Serveur d'exploration Chloroquine

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

PFKFB3 Inhibition Attenuates Oxaliplatin-Induced Autophagy and Enhances Its Cytotoxicity in Colon Cancer Cells

Identifieur interne : 000B59 ( Ncbi/Merge ); précédent : 000B58; suivant : 000B60

PFKFB3 Inhibition Attenuates Oxaliplatin-Induced Autophagy and Enhances Its Cytotoxicity in Colon Cancer Cells

Auteurs : Siyuan Yan ; Nan Zhou ; Deru Zhang ; Kaile Zhang ; Wenao Zheng ; Yonghua Bao ; Wancai Yang [États-Unis]

Source :

RBID : PMC:6862230

Abstract

6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase isoform 3 (PFKFB3), a glycolytic enzyme highly expressed in cancer cells, has been reported to participate in regulating metabolism, angiogenesis, and autophagy. Although anti-cancer drug oxaliplatin (Oxa) effectively inhibits cell proliferation and induces apoptosis, the growing resistance and side-effects make it urgent to improve the therapeutic strategy of Oxa. Although Oxa induces the autophagy process, the role of PFKFB3 in this process remains unknown. In addition, whether PFKFB3 affects the cytotoxicity of Oxa has not been investigated. Here, we show that Oxa-inhibited cell proliferation and migration concomitant with the induction of apoptosis and autophagy in SW480 cells. Both inhibition of autophagy by small molecule inhibitors and siRNA modification decreased the cell viability loss and apoptosis induced by Oxa. Utilizing quantitative PCR and immunoblotting, we observed that Oxa increased PFKFB3 expression in a time- and dose-dependent manner. Meanwhile, suppression of PFKFB3 attenuated both the basal and Oxa-induced autophagy, by monitoring the autophagic flux and phosphorylated-Ulk1, which play essential roles in autophagy initiation. Moreover, PFKFB3 inhibition further inhibited the cell proliferation/migration, and cell viability decreased by Oxa. Collectively, the presented data demonstrated that PFKFB3 inhibition attenuated Oxa-induced autophagy and enhanced its cytotoxicity in colorectal cancer cells.


Url:
DOI: 10.3390/ijms20215415
PubMed: 31671668
PubMed Central: 6862230

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:6862230

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">PFKFB3 Inhibition Attenuates Oxaliplatin-Induced Autophagy and Enhances Its Cytotoxicity in Colon Cancer Cells</title>
<author>
<name sortKey="Yan, Siyuan" sort="Yan, Siyuan" uniqKey="Yan S" first="Siyuan" last="Yan">Siyuan Yan</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhou, Nan" sort="Zhou, Nan" uniqKey="Zhou N" first="Nan" last="Zhou">Nan Zhou</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Deru" sort="Zhang, Deru" uniqKey="Zhang D" first="Deru" last="Zhang">Deru Zhang</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Kaile" sort="Zhang, Kaile" uniqKey="Zhang K" first="Kaile" last="Zhang">Kaile Zhang</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zheng, Wenao" sort="Zheng, Wenao" uniqKey="Zheng W" first="Wenao" last="Zheng">Wenao Zheng</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bao, Yonghua" sort="Bao, Yonghua" uniqKey="Bao Y" first="Yonghua" last="Bao">Yonghua Bao</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yang, Wancai" sort="Yang, Wancai" uniqKey="Yang W" first="Wancai" last="Yang">Wancai Yang</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="af2-ijms-20-05415">Department of Pathology, University of Illinois at Chicago, Chicago, IL 60612, USA</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea>Department of Pathology, University of Illinois at Chicago, Chicago, IL 60612</wicri:regionArea>
<orgName type="university">Université de l'Illinois à Chicago</orgName>
<placeName>
<settlement type="city">Chicago</settlement>
<region type="state">Illinois</region>
</placeName>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">31671668</idno>
<idno type="pmc">6862230</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6862230</idno>
<idno type="RBID">PMC:6862230</idno>
<idno type="doi">10.3390/ijms20215415</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">000615</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000615</idno>
<idno type="wicri:Area/Pmc/Curation">000615</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000615</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000511</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000511</idno>
<idno type="wicri:Area/Ncbi/Merge">000B59</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">PFKFB3 Inhibition Attenuates Oxaliplatin-Induced Autophagy and Enhances Its Cytotoxicity in Colon Cancer Cells</title>
<author>
<name sortKey="Yan, Siyuan" sort="Yan, Siyuan" uniqKey="Yan S" first="Siyuan" last="Yan">Siyuan Yan</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhou, Nan" sort="Zhou, Nan" uniqKey="Zhou N" first="Nan" last="Zhou">Nan Zhou</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Deru" sort="Zhang, Deru" uniqKey="Zhang D" first="Deru" last="Zhang">Deru Zhang</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Kaile" sort="Zhang, Kaile" uniqKey="Zhang K" first="Kaile" last="Zhang">Kaile Zhang</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zheng, Wenao" sort="Zheng, Wenao" uniqKey="Zheng W" first="Wenao" last="Zheng">Wenao Zheng</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bao, Yonghua" sort="Bao, Yonghua" uniqKey="Bao Y" first="Yonghua" last="Bao">Yonghua Bao</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yang, Wancai" sort="Yang, Wancai" uniqKey="Yang W" first="Wancai" last="Yang">Wancai Yang</name>
<affiliation>
<nlm:aff id="af1-ijms-20-05415">Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</nlm:aff>
</affiliation>
<affiliation wicri:level="4">
<nlm:aff id="af2-ijms-20-05415">Department of Pathology, University of Illinois at Chicago, Chicago, IL 60612, USA</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea>Department of Pathology, University of Illinois at Chicago, Chicago, IL 60612</wicri:regionArea>
<orgName type="university">Université de l'Illinois à Chicago</orgName>
<placeName>
<settlement type="city">Chicago</settlement>
<region type="state">Illinois</region>
</placeName>
</affiliation>
</author>
</analytic>
<series>
<title level="j">International Journal of Molecular Sciences</title>
<idno type="eISSN">1422-0067</idno>
<imprint>
<date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase isoform 3 (PFKFB3), a glycolytic enzyme highly expressed in cancer cells, has been reported to participate in regulating metabolism, angiogenesis, and autophagy. Although anti-cancer drug oxaliplatin (Oxa) effectively inhibits cell proliferation and induces apoptosis, the growing resistance and side-effects make it urgent to improve the therapeutic strategy of Oxa. Although Oxa induces the autophagy process, the role of PFKFB3 in this process remains unknown. In addition, whether PFKFB3 affects the cytotoxicity of Oxa has not been investigated. Here, we show that Oxa-inhibited cell proliferation and migration concomitant with the induction of apoptosis and autophagy in SW480 cells. Both inhibition of autophagy by small molecule inhibitors and siRNA modification decreased the cell viability loss and apoptosis induced by Oxa. Utilizing quantitative PCR and immunoblotting, we observed that Oxa increased PFKFB3 expression in a time- and dose-dependent manner. Meanwhile, suppression of PFKFB3 attenuated both the basal and Oxa-induced autophagy, by monitoring the autophagic flux and phosphorylated-Ulk1, which play essential roles in autophagy initiation. Moreover, PFKFB3 inhibition further inhibited the cell proliferation/migration, and cell viability decreased by Oxa. Collectively, the presented data demonstrated that PFKFB3 inhibition attenuated Oxa-induced autophagy and enhanced its cytotoxicity in colorectal cancer cells.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Brenner, H" uniqKey="Brenner H">H. Brenner</name>
</author>
<author>
<name sortKey="Kloor, M" uniqKey="Kloor M">M. Kloor</name>
</author>
<author>
<name sortKey="Pox, C P" uniqKey="Pox C">C.P. Pox</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Siegel, R L" uniqKey="Siegel R">R.L. Siegel</name>
</author>
<author>
<name sortKey="Miller, K D" uniqKey="Miller K">K.D. Miller</name>
</author>
<author>
<name sortKey="Fedewa, S A" uniqKey="Fedewa S">S.A. Fedewa</name>
</author>
<author>
<name sortKey="Ahnen, D J" uniqKey="Ahnen D">D.J. Ahnen</name>
</author>
<author>
<name sortKey="Meester, R G S" uniqKey="Meester R">R.G.S. Meester</name>
</author>
<author>
<name sortKey="Barzi, A" uniqKey="Barzi A">A. Barzi</name>
</author>
<author>
<name sortKey="Jemal, A" uniqKey="Jemal A">A. Jemal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Miller, K D" uniqKey="Miller K">K.D. Miller</name>
</author>
<author>
<name sortKey="Siegel, R L" uniqKey="Siegel R">R.L. Siegel</name>
</author>
<author>
<name sortKey="Lin, C C" uniqKey="Lin C">C.C. Lin</name>
</author>
<author>
<name sortKey="Mariotto, A B" uniqKey="Mariotto A">A.B. Mariotto</name>
</author>
<author>
<name sortKey="Kramer, J L" uniqKey="Kramer J">J.L. Kramer</name>
</author>
<author>
<name sortKey="Rowland, J H" uniqKey="Rowland J">J.H. Rowland</name>
</author>
<author>
<name sortKey="Stein, K D" uniqKey="Stein K">K.D. Stein</name>
</author>
<author>
<name sortKey="Alteri, R" uniqKey="Alteri R">R. Alteri</name>
</author>
<author>
<name sortKey="Jemal, A" uniqKey="Jemal A">A. Jemal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fang, C" uniqKey="Fang C">C. Fang</name>
</author>
<author>
<name sortKey="Fan, C" uniqKey="Fan C">C. Fan</name>
</author>
<author>
<name sortKey="Wang, C" uniqKey="Wang C">C. Wang</name>
</author>
<author>
<name sortKey="Huang, Q" uniqKey="Huang Q">Q. Huang</name>
</author>
<author>
<name sortKey="Meng, W" uniqKey="Meng W">W. Meng</name>
</author>
<author>
<name sortKey="Yu, Y" uniqKey="Yu Y">Y. Yu</name>
</author>
<author>
<name sortKey="Yang, L" uniqKey="Yang L">L. Yang</name>
</author>
<author>
<name sortKey="Hu, J" uniqKey="Hu J">J. Hu</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y. Li</name>
</author>
<author>
<name sortKey="Mo, X" uniqKey="Mo X">X. Mo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Edwards, B K" uniqKey="Edwards B">B.K. Edwards</name>
</author>
<author>
<name sortKey="Noone, A M" uniqKey="Noone A">A.M. Noone</name>
</author>
<author>
<name sortKey="Mariotto, A B" uniqKey="Mariotto A">A.B. Mariotto</name>
</author>
<author>
<name sortKey="Simard, E P" uniqKey="Simard E">E.P. Simard</name>
</author>
<author>
<name sortKey="Boscoe, F P" uniqKey="Boscoe F">F.P. Boscoe</name>
</author>
<author>
<name sortKey="Henley, S J" uniqKey="Henley S">S.J. Henley</name>
</author>
<author>
<name sortKey="Jemal, A" uniqKey="Jemal A">A. Jemal</name>
</author>
<author>
<name sortKey="Cho, H" uniqKey="Cho H">H. Cho</name>
</author>
<author>
<name sortKey="Anderson, R N" uniqKey="Anderson R">R.N. Anderson</name>
</author>
<author>
<name sortKey="Kohler, B A" uniqKey="Kohler B">B.A. Kohler</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Du, Z" uniqKey="Du Z">Z. Du</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X. Liu</name>
</author>
<author>
<name sortKey="Chen, T" uniqKey="Chen T">T. Chen</name>
</author>
<author>
<name sortKey="Gao, W" uniqKey="Gao W">W. Gao</name>
</author>
<author>
<name sortKey="Wu, Z" uniqKey="Wu Z">Z. Wu</name>
</author>
<author>
<name sortKey="Hu, Z" uniqKey="Hu Z">Z. Hu</name>
</author>
<author>
<name sortKey="Wei, D" uniqKey="Wei D">D. Wei</name>
</author>
<author>
<name sortKey="Gao, C" uniqKey="Gao C">C. Gao</name>
</author>
<author>
<name sortKey="Li, Q" uniqKey="Li Q">Q. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lin, G L" uniqKey="Lin G">G.-L. Lin</name>
</author>
<author>
<name sortKey="Ting, H J" uniqKey="Ting H">H.-J. Ting</name>
</author>
<author>
<name sortKey="Tseng, T C" uniqKey="Tseng T">T.-C. Tseng</name>
</author>
<author>
<name sortKey="Juang, V" uniqKey="Juang V">V. Juang</name>
</author>
<author>
<name sortKey="Lo, Y L" uniqKey="Lo Y">Y.-L. Lo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bhardwaj, M" uniqKey="Bhardwaj M">M. Bhardwaj</name>
</author>
<author>
<name sortKey="Cho, H J" uniqKey="Cho H">H.J. Cho</name>
</author>
<author>
<name sortKey="Paul, S" uniqKey="Paul S">S. Paul</name>
</author>
<author>
<name sortKey="Jakhar, R" uniqKey="Jakhar R">R. Jakhar</name>
</author>
<author>
<name sortKey="Khan, I" uniqKey="Khan I">I. Khan</name>
</author>
<author>
<name sortKey="Lee, S J" uniqKey="Lee S">S.J. Lee</name>
</author>
<author>
<name sortKey="Kim, B Y" uniqKey="Kim B">B.Y. Kim</name>
</author>
<author>
<name sortKey="Krishnan, M" uniqKey="Krishnan M">M. Krishnan</name>
</author>
<author>
<name sortKey="Khaket, T P" uniqKey="Khaket T">T.P. Khaket</name>
</author>
<author>
<name sortKey="Lee, H G" uniqKey="Lee H">H.G. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, J" uniqKey="Li J">J. Li</name>
</author>
<author>
<name sortKey="Hou, N" uniqKey="Hou N">N. Hou</name>
</author>
<author>
<name sortKey="Faried, A" uniqKey="Faried A">A. Faried</name>
</author>
<author>
<name sortKey="Tsutsumi, S" uniqKey="Tsutsumi S">S. Tsutsumi</name>
</author>
<author>
<name sortKey="Kuwano, H" uniqKey="Kuwano H">H. Kuwano</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Klionsky, D J" uniqKey="Klionsky D">D.J. Klionsky</name>
</author>
<author>
<name sortKey="Abdelmohsen, K" uniqKey="Abdelmohsen K">K. Abdelmohsen</name>
</author>
<author>
<name sortKey="Abe, A" uniqKey="Abe A">A. Abe</name>
</author>
<author>
<name sortKey="Abedin, M J" uniqKey="Abedin M">M.J. Abedin</name>
</author>
<author>
<name sortKey="Abeliovich, H" uniqKey="Abeliovich H">H. Abeliovich</name>
</author>
<author>
<name sortKey="Arozena, A A" uniqKey="Arozena A">A.A. Arozena</name>
</author>
<author>
<name sortKey="Adachi, H" uniqKey="Adachi H">H. Adachi</name>
</author>
<author>
<name sortKey="Adams, C M" uniqKey="Adams C">C.M. Adams</name>
</author>
<author>
<name sortKey="Adams, P D" uniqKey="Adams P">P.D. Adams</name>
</author>
<author>
<name sortKey="Adeli, K" uniqKey="Adeli K">K. Adeli</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kroemer, G" uniqKey="Kroemer G">G. Kroemer</name>
</author>
<author>
<name sortKey="Levine, B" uniqKey="Levine B">B. Levine</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yan, S" uniqKey="Yan S">S. Yan</name>
</author>
<author>
<name sortKey="Yang, X" uniqKey="Yang X">X. Yang</name>
</author>
<author>
<name sortKey="Chen, T" uniqKey="Chen T">T. Chen</name>
</author>
<author>
<name sortKey="Xi, Z" uniqKey="Xi Z">Z. Xi</name>
</author>
<author>
<name sortKey="Jiang, X" uniqKey="Jiang X">X. Jiang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kumar, P" uniqKey="Kumar P">P. Kumar</name>
</author>
<author>
<name sortKey="Zhang, D M" uniqKey="Zhang D">D.-M. Zhang</name>
</author>
<author>
<name sortKey="Degenhardt, K" uniqKey="Degenhardt K">K. Degenhardt</name>
</author>
<author>
<name sortKey="Chen, Z S" uniqKey="Chen Z">Z.-S. Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, Z" uniqKey="Yang Z">Z. Yang</name>
</author>
<author>
<name sortKey="Klionsky, D J" uniqKey="Klionsky D">D.J. Klionsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Inoki, K" uniqKey="Inoki K">K. Inoki</name>
</author>
<author>
<name sortKey="Zhu, T" uniqKey="Zhu T">T. Zhu</name>
</author>
<author>
<name sortKey="Guan, K L" uniqKey="Guan K">K.-L. Guan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gwinn, D M" uniqKey="Gwinn D">D.M. Gwinn</name>
</author>
<author>
<name sortKey="Shackelford, D B" uniqKey="Shackelford D">D.B. Shackelford</name>
</author>
<author>
<name sortKey="Egan, D F" uniqKey="Egan D">D.F. Egan</name>
</author>
<author>
<name sortKey="Mihaylova, M M" uniqKey="Mihaylova M">M.M. Mihaylova</name>
</author>
<author>
<name sortKey="Mery, A" uniqKey="Mery A">A. Méry</name>
</author>
<author>
<name sortKey="Vasquez, D S" uniqKey="Vasquez D">D.S. Vasquez</name>
</author>
<author>
<name sortKey="Turk, B E" uniqKey="Turk B">B.E. Turk</name>
</author>
<author>
<name sortKey="Shaw, R J" uniqKey="Shaw R">R.J. Shaw</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Egan, D F" uniqKey="Egan D">D.F. Egan</name>
</author>
<author>
<name sortKey="Shackelford, D B" uniqKey="Shackelford D">D.B. Shackelford</name>
</author>
<author>
<name sortKey="Mihaylova, M M" uniqKey="Mihaylova M">M.M. Mihaylova</name>
</author>
<author>
<name sortKey="Gelino, S" uniqKey="Gelino S">S. Gelino</name>
</author>
<author>
<name sortKey="Kohnz, R A" uniqKey="Kohnz R">R.A. Kohnz</name>
</author>
<author>
<name sortKey="Mair, W" uniqKey="Mair W">W. Mair</name>
</author>
<author>
<name sortKey="Vasquez, D S" uniqKey="Vasquez D">D.S. Vasquez</name>
</author>
<author>
<name sortKey="Joshi, A" uniqKey="Joshi A">A. Joshi</name>
</author>
<author>
<name sortKey="Gwinn, D M" uniqKey="Gwinn D">D.M. Gwinn</name>
</author>
<author>
<name sortKey="Taylor, R" uniqKey="Taylor R">R. Taylor</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brown, E B" uniqKey="Brown E">E.B. Brown</name>
</author>
<author>
<name sortKey="Campbell, R B" uniqKey="Campbell R">R.B. Campbell</name>
</author>
<author>
<name sortKey="Tsuzuki, Y" uniqKey="Tsuzuki Y">Y. Tsuzuki</name>
</author>
<author>
<name sortKey="Xu, L" uniqKey="Xu L">L. Xu</name>
</author>
<author>
<name sortKey="Carmeliet, P" uniqKey="Carmeliet P">P. Carmeliet</name>
</author>
<author>
<name sortKey="Fukumura, D" uniqKey="Fukumura D">D. Fukumura</name>
</author>
<author>
<name sortKey="Jain, R K" uniqKey="Jain R">R.K. Jain</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Goel, S" uniqKey="Goel S">S. Goel</name>
</author>
<author>
<name sortKey="Duda, D G" uniqKey="Duda D">D.G. Duda</name>
</author>
<author>
<name sortKey="Xu, L" uniqKey="Xu L">L. Xu</name>
</author>
<author>
<name sortKey="Munn, L L" uniqKey="Munn L">L.L. Munn</name>
</author>
<author>
<name sortKey="Boucher, Y" uniqKey="Boucher Y">Y. Boucher</name>
</author>
<author>
<name sortKey="Fukumura, D" uniqKey="Fukumura D">D. Fukumura</name>
</author>
<author>
<name sortKey="Jain, R K" uniqKey="Jain R">R.K. Jain</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ros, S" uniqKey="Ros S">S. Ros</name>
</author>
<author>
<name sortKey="Schulze, A" uniqKey="Schulze A">A. Schulze</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, F L" uniqKey="Li F">F.-L. Li</name>
</author>
<author>
<name sortKey="Liu, J P" uniqKey="Liu J">J.-P. Liu</name>
</author>
<author>
<name sortKey="Bao, R X" uniqKey="Bao R">R.-X. Bao</name>
</author>
<author>
<name sortKey="Yan, G" uniqKey="Yan G">G. Yan</name>
</author>
<author>
<name sortKey="Feng, X" uniqKey="Feng X">X. Feng</name>
</author>
<author>
<name sortKey="Xu, Y P" uniqKey="Xu Y">Y.-P. Xu</name>
</author>
<author>
<name sortKey="Sun, Y P" uniqKey="Sun Y">Y.-P. Sun</name>
</author>
<author>
<name sortKey="Yan, W" uniqKey="Yan W">W. Yan</name>
</author>
<author>
<name sortKey="Ling, Z Q" uniqKey="Ling Z">Z.-Q. Ling</name>
</author>
<author>
<name sortKey="Xiong, Y" uniqKey="Xiong Y">Y. Xiong</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yan, S" uniqKey="Yan S">S. Yan</name>
</author>
<author>
<name sortKey="Wei, X" uniqKey="Wei X">X. Wei</name>
</author>
<author>
<name sortKey="Xu, S" uniqKey="Xu S">S. Xu</name>
</author>
<author>
<name sortKey="Sun, H" uniqKey="Sun H">H. Sun</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W. Wang</name>
</author>
<author>
<name sortKey="Liu, L" uniqKey="Liu L">L. Liu</name>
</author>
<author>
<name sortKey="Jiang, X" uniqKey="Jiang X">X. Jiang</name>
</author>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y. Zhang</name>
</author>
<author>
<name sortKey="Che, Y" uniqKey="Che Y">Y. Che</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yalcin, A" uniqKey="Yalcin A">A. Yalcin</name>
</author>
<author>
<name sortKey="Clem, B F" uniqKey="Clem B">B.F. Clem</name>
</author>
<author>
<name sortKey="Simmons, A" uniqKey="Simmons A">A. Simmons</name>
</author>
<author>
<name sortKey="Lane, A" uniqKey="Lane A">A. Lane</name>
</author>
<author>
<name sortKey="Nelson, K" uniqKey="Nelson K">K. Nelson</name>
</author>
<author>
<name sortKey="Clem, A L" uniqKey="Clem A">A.L. Clem</name>
</author>
<author>
<name sortKey="Brock, E" uniqKey="Brock E">E. Brock</name>
</author>
<author>
<name sortKey="Siow, D" uniqKey="Siow D">D. Siow</name>
</author>
<author>
<name sortKey="Wattenberg, B" uniqKey="Wattenberg B">B. Wattenberg</name>
</author>
<author>
<name sortKey="Telang, S" uniqKey="Telang S">S. Telang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, C" uniqKey="Wang C">C. Wang</name>
</author>
<author>
<name sortKey="Qu, J" uniqKey="Qu J">J. Qu</name>
</author>
<author>
<name sortKey="Yan, S" uniqKey="Yan S">S. Yan</name>
</author>
<author>
<name sortKey="Gao, Q" uniqKey="Gao Q">Q. Gao</name>
</author>
<author>
<name sortKey="Hao, S" uniqKey="Hao S">S. Hao</name>
</author>
<author>
<name sortKey="Zhou, D" uniqKey="Zhou D">D. Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sarkar Bhattacharya, S" uniqKey="Sarkar Bhattacharya S">S. Sarkar Bhattacharya</name>
</author>
<author>
<name sortKey="Thirusangu, P" uniqKey="Thirusangu P">P. Thirusangu</name>
</author>
<author>
<name sortKey="Jin, L" uniqKey="Jin L">L. Jin</name>
</author>
<author>
<name sortKey="Roy, D" uniqKey="Roy D">D. Roy</name>
</author>
<author>
<name sortKey="Jung, D" uniqKey="Jung D">D. Jung</name>
</author>
<author>
<name sortKey="Xiao, Y" uniqKey="Xiao Y">Y. Xiao</name>
</author>
<author>
<name sortKey="Staub, J" uniqKey="Staub J">J. Staub</name>
</author>
<author>
<name sortKey="Roy, B" uniqKey="Roy B">B. Roy</name>
</author>
<author>
<name sortKey="Molina, J R" uniqKey="Molina J">J.R. Molina</name>
</author>
<author>
<name sortKey="Shridhar, V" uniqKey="Shridhar V">V. Shridhar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mondal, S" uniqKey="Mondal S">S. Mondal</name>
</author>
<author>
<name sortKey="Roy, D" uniqKey="Roy D">D. Roy</name>
</author>
<author>
<name sortKey="Sarkar Bhattacharya, S" uniqKey="Sarkar Bhattacharya S">S. Sarkar Bhattacharya</name>
</author>
<author>
<name sortKey="Jin, L" uniqKey="Jin L">L. Jin</name>
</author>
<author>
<name sortKey="Jung, D" uniqKey="Jung D">D. Jung</name>
</author>
<author>
<name sortKey="Zhang, S" uniqKey="Zhang S">S. Zhang</name>
</author>
<author>
<name sortKey="Kalogera, E" uniqKey="Kalogera E">E. Kalogera</name>
</author>
<author>
<name sortKey="Staub, J" uniqKey="Staub J">J. Staub</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y. Wang</name>
</author>
<author>
<name sortKey="Chien, J" uniqKey="Chien J">J. Chien</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schoors, S" uniqKey="Schoors S">S. Schoors</name>
</author>
<author>
<name sortKey="De Bock, K" uniqKey="De Bock K">K. De Bock</name>
</author>
<author>
<name sortKey="Cantelmo, A R" uniqKey="Cantelmo A">A.R. Cantelmo</name>
</author>
<author>
<name sortKey="Georgiadou, M" uniqKey="Georgiadou M">M. Georgiadou</name>
</author>
<author>
<name sortKey="Ghesquiere, B" uniqKey="Ghesquiere B">B. Ghesquière</name>
</author>
<author>
<name sortKey="Cauwenberghs, S" uniqKey="Cauwenberghs S">S. Cauwenberghs</name>
</author>
<author>
<name sortKey="Kuchnio, A" uniqKey="Kuchnio A">A. Kuchnio</name>
</author>
<author>
<name sortKey="Wong, B W" uniqKey="Wong B">B.W. Wong</name>
</author>
<author>
<name sortKey="Quaegebeur, A" uniqKey="Quaegebeur A">A. Quaegebeur</name>
</author>
<author>
<name sortKey="Goveia, J" uniqKey="Goveia J">J. Goveia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cantelmo, A R" uniqKey="Cantelmo A">A.R. Cantelmo</name>
</author>
<author>
<name sortKey="Conradi, L C" uniqKey="Conradi L">L.-C. Conradi</name>
</author>
<author>
<name sortKey="Brajic, A" uniqKey="Brajic A">A. Brajic</name>
</author>
<author>
<name sortKey="Goveia, J" uniqKey="Goveia J">J. Goveia</name>
</author>
<author>
<name sortKey="Kalucka, J" uniqKey="Kalucka J">J. Kalucka</name>
</author>
<author>
<name sortKey="Pircher, A" uniqKey="Pircher A">A. Pircher</name>
</author>
<author>
<name sortKey="Chaturvedi, P" uniqKey="Chaturvedi P">P. Chaturvedi</name>
</author>
<author>
<name sortKey="Hol, J" uniqKey="Hol J">J. Hol</name>
</author>
<author>
<name sortKey="Thienpont, B" uniqKey="Thienpont B">B. Thienpont</name>
</author>
<author>
<name sortKey="Teuwen, L A" uniqKey="Teuwen L">L.-A. Teuwen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, S" uniqKey="Li S">S. Li</name>
</author>
<author>
<name sortKey="Dai, W" uniqKey="Dai W">W. Dai</name>
</author>
<author>
<name sortKey="Mo, W" uniqKey="Mo W">W. Mo</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J. Li</name>
</author>
<author>
<name sortKey="Feng, J" uniqKey="Feng J">J. Feng</name>
</author>
<author>
<name sortKey="Wu, L" uniqKey="Wu L">L. Wu</name>
</author>
<author>
<name sortKey="Liu, T" uniqKey="Liu T">T. Liu</name>
</author>
<author>
<name sortKey="Yu, Q" uniqKey="Yu Q">Q. Yu</name>
</author>
<author>
<name sortKey="Xu, S" uniqKey="Xu S">S. Xu</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mou, J J" uniqKey="Mou J">J.-J. Mou</name>
</author>
<author>
<name sortKey="Peng, J" uniqKey="Peng J">J. Peng</name>
</author>
<author>
<name sortKey="Shi, Y Y" uniqKey="Shi Y">Y.-Y. Shi</name>
</author>
<author>
<name sortKey="Li, N" uniqKey="Li N">N. Li</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y. Wang</name>
</author>
<author>
<name sortKey="Ke, Y" uniqKey="Ke Y">Y. Ke</name>
</author>
<author>
<name sortKey="Zhou, Y F" uniqKey="Zhou Y">Y.-F. Zhou</name>
</author>
<author>
<name sortKey="Zhou, F X" uniqKey="Zhou F">F.-X. Zhou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lu, W Q" uniqKey="Lu W">W.-Q. Lu</name>
</author>
<author>
<name sortKey="Hu, Y Y" uniqKey="Hu Y">Y.-Y. Hu</name>
</author>
<author>
<name sortKey="Lin, X P" uniqKey="Lin X">X.-P. Lin</name>
</author>
<author>
<name sortKey="Fan, W" uniqKey="Fan W">W. Fan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ekert, P G" uniqKey="Ekert P">P.G. Ekert</name>
</author>
<author>
<name sortKey="Silke, J" uniqKey="Silke J">J. Silke</name>
</author>
<author>
<name sortKey="Vaux, D L" uniqKey="Vaux D">D.L. Vaux</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seglen, P O" uniqKey="Seglen P">P.O. Seglen</name>
</author>
<author>
<name sortKey="Gordon, P B" uniqKey="Gordon P">P.B. Gordon</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lu, Q" uniqKey="Lu Q">Q. Lu</name>
</author>
<author>
<name sortKey="Yan, S" uniqKey="Yan S">S. Yan</name>
</author>
<author>
<name sortKey="Sun, H" uniqKey="Sun H">H. Sun</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W. Wang</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y. Li</name>
</author>
<author>
<name sortKey="Yang, X" uniqKey="Yang X">X. Yang</name>
</author>
<author>
<name sortKey="Jiang, X" uniqKey="Jiang X">X. Jiang</name>
</author>
<author>
<name sortKey="Che, Y" uniqKey="Che Y">Y. Che</name>
</author>
<author>
<name sortKey="Xi, Z" uniqKey="Xi Z">Z. Xi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="De Bock, K" uniqKey="De Bock K">K. De Bock</name>
</author>
<author>
<name sortKey="Georgiadou, M" uniqKey="Georgiadou M">M. Georgiadou</name>
</author>
<author>
<name sortKey="Schoors, S" uniqKey="Schoors S">S. Schoors</name>
</author>
<author>
<name sortKey="Kuchnio, A" uniqKey="Kuchnio A">A. Kuchnio</name>
</author>
<author>
<name sortKey="Wong, B W" uniqKey="Wong B">B.W. Wong</name>
</author>
<author>
<name sortKey="Cantelmo, A R" uniqKey="Cantelmo A">A.R. Cantelmo</name>
</author>
<author>
<name sortKey="Quaegebeur, A" uniqKey="Quaegebeur A">A. Quaegebeur</name>
</author>
<author>
<name sortKey="Ghesquiere, B" uniqKey="Ghesquiere B">B. Ghesquière</name>
</author>
<author>
<name sortKey="Cauwenberghs, S" uniqKey="Cauwenberghs S">S. Cauwenberghs</name>
</author>
<author>
<name sortKey="Eelen, G" uniqKey="Eelen G">G. Eelen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, Z" uniqKey="Yang Z">Z. Yang</name>
</author>
<author>
<name sortKey="Fujii, H" uniqKey="Fujii H">H. Fujii</name>
</author>
<author>
<name sortKey="Mohan, S V" uniqKey="Mohan S">S.V. Mohan</name>
</author>
<author>
<name sortKey="Goronzy, J J" uniqKey="Goronzy J">J.J. Goronzy</name>
</author>
<author>
<name sortKey="Weyand, C M" uniqKey="Weyand C">C.M. Weyand</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="White, E" uniqKey="White E">E. White</name>
</author>
<author>
<name sortKey="Dipaola, R S" uniqKey="Dipaola R">R.S. DiPaola</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kimura, T" uniqKey="Kimura T">T. Kimura</name>
</author>
<author>
<name sortKey="Takabatake, Y" uniqKey="Takabatake Y">Y. Takabatake</name>
</author>
<author>
<name sortKey="Takahashi, A" uniqKey="Takahashi A">A. Takahashi</name>
</author>
<author>
<name sortKey="Isaka, Y" uniqKey="Isaka Y">Y. Isaka</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="El Khattouti, A" uniqKey="El Khattouti A">A. El-Khattouti</name>
</author>
<author>
<name sortKey="Selimovic, D" uniqKey="Selimovic D">D. Selimovic</name>
</author>
<author>
<name sortKey="Haikel, Y" uniqKey="Haikel Y">Y. Haikel</name>
</author>
<author>
<name sortKey="Hassan, M" uniqKey="Hassan M">M. Hassan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nikoletopoulou, V" uniqKey="Nikoletopoulou V">V. Nikoletopoulou</name>
</author>
<author>
<name sortKey="Markaki, M" uniqKey="Markaki M">M. Markaki</name>
</author>
<author>
<name sortKey="Palikaras, K" uniqKey="Palikaras K">K. Palikaras</name>
</author>
<author>
<name sortKey="Tavernarakis, N" uniqKey="Tavernarakis N">N. Tavernarakis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cho, D H" uniqKey="Cho D">D.-H. Cho</name>
</author>
<author>
<name sortKey="Jo, Y K" uniqKey="Jo Y">Y.K. Jo</name>
</author>
<author>
<name sortKey="Hwang, J J" uniqKey="Hwang J">J.J. Hwang</name>
</author>
<author>
<name sortKey="Lee, Y M" uniqKey="Lee Y">Y.M. Lee</name>
</author>
<author>
<name sortKey="Roh, S A" uniqKey="Roh S">S.A. Roh</name>
</author>
<author>
<name sortKey="Kim, J C" uniqKey="Kim J">J.C. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yamamoto, T" uniqKey="Yamamoto T">T. Yamamoto</name>
</author>
<author>
<name sortKey="Takano, N" uniqKey="Takano N">N. Takano</name>
</author>
<author>
<name sortKey="Ishiwata, K" uniqKey="Ishiwata K">K. Ishiwata</name>
</author>
<author>
<name sortKey="Ohmura, M" uniqKey="Ohmura M">M. Ohmura</name>
</author>
<author>
<name sortKey="Nagahata, Y" uniqKey="Nagahata Y">Y. Nagahata</name>
</author>
<author>
<name sortKey="Matsuura, T" uniqKey="Matsuura T">T. Matsuura</name>
</author>
<author>
<name sortKey="Kamata, A" uniqKey="Kamata A">A. Kamata</name>
</author>
<author>
<name sortKey="Sakamoto, K" uniqKey="Sakamoto K">K. Sakamoto</name>
</author>
<author>
<name sortKey="Nakanishi, T" uniqKey="Nakanishi T">T. Nakanishi</name>
</author>
<author>
<name sortKey="Kubo, A" uniqKey="Kubo A">A. Kubo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xu, Y" uniqKey="Xu Y">Y. Xu</name>
</author>
<author>
<name sortKey="An, X" uniqKey="An X">X. An</name>
</author>
<author>
<name sortKey="Guo, X" uniqKey="Guo X">X. Guo</name>
</author>
<author>
<name sortKey="Habtetsion, T G" uniqKey="Habtetsion T">T.G. Habtetsion</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y. Wang</name>
</author>
<author>
<name sortKey="Xu, X" uniqKey="Xu X">X. Xu</name>
</author>
<author>
<name sortKey="Kandala, S" uniqKey="Kandala S">S. Kandala</name>
</author>
<author>
<name sortKey="Li, Q" uniqKey="Li Q">Q. Li</name>
</author>
<author>
<name sortKey="Li, H" uniqKey="Li H">H. Li</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C. Zhang</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Int J Mol Sci</journal-id>
<journal-id journal-id-type="iso-abbrev">Int J Mol Sci</journal-id>
<journal-id journal-id-type="publisher-id">ijms</journal-id>
<journal-title-group>
<journal-title>International Journal of Molecular Sciences</journal-title>
</journal-title-group>
<issn pub-type="epub">1422-0067</issn>
<publisher>
<publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">31671668</article-id>
<article-id pub-id-type="pmc">6862230</article-id>
<article-id pub-id-type="doi">10.3390/ijms20215415</article-id>
<article-id pub-id-type="publisher-id">ijms-20-05415</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>PFKFB3 Inhibition Attenuates Oxaliplatin-Induced Autophagy and Enhances Its Cytotoxicity in Colon Cancer Cells</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Yan</surname>
<given-names>Siyuan</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-20-05415">1</xref>
<xref rid="c1-ijms-20-05415" ref-type="corresp">*</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhou</surname>
<given-names>Nan</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-20-05415">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Deru</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-20-05415">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Kaile</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-20-05415">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zheng</surname>
<given-names>Wenao</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-20-05415">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bao</surname>
<given-names>Yonghua</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-20-05415">1</xref>
</contrib>
<contrib contrib-type="author">
<contrib-id contrib-id-type="orcid" authenticated="true">https://orcid.org/0000-0001-7437-9197</contrib-id>
<name>
<surname>Yang</surname>
<given-names>Wancai</given-names>
</name>
<xref ref-type="aff" rid="af1-ijms-20-05415">1</xref>
<xref ref-type="aff" rid="af2-ijms-20-05415">2</xref>
<xref rid="c1-ijms-20-05415" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<aff id="af1-ijms-20-05415">
<label>1</label>
Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University, Jining 272067, China;
<email>zhounanzn720@163.com</email>
(N.Z.);
<email>zhangdr2613@163.com</email>
(D.Z.);
<email>zhangkaile1315@163.com</email>
(K.Z.);
<email>zwa2019med@163.com</email>
(W.Z.);
<email>baoyonghua2005@126.com</email>
(Y.B.)</aff>
<aff id="af2-ijms-20-05415">
<label>2</label>
Department of Pathology, University of Illinois at Chicago, Chicago, IL 60612, USA</aff>
<author-notes>
<corresp id="c1-ijms-20-05415">
<label>*</label>
Correspondence:
<email>yansy@mail.jnmc.edu.cn</email>
(S.Y.);
<email>wyang06@uic.edu</email>
(W.Y.)</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>30</day>
<month>10</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="collection">
<month>11</month>
<year>2019</year>
</pub-date>
<volume>20</volume>
<issue>21</issue>
<elocation-id>5415</elocation-id>
<history>
<date date-type="received">
<day>09</day>
<month>9</month>
<year>2019</year>
</date>
<date date-type="accepted">
<day>28</day>
<month>10</month>
<year>2019</year>
</date>
</history>
<permissions>
<copyright-statement>© 2019 by the authors.</copyright-statement>
<copyright-year>2019</copyright-year>
<license license-type="open-access">
<license-p>Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<p>6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase isoform 3 (PFKFB3), a glycolytic enzyme highly expressed in cancer cells, has been reported to participate in regulating metabolism, angiogenesis, and autophagy. Although anti-cancer drug oxaliplatin (Oxa) effectively inhibits cell proliferation and induces apoptosis, the growing resistance and side-effects make it urgent to improve the therapeutic strategy of Oxa. Although Oxa induces the autophagy process, the role of PFKFB3 in this process remains unknown. In addition, whether PFKFB3 affects the cytotoxicity of Oxa has not been investigated. Here, we show that Oxa-inhibited cell proliferation and migration concomitant with the induction of apoptosis and autophagy in SW480 cells. Both inhibition of autophagy by small molecule inhibitors and siRNA modification decreased the cell viability loss and apoptosis induced by Oxa. Utilizing quantitative PCR and immunoblotting, we observed that Oxa increased PFKFB3 expression in a time- and dose-dependent manner. Meanwhile, suppression of PFKFB3 attenuated both the basal and Oxa-induced autophagy, by monitoring the autophagic flux and phosphorylated-Ulk1, which play essential roles in autophagy initiation. Moreover, PFKFB3 inhibition further inhibited the cell proliferation/migration, and cell viability decreased by Oxa. Collectively, the presented data demonstrated that PFKFB3 inhibition attenuated Oxa-induced autophagy and enhanced its cytotoxicity in colorectal cancer cells.</p>
</abstract>
<kwd-group>
<kwd>PFKFB3</kwd>
<kwd>Oxaliplatin</kwd>
<kwd>autophagy</kwd>
<kwd>colorectal cancer</kwd>
<kwd>proliferation</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="ijms-20-05415-f001" orientation="portrait" position="float">
<label>Figure 1</label>
<caption>
<p>Oxa shows obvious cytotoxicity in SW480 cells. (
<bold>a</bold>
) SW480 cells were treated with Oxa for 24 h; cell viability was analyzed by a MTS assay as described in Materials and Methods. (
<bold>b</bold>
) A colony growth assay was performed with different doses of Oxa. (
<bold>c</bold>
,
<bold>d</bold>
) A wound healing assay was carried out with Oxa, and images were taken at indicated time points (100 magnification). The wound area was analyzed using Photoshop software and the relatively closed area of the wound was shown in the histogram (
<bold>d</bold>
). (
<bold>e</bold>
) Cell lysates were prepared and analyzed by immunoblotting after treating SW480 cells with Oxa for 24 h. (
<bold>f</bold>
) Following treatment of the cells with Oxa for 24 h, the apoptosis was determined by flow cytometry (AV-positive). For histogram results, data were presented as mean ± S.D. and were representatives of three independent experiments (*
<italic>p</italic>
< 0.05 vs. control, and **
<italic>p</italic>
< 0.01 vs. control). Similar experiments were repeated three times.</p>
</caption>
<graphic xlink:href="ijms-20-05415-g001"></graphic>
</fig>
<fig id="ijms-20-05415-f002" orientation="portrait" position="float">
<label>Figure 2</label>
<caption>
<p>Oxa induces autophagy in SW480 cells. (
<bold>a</bold>
) Immunofluorescence using the antibody of LC3 was performed in SW480 cells following treatment with Oxa (25 μM hereafter, or otherwise indicated) in the presence or absence of CQ (20 μM hereafter) for 2 h (1000 magnification). The numbers of the punctate LC3 in each cell were counted, and at least 30 cells were included for each group. (
<bold>b</bold>
<bold>d</bold>
) Cells were treated with indicated dose of Oxa for 2 h in the presence or absence of CQ. Cell lysates were subjected to immunoblotting with the antibodies indicated. (
<bold>e</bold>
) After transfection with GFP-RFP-LC3 plasmids for 24 h and split onto coverslips then cultured overnight, SW480 cells were treated with or without Oxa for 2 h (1000 magnification). The number of the yellow and red dots in each cell was counted, and at least 20 cells were included for each group. Data represent three independent experiments. **
<italic>p</italic>
< 0.01 vs. control.</p>
</caption>
<graphic xlink:href="ijms-20-05415-g002"></graphic>
</fig>
<fig id="ijms-20-05415-f003" orientation="portrait" position="float">
<label>Figure 3</label>
<caption>
<p>Oxa up-regulates the expression of PFKFB3. (
<bold>a</bold>
) Following treatment with Oxa for 6 h, culture media were collected and subjected to lactate assay. (
<bold>b</bold>
) Real-time PCR was performed to detect the mRNA expression of PFKFB3 following treatment with Oxa for 6 h. (
<bold>c</bold>
<bold>f</bold>
) SW480 cells were treated with Oxa (
<bold>e</bold>
: 50 μM) upon to 2 h (
<bold>c</bold>
: 2 h). Cell lysates were subjected to immunoblotting with the indicated antibodies, and the relatively ratios of PFKFB3 and p-Ulk1 to Actin were shown in the histogram graphs. *
<italic>p</italic>
< 0.05 vs. control, and **
<italic>p</italic>
< 0.01 vs. control. Data represent three independent experiments.</p>
</caption>
<graphic xlink:href="ijms-20-05415-g003"></graphic>
</fig>
<fig id="ijms-20-05415-f004" orientation="portrait" position="float">
<label>Figure 4</label>
<caption>
<p>PFKFB3 inhibition lessens Oxa-induced autophagy. (
<bold>a</bold>
,
<bold>b</bold>
) Cell lysates were subjected to immunoblotting following treatment of SW480 cells with Oxa, or together with PFK-15 (6 μM; unless otherwise indicated) in the presence or absence of CQ for 2 h. (
<bold>c</bold>
,
<bold>d</bold>
) SW480 cells were transfected with the PFKFB3 siRNA or control siRNA (mock) for 48 h. Cell lysates were collected and subjected to immunoblotting following treatment with Oxa in the presence or absence of CQ for 2 h. All data were acquired from at least three independent experiments.</p>
</caption>
<graphic xlink:href="ijms-20-05415-g004"></graphic>
</fig>
<fig id="ijms-20-05415-f005" orientation="portrait" position="float">
<label>Figure 5</label>
<caption>
<p>PFKFB3 inhibition enhances the cytotoxicity of Oxa. (
<bold>a</bold>
,
<bold>b</bold>
) Colony growth assay was performed with Oxa (1.5 μM) in the presence or absence of PFK-15. (
<bold>c</bold>
,
<bold>d</bold>
) Cell viability was analyzed by MTS assay following the treatment with Oxa in the presence or absence of PFK-15 for 24 h (
<bold>c</bold>
); cell lysates from cells treated same as (
<bold>c</bold>
) were subjected to immunoblotting with indicated antibodies (
<bold>d</bold>
). (
<bold>e</bold>
<bold>h</bold>
) SW480 cells were transfected with the PFKFB3 siRNA or control siRNA for 48 h. Colony growth assay was performed with Oxa (1.5 μM) (
<bold>e</bold>
), and relative clones number to control was shown in (
<bold>f</bold>
). Cell viability was analyzed by MTS assay following the treatment with Oxa for 24 h (
<bold>g</bold>
). Cell lysates were subjected to immunoblotting with indicated antibodies following treatment with Oxa for 24 h (
<bold>h</bold>
). For histogram graph data, *
<italic>p</italic>
< 0.05 vs. control, and **
<italic>p</italic>
< 0.01 vs. control. Similar experiments were repeated three times.</p>
</caption>
<graphic xlink:href="ijms-20-05415-g005"></graphic>
</fig>
<table-wrap id="ijms-20-05415-t001" orientation="portrait" position="float">
<object-id pub-id-type="pii">ijms-20-05415-t001_Table 1</object-id>
<label>Table 1</label>
<caption>
<p>Primer sequences for Real-time PCR analysis.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Gene</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Forward/Reverse</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Nucleotides</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">PFKFB3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward (5′→3′)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GTGCCTTAGCTGCCTTGAGA</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse (5′→3′)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CCGACTCGATGAAAAACGCC</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">LC3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward (5′→3′)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TAGAAGGCGCTTACAGCTCAAT</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse (5′→3′)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">ACTGACAATTTCATCCCGAACG</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">p62</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward (5′→3′)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">CATCGGAGGATCCGAGTGTG</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">Reverse (5′→3′)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">TTCTTTTCCCTCCGTGCTCC</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">β-Actin</td>
<td align="center" valign="middle" rowspan="1" colspan="1">Forward (5′→3′)</td>
<td align="center" valign="middle" rowspan="1" colspan="1">GCCTGACGGCCAGGTCATCAC</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">Reverse (5′→3′)</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CGGATGTCCACGTCACACTTC</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>États-Unis</li>
</country>
<region>
<li>Illinois</li>
</region>
<settlement>
<li>Chicago</li>
</settlement>
<orgName>
<li>Université de l'Illinois à Chicago</li>
</orgName>
</list>
<tree>
<noCountry>
<name sortKey="Bao, Yonghua" sort="Bao, Yonghua" uniqKey="Bao Y" first="Yonghua" last="Bao">Yonghua Bao</name>
<name sortKey="Yan, Siyuan" sort="Yan, Siyuan" uniqKey="Yan S" first="Siyuan" last="Yan">Siyuan Yan</name>
<name sortKey="Zhang, Deru" sort="Zhang, Deru" uniqKey="Zhang D" first="Deru" last="Zhang">Deru Zhang</name>
<name sortKey="Zhang, Kaile" sort="Zhang, Kaile" uniqKey="Zhang K" first="Kaile" last="Zhang">Kaile Zhang</name>
<name sortKey="Zheng, Wenao" sort="Zheng, Wenao" uniqKey="Zheng W" first="Wenao" last="Zheng">Wenao Zheng</name>
<name sortKey="Zhou, Nan" sort="Zhou, Nan" uniqKey="Zhou N" first="Nan" last="Zhou">Nan Zhou</name>
</noCountry>
<country name="États-Unis">
<region name="Illinois">
<name sortKey="Yang, Wancai" sort="Yang, Wancai" uniqKey="Yang W" first="Wancai" last="Yang">Wancai Yang</name>
</region>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/ChloroquineV1/Data/Ncbi/Merge
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000B59 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd -nk 000B59 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    ChloroquineV1
   |flux=    Ncbi
   |étape=   Merge
   |type=    RBID
   |clé=     PMC:6862230
   |texte=   PFKFB3 Inhibition Attenuates Oxaliplatin-Induced Autophagy and Enhances Its Cytotoxicity in Colon Cancer Cells
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/RBID.i   -Sk "pubmed:31671668" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd   \
       | NlmPubMed2Wicri -a ChloroquineV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Wed Mar 25 22:43:59 2020. Site generation: Sun Jan 31 12:44:45 2021