Serveur d'exploration Chloroquine

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Combination Therapy with a PI3K/mTOR Dual Inhibitor and Chloroquine Enhances Synergistic Apoptotic Cell Death in Epstein–Barr Virus-Infected Gastric Cancer Cells

Identifieur interne : 000616 ( Ncbi/Merge ); précédent : 000615; suivant : 000617

Combination Therapy with a PI3K/mTOR Dual Inhibitor and Chloroquine Enhances Synergistic Apoptotic Cell Death in Epstein–Barr Virus-Infected Gastric Cancer Cells

Auteurs : Mi-Young Kim [Corée du Sud, États-Unis] ; Annie J. Kruger [États-Unis] ; Ju-Yeon Jeong [Corée du Sud] ; Jaehee Kim [Corée du Sud] ; Phil Kyung Shin [Corée du Sud] ; Sun Young Kim [Corée du Sud] ; Joo Young Cho [Corée du Sud] ; Ki Baik Hahm [Corée du Sud] ; Sung Pyo Hong [Corée du Sud]

Source :

RBID : PMC:6602147

Abstract

The phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/AKT/mTOR) signaling pathway is a promising target for gastric cancer (GC) treatment; however the efficacy of PI3K/mTOR dual inhibitors in GC has not yet been maximized. Additionally, the effect of autophagy regulation by PI3K/mTOR dual inhibitors has not been clearly elucidated in GC treatment. We aimed to show that our newly developed PI3K/mTOR dual inhibitor, CMG002, when combined with an autophagy inhibitor, chloroquine (CQ), potently induces effective cancer cell death in Epstein–Barr virus (EBV)-associated gastric cancer (EBVaGC) cells, where both the PI3K/AKT/mTOR and autophagy pathways play important roles in disease pathogenesis. EBV- and mock-infected AGS and NUGC3 GC cell lines were treated with CMG002 +/− CQ. PI3K/AKT/mTOR signaling pathway mediators, cellular apoptosis and autophagy markers were confirmed by Western blot assay. Cell viability was assessed using the Cell Counting Kit-8 (CCK-8) assay. CMG002 effectively blocked the PI3K/AKT/mTOR pathway by markedly decreasing phosphorylation of AKT and its downstream mediator S6. CMG002 induced G0/G1 cell cycle arrest and enhanced apoptotic cell death in AGS and NUGC3 cells, particularly EBV-infected cells compared with mock-infected cells, as confirmed by flow cytometric analyses and TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) assays. The combination of CMG002 plus CQ synergistically increased apoptotic cell death in EBV-infected GC cell lines when compared with CMG002 alone (P < 0.05). Our results suggest that the new PI3K/mTOR dual inhibitor, CMG002, when used in combination with the autophagy inhibitor, CQ, provides enhanced therapeutic efficacy against EBVaGC.


Url:
DOI: 10.14348/molcells.2019.2395
PubMed: 31085812
PubMed Central: 6602147

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:6602147

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Combination Therapy with a PI3K/mTOR Dual Inhibitor and Chloroquine Enhances Synergistic Apoptotic Cell Death in Epstein–Barr Virus-Infected Gastric Cancer Cells</title>
<author>
<name sortKey="Kim, Mi Young" sort="Kim, Mi Young" uniqKey="Kim M" first="Mi-Young" last="Kim">Mi-Young Kim</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-molce-42-448">Digestive Disease Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-molce-42-448">Liver Center and Gastrointestinal Division, Department of Medicine, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114,
<country>USA</country>
</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Kruger, Annie J" sort="Kruger, Annie J" uniqKey="Kruger A" first="Annie J." last="Kruger">Annie J. Kruger</name>
<affiliation wicri:level="1">
<nlm:aff id="af2-molce-42-448">Liver Center and Gastrointestinal Division, Department of Medicine, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114,
<country>USA</country>
</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af3-molce-42-448">Division of Gastroenterology, MedStar Georgetown University Hospital, Washington, DC 20007,
<country>USA</country>
</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Jeong, Ju Yeon" sort="Jeong, Ju Yeon" uniqKey="Jeong J" first="Ju-Yeon" last="Jeong">Ju-Yeon Jeong</name>
<affiliation wicri:level="1">
<nlm:aff id="af4-molce-42-448">Institute for Clinical Research, CHA Bundang Medical Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Kim, Jaehee" sort="Kim, Jaehee" uniqKey="Kim J" first="Jaehee" last="Kim">Jaehee Kim</name>
<affiliation wicri:level="1">
<nlm:aff id="af4-molce-42-448">Institute for Clinical Research, CHA Bundang Medical Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Shin, Phil Kyung" sort="Shin, Phil Kyung" uniqKey="Shin P" first="Phil Kyung" last="Shin">Phil Kyung Shin</name>
<affiliation wicri:level="1">
<nlm:aff id="af4-molce-42-448">Institute for Clinical Research, CHA Bundang Medical Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Kim, Sun Young" sort="Kim, Sun Young" uniqKey="Kim S" first="Sun Young" last="Kim">Sun Young Kim</name>
<affiliation wicri:level="1">
<nlm:aff id="af5-molce-42-448">Department of Hematology and Oncology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul 06351,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Cho, Joo Young" sort="Cho, Joo Young" uniqKey="Cho J" first="Joo Young" last="Cho">Joo Young Cho</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-molce-42-448">Digestive Disease Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Hahm, Ki Baik" sort="Hahm, Ki Baik" uniqKey="Hahm K" first="Ki Baik" last="Hahm">Ki Baik Hahm</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-molce-42-448">Digestive Disease Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Hong, Sung Pyo" sort="Hong, Sung Pyo" uniqKey="Hong S" first="Sung Pyo" last="Hong">Sung Pyo Hong</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-molce-42-448">Digestive Disease Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">31085812</idno>
<idno type="pmc">6602147</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6602147</idno>
<idno type="RBID">PMC:6602147</idno>
<idno type="doi">10.14348/molcells.2019.2395</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">000702</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000702</idno>
<idno type="wicri:Area/Pmc/Curation">000702</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">000702</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000880</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Checkpoint">000880</idno>
<idno type="wicri:Area/Ncbi/Merge">000616</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Combination Therapy with a PI3K/mTOR Dual Inhibitor and Chloroquine Enhances Synergistic Apoptotic Cell Death in Epstein–Barr Virus-Infected Gastric Cancer Cells</title>
<author>
<name sortKey="Kim, Mi Young" sort="Kim, Mi Young" uniqKey="Kim M" first="Mi-Young" last="Kim">Mi-Young Kim</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-molce-42-448">Digestive Disease Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af2-molce-42-448">Liver Center and Gastrointestinal Division, Department of Medicine, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114,
<country>USA</country>
</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Kruger, Annie J" sort="Kruger, Annie J" uniqKey="Kruger A" first="Annie J." last="Kruger">Annie J. Kruger</name>
<affiliation wicri:level="1">
<nlm:aff id="af2-molce-42-448">Liver Center and Gastrointestinal Division, Department of Medicine, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114,
<country>USA</country>
</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1">
<nlm:aff id="af3-molce-42-448">Division of Gastroenterology, MedStar Georgetown University Hospital, Washington, DC 20007,
<country>USA</country>
</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Jeong, Ju Yeon" sort="Jeong, Ju Yeon" uniqKey="Jeong J" first="Ju-Yeon" last="Jeong">Ju-Yeon Jeong</name>
<affiliation wicri:level="1">
<nlm:aff id="af4-molce-42-448">Institute for Clinical Research, CHA Bundang Medical Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Kim, Jaehee" sort="Kim, Jaehee" uniqKey="Kim J" first="Jaehee" last="Kim">Jaehee Kim</name>
<affiliation wicri:level="1">
<nlm:aff id="af4-molce-42-448">Institute for Clinical Research, CHA Bundang Medical Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Shin, Phil Kyung" sort="Shin, Phil Kyung" uniqKey="Shin P" first="Phil Kyung" last="Shin">Phil Kyung Shin</name>
<affiliation wicri:level="1">
<nlm:aff id="af4-molce-42-448">Institute for Clinical Research, CHA Bundang Medical Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Kim, Sun Young" sort="Kim, Sun Young" uniqKey="Kim S" first="Sun Young" last="Kim">Sun Young Kim</name>
<affiliation wicri:level="1">
<nlm:aff id="af5-molce-42-448">Department of Hematology and Oncology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul 06351,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Cho, Joo Young" sort="Cho, Joo Young" uniqKey="Cho J" first="Joo Young" last="Cho">Joo Young Cho</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-molce-42-448">Digestive Disease Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Hahm, Ki Baik" sort="Hahm, Ki Baik" uniqKey="Hahm K" first="Ki Baik" last="Hahm">Ki Baik Hahm</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-molce-42-448">Digestive Disease Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Hong, Sung Pyo" sort="Hong, Sung Pyo" uniqKey="Hong S" first="Sung Pyo" last="Hong">Sung Pyo Hong</name>
<affiliation wicri:level="1">
<nlm:aff id="af1-molce-42-448">Digestive Disease Center, CHA University, Seongnam 13496,
<country>Korea</country>
</nlm:aff>
<country xml:lang="fr">Corée du Sud</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Molecules and Cells</title>
<idno type="ISSN">1016-8478</idno>
<idno type="eISSN">0219-1032</idno>
<imprint>
<date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>The phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/AKT/mTOR) signaling pathway is a promising target for gastric cancer (GC) treatment; however the efficacy of PI3K/mTOR dual inhibitors in GC has not yet been maximized. Additionally, the effect of autophagy regulation by PI3K/mTOR dual inhibitors has not been clearly elucidated in GC treatment. We aimed to show that our newly developed PI3K/mTOR dual inhibitor, CMG002, when combined with an autophagy inhibitor, chloroquine (CQ), potently induces effective cancer cell death in Epstein–Barr virus (EBV)-associated gastric cancer (EBVaGC) cells, where both the PI3K/AKT/mTOR and autophagy pathways play important roles in disease pathogenesis. EBV- and mock-infected AGS and NUGC3 GC cell lines were treated with CMG002 +/− CQ. PI3K/AKT/mTOR signaling pathway mediators, cellular apoptosis and autophagy markers were confirmed by Western blot assay. Cell viability was assessed using the Cell Counting Kit-8 (CCK-8) assay. CMG002 effectively blocked the PI3K/AKT/mTOR pathway by markedly decreasing phosphorylation of AKT and its downstream mediator S6. CMG002 induced G0/G1 cell cycle arrest and enhanced apoptotic cell death in AGS and NUGC3 cells, particularly EBV-infected cells compared with mock-infected cells, as confirmed by flow cytometric analyses and TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) assays. The combination of CMG002 plus CQ synergistically increased apoptotic cell death in EBV-infected GC cell lines when compared with CMG002 alone (
<italic>P</italic>
< 0.05). Our results suggest that the new PI3K/mTOR dual inhibitor, CMG002, when used in combination with the autophagy inhibitor, CQ, provides enhanced therapeutic efficacy against EBVaGC.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Akiyama, S" uniqKey="Akiyama S">S. Akiyama</name>
</author>
<author>
<name sortKey="Amo, H" uniqKey="Amo H">H. Amo</name>
</author>
<author>
<name sortKey="Watanabe, T" uniqKey="Watanabe T">T. Watanabe</name>
</author>
<author>
<name sortKey="Matsuyama, M" uniqKey="Matsuyama M">M. Matsuyama</name>
</author>
<author>
<name sortKey="Sakamoto, J" uniqKey="Sakamoto J">J. Sakamoto</name>
</author>
<author>
<name sortKey="Imaizumi, M" uniqKey="Imaizumi M">M. Imaizumi</name>
</author>
<author>
<name sortKey="Ichihashi, H" uniqKey="Ichihashi H">H. Ichihashi</name>
</author>
<author>
<name sortKey="Kondo, T" uniqKey="Kondo T">T. Kondo</name>
</author>
<author>
<name sortKey="Takagi, H" uniqKey="Takagi H">H. Takagi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bhattacharya, B" uniqKey="Bhattacharya B">B. Bhattacharya</name>
</author>
<author>
<name sortKey="Akram, M" uniqKey="Akram M">M. Akram</name>
</author>
<author>
<name sortKey="Balasubramanian, I" uniqKey="Balasubramanian I">I. Balasubramanian</name>
</author>
<author>
<name sortKey="Tam, K K" uniqKey="Tam K">K.K. Tam</name>
</author>
<author>
<name sortKey="Koh, K X" uniqKey="Koh K">K.X. Koh</name>
</author>
<author>
<name sortKey="Yee, M Q" uniqKey="Yee M">M.Q. Yee</name>
</author>
<author>
<name sortKey="Soong, R" uniqKey="Soong R">R. Soong</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chang, Z" uniqKey="Chang Z">Z. Chang</name>
</author>
<author>
<name sortKey="Shi, G" uniqKey="Shi G">G. Shi</name>
</author>
<author>
<name sortKey="Jin, J" uniqKey="Jin J">J. Jin</name>
</author>
<author>
<name sortKey="Guo, H" uniqKey="Guo H">H. Guo</name>
</author>
<author>
<name sortKey="Guo, X" uniqKey="Guo X">X. Guo</name>
</author>
<author>
<name sortKey="Luo, F" uniqKey="Luo F">F. Luo</name>
</author>
<author>
<name sortKey="Song, Y" uniqKey="Song Y">Y. Song</name>
</author>
<author>
<name sortKey="Jia, X" uniqKey="Jia X">X. Jia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, Y R" uniqKey="Chen Y">Y.R. Chen</name>
</author>
<author>
<name sortKey="Liu, M T" uniqKey="Liu M">M.T. Liu</name>
</author>
<author>
<name sortKey="Chang, Y T" uniqKey="Chang Y">Y.T. Chang</name>
</author>
<author>
<name sortKey="Wu, C C" uniqKey="Wu C">C.C. Wu</name>
</author>
<author>
<name sortKey="Hu, C Y" uniqKey="Hu C">C.Y. Hu</name>
</author>
<author>
<name sortKey="Chen, J Y" uniqKey="Chen J">J.Y. Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Choi, P R" uniqKey="Choi P">P.R. Choi</name>
</author>
<author>
<name sortKey="Kang, Y J" uniqKey="Kang Y">Y.J. Kang</name>
</author>
<author>
<name sortKey="Sung, B" uniqKey="Sung B">B. Sung</name>
</author>
<author>
<name sortKey="Kim, J H" uniqKey="Kim J">J.H. Kim</name>
</author>
<author>
<name sortKey="Moon, H R" uniqKey="Moon H">H.R. Moon</name>
</author>
<author>
<name sortKey="Chung, H Y" uniqKey="Chung H">H.Y. Chung</name>
</author>
<author>
<name sortKey="Kim, S E" uniqKey="Kim S">S.E. Kim</name>
</author>
<author>
<name sortKey="Park, M I" uniqKey="Park M">M.I. Park</name>
</author>
<author>
<name sortKey="Park, S J" uniqKey="Park S">S.J. Park</name>
</author>
<author>
<name sortKey="Kim, N D" uniqKey="Kim N">N.D. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dawson, C W" uniqKey="Dawson C">C.W. Dawson</name>
</author>
<author>
<name sortKey="Tramountanis, G" uniqKey="Tramountanis G">G. Tramountanis</name>
</author>
<author>
<name sortKey="Eliopoulos, A G" uniqKey="Eliopoulos A">A.G. Eliopoulos</name>
</author>
<author>
<name sortKey="Young, L S" uniqKey="Young L">L.S. Young</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eisenberg Lerner, A" uniqKey="Eisenberg Lerner A">A. Eisenberg-Lerner</name>
</author>
<author>
<name sortKey="Bialik, S" uniqKey="Bialik S">S. Bialik</name>
</author>
<author>
<name sortKey="Simon, H U" uniqKey="Simon H">H.U. Simon</name>
</author>
<author>
<name sortKey="Kimchi, A" uniqKey="Kimchi A">A. Kimchi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fang, W L" uniqKey="Fang W">W.L. Fang</name>
</author>
<author>
<name sortKey="Huang, K H" uniqKey="Huang K">K.H. Huang</name>
</author>
<author>
<name sortKey="Lan, Y T" uniqKey="Lan Y">Y.T. Lan</name>
</author>
<author>
<name sortKey="Lin, C H" uniqKey="Lin C">C.H. Lin</name>
</author>
<author>
<name sortKey="Chang, S C" uniqKey="Chang S">S.C. Chang</name>
</author>
<author>
<name sortKey="Chen, M H" uniqKey="Chen M">M.H. Chen</name>
</author>
<author>
<name sortKey="Chao, Y" uniqKey="Chao Y">Y. Chao</name>
</author>
<author>
<name sortKey="Lin, W C" uniqKey="Lin W">W.C. Lin</name>
</author>
<author>
<name sortKey="Lo, S S" uniqKey="Lo S">S.S. Lo</name>
</author>
<author>
<name sortKey="Li, A F" uniqKey="Li A">A.F. Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fei, H R" uniqKey="Fei H">H.R. Fei</name>
</author>
<author>
<name sortKey="Tian, H" uniqKey="Tian H">H. Tian</name>
</author>
<author>
<name sortKey="Zhou, X L" uniqKey="Zhou X">X.L. Zhou</name>
</author>
<author>
<name sortKey="Yang, M F" uniqKey="Yang M">M.F. Yang</name>
</author>
<author>
<name sortKey="Sun, B L" uniqKey="Sun B">B.L. Sun</name>
</author>
<author>
<name sortKey="Yang, X Y" uniqKey="Yang X">X.Y. Yang</name>
</author>
<author>
<name sortKey="Jiao, P" uniqKey="Jiao P">P. Jiao</name>
</author>
<author>
<name sortKey="Wang, F Z" uniqKey="Wang F">F.Z. Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fukagawa, Y" uniqKey="Fukagawa Y">Y. Fukagawa</name>
</author>
<author>
<name sortKey="Nishikawa, J" uniqKey="Nishikawa J">J. Nishikawa</name>
</author>
<author>
<name sortKey="Kuramitsu, Y" uniqKey="Kuramitsu Y">Y. Kuramitsu</name>
</author>
<author>
<name sortKey="Iwakiri, D" uniqKey="Iwakiri D">D. Iwakiri</name>
</author>
<author>
<name sortKey="Takada, K" uniqKey="Takada K">K. Takada</name>
</author>
<author>
<name sortKey="Imai, S" uniqKey="Imai S">S. Imai</name>
</author>
<author>
<name sortKey="Satake, M" uniqKey="Satake M">M. Satake</name>
</author>
<author>
<name sortKey="Okamoto, T" uniqKey="Okamoto T">T. Okamoto</name>
</author>
<author>
<name sortKey="Fujimoto, M" uniqKey="Fujimoto M">M. Fujimoto</name>
</author>
<author>
<name sortKey="Okita, K" uniqKey="Okita K">K. Okita</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ghadimi, M P" uniqKey="Ghadimi M">M.P. Ghadimi</name>
</author>
<author>
<name sortKey="Lopez, G" uniqKey="Lopez G">G. Lopez</name>
</author>
<author>
<name sortKey="Torres, K E" uniqKey="Torres K">K.E. Torres</name>
</author>
<author>
<name sortKey="Belousov, R" uniqKey="Belousov R">R. Belousov</name>
</author>
<author>
<name sortKey="Young, E D" uniqKey="Young E">E.D. Young</name>
</author>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J. Liu</name>
</author>
<author>
<name sortKey="Brewer, K J" uniqKey="Brewer K">K.J. Brewer</name>
</author>
<author>
<name sortKey="Hoffman, A" uniqKey="Hoffman A">A. Hoffman</name>
</author>
<author>
<name sortKey="Lusby, K" uniqKey="Lusby K">K. Lusby</name>
</author>
<author>
<name sortKey="Lazar, A J" uniqKey="Lazar A">A.J. Lazar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hart, S" uniqKey="Hart S">S. Hart</name>
</author>
<author>
<name sortKey="Novotny Diermayr, V" uniqKey="Novotny Diermayr V">V. Novotny-Diermayr</name>
</author>
<author>
<name sortKey="Goh, K C" uniqKey="Goh K">K.C. Goh</name>
</author>
<author>
<name sortKey="Williams, M" uniqKey="Williams M">M. Williams</name>
</author>
<author>
<name sortKey="Tan, Y C" uniqKey="Tan Y">Y.C. Tan</name>
</author>
<author>
<name sortKey="Ong, L C" uniqKey="Ong L">L.C. Ong</name>
</author>
<author>
<name sortKey="Cheong, A" uniqKey="Cheong A">A. Cheong</name>
</author>
<author>
<name sortKey="Ng, B K" uniqKey="Ng B">B.K. Ng</name>
</author>
<author>
<name sortKey="Amalini, C" uniqKey="Amalini C">C. Amalini</name>
</author>
<author>
<name sortKey="Madan, B" uniqKey="Madan B">B. Madan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hino, R" uniqKey="Hino R">R. Hino</name>
</author>
<author>
<name sortKey="Uozaki, H" uniqKey="Uozaki H">H. Uozaki</name>
</author>
<author>
<name sortKey="Murakami, N" uniqKey="Murakami N">N. Murakami</name>
</author>
<author>
<name sortKey="Ushiku, T" uniqKey="Ushiku T">T. Ushiku</name>
</author>
<author>
<name sortKey="Shinozaki, A" uniqKey="Shinozaki A">A. Shinozaki</name>
</author>
<author>
<name sortKey="Ishikawa, S" uniqKey="Ishikawa S">S. Ishikawa</name>
</author>
<author>
<name sortKey="Morikawa, T" uniqKey="Morikawa T">T. Morikawa</name>
</author>
<author>
<name sortKey="Nakaya, T" uniqKey="Nakaya T">T. Nakaya</name>
</author>
<author>
<name sortKey="Sakatani, T" uniqKey="Sakatani T">T. Sakatani</name>
</author>
<author>
<name sortKey="Takada, K" uniqKey="Takada K">K. Takada</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Imai, S" uniqKey="Imai S">S. Imai</name>
</author>
<author>
<name sortKey="Nishikawa, J" uniqKey="Nishikawa J">J. Nishikawa</name>
</author>
<author>
<name sortKey="Takada, K" uniqKey="Takada K">K. Takada</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ji, Y" uniqKey="Ji Y">Y. Ji</name>
</author>
<author>
<name sortKey="Di, W" uniqKey="Di W">W. Di</name>
</author>
<author>
<name sortKey="Yang, Q" uniqKey="Yang Q">Q. Yang</name>
</author>
<author>
<name sortKey="Lu, Z" uniqKey="Lu Z">Z. Lu</name>
</author>
<author>
<name sortKey="Cai, W" uniqKey="Cai W">W. Cai</name>
</author>
<author>
<name sortKey="Wu, J" uniqKey="Wu J">J. Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Klionsky, D J" uniqKey="Klionsky D">D.J. Klionsky</name>
</author>
<author>
<name sortKey="Abdelmohsen, K" uniqKey="Abdelmohsen K">K. Abdelmohsen</name>
</author>
<author>
<name sortKey="Abe, A" uniqKey="Abe A">A. Abe</name>
</author>
<author>
<name sortKey="Abedin, M J" uniqKey="Abedin M">M.J. Abedin</name>
</author>
<author>
<name sortKey="Abeliovich, H" uniqKey="Abeliovich H">H. Abeliovich</name>
</author>
<author>
<name sortKey="Acevedo Arozena, A" uniqKey="Acevedo Arozena A">A. Acevedo Arozena</name>
</author>
<author>
<name sortKey="Adachi, H" uniqKey="Adachi H">H. Adachi</name>
</author>
<author>
<name sortKey="Adams, C M" uniqKey="Adams C">C.M. Adams</name>
</author>
<author>
<name sortKey="Adams, P D" uniqKey="Adams P">P.D. Adams</name>
</author>
<author>
<name sortKey="Adeli, K" uniqKey="Adeli K">K. Adeli</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Levine, B" uniqKey="Levine B">B. Levine</name>
</author>
<author>
<name sortKey="Kroemer, G" uniqKey="Kroemer G">G. Kroemer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, P" uniqKey="Liu P">P. Liu</name>
</author>
<author>
<name sortKey="Begley, M" uniqKey="Begley M">M. Begley</name>
</author>
<author>
<name sortKey="Michowski, W" uniqKey="Michowski W">W. Michowski</name>
</author>
<author>
<name sortKey="Inuzuka, H" uniqKey="Inuzuka H">H. Inuzuka</name>
</author>
<author>
<name sortKey="Ginzberg, M" uniqKey="Ginzberg M">M. Ginzberg</name>
</author>
<author>
<name sortKey="Gao, D" uniqKey="Gao D">D. Gao</name>
</author>
<author>
<name sortKey="Tsou, P" uniqKey="Tsou P">P. Tsou</name>
</author>
<author>
<name sortKey="Gan, W" uniqKey="Gan W">W. Gan</name>
</author>
<author>
<name sortKey="Papa, A" uniqKey="Papa A">A. Papa</name>
</author>
<author>
<name sortKey="Kim, B M" uniqKey="Kim B">B.M. Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mirzoeva, O K" uniqKey="Mirzoeva O">O.K. Mirzoeva</name>
</author>
<author>
<name sortKey="Hann, B" uniqKey="Hann B">B. Hann</name>
</author>
<author>
<name sortKey="Hom, Y K" uniqKey="Hom Y">Y.K. Hom</name>
</author>
<author>
<name sortKey="Debnath, J" uniqKey="Debnath J">J. Debnath</name>
</author>
<author>
<name sortKey="Aftab, D" uniqKey="Aftab D">D. Aftab</name>
</author>
<author>
<name sortKey="Shokat, K" uniqKey="Shokat K">K. Shokat</name>
</author>
<author>
<name sortKey="Korn, W M" uniqKey="Korn W">W.M. Korn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ning, C" uniqKey="Ning C">C. Ning</name>
</author>
<author>
<name sortKey="Liang, M" uniqKey="Liang M">M. Liang</name>
</author>
<author>
<name sortKey="Liu, S" uniqKey="Liu S">S. Liu</name>
</author>
<author>
<name sortKey="Wang, G" uniqKey="Wang G">G. Wang</name>
</author>
<author>
<name sortKey="Edwards, H" uniqKey="Edwards H">H. Edwards</name>
</author>
<author>
<name sortKey="Xia, Y" uniqKey="Xia Y">Y. Xia</name>
</author>
<author>
<name sortKey="Polin, L" uniqKey="Polin L">L. Polin</name>
</author>
<author>
<name sortKey="Dyson, G" uniqKey="Dyson G">G. Dyson</name>
</author>
<author>
<name sortKey="Taub, J W" uniqKey="Taub J">J.W. Taub</name>
</author>
<author>
<name sortKey="Mohammad, R M" uniqKey="Mohammad R">R.M. Mohammad</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Samuels, Y" uniqKey="Samuels Y">Y. Samuels</name>
</author>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z. Wang</name>
</author>
<author>
<name sortKey="Bardelli, A" uniqKey="Bardelli A">A. Bardelli</name>
</author>
<author>
<name sortKey="Silliman, N" uniqKey="Silliman N">N. Silliman</name>
</author>
<author>
<name sortKey="Ptak, J" uniqKey="Ptak J">J. Ptak</name>
</author>
<author>
<name sortKey="Szabo, S" uniqKey="Szabo S">S. Szabo</name>
</author>
<author>
<name sortKey="Yan, H" uniqKey="Yan H">H. Yan</name>
</author>
<author>
<name sortKey="Gazdar, A" uniqKey="Gazdar A">A. Gazdar</name>
</author>
<author>
<name sortKey="Powell, S M" uniqKey="Powell S">S.M. Powell</name>
</author>
<author>
<name sortKey="Riggins, G J" uniqKey="Riggins G">G.J. Riggins</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shair, K H" uniqKey="Shair K">K.H. Shair</name>
</author>
<author>
<name sortKey="Schnegg, C I" uniqKey="Schnegg C">C.I. Schnegg</name>
</author>
<author>
<name sortKey="Raab Traub, N" uniqKey="Raab Traub N">N. Raab-Traub</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shibata, D" uniqKey="Shibata D">D. Shibata</name>
</author>
<author>
<name sortKey="Weiss, L M" uniqKey="Weiss L">L.M. Weiss</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shimizu, S" uniqKey="Shimizu S">S. Shimizu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shin, J Y" uniqKey="Shin J">J.Y. Shin</name>
</author>
<author>
<name sortKey="Kim, J O" uniqKey="Kim J">J.O. Kim</name>
</author>
<author>
<name sortKey="Lee, S K" uniqKey="Lee S">S.K. Lee</name>
</author>
<author>
<name sortKey="Chae, H S" uniqKey="Chae H">H.S. Chae</name>
</author>
<author>
<name sortKey="Kang, J H" uniqKey="Kang J">J.H. Kang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Soares, H P" uniqKey="Soares H">H.P. Soares</name>
</author>
<author>
<name sortKey="Ming, M" uniqKey="Ming M">M. Ming</name>
</author>
<author>
<name sortKey="Mellon, M" uniqKey="Mellon M">M. Mellon</name>
</author>
<author>
<name sortKey="Young, S H" uniqKey="Young S">S.H. Young</name>
</author>
<author>
<name sortKey="Han, L" uniqKey="Han L">L. Han</name>
</author>
<author>
<name sortKey="Sinnet Smith, J" uniqKey="Sinnet Smith J">J. Sinnet-Smith</name>
</author>
<author>
<name sortKey="Rozengurt, E" uniqKey="Rozengurt E">E. Rozengurt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, C H" uniqKey="Zhang C">C.H. Zhang</name>
</author>
<author>
<name sortKey="Awasthi, N" uniqKey="Awasthi N">N. Awasthi</name>
</author>
<author>
<name sortKey="Schwarz, M A" uniqKey="Schwarz M">M.A. Schwarz</name>
</author>
<author>
<name sortKey="Schwarz, R E" uniqKey="Schwarz R">R.E. Schwarz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhu, Y" uniqKey="Zhu Y">Y. Zhu</name>
</author>
<author>
<name sortKey="Tian, T" uniqKey="Tian T">T. Tian</name>
</author>
<author>
<name sortKey="Zou, J" uniqKey="Zou J">J. Zou</name>
</author>
<author>
<name sortKey="Wang, Q" uniqKey="Wang Q">Q. Wang</name>
</author>
<author>
<name sortKey="Li, Z" uniqKey="Li Z">Z. Li</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y. Li</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X. Liu</name>
</author>
<author>
<name sortKey="Dong, B" uniqKey="Dong B">B. Dong</name>
</author>
<author>
<name sortKey="Li, N" uniqKey="Li N">N. Li</name>
</author>
<author>
<name sortKey="Gao, J" uniqKey="Gao J">J. Gao</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Mol Cells</journal-id>
<journal-id journal-id-type="iso-abbrev">Mol. Cells</journal-id>
<journal-id journal-id-type="publisher-id">ksmcb</journal-id>
<journal-title-group>
<journal-title>Molecules and Cells</journal-title>
</journal-title-group>
<issn pub-type="ppub">1016-8478</issn>
<issn pub-type="epub">0219-1032</issn>
<publisher>
<publisher-name>Korean Society for Molecular and Cellular Biology</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">31085812</article-id>
<article-id pub-id-type="pmc">6602147</article-id>
<article-id pub-id-type="doi">10.14348/molcells.2019.2395</article-id>
<article-id pub-id-type="publisher-id">molce-42-448</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Articles</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Combination Therapy with a PI3K/mTOR Dual Inhibitor and Chloroquine Enhances Synergistic Apoptotic Cell Death in Epstein–Barr Virus-Infected Gastric Cancer Cells</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Kim</surname>
<given-names>Mi-Young</given-names>
</name>
<xref ref-type="aff" rid="af1-molce-42-448">1</xref>
<xref ref-type="aff" rid="af2-molce-42-448">2</xref>
<xref rid="c1-molce-42-448" ref-type="corresp">*</xref>
<contrib-id contrib-id-type="orcid">https://orcid.org/0000-0003-2395-5822</contrib-id>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kruger</surname>
<given-names>Annie J.</given-names>
</name>
<xref ref-type="aff" rid="af2-molce-42-448">2</xref>
<xref ref-type="aff" rid="af3-molce-42-448">3</xref>
<contrib-id contrib-id-type="orcid">https://orcid.org/0000-0001-8227-5996</contrib-id>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jeong</surname>
<given-names>Ju-Yeon</given-names>
</name>
<xref ref-type="aff" rid="af4-molce-42-448">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kim</surname>
<given-names>Jaehee</given-names>
</name>
<xref ref-type="aff" rid="af4-molce-42-448">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Shin</surname>
<given-names>Phil kyung</given-names>
</name>
<xref ref-type="aff" rid="af4-molce-42-448">4</xref>
<contrib-id contrib-id-type="orcid">https://orcid.org/0000-0002-3935-3132</contrib-id>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kim</surname>
<given-names>Sun Young</given-names>
</name>
<xref ref-type="aff" rid="af5-molce-42-448">5</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Cho</surname>
<given-names>Joo Young</given-names>
</name>
<xref ref-type="aff" rid="af1-molce-42-448">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hahm</surname>
<given-names>Ki Baik</given-names>
</name>
<xref ref-type="aff" rid="af1-molce-42-448">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hong</surname>
<given-names>Sung Pyo</given-names>
</name>
<xref ref-type="aff" rid="af1-molce-42-448">1</xref>
</contrib>
</contrib-group>
<aff id="af1-molce-42-448">
<label>1</label>
Digestive Disease Center, CHA University, Seongnam 13496,
<country>Korea</country>
</aff>
<aff id="af4-molce-42-448">
<label>4</label>
Institute for Clinical Research, CHA Bundang Medical Center, CHA University, Seongnam 13496,
<country>Korea</country>
</aff>
<aff id="af2-molce-42-448">
<label>2</label>
Liver Center and Gastrointestinal Division, Department of Medicine, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114,
<country>USA</country>
</aff>
<aff id="af3-molce-42-448">
<label>3</label>
Division of Gastroenterology, MedStar Georgetown University Hospital, Washington, DC 20007,
<country>USA</country>
</aff>
<aff id="af5-molce-42-448">
<label>5</label>
Department of Hematology and Oncology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul 06351,
<country>Korea</country>
</aff>
<author-notes>
<corresp id="c1-molce-42-448">
<label>*</label>
Correspondence:
<email>mykim@cha.ac.kr</email>
</corresp>
</author-notes>
<pub-date pub-type="ppub">
<month>6</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="epub">
<day>03</day>
<month>5</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="pmc-release">
<day>03</day>
<month>5</month>
<year>2019</year>
</pub-date>
<pmc-comment> PMC Release delay is 0 months and 0 days and was based on the . </pmc-comment>
<volume>42</volume>
<issue>6</issue>
<fpage>448</fpage>
<lpage>459</lpage>
<history>
<date date-type="received">
<day>22</day>
<month>9</month>
<year>2018</year>
</date>
<date date-type="rev-recd">
<day>26</day>
<month>3</month>
<year>2019</year>
</date>
<date date-type="accepted">
<day>27</day>
<month>3</month>
<year>2019</year>
</date>
</history>
<permissions>
<copyright-statement>© The Korean Society for Molecular and Cellular Biology. All rights reserved.</copyright-statement>
<copyright-year>2019</copyright-year>
<license>
<license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License. To view a copy of this license, visit
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by-nc-sa/3.0/">http://creativecommons.org/licenses/by-nc-sa/3.0/</ext-link>
.</license-p>
</license>
</permissions>
<abstract>
<p>The phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/AKT/mTOR) signaling pathway is a promising target for gastric cancer (GC) treatment; however the efficacy of PI3K/mTOR dual inhibitors in GC has not yet been maximized. Additionally, the effect of autophagy regulation by PI3K/mTOR dual inhibitors has not been clearly elucidated in GC treatment. We aimed to show that our newly developed PI3K/mTOR dual inhibitor, CMG002, when combined with an autophagy inhibitor, chloroquine (CQ), potently induces effective cancer cell death in Epstein–Barr virus (EBV)-associated gastric cancer (EBVaGC) cells, where both the PI3K/AKT/mTOR and autophagy pathways play important roles in disease pathogenesis. EBV- and mock-infected AGS and NUGC3 GC cell lines were treated with CMG002 +/− CQ. PI3K/AKT/mTOR signaling pathway mediators, cellular apoptosis and autophagy markers were confirmed by Western blot assay. Cell viability was assessed using the Cell Counting Kit-8 (CCK-8) assay. CMG002 effectively blocked the PI3K/AKT/mTOR pathway by markedly decreasing phosphorylation of AKT and its downstream mediator S6. CMG002 induced G0/G1 cell cycle arrest and enhanced apoptotic cell death in AGS and NUGC3 cells, particularly EBV-infected cells compared with mock-infected cells, as confirmed by flow cytometric analyses and TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) assays. The combination of CMG002 plus CQ synergistically increased apoptotic cell death in EBV-infected GC cell lines when compared with CMG002 alone (
<italic>P</italic>
< 0.05). Our results suggest that the new PI3K/mTOR dual inhibitor, CMG002, when used in combination with the autophagy inhibitor, CQ, provides enhanced therapeutic efficacy against EBVaGC.</p>
</abstract>
<kwd-group>
<kwd>apoptosis</kwd>
<kwd>autophagy</kwd>
<kwd>chloroquine</kwd>
<kwd>gastric cancer</kwd>
<kwd>PI3K/mTOR dual inhibitor</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<fig id="f1-molce-42-448" orientation="portrait" position="float">
<label>Fig. 1</label>
<caption>
<p>Chemical structure of CMG002, Isopropyl 4-(6-(6-chloro-5-(2,4-difluorophenylsulfonamido)pyridine-3-yl)pyrido[3,2-
<italic>d</italic>
]pyrimidin-4-ylamino)piperidine-1-carboxylate.</p>
</caption>
<graphic xlink:href="molce-42-448f1"></graphic>
</fig>
<fig id="f2-molce-42-448" orientation="portrait" position="float">
<label>Fig. 2</label>
<caption>
<title>Confirmation of Epstein–Barr virus (EBV) infection and its effect on phosphorylation of AKT in EBV-infected gastric cancer cell lines</title>
<p>(A)
<italic>Epstein-Barr nuclear antigen 1</italic>
(
<italic>EBNA1</italic>
) mRNA was detected by RT-PCR (upper 2 panels). EBNA1, p-AKT and AKT protein was detected by Western blot, respectively. Western blot data represent experiments that were performed in triplicate with EBV- and mock-infected AGS and NUGC3 cells. (B) Western blot image quantification of p-AKT to AKT ratio in EBV- and mock-infected AGS and NUGC3 cells. The data are expressed as the mean ± SEM of assays run in triplicate. *
<italic>P</italic>
< 0.001.</p>
</caption>
<graphic xlink:href="molce-42-448f2"></graphic>
</fig>
<fig id="f3-molce-42-448" orientation="portrait" position="float">
<label>Fig. 3</label>
<caption>
<title>Effect of CMG002 on cell viability and downstream mediators of the PI3K/AKT/mTOR pathway in EBV- and mock-infected AGS and NUGC3 cells</title>
<p>(A) Cell viability following CMG002 treatment assessed using a 10-dimensional drug response assay. Cells were seeded at 5 × 10
<sup>3</sup>
per well in 96-well culture plates, and incubated for 48 hours with CMG002, following which cell viability was performed in triplicate. Results are expressed as the mean ± SEM. (B) Western blot analysis of the PI3K/AKT/mTOR pathway proteins from AGS and NUGC3 cells 1 hour post-treatment with 50 nM and 100 nM of CMG002, respectively. Western blot data represent experiments performed in triplicate.</p>
</caption>
<graphic xlink:href="molce-42-448f3"></graphic>
</fig>
<fig id="f4-molce-42-448" orientation="portrait" position="float">
<label>Fig. 4</label>
<caption>
<title>CMG002 exerts its anti-proliferative effect on gastric cancer cell lines by inducing cell cycle arrest in the G0/G1 phase</title>
<p>(A) Representative images of AGS (left two panels) and NUGC3 (right two panels) cells treated for 48 hours with CMG002 (40× magnification). (B) CCK-8 assay-based cell viability analysis of EBV- and mock- infected AGS (left panel) and NUGC3 (right panel) cells treated for 48 hours with CMG002 compared with control cells. (C) Flow cytometry-based cell cycle analysis of CMG002 in EBV- and mock-infected AGS cells. Cells were incubated for 48 hours with CMG002 at each concentration prior to cell cycle analysis. (D) Numeric representation of changes in fraction of AGS cells in each cell cycle phase following treatment with CMG002. (E) Flow cytometry-based cell cycle analysis of CMG002 in EBV- and mock-infected NUGC3 cells. Cells were incubated for 48 hours with CMG002 at each concentration prior to cell cycle analysis. (F) Numeric representation of changes in the fraction of EBV- and mock-infected NUGC3 cells in each cell cycle phase following treatment with CMG002. Cell cycle analyses in Figures 4C and 4E were performed in triplicate and data in Figures 4D and 4F are expressed as the mean ± SEM. *
<italic>P</italic>
< 0.05; **
<italic>P</italic>
< 0.001.</p>
</caption>
<graphic xlink:href="molce-42-448f4"></graphic>
</fig>
<fig id="f5-molce-42-448" orientation="portrait" position="float">
<label>Fig. 5</label>
<caption>
<title>Autophagy regulation by CMG002 and CQ</title>
<p>(A) Western blot analysis of LC3B 48 hours following increasing doses of CMG002 in EBV- and mock-infected AGS and NUGC3 cells. Western blot data represent experiments performed in triplicate. (B) Quantification of the LC3B-II to LC3B-I ratio in CMG002 treated cells compared with control cells in EBV- and mock-infected AGS (left panel) and NUGC3 (right panel) cells. Data represent experiments performed in triplicate and are expressed as the mean ± SEM. (C) CCK-8 assay-based cell viability following CQ treatment in EBV- and mock-infected AGS (left panel) and NUGC3 (right panel) cells. Cells were seeded at 5 × 10
<sup>3</sup>
per well in 96-well culture plates, and incubated for 48 hours with CQ treatment following which cell viability was performed in triplicate. Results expressed represent the mean ± SEM. (D) Western blot analysis of LC3B 24 hours post-treatment with 10 μM of CQ on EBV- and mock-infected AGS (left two panels) and NUGC3 (right two panels) cell lines. Western blot data represent experiments that were performed in triplicate. *
<italic>P</italic>
< 0.05.</p>
</caption>
<graphic xlink:href="molce-42-448f5"></graphic>
</fig>
<fig id="f6-molce-42-448" orientation="portrait" position="float">
<label>Fig. 6</label>
<caption>
<title>Synergistic apoptotic cell death after SCT with CQ and CMG002 in AGS cell line</title>
<p>(A) Representative images of EBV- and mock-infected AGS cells 48 hours post-sequential combination therapy (SCT; cells were incubated with 10 μM CQ for 1 hour followed by concomitant 10 μM CQ and 100 nM of CMG002 for the remainder of the 48-hour period) (40× magnification). (B) Flow cytometry-based TUNEL assay demonstrating gating of apoptotic cells 48 hours following monotherapy and SCT. The percentage of apoptotic cells represents the mean of more than three independent experiments. (C) Apoptotic index (%) in EBV- and mock-infected AGS cells after 48 hours of treatment with CQ and CMG002 monotherapy and SCT. Results expressed represent the mean ± SEM from experiments performed in triplicate. (D) Western blot analysis of the apoptotic marker proteins, caspase-3 and PARP-1, and the autophagy marker LC3B. Western blot data represent experiments performed in triplicate. *
<italic>P</italic>
< 0.05.</p>
</caption>
<graphic xlink:href="molce-42-448f6"></graphic>
</fig>
<fig id="f7-molce-42-448" orientation="portrait" position="float">
<label>Fig. 7</label>
<caption>
<title>Synergistic apoptotic cell death induced by SCT with CQ and CMG002 in NUGC3 cell line</title>
<p>(A) Representative images of EBV- and mock-infected NUGC3 cells 48 hours post-SCT with CQ and CMG002 (40× magnification). (B) Flow cytometry-based TUNEL assay demonstrating gating of apoptotic cells 48 hours following monotherapy and SCT. The percentages of apoptotic cells represent the mean of more than three independent experiments. (C) Apoptotic index (%) in EBV- and mock-infected NUGC3 cells after 48 hours of treatment with monotherapy and SCT. Results expressed represent the mean ± SEM from the experiments conducted in triplicate. (D) Western blot analysis of the apoptotic marker proteins, caspase-3 and PARP-1, and the autophagy marker LC3B. Western blot data represent experiments performed in triplicate. *
<italic>P</italic>
< 0.05.</p>
</caption>
<graphic xlink:href="molce-42-448f7"></graphic>
</fig>
<fig id="f8-molce-42-448" orientation="portrait" position="float">
<label>Fig. 8</label>
<caption>
<title>Synergistic apoptotic cell death induced by SCT using bafilomycin A1 and CMG002 in AGS cell line</title>
<p>(A) Representative images of EBV- and mock-infected AGS cells 48 hours post-SCT with 2.5 nM of bafilomycin A1 for 1 hour followed by concomitant 2.5 nM bafilomycin and 100 nM of CMG002 for the remainder of the 48-hour period (40× magnification). (B) Flow cytometry-based TUNEL assay demonstrating gating of apoptotic cells 48 hours following monotherapy and SCT with bafilomycin A1 and CMG002. The percentage of apoptotic cells represents the mean of three or more independent experiments. (C) Apoptotic index (%) in EBV- and mock-infected AGS cells following 48 hours of treatment with monotherapy and SCT with bafilomycin A1 and CMG002. Results represent the mean ± SEM of experiments conducted in triplicate. *
<italic>P</italic>
< 0.05.</p>
</caption>
<graphic xlink:href="molce-42-448f8"></graphic>
</fig>
<fig id="f9-molce-42-448" orientation="portrait" position="float">
<label>Fig. 9</label>
<caption>
<title>Synergistic apoptotic cell death induced by SCT with bafilomycin A1 and CMG002 in NUGC3 cell line</title>
<p>(A) Representative images of EBV- and mock-infected NUGC3 cells 48 hours post-SCT with bafilomycin A1 and CMG002 (40× magnification). (B) Flow cytometry-based TUNEL assay demonstrating gating of apoptotic cells 48 hours following monotherapy and SCT with bafilomycin A1 and CMG002. The percentage of apoptotic cells represents the mean of more than three independent experiments. (C) Apoptotic index (%) in EBV- and mock-infected NUGC3 cells after 48 hours of treatment with monotherapy and SCT with bafilomycin A1 and CMG002. Results expressed represent the mean ± SEM from the experiments conducted in triplicate. *
<italic>P</italic>
< 0.05.</p>
</caption>
<graphic xlink:href="molce-42-448f9"></graphic>
</fig>
<fig id="f10-molce-42-448" orientation="portrait" position="float">
<label>Fig. 10</label>
<caption>
<p>Proposed schematic mechanism of EBV-associated gastric carcinogenesis via the activation of the PI3K/AKT/mTOR pathway, and its blockade by CMG002.</p>
</caption>
<graphic xlink:href="molce-42-448f10"></graphic>
</fig>
<table-wrap id="t1-molce-42-448" orientation="portrait" position="float">
<label>Table 1</label>
<caption>
<p>Information on primers for PCR</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th valign="bottom" align="center" rowspan="1" colspan="1">Gene</th>
<th valign="bottom" align="center" rowspan="1" colspan="1">Forward primer (5′-3′)</th>
<th valign="bottom" align="center" rowspan="1" colspan="1">Reverse primer (5′-3′)</th>
<th valign="bottom" align="center" rowspan="1" colspan="1">Size (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>EBNA1</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">AGATGACCCAGGAGAAGGCCCAAGC</td>
<td valign="top" align="left" rowspan="1" colspan="1">CAAAGGGGAGACGACTCAATG</td>
<td valign="top" align="center" rowspan="1" colspan="1">308</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>GAPDH</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">CACTGGCGTCTTCACCACCATG</td>
<td valign="top" align="left" rowspan="1" colspan="1">GCTTCACCACCTTCTTGATGTCA</td>
<td valign="top" align="center" rowspan="1" colspan="1">465</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>Corée du Sud</li>
<li>États-Unis</li>
</country>
</list>
<tree>
<country name="Corée du Sud">
<noRegion>
<name sortKey="Kim, Mi Young" sort="Kim, Mi Young" uniqKey="Kim M" first="Mi-Young" last="Kim">Mi-Young Kim</name>
</noRegion>
<name sortKey="Cho, Joo Young" sort="Cho, Joo Young" uniqKey="Cho J" first="Joo Young" last="Cho">Joo Young Cho</name>
<name sortKey="Hahm, Ki Baik" sort="Hahm, Ki Baik" uniqKey="Hahm K" first="Ki Baik" last="Hahm">Ki Baik Hahm</name>
<name sortKey="Hong, Sung Pyo" sort="Hong, Sung Pyo" uniqKey="Hong S" first="Sung Pyo" last="Hong">Sung Pyo Hong</name>
<name sortKey="Jeong, Ju Yeon" sort="Jeong, Ju Yeon" uniqKey="Jeong J" first="Ju-Yeon" last="Jeong">Ju-Yeon Jeong</name>
<name sortKey="Kim, Jaehee" sort="Kim, Jaehee" uniqKey="Kim J" first="Jaehee" last="Kim">Jaehee Kim</name>
<name sortKey="Kim, Sun Young" sort="Kim, Sun Young" uniqKey="Kim S" first="Sun Young" last="Kim">Sun Young Kim</name>
<name sortKey="Shin, Phil Kyung" sort="Shin, Phil Kyung" uniqKey="Shin P" first="Phil Kyung" last="Shin">Phil Kyung Shin</name>
</country>
<country name="États-Unis">
<noRegion>
<name sortKey="Kim, Mi Young" sort="Kim, Mi Young" uniqKey="Kim M" first="Mi-Young" last="Kim">Mi-Young Kim</name>
</noRegion>
<name sortKey="Kruger, Annie J" sort="Kruger, Annie J" uniqKey="Kruger A" first="Annie J." last="Kruger">Annie J. Kruger</name>
<name sortKey="Kruger, Annie J" sort="Kruger, Annie J" uniqKey="Kruger A" first="Annie J." last="Kruger">Annie J. Kruger</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/ChloroquineV1/Data/Ncbi/Merge
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000616 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd -nk 000616 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    ChloroquineV1
   |flux=    Ncbi
   |étape=   Merge
   |type=    RBID
   |clé=     PMC:6602147
   |texte=   Combination Therapy with a PI3K/mTOR Dual Inhibitor and Chloroquine Enhances Synergistic Apoptotic Cell Death in Epstein–Barr Virus-Infected Gastric Cancer Cells
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/RBID.i   -Sk "pubmed:31085812" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd   \
       | NlmPubMed2Wicri -a ChloroquineV1 

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Wed Mar 25 22:43:59 2020. Site generation: Sun Jan 31 12:44:45 2021