal Autophagy to Alleviate Biological Stress in Early-Weaned Piglets

Auteurs : Simeng Liao [République populaire de Chine] ; Shengguo Tang ; Meinan Chang ; Ming Qi [République populaire de Chine] ; Jianjun Li ; Bie Tan ; Qian Gao ; Shuo Zhang ; Xiaozhen Li ; Yulong Yin ; Peng Sun ; Yulong Tang

Source :

RBID : PMC:7071126

Abstract

Simple Summary

Weaning is one of the biggest challenges in a pig’s life. Autophagy is a catabolic process aimed at recycling cellular components and damaged organelles in response to diverse stress conditions. There are two autophagy-modifying agents, rapamycin (RAPA) and chloroquine (CQ), that are often used in vitro and in vivo to regulate this process. We speculated that the regulation of autophagy may have some effect on weaning pressure. In this study, we try to understand the role of autophagy in intestinal barrier function and inflammation during the first week after weaning. We examined the effects of modulation of autophagy via RAPA and CQ on growth performance, immunity, inflammation profile, and the intestinal barrier to find potential value for CQ as a feed additive agent for ameliorating weaning stress.

Abstract

Early weaning stress impairs the development of gastrointestinal barrier function, causing immune system dysfunctions, reduction in feed intake, and growth retardation. Autophagy was hypothesized to be a key underlying cellular process in these dysfunctions. We conjectured that rapamycin (RAPA) and chloroquine (CQ), as two autophagy-modifying agents, regulate the autophagy process and may produce deleterious or beneficial effects on intestinal health and growth. To explore the effect of autophagy on early weaning stress in piglets, 18 early-weaned piglets were assigned to three treatments (each treatment of six piglets) and treated with an equal volume of RAPA, CQ, or saline. The degree of autophagy and serum concentrations of immunoglobulins and cytokines, as well as intestinal morphology and tight junction protein expression, were evaluated. Compared with the control treatment, RAPA-treated piglets exhibited activated autophagy and had decreased final body weight (BW) and average daily gain (ADG) (p < 0.05), impaired intestinal morphology and tight junction function, and higher inflammatory responses. The CQ-treated piglets showed higher final BW, ADG, jejuna and ileal villus height, and lower autophagy and inflammation, compared with control piglets (p < 0.05). Throughout the experiment, CQ treatment was beneficial to alleviate early weaning stress and intestinal and immune system dysfunction.


Url:
DOI: 10.3390/ani10020290
PubMed: 32059526
PubMed Central: 7071126

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:7071126

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Chloroquine Downregulation of Intestinal Autophagy to Alleviate Biological Stress in Early-Weaned Piglets</title>
<author>
<name sortKey="Liao, Simeng" sort="Liao, Simeng" uniqKey="Liao S" first="Simeng" last="Liao">Simeng Liao</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-animals-10-00290">State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100093, China;
<email>meinanchang2020@163.com</email>
</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af3-animals-10-00290">College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100008, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100008</wicri:regionArea>
<placeName>
<settlement type="city">Pékin</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Tang, Shengguo" sort="Tang, Shengguo" uniqKey="Tang S" first="Shengguo" last="Tang">Shengguo Tang</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-animals-10-00290">College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China;
<email>gaoqian996@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Meinan" sort="Chang, Meinan" uniqKey="Chang M" first="Meinan" last="Chang">Meinan Chang</name>
<affiliation>
<nlm:aff id="af2-animals-10-00290">State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100093, China;
<email>meinanchang2020@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Qi, Ming" sort="Qi, Ming" uniqKey="Qi M" first="Ming" last="Qi">Ming Qi</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af3-animals-10-00290">College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100008, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100008</wicri:regionArea>
<placeName>
<settlement type="city">Pékin</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Li, Jianjun" sort="Li, Jianjun" uniqKey="Li J" first="Jianjun" last="Li">Jianjun Li</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tan, Bie" sort="Tan, Bie" uniqKey="Tan B" first="Bie" last="Tan">Bie Tan</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-animals-10-00290">College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China;
<email>gaoqian996@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Gao, Qian" sort="Gao, Qian" uniqKey="Gao Q" first="Qian" last="Gao">Qian Gao</name>
<affiliation>
<nlm:aff id="af4-animals-10-00290">College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China;
<email>gaoqian996@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Shuo" sort="Zhang, Shuo" uniqKey="Zhang S" first="Shuo" last="Zhang">Shuo Zhang</name>
<affiliation>
<nlm:aff id="af5-animals-10-00290">Yunnan Yin Yulong Academician Workstation at Yunnan, Yin Yulong Academician Workstation, Yunnan Xinan Tianyou Animal Husbandry Technology co. Ltd., Kunming 650032, China;
<email>jschen@hunan.edu.cn</email>
(S.Z.);
<email>lxzp888@163.com</email>
(X.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Xiaozhen" sort="Li, Xiaozhen" uniqKey="Li X" first="Xiaozhen" last="Li">Xiaozhen Li</name>
<affiliation>
<nlm:aff id="af5-animals-10-00290">Yunnan Yin Yulong Academician Workstation at Yunnan, Yin Yulong Academician Workstation, Yunnan Xinan Tianyou Animal Husbandry Technology co. Ltd., Kunming 650032, China;
<email>jschen@hunan.edu.cn</email>
(S.Z.);
<email>lxzp888@163.com</email>
(X.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yin, Yulong" sort="Yin, Yulong" uniqKey="Yin Y" first="Yulong" last="Yin">Yulong Yin</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af5-animals-10-00290">Yunnan Yin Yulong Academician Workstation at Yunnan, Yin Yulong Academician Workstation, Yunnan Xinan Tianyou Animal Husbandry Technology co. Ltd., Kunming 650032, China;
<email>jschen@hunan.edu.cn</email>
(S.Z.);
<email>lxzp888@163.com</email>
(X.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sun, Peng" sort="Sun, Peng" uniqKey="Sun P" first="Peng" last="Sun">Peng Sun</name>
<affiliation>
<nlm:aff id="af2-animals-10-00290">State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100093, China;
<email>meinanchang2020@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tang, Yulong" sort="Tang, Yulong" uniqKey="Tang Y" first="Yulong" last="Tang">Yulong Tang</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-animals-10-00290">State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100093, China;
<email>meinanchang2020@163.com</email>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">32059526</idno>
<idno type="pmc">7071126</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7071126</idno>
<idno type="RBID">PMC:7071126</idno>
<idno type="doi">10.3390/ani10020290</idno>
<date when="2020">2020</date>
<idno type="wicri:Area/Pmc/Corpus">000407</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000407</idno>
<idno type="wicri:Area/Pmc/Curation">000407</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000407</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000174</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000174</idno>
<idno type="wicri:Area/Ncbi/Merge">000F29</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Chloroquine Downregulation of Intestinal Autophagy to Alleviate Biological Stress in Early-Weaned Piglets</title>
<author>
<name sortKey="Liao, Simeng" sort="Liao, Simeng" uniqKey="Liao S" first="Simeng" last="Liao">Simeng Liao</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-animals-10-00290">State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100093, China;
<email>meinanchang2020@163.com</email>
</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af3-animals-10-00290">College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100008, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100008</wicri:regionArea>
<placeName>
<settlement type="city">Pékin</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Tang, Shengguo" sort="Tang, Shengguo" uniqKey="Tang S" first="Shengguo" last="Tang">Shengguo Tang</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-animals-10-00290">College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China;
<email>gaoqian996@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chang, Meinan" sort="Chang, Meinan" uniqKey="Chang M" first="Meinan" last="Chang">Meinan Chang</name>
<affiliation>
<nlm:aff id="af2-animals-10-00290">State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100093, China;
<email>meinanchang2020@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Qi, Ming" sort="Qi, Ming" uniqKey="Qi M" first="Ming" last="Qi">Ming Qi</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af3-animals-10-00290">College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100008, China</nlm:aff>
<country xml:lang="fr">République populaire de Chine</country>
<wicri:regionArea>College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100008</wicri:regionArea>
<placeName>
<settlement type="city">Pékin</settlement>
</placeName>
</affiliation>
</author>
<author>
<name sortKey="Li, Jianjun" sort="Li, Jianjun" uniqKey="Li J" first="Jianjun" last="Li">Jianjun Li</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tan, Bie" sort="Tan, Bie" uniqKey="Tan B" first="Bie" last="Tan">Bie Tan</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-animals-10-00290">College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China;
<email>gaoqian996@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Gao, Qian" sort="Gao, Qian" uniqKey="Gao Q" first="Qian" last="Gao">Qian Gao</name>
<affiliation>
<nlm:aff id="af4-animals-10-00290">College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China;
<email>gaoqian996@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Shuo" sort="Zhang, Shuo" uniqKey="Zhang S" first="Shuo" last="Zhang">Shuo Zhang</name>
<affiliation>
<nlm:aff id="af5-animals-10-00290">Yunnan Yin Yulong Academician Workstation at Yunnan, Yin Yulong Academician Workstation, Yunnan Xinan Tianyou Animal Husbandry Technology co. Ltd., Kunming 650032, China;
<email>jschen@hunan.edu.cn</email>
(S.Z.);
<email>lxzp888@163.com</email>
(X.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Xiaozhen" sort="Li, Xiaozhen" uniqKey="Li X" first="Xiaozhen" last="Li">Xiaozhen Li</name>
<affiliation>
<nlm:aff id="af5-animals-10-00290">Yunnan Yin Yulong Academician Workstation at Yunnan, Yin Yulong Academician Workstation, Yunnan Xinan Tianyou Animal Husbandry Technology co. Ltd., Kunming 650032, China;
<email>jschen@hunan.edu.cn</email>
(S.Z.);
<email>lxzp888@163.com</email>
(X.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yin, Yulong" sort="Yin, Yulong" uniqKey="Yin Y" first="Yulong" last="Yin">Yulong Yin</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af5-animals-10-00290">Yunnan Yin Yulong Academician Workstation at Yunnan, Yin Yulong Academician Workstation, Yunnan Xinan Tianyou Animal Husbandry Technology co. Ltd., Kunming 650032, China;
<email>jschen@hunan.edu.cn</email>
(S.Z.);
<email>lxzp888@163.com</email>
(X.L.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sun, Peng" sort="Sun, Peng" uniqKey="Sun P" first="Peng" last="Sun">Peng Sun</name>
<affiliation>
<nlm:aff id="af2-animals-10-00290">State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100093, China;
<email>meinanchang2020@163.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Tang, Yulong" sort="Tang, Yulong" uniqKey="Tang Y" first="Yulong" last="Tang">Yulong Tang</name>
<affiliation>
<nlm:aff id="af1-animals-10-00290">Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-animals-10-00290">State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100093, China;
<email>meinanchang2020@163.com</email>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Animals : an Open Access Journal from MDPI</title>
<idno type="eISSN">2076-2615</idno>
<imprint>
<date when="2020">2020</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Simple Summary</title>
<p>Weaning is one of the biggest challenges in a pig’s life. Autophagy is a catabolic process aimed at recycling cellular components and damaged organelles in response to diverse stress conditions. There are two autophagy-modifying agents, rapamycin (RAPA) and chloroquine (CQ), that are often used in vitro and in vivo to regulate this process. We speculated that the regulation of autophagy may have some effect on weaning pressure. In this study, we try to understand the role of autophagy in intestinal barrier function and inflammation during the first week after weaning. We examined the effects of modulation of autophagy via RAPA and CQ on growth performance, immunity, inflammation profile, and the intestinal barrier to find potential value for CQ as a feed additive agent for ameliorating weaning stress.</p>
</sec>
<sec>
<title>Abstract</title>
<p>Early weaning stress impairs the development of gastrointestinal barrier function, causing immune system dysfunctions, reduction in feed intake, and growth retardation. Autophagy was hypothesized to be a key underlying cellular process in these dysfunctions. We conjectured that rapamycin (RAPA) and chloroquine (CQ), as two autophagy-modifying agents, regulate the autophagy process and may produce deleterious or beneficial effects on intestinal health and growth. To explore the effect of autophagy on early weaning stress in piglets, 18 early-weaned piglets were assigned to three treatments (each treatment of six piglets) and treated with an equal volume of RAPA, CQ, or saline. The degree of autophagy and serum concentrations of immunoglobulins and cytokines, as well as intestinal morphology and tight junction protein expression, were evaluated. Compared with the control treatment, RAPA-treated piglets exhibited activated autophagy and had decreased final body weight (BW) and average daily gain (ADG) (
<italic>p</italic>
< 0.05), impaired intestinal morphology and tight junction function, and higher inflammatory responses. The CQ-treated piglets showed higher final BW, ADG, jejuna and ileal villus height, and lower autophagy and inflammation, compared with control piglets (
<italic>p</italic>
< 0.05). Throughout the experiment, CQ treatment was beneficial to alleviate early weaning stress and intestinal and immune system dysfunction.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Kick, A R" uniqKey="Kick A">A.R. Kick</name>
</author>
<author>
<name sortKey="Tompkins, M B" uniqKey="Tompkins M">M.B. Tompkins</name>
</author>
<author>
<name sortKey="Flowers, W L" uniqKey="Flowers W">W.L. Flowers</name>
</author>
<author>
<name sortKey="Whisnant, C S" uniqKey="Whisnant C">C.S. Whisnant</name>
</author>
<author>
<name sortKey="Almond, G W" uniqKey="Almond G">G.W. Almond</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hu, C H" uniqKey="Hu C">C.H. Hu</name>
</author>
<author>
<name sortKey="Xiao, K" uniqKey="Xiao K">K. Xiao</name>
</author>
<author>
<name sortKey="Luan, Z S" uniqKey="Luan Z">Z.S. Luan</name>
</author>
<author>
<name sortKey="Song, J" uniqKey="Song J">J. Song</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moeser, A J" uniqKey="Moeser A">A.J. Moeser</name>
</author>
<author>
<name sortKey="Pohl, C S" uniqKey="Pohl C">C.S. Pohl</name>
</author>
<author>
<name sortKey="Rajput, M" uniqKey="Rajput M">M. Rajput</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xiao, H" uniqKey="Xiao H">H. Xiao</name>
</author>
<author>
<name sortKey="Tan, B E" uniqKey="Tan B">B.E. Tan</name>
</author>
<author>
<name sortKey="Wu, M M" uniqKey="Wu M">M.M. Wu</name>
</author>
<author>
<name sortKey="Yin, Y L" uniqKey="Yin Y">Y.L. Yin</name>
</author>
<author>
<name sortKey="Li, T J" uniqKey="Li T">T.J. Li</name>
</author>
<author>
<name sortKey="Yuan, D X" uniqKey="Yuan D">D.X. Yuan</name>
</author>
<author>
<name sortKey="Li, L" uniqKey="Li L">L. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cao, S T" uniqKey="Cao S">S.T. Cao</name>
</author>
<author>
<name sortKey="Wang, C C" uniqKey="Wang C">C.C. Wang</name>
</author>
<author>
<name sortKey="Wu, H" uniqKey="Wu H">H. Wu</name>
</author>
<author>
<name sortKey="Zhang, Q H" uniqKey="Zhang Q">Q.H. Zhang</name>
</author>
<author>
<name sortKey="Jiao, L F" uniqKey="Jiao L">L.F. Jiao</name>
</author>
<author>
<name sortKey="Hu, C H" uniqKey="Hu C">C.H. Hu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xiao, H" uniqKey="Xiao H">H. Xiao</name>
</author>
<author>
<name sortKey="Wu, M M" uniqKey="Wu M">M.M. Wu</name>
</author>
<author>
<name sortKey="Tan, B E" uniqKey="Tan B">B.E. Tan</name>
</author>
<author>
<name sortKey="Yin, Y L" uniqKey="Yin Y">Y.L. Yin</name>
</author>
<author>
<name sortKey="Li, T J" uniqKey="Li T">T.J. Li</name>
</author>
<author>
<name sortKey="Xiao, D F" uniqKey="Xiao D">D.F. Xiao</name>
</author>
<author>
<name sortKey="Li, L" uniqKey="Li L">L. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Galluzzi, L" uniqKey="Galluzzi L">L. Galluzzi</name>
</author>
<author>
<name sortKey="Pietrocola, F" uniqKey="Pietrocola F">F. Pietrocola</name>
</author>
<author>
<name sortKey="Levine, B" uniqKey="Levine B">B. Levine</name>
</author>
<author>
<name sortKey="Kroemer, G" uniqKey="Kroemer G">G. Kroemer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Grizotte Lake, M" uniqKey="Grizotte Lake M">M. Grizotte-Lake</name>
</author>
<author>
<name sortKey="Vaishnava, S" uniqKey="Vaishnava S">S. Vaishnava</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Glick, D" uniqKey="Glick D">D. Glick</name>
</author>
<author>
<name sortKey="Barth, S" uniqKey="Barth S">S. Barth</name>
</author>
<author>
<name sortKey="Macleod, K F" uniqKey="Macleod K">K.F. Macleod</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Huett, A" uniqKey="Huett A">A. Huett</name>
</author>
<author>
<name sortKey="Xavier, R J" uniqKey="Xavier R">R.J. Xavier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tang, Y" uniqKey="Tang Y">Y. Tang</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J. Li</name>
</author>
<author>
<name sortKey="Li, F" uniqKey="Li F">F. Li</name>
</author>
<author>
<name sortKey="Hu, C A" uniqKey="Hu C">C.A. Hu</name>
</author>
<author>
<name sortKey="Liao, P" uniqKey="Liao P">P. Liao</name>
</author>
<author>
<name sortKey="Tan, K" uniqKey="Tan K">K. Tan</name>
</author>
<author>
<name sortKey="Tan, B" uniqKey="Tan B">B. Tan</name>
</author>
<author>
<name sortKey="Xiong, X" uniqKey="Xiong X">X. Xiong</name>
</author>
<author>
<name sortKey="Liu, G" uniqKey="Liu G">G. Liu</name>
</author>
<author>
<name sortKey="Li, T" uniqKey="Li T">T. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Randall Demllo, S" uniqKey="Randall Demllo S">S. Randall-Demllo</name>
</author>
<author>
<name sortKey="Chieppa, M" uniqKey="Chieppa M">M. Chieppa</name>
</author>
<author>
<name sortKey="Eri, R" uniqKey="Eri R">R. Eri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Elshaer, D" uniqKey="Elshaer D">D. Elshaer</name>
</author>
<author>
<name sortKey="Begun, J" uniqKey="Begun J">J. Begun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Patel, K K" uniqKey="Patel K">K.K. Patel</name>
</author>
<author>
<name sortKey="Stappenbeck, T S" uniqKey="Stappenbeck T">T.S. Stappenbeck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="He, C" uniqKey="He C">C. He</name>
</author>
<author>
<name sortKey="Klionsky, D J" uniqKey="Klionsky D">D.J. Klionsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nalbandian, A" uniqKey="Nalbandian A">A. Nalbandian</name>
</author>
<author>
<name sortKey="Llewellyn, K J" uniqKey="Llewellyn K">K.J. Llewellyn</name>
</author>
<author>
<name sortKey="Nguyen, C" uniqKey="Nguyen C">C. Nguyen</name>
</author>
<author>
<name sortKey="Yazdi, P G" uniqKey="Yazdi P">P.G. Yazdi</name>
</author>
<author>
<name sortKey="Kimonis, V E" uniqKey="Kimonis V">V.E. Kimonis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, S Q" uniqKey="Liu S">S.Q. Liu</name>
</author>
<author>
<name sortKey="Zhao, J P" uniqKey="Zhao J">J.P. Zhao</name>
</author>
<author>
<name sortKey="Fan, X X" uniqKey="Fan X">X.X. Fan</name>
</author>
<author>
<name sortKey="Liu, G H" uniqKey="Liu G">G.H. Liu</name>
</author>
<author>
<name sortKey="Jiao, H C" uniqKey="Jiao H">H.C. Jiao</name>
</author>
<author>
<name sortKey="Wang, X J" uniqKey="Wang X">X.J. Wang</name>
</author>
<author>
<name sortKey="Sun, S H" uniqKey="Sun S">S.H. Sun</name>
</author>
<author>
<name sortKey="Lin, H" uniqKey="Lin H">H. Lin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Makky, K" uniqKey="Makky K">K. Makky</name>
</author>
<author>
<name sortKey="Tekiela, J" uniqKey="Tekiela J">J. Tekiela</name>
</author>
<author>
<name sortKey="Mayer, A N" uniqKey="Mayer A">A.N. Mayer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nagar, J" uniqKey="Nagar J">J. Nagar</name>
</author>
<author>
<name sortKey="Ranade, S" uniqKey="Ranade S">S. Ranade</name>
</author>
<author>
<name sortKey="Kamath, V" uniqKey="Kamath V">V. Kamath</name>
</author>
<author>
<name sortKey="Singh, S" uniqKey="Singh S">S. Singh</name>
</author>
<author>
<name sortKey="Karunanithi, P" uniqKey="Karunanithi P">P. Karunanithi</name>
</author>
<author>
<name sortKey="Subramani, S" uniqKey="Subramani S">S. Subramani</name>
</author>
<author>
<name sortKey="Venkatesh, K" uniqKey="Venkatesh K">K. Venkatesh</name>
</author>
<author>
<name sortKey="Srivastava, R" uniqKey="Srivastava R">R. Srivastava</name>
</author>
<author>
<name sortKey="Dudhgaonkar, S" uniqKey="Dudhgaonkar S">S. Dudhgaonkar</name>
</author>
<author>
<name sortKey="Vikramadithyan, R K" uniqKey="Vikramadithyan R">R.K. Vikramadithyan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, P" uniqKey="Li P">P. Li</name>
</author>
<author>
<name sortKey="Hao, L" uniqKey="Hao L">L. Hao</name>
</author>
<author>
<name sortKey="Guo, Y Y" uniqKey="Guo Y">Y.Y. Guo</name>
</author>
<author>
<name sortKey="Yang, G L" uniqKey="Yang G">G.L. Yang</name>
</author>
<author>
<name sortKey="Mei, H" uniqKey="Mei H">H. Mei</name>
</author>
<author>
<name sortKey="Li, X H" uniqKey="Li X">X.H. Li</name>
</author>
<author>
<name sortKey="Zhai, Q X" uniqKey="Zhai Q">Q.X. Zhai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wu, F" uniqKey="Wu F">F. Wu</name>
</author>
<author>
<name sortKey="Wei, X" uniqKey="Wei X">X. Wei</name>
</author>
<author>
<name sortKey="Wu, Y" uniqKey="Wu Y">Y. Wu</name>
</author>
<author>
<name sortKey="Kong, X" uniqKey="Kong X">X. Kong</name>
</author>
<author>
<name sortKey="Hu, A" uniqKey="Hu A">A. Hu</name>
</author>
<author>
<name sortKey="Tong, S" uniqKey="Tong S">S. Tong</name>
</author>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y. Liu</name>
</author>
<author>
<name sortKey="Gong, F" uniqKey="Gong F">F. Gong</name>
</author>
<author>
<name sortKey="Xie, L" uniqKey="Xie L">L. Xie</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J. Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, H" uniqKey="Liu H">H. Liu</name>
</author>
<author>
<name sortKey="Tan, B" uniqKey="Tan B">B. Tan</name>
</author>
<author>
<name sortKey="Huang, B" uniqKey="Huang B">B. Huang</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J. Li</name>
</author>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J. Wang</name>
</author>
<author>
<name sortKey="Liao, P" uniqKey="Liao P">P. Liao</name>
</author>
<author>
<name sortKey="Guan, G" uniqKey="Guan G">G. Guan</name>
</author>
<author>
<name sortKey="Ji, P" uniqKey="Ji P">P. Ji</name>
</author>
<author>
<name sortKey="Yin, Y" uniqKey="Yin Y">Y. Yin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hou, Y" uniqKey="Hou Y">Y. Hou</name>
</author>
<author>
<name sortKey="Yao, K" uniqKey="Yao K">K. Yao</name>
</author>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L. Wang</name>
</author>
<author>
<name sortKey="Ding, B" uniqKey="Ding B">B. Ding</name>
</author>
<author>
<name sortKey="Fu, D" uniqKey="Fu D">D. Fu</name>
</author>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y. Liu</name>
</author>
<author>
<name sortKey="Zhu, H" uniqKey="Zhu H">H. Zhu</name>
</author>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J. Liu</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y. Li</name>
</author>
<author>
<name sortKey="Kang, P" uniqKey="Kang P">P. Kang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Duan, Y" uniqKey="Duan Y">Y. Duan</name>
</author>
<author>
<name sortKey="Li, F" uniqKey="Li F">F. Li</name>
</author>
<author>
<name sortKey="Liu, H" uniqKey="Liu H">H. Liu</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y. Li</name>
</author>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y. Liu</name>
</author>
<author>
<name sortKey="Kong, X" uniqKey="Kong X">X. Kong</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y. Zhang</name>
</author>
<author>
<name sortKey="Deng, D" uniqKey="Deng D">D. Deng</name>
</author>
<author>
<name sortKey="Tang, Y" uniqKey="Tang Y">Y. Tang</name>
</author>
<author>
<name sortKey="Feng, Z" uniqKey="Feng Z">Z. Feng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, J" uniqKey="Chen J">J. Chen</name>
</author>
<author>
<name sortKey="Su, W" uniqKey="Su W">W. Su</name>
</author>
<author>
<name sortKey="Kang, B" uniqKey="Kang B">B. Kang</name>
</author>
<author>
<name sortKey="Jiang, Q" uniqKey="Jiang Q">Q. Jiang</name>
</author>
<author>
<name sortKey="Zhao, Y" uniqKey="Zhao Y">Y. Zhao</name>
</author>
<author>
<name sortKey="Fu, C" uniqKey="Fu C">C. Fu</name>
</author>
<author>
<name sortKey="Yao, K" uniqKey="Yao K">K. Yao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J. Wang</name>
</author>
<author>
<name sortKey="Li, G R" uniqKey="Li G">G.R. Li</name>
</author>
<author>
<name sortKey="Tan, B E" uniqKey="Tan B">B.E. Tan</name>
</author>
<author>
<name sortKey="Xiong, X" uniqKey="Xiong X">X. Xiong</name>
</author>
<author>
<name sortKey="Kong, X F" uniqKey="Kong X">X.F. Kong</name>
</author>
<author>
<name sortKey="Xiao, D F" uniqKey="Xiao D">D.F. Xiao</name>
</author>
<author>
<name sortKey="Xu, L W" uniqKey="Xu L">L.W. Xu</name>
</author>
<author>
<name sortKey="Wu, M M" uniqKey="Wu M">M.M. Wu</name>
</author>
<author>
<name sortKey="Huang, B" uniqKey="Huang B">B. Huang</name>
</author>
<author>
<name sortKey="Kim, S W" uniqKey="Kim S">S.W. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Coleman, C M" uniqKey="Coleman C">C.M. Coleman</name>
</author>
<author>
<name sortKey="Olivier, A K" uniqKey="Olivier A">A.K. Olivier</name>
</author>
<author>
<name sortKey="Jacobus, J A" uniqKey="Jacobus J">J.A. Jacobus</name>
</author>
<author>
<name sortKey="Mapuskar, K A" uniqKey="Mapuskar K">K.A. Mapuskar</name>
</author>
<author>
<name sortKey="Mao, G" uniqKey="Mao G">G. Mao</name>
</author>
<author>
<name sortKey="Martin, S M" uniqKey="Martin S">S.M. Martin</name>
</author>
<author>
<name sortKey="Riley, D P" uniqKey="Riley D">D.P. Riley</name>
</author>
<author>
<name sortKey="Gius, D" uniqKey="Gius D">D. Gius</name>
</author>
<author>
<name sortKey="Spitz, D R" uniqKey="Spitz D">D.R. Spitz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dong, J Q" uniqKey="Dong J">J.Q. Dong</name>
</author>
<author>
<name sortKey="Varma, M V" uniqKey="Varma M">M.V. Varma</name>
</author>
<author>
<name sortKey="Wolford, A" uniqKey="Wolford A">A. Wolford</name>
</author>
<author>
<name sortKey="Ryder, T" uniqKey="Ryder T">T. Ryder</name>
</author>
<author>
<name sortKey="Di, L" uniqKey="Di L">L. Di</name>
</author>
<author>
<name sortKey="Feng, B" uniqKey="Feng B">B. Feng</name>
</author>
<author>
<name sortKey="Terra, S G" uniqKey="Terra S">S.G. Terra</name>
</author>
<author>
<name sortKey="Sagawa, K" uniqKey="Sagawa K">K. Sagawa</name>
</author>
<author>
<name sortKey="Kalgutkar, A S" uniqKey="Kalgutkar A">A.S. Kalgutkar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Turner, J R" uniqKey="Turner J">J.R. Turner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yu, Y" uniqKey="Yu Y">Y. Yu</name>
</author>
<author>
<name sortKey="Shiou, S R" uniqKey="Shiou S">S.R. Shiou</name>
</author>
<author>
<name sortKey="Guo, Y" uniqKey="Guo Y">Y. Guo</name>
</author>
<author>
<name sortKey="Lu, L" uniqKey="Lu L">L. Lu</name>
</author>
<author>
<name sortKey="Westerhoff, M" uniqKey="Westerhoff M">M. Westerhoff</name>
</author>
<author>
<name sortKey="Sun, J" uniqKey="Sun J">J. Sun</name>
</author>
<author>
<name sortKey="Petrof, E O" uniqKey="Petrof E">E.O. Petrof</name>
</author>
<author>
<name sortKey="Claud, E C" uniqKey="Claud E">E.C. Claud</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baxt, L A" uniqKey="Baxt L">L.A. Baxt</name>
</author>
<author>
<name sortKey="Xavier, R J" uniqKey="Xavier R">R.J. Xavier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, G E" uniqKey="Yang G">G.E. Yang</name>
</author>
<author>
<name sortKey="Duan, X" uniqKey="Duan X">X. Duan</name>
</author>
<author>
<name sortKey="Lin, D" uniqKey="Lin D">D. Lin</name>
</author>
<author>
<name sortKey="Li, T" uniqKey="Li T">T. Li</name>
</author>
<author>
<name sortKey="Luo, D" uniqKey="Luo D">D. Luo</name>
</author>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L. Wang</name>
</author>
<author>
<name sortKey="Lian, K" uniqKey="Lian K">K. Lian</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ding, C" uniqKey="Ding C">C. Ding</name>
</author>
<author>
<name sortKey="Li, F" uniqKey="Li F">F. Li</name>
</author>
<author>
<name sortKey="Long, Y" uniqKey="Long Y">Y. Long</name>
</author>
<author>
<name sortKey="Zheng, J" uniqKey="Zheng J">J. Zheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shen, H" uniqKey="Shen H">H. Shen</name>
</author>
<author>
<name sortKey="Wu, N" uniqKey="Wu N">N. Wu</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y. Wang</name>
</author>
<author>
<name sortKey="Zhao, H" uniqKey="Zhao H">H. Zhao</name>
</author>
<author>
<name sortKey="Zhang, L" uniqKey="Zhang L">L. Zhang</name>
</author>
<author>
<name sortKey="Li, T" uniqKey="Li T">T. Li</name>
</author>
<author>
<name sortKey="Zhao, M" uniqKey="Zhao M">M. Zhao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Siracusa, R" uniqKey="Siracusa R">R. Siracusa</name>
</author>
<author>
<name sortKey="Paterniti, I" uniqKey="Paterniti I">I. Paterniti</name>
</author>
<author>
<name sortKey="Bruschetta, G" uniqKey="Bruschetta G">G. Bruschetta</name>
</author>
<author>
<name sortKey="Cordaro, M" uniqKey="Cordaro M">M. Cordaro</name>
</author>
<author>
<name sortKey="Impellizzeri, D" uniqKey="Impellizzeri D">D. Impellizzeri</name>
</author>
<author>
<name sortKey="Crupi, R" uniqKey="Crupi R">R. Crupi</name>
</author>
<author>
<name sortKey="Cuzzocre, S" uniqKey="Cuzzocre S">S. Cuzzocre</name>
</author>
<author>
<name sortKey="Esposito, E" uniqKey="Esposito E">E. Esposito</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Animals (Basel)</journal-id>
<journal-id journal-id-type="iso-abbrev">Animals (Basel)</journal-id>
<journal-id journal-id-type="publisher-id">animals</journal-id>
<journal-title-group>
<journal-title>Animals : an Open Access Journal from MDPI</journal-title>
</journal-title-group>
<issn pub-type="epub">2076-2615</issn>
<publisher>
<publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">32059526</article-id>
<article-id pub-id-type="pmc">7071126</article-id>
<article-id pub-id-type="doi">10.3390/ani10020290</article-id>
<article-id pub-id-type="publisher-id">animals-10-00290</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Chloroquine Downregulation of Intestinal Autophagy to Alleviate Biological Stress in Early-Weaned Piglets</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0003-1254-5561</contrib-id>
<name>
<surname>Liao</surname>
<given-names>Simeng</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-10-00290">1</xref>
<xref ref-type="aff" rid="af2-animals-10-00290">2</xref>
<xref ref-type="aff" rid="af3-animals-10-00290">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tang</surname>
<given-names>Shengguo</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-10-00290">1</xref>
<xref ref-type="aff" rid="af4-animals-10-00290">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chang</surname>
<given-names>Meinan</given-names>
</name>
<xref ref-type="aff" rid="af2-animals-10-00290">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Qi</surname>
<given-names>Ming</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-10-00290">1</xref>
<xref ref-type="aff" rid="af3-animals-10-00290">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Jianjun</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-10-00290">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tan</surname>
<given-names>Bie</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-10-00290">1</xref>
<xref ref-type="aff" rid="af4-animals-10-00290">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Gao</surname>
<given-names>Qian</given-names>
</name>
<xref ref-type="aff" rid="af4-animals-10-00290">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Shuo</given-names>
</name>
<xref ref-type="aff" rid="af5-animals-10-00290">5</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Xiaozhen</given-names>
</name>
<xref ref-type="aff" rid="af5-animals-10-00290">5</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yin</surname>
<given-names>Yulong</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-10-00290">1</xref>
<xref ref-type="aff" rid="af5-animals-10-00290">5</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Peng</given-names>
</name>
<xref ref-type="aff" rid="af2-animals-10-00290">2</xref>
<xref rid="c1-animals-10-00290" ref-type="corresp">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tang</surname>
<given-names>Yulong</given-names>
</name>
<xref ref-type="aff" rid="af1-animals-10-00290">1</xref>
<xref ref-type="aff" rid="af2-animals-10-00290">2</xref>
<xref rid="c1-animals-10-00290" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<aff id="af1-animals-10-00290">
<label>1</label>
Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China;
<email>lsm19931@163.com</email>
(S.L.);
<email>tangshengguo1983@hunau.edu.cn</email>
(S.T.);
<email>qmcharisma@sina.com</email>
(M.Q.);
<email>jianjunli@isa.ac.cn</email>
(J.L.);
<email>bietan@isa.ac.cn</email>
(B.T.);
<email>yinyulong@isa.ac.cn</email>
(Y.Y.)</aff>
<aff id="af2-animals-10-00290">
<label>2</label>
State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100093, China;
<email>meinanchang2020@163.com</email>
</aff>
<aff id="af3-animals-10-00290">
<label>3</label>
College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100008, China</aff>
<aff id="af4-animals-10-00290">
<label>4</label>
College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China;
<email>gaoqian996@163.com</email>
</aff>
<aff id="af5-animals-10-00290">
<label>5</label>
Yunnan Yin Yulong Academician Workstation at Yunnan, Yin Yulong Academician Workstation, Yunnan Xinan Tianyou Animal Husbandry Technology co. Ltd., Kunming 650032, China;
<email>jschen@hunan.edu.cn</email>
(S.Z.);
<email>lxzp888@163.com</email>
(X.L.)</aff>
<author-notes>
<corresp id="c1-animals-10-00290">
<label>*</label>
Correspondence:
<email>sunpeng02@caas.cn</email>
(P.S.);
<email>tangyulong@isa.ac.cn</email>
(Y.T.); Tel.: +86-185-1037-8598 (P.S.); +86-1822-992-4248 (Y.T.)</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>12</day>
<month>2</month>
<year>2020</year>
</pub-date>
<pub-date pub-type="collection">
<month>2</month>
<year>2020</year>
</pub-date>
<volume>10</volume>
<issue>2</issue>
<elocation-id>290</elocation-id>
<history>
<date date-type="received">
<day>07</day>
<month>1</month>
<year>2020</year>
</date>
<date date-type="accepted">
<day>10</day>
<month>2</month>
<year>2020</year>
</date>
</history>
<permissions>
<copyright-statement>© 2020 by the authors.</copyright-statement>
<copyright-year>2020</copyright-year>
<license license-type="open-access">
<license-p>Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Simple Summary</title>
<p>Weaning is one of the biggest challenges in a pig’s life. Autophagy is a catabolic process aimed at recycling cellular components and damaged organelles in response to diverse stress conditions. There are two autophagy-modifying agents, rapamycin (RAPA) and chloroquine (CQ), that are often used in vitro and in vivo to regulate this process. We speculated that the regulation of autophagy may have some effect on weaning pressure. In this study, we try to understand the role of autophagy in intestinal barrier function and inflammation during the first week after weaning. We examined the effects of modulation of autophagy via RAPA and CQ on growth performance, immunity, inflammation profile, and the intestinal barrier to find potential value for CQ as a feed additive agent for ameliorating weaning stress.</p>
</sec>
<sec>
<title>Abstract</title>
<p>Early weaning stress impairs the development of gastrointestinal barrier function, causing immune system dysfunctions, reduction in feed intake, and growth retardation. Autophagy was hypothesized to be a key underlying cellular process in these dysfunctions. We conjectured that rapamycin (RAPA) and chloroquine (CQ), as two autophagy-modifying agents, regulate the autophagy process and may produce deleterious or beneficial effects on intestinal health and growth. To explore the effect of autophagy on early weaning stress in piglets, 18 early-weaned piglets were assigned to three treatments (each treatment of six piglets) and treated with an equal volume of RAPA, CQ, or saline. The degree of autophagy and serum concentrations of immunoglobulins and cytokines, as well as intestinal morphology and tight junction protein expression, were evaluated. Compared with the control treatment, RAPA-treated piglets exhibited activated autophagy and had decreased final body weight (BW) and average daily gain (ADG) (
<italic>p</italic>
< 0.05), impaired intestinal morphology and tight junction function, and higher inflammatory responses. The CQ-treated piglets showed higher final BW, ADG, jejuna and ileal villus height, and lower autophagy and inflammation, compared with control piglets (
<italic>p</italic>
< 0.05). Throughout the experiment, CQ treatment was beneficial to alleviate early weaning stress and intestinal and immune system dysfunction.</p>
</sec>
</abstract>
<kwd-group>
<kwd>autophagy</kwd>
<kwd>chloroquine</kwd>
<kwd>mucosal barrier</kwd>
<kwd>weaning stress</kwd>
<kwd>rapamycin</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="animals-10-00290-f001" orientation="portrait" position="float">
<label>Figure 1</label>
<caption>
<p>Autophagy validation in the jejunum of weaning piglets. (
<bold>A</bold>
) Observation of autophagy bubbles by transmission electron microscopy. Red arrows indicate autolysosomes, blue arrows indicate autophagosome. (
<bold>B</bold>
) Western blot results. (
<bold>C</bold>
) Beclin1 protein abundance. (
<bold>D</bold>
) p62 protein abundance. (
<bold>E</bold>
) LC3B protein abundance (the ratio of LC3II and LC3I). Dietary treatment: RAPA, rapamycin; CQ, chloroquine; CON, normal saline. Data are expressed as means ± SEM (
<italic>n</italic>
= 6), three models chosen, all values are expressed in relation to the control. *
<italic>p</italic>
< 0.05 vs. control.</p>
</caption>
<graphic xlink:href="animals-10-00290-g001"></graphic>
</fig>
<fig id="animals-10-00290-f002" orientation="portrait" position="float">
<label>Figure 2</label>
<caption>
<p>Morphology analysis. (
<bold>A</bold>
) Sections were stained with hematoxylin and eosin (H and E). (
<bold>B</bold>
) Jejunum morphology. (
<bold>C</bold>
) Ratio of villus height to crypt depth in jejunum. (
<bold>D</bold>
) Ileum morphology. (
<bold>E</bold>
) Ratio of villus height to crypt depth in ileum. Dietary treatment: RAPA, rapamycin; CQ, chloroquine; CON, normal saline. Data are expressed as means ± SEM (
<italic>n</italic>
= 6), all values are expressed in relation to the control. *
<italic>p</italic>
< 0.05 vs. control.</p>
</caption>
<graphic xlink:href="animals-10-00290-g002"></graphic>
</fig>
<fig id="animals-10-00290-f003" orientation="portrait" position="float">
<label>Figure 3</label>
<caption>
<p>Relative mRNA levels. (
<bold>A</bold>
)
<italic>E-cadherin</italic>
,
<italic>occludin</italic>
,
<italic>ZO-1</italic>
, and
<italic>integrin</italic>
mRNA levels on jejunum; (
<bold>B</bold>
)
<italic>E-cadherin</italic>
,
<italic>occludin</italic>
,
<italic>ZO-1</italic>
, and
<italic>integrin</italic>
mRNA levels ileum. Dietary treatment: RAPA, rapamycin; CQ, chloroquine; CON, normal saline. Data are expressed as means ± SEM (
<italic>n</italic>
= 6), all values are expressed in relation to the control. *
<italic>p</italic>
< 0.05 vs. control.</p>
</caption>
<graphic xlink:href="animals-10-00290-g003"></graphic>
</fig>
<fig id="animals-10-00290-f004" orientation="portrait" position="float">
<label>Figure 4</label>
<caption>
<p>Serum immune factors levels of IgG and IgM. Dietary treatment: RAPA, rapamycin; CQ, chloroquine; CON, normal saline. Data are expressed as means ± SEM (
<italic>n</italic>
= 6), all values are expressed in relation to the control. *
<italic>p</italic>
< 0.05 vs. control.</p>
</caption>
<graphic xlink:href="animals-10-00290-g004"></graphic>
</fig>
<table-wrap id="animals-10-00290-t001" orientation="portrait" position="float">
<object-id pub-id-type="pii">animals-10-00290-t001_Table 1</object-id>
<label>Table 1</label>
<caption>
<p>Primers used for real-time quantitative PCR.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Genes</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Accession No.</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Primers</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Sequences (5′-3′)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>E-cadherin</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">NM_001163060.1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GAAGGAGGTGGAGAAGAGGAC</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGAGTCATAAGGTGGGGCAGT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>Occludin</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">NM_001163647.2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGAGTCATAAGGTGGGGCAGT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CGCCCGTCGTGTAGTCTGTC</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>ZO-1</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">XM_005659811.1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TACCCTGCGGCTGGAAGA</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GGACGGGACCTGCTCATAACT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>Integrin</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">NM_213968.1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GCAGTTTCAAGGTCAAGATGG</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse</td>
<td align="center" valign="middle" rowspan="1" colspan="1">AGCAGGAGGAAGATGAGCAG</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>β-actin</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">XM_003124280.3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GGATGCAGAAGGAGATCACG</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1"></td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">Reverse</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">ATCTGCTGGAAGGTGGACAG</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>ZO-1, zonula occludens-1.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="animals-10-00290-t002" orientation="portrait" position="float">
<object-id pub-id-type="pii">animals-10-00290-t002_Table 2</object-id>
<label>Table 2</label>
<caption>
<p>Growth performance of piglets.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">Items</th>
<th colspan="3" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1">Dietary Treatment</th>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">SEM</th>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">
<italic>p</italic>
-Value</th>
</tr>
<tr>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CON</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">RAPA</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CQ</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Day 1 body weight, kg</td>
<td align="center" valign="middle" rowspan="1" colspan="1">7.14 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">6.78 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">6.86 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.15 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.63 </td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Day 7 body weight, kg</td>
<td align="center" valign="middle" rowspan="1" colspan="1">8.04 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">6.78 * </td>
<td align="center" valign="middle" rowspan="1" colspan="1">7.84 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.20 </td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Day 14 body weight, kg</td>
<td align="center" valign="middle" rowspan="1" colspan="1">9.57 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">6.80 * </td>
<td align="center" valign="middle" rowspan="1" colspan="1">9.99 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.40 </td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Average daily gain, g</td>
<td align="center" valign="middle" rowspan="1" colspan="1">173.43 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">1.19 * </td>
<td align="center" valign="middle" rowspan="1" colspan="1">223.29 * </td>
<td align="center" valign="middle" rowspan="1" colspan="1">26.13 </td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Average daily feed intake, g</td>
<td align="center" valign="middle" rowspan="1" colspan="1">261.67 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">122.50 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">254.50 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">16.53 </td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">Feed efficiency, g gain/g feed </td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.60 </td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.13 </td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.91 </td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.11 </td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1"><0.01</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Growth performance of piglets. Dietary treatment: RAPA, rapamycin; CQ, chloroquine; CON, normal saline. All values are expressed in relation to the control. *
<italic>p</italic>
< 0.05 vs. control (
<italic>n</italic>
= 6).</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="animals-10-00290-t003" orientation="portrait" position="float">
<object-id pub-id-type="pii">animals-10-00290-t003_Table 3</object-id>
<label>Table 3</label>
<caption>
<p>Serum levels of serum diamine oxidase (DAO) and D-lactate.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">Items</th>
<th colspan="3" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1">Dietary Treatment</th>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">SEM</th>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">
<italic>p</italic>
-Value</th>
</tr>
<tr>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CON</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">RAPA</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CQ</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">DAO, mmol/L</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1.40 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.72 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1.35 </td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.22</td>
<td align="center" valign="middle" rowspan="1" colspan="1">< 0.01</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">D-lactate, μg/mL</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">77.75</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">95.67 *</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">63.53 *</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">9.30</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">< 0.01</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Dietary treatment: RAPA, rapamycin; CQ, chloroquine; CON, normal saline. All values are expressed in relation to the control. *
<italic>p</italic>
< 0.05 vs. control (
<italic>n</italic>
= 6).</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="animals-10-00290-t004" orientation="portrait" position="float">
<object-id pub-id-type="pii">animals-10-00290-t004_Table 4</object-id>
<label>Table 4</label>
<caption>
<p>Serum inflammatory factors levels (pg/mL).</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">Items</th>
<th colspan="3" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1">Dietary Treatment</th>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">SEM</th>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">
<italic>p</italic>
-Value</th>
</tr>
<tr>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CON</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">RAPA</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CQ</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IL-6</td>
<td align="center" valign="middle" rowspan="1" colspan="1">669.74</td>
<td align="center" valign="middle" rowspan="1" colspan="1">705.83 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">565.70 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">42.01</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.04</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IL-12</td>
<td align="center" valign="middle" rowspan="1" colspan="1">106.20</td>
<td align="center" valign="middle" rowspan="1" colspan="1">123.07 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">104.06</td>
<td align="center" valign="middle" rowspan="1" colspan="1">24.60</td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IL-1β</td>
<td align="center" valign="middle" rowspan="1" colspan="1">339.61</td>
<td align="center" valign="middle" rowspan="1" colspan="1">376.88 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">231.75 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">44.53</td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">TNF-α</td>
<td align="center" valign="middle" rowspan="1" colspan="1">110.68</td>
<td align="center" valign="middle" rowspan="1" colspan="1">125.06</td>
<td align="center" valign="middle" rowspan="1" colspan="1">96.10</td>
<td align="center" valign="middle" rowspan="1" colspan="1">8.53</td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IL-8</td>
<td align="center" valign="middle" rowspan="1" colspan="1">38.48</td>
<td align="center" valign="middle" rowspan="1" colspan="1">44.40 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">23.56 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">6.20</td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IFN-γ</td>
<td align="center" valign="middle" rowspan="1" colspan="1">25.59</td>
<td align="center" valign="middle" rowspan="1" colspan="1">27.19</td>
<td align="center" valign="middle" rowspan="1" colspan="1">13.34 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">4.37</td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">TGF-β</td>
<td align="center" valign="middle" rowspan="1" colspan="1">454.20</td>
<td align="center" valign="middle" rowspan="1" colspan="1">216.89 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">549.37 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">47.00</td>
<td align="center" valign="middle" rowspan="1" colspan="1"><0.01</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">IL-10</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">107.62</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">91.83</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">106.80</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">5.13</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.20</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Dietary treatment: RAPA, rapamycin; CQ, chloroquine; CON, normal saline. All values are expressed in relation to the control. *
<italic>p</italic>
< 0.05 vs. control (
<italic>n</italic>
= 6).</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="animals-10-00290-t005" orientation="portrait" position="float">
<object-id pub-id-type="pii">animals-10-00290-t005_Table 5</object-id>
<label>Table 5</label>
<caption>
<p>Plasma antioxidant index.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">Items</th>
<th colspan="3" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1">Dietary treatment</th>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">SEM</th>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">
<italic>p</italic>
-Value</th>
</tr>
<tr>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CON</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">RAPA</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CQ</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">SOD, U/ml</td>
<td align="center" valign="middle" rowspan="1" colspan="1">74.38</td>
<td align="center" valign="middle" rowspan="1" colspan="1">64.28 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">71.86</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1.17</td>
<td align="center" valign="middle" rowspan="1" colspan="1">< 0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">MDA, nmol/ml</td>
<td align="center" valign="middle" rowspan="1" colspan="1">3.65</td>
<td align="center" valign="middle" rowspan="1" colspan="1">4.56 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">3.43</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.16</td>
<td align="center" valign="middle" rowspan="1" colspan="1">< 0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">GST, U/ml</td>
<td align="center" valign="middle" rowspan="1" colspan="1">34.32</td>
<td align="center" valign="middle" rowspan="1" colspan="1">26.61 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">42.60 * </td>
<td align="center" valign="middle" rowspan="1" colspan="1">1.72</td>
<td align="center" valign="middle" rowspan="1" colspan="1">< 0.01</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">GSH-PX, U/ml</td>
<td align="center" valign="middle" rowspan="1" colspan="1">105.39</td>
<td align="center" valign="middle" rowspan="1" colspan="1">86.33 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">114.52 *</td>
<td align="center" valign="middle" rowspan="1" colspan="1">3.07</td>
<td align="center" valign="middle" rowspan="1" colspan="1">< 0.01</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">T-AOC, mmol/L</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.22</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.18 </td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.22</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.02</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Superoxide dismutase, SOD; malondialdehyde, MDA; glutathione S-transferase, GST; glutathione peroxidase, GSH-Px; total antioxidant capacity, T-AOC. Dietary treatment: RAPA, rapamycin; CQ, chloroquine; CON, normal saline. All values are expressed in relation to the control. *
<italic>p</italic>
< 0.05 vs. control (
<italic>n</italic>
= 6).</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>République populaire de Chine</li>
</country>
<settlement>
<li>Pékin</li>
</settlement>
</list>
<tree>
<noCountry>
<name sortKey="Chang, Meinan" sort="Chang, Meinan" uniqKey="Chang M" first="Meinan" last="Chang">Meinan Chang</name>
<name sortKey="Gao, Qian" sort="Gao, Qian" uniqKey="Gao Q" first="Qian" last="Gao">Qian Gao</name>
<name sortKey="Li, Jianjun" sort="Li, Jianjun" uniqKey="Li J" first="Jianjun" last="Li">Jianjun Li</name>
<name sortKey="Li, Xiaozhen" sort="Li, Xiaozhen" uniqKey="Li X" first="Xiaozhen" last="Li">Xiaozhen Li</name>
<name sortKey="Sun, Peng" sort="Sun, Peng" uniqKey="Sun P" first="Peng" last="Sun">Peng Sun</name>
<name sortKey="Tan, Bie" sort="Tan, Bie" uniqKey="Tan B" first="Bie" last="Tan">Bie Tan</name>
<name sortKey="Tang, Shengguo" sort="Tang, Shengguo" uniqKey="Tang S" first="Shengguo" last="Tang">Shengguo Tang</name>
<name sortKey="Tang, Yulong" sort="Tang, Yulong" uniqKey="Tang Y" first="Yulong" last="Tang">Yulong Tang</name>
<name sortKey="Yin, Yulong" sort="Yin, Yulong" uniqKey="Yin Y" first="Yulong" last="Yin">Yulong Yin</name>
<name sortKey="Zhang, Shuo" sort="Zhang, Shuo" uniqKey="Zhang S" first="Shuo" last="Zhang">Shuo Zhang</name>
</noCountry>
<country name="République populaire de Chine">
<noRegion>
<name sortKey="Liao, Simeng" sort="Liao, Simeng" uniqKey="Liao S" first="Simeng" last="Liao">Simeng Liao</name>
</noRegion>
<name sortKey="Qi, Ming" sort="Qi, Ming" uniqKey="Qi M" first="Ming" last="Qi">Ming Qi</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/ChloroquineV1/Data/Ncbi/Merge
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000F29 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd -nk 000F29 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    ChloroquineV1
   |flux=    Ncbi
   |étape=   Merge
   |type=    RBID
   |clé=     PMC:7071126
   |texte=   Chloroquine Downregulation of Intestinal Autophagy to Alleviate Biological Stress in Early-Weaned Piglets
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/RBID.i   -Sk "pubmed:32059526" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd   \
       | NlmPubMed2Wicri -a ChloroquineV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Wed Mar 25 22:43:59 2020. Site generation: Sun Jan 31 12:44:45 2021