Serveur d'exploration Stress et Covid

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 000702 ( Pmc/Corpus ); précédent : 0007019; suivant : 0007030 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Effect of chicken egg yolk immunoglobulins on serum biochemical profiles and intestinal bacterial populations in early‐weaned piglets</title>
<author>
<name sortKey="Tan, Xian" sort="Tan, Xian" uniqKey="Tan X" first="Xian" last="Tan">Xian Tan</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Jia" sort="Li, Jia" uniqKey="Li J" first="Jia" last="Li">Jia Li</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="jpn13129-aff-0002"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Yali" sort="Li, Yali" uniqKey="Li Y" first="Yali" last="Li">Yali Li</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Jianzhong" sort="Li, Jianzhong" uniqKey="Li J" first="Jianzhong" last="Li">Jianzhong Li</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Qingping" sort="Wang, Qingping" uniqKey="Wang Q" first="Qingping" last="Wang">Qingping Wang</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0003"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Fang, Lin" sort="Fang, Lin" uniqKey="Fang L" first="Lin" last="Fang">Lin Fang</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0003"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Ding, Xueqin" sort="Ding, Xueqin" uniqKey="Ding X" first="Xueqin" last="Ding">Xueqin Ding</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Huang, Pengfei" sort="Huang, Pengfei" uniqKey="Huang P" first="Pengfei" last="Huang">Pengfei Huang</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yang, Huansheng" sort="Yang, Huansheng" uniqKey="Yang H" first="Huansheng" last="Yang">Huansheng Yang</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="jpn13129-aff-0002"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yin, Yulong" sort="Yin, Yulong" uniqKey="Yin Y" first="Yulong" last="Yin">Yulong Yin</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="jpn13129-aff-0002"></nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">31144409</idno>
<idno type="pmc">7166376</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7166376</idno>
<idno type="RBID">PMC:7166376</idno>
<idno type="doi">10.1111/jpn.13129</idno>
<date when="2019">2019</date>
<idno type="wicri:Area/Pmc/Corpus">000702</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000702</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Effect of chicken egg yolk immunoglobulins on serum biochemical profiles and intestinal bacterial populations in early‐weaned piglets</title>
<author>
<name sortKey="Tan, Xian" sort="Tan, Xian" uniqKey="Tan X" first="Xian" last="Tan">Xian Tan</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Jia" sort="Li, Jia" uniqKey="Li J" first="Jia" last="Li">Jia Li</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="jpn13129-aff-0002"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Yali" sort="Li, Yali" uniqKey="Li Y" first="Yali" last="Li">Yali Li</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Li, Jianzhong" sort="Li, Jianzhong" uniqKey="Li J" first="Jianzhong" last="Li">Jianzhong Li</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Qingping" sort="Wang, Qingping" uniqKey="Wang Q" first="Qingping" last="Wang">Qingping Wang</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0003"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Fang, Lin" sort="Fang, Lin" uniqKey="Fang L" first="Lin" last="Fang">Lin Fang</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0003"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Ding, Xueqin" sort="Ding, Xueqin" uniqKey="Ding X" first="Xueqin" last="Ding">Xueqin Ding</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Huang, Pengfei" sort="Huang, Pengfei" uniqKey="Huang P" first="Pengfei" last="Huang">Pengfei Huang</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yang, Huansheng" sort="Yang, Huansheng" uniqKey="Yang H" first="Huansheng" last="Yang">Huansheng Yang</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="jpn13129-aff-0002"></nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Yin, Yulong" sort="Yin, Yulong" uniqKey="Yin Y" first="Yulong" last="Yin">Yulong Yin</name>
<affiliation>
<nlm:aff id="jpn13129-aff-0001"></nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="jpn13129-aff-0002"></nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Journal of Animal Physiology and Animal Nutrition</title>
<idno type="ISSN">0931-2439</idno>
<idno type="eISSN">1439-0396</idno>
<imprint>
<date when="2019">2019</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<title>Abstract</title>
<p>This study was conducted to test the hypothesis that dietary supplementation with anti‐
<italic>E. coli</italic>
, chicken egg yolk immunoglobulins (IgY), may affect early weaned piglet (EWP) intestinal functions and enteric micro‐organisms. One hundred and forty‐eight ([Landrace × Yorkshire] × Duroc) piglets, weaned at age day 21, were randomly assigned to receive one of three diets for 14 days. Treatment group one (control group) was fed the base diet. Treatment group two (antibiotics group) was fed the base diet which was supplemented with 100 ppm colistin sulphate and 15 ppm enramycin; treatment group three (IgY group) was fed the base diet which was supplemented with 500 mg/kg anti‐
<italic>E. coli</italic>
IgY. The study evaluated the effects on EWPs of IgY on growth, serum biochemical, inflammatory profiles and also digestion content intestinal bacterial populations. Results showed no significant difference in diarrhoea rates between IgY‐fed EWPs and antibiotic‐treated EWPs. Serum biochemical analysis showed that EWPs fed an IgY‐containing diet had both lower (
<italic>p</italic>
 < 0.05) cholesterol and low‐density lipoprotein compared to antibiotic‐treated EWPs.
<italic>Escherichia coli</italic>
populations measured in IgY‐fed EWP ileal contents, compared to the control group, were significantly reduced (
<italic>p</italic>
 < 0.05).
<italic>Enterococcus</italic>
,
<italic>Lactobacillus</italic>
,
<italic>Clostridium</italic>
and
<italic>Bifidobacterium</italic>
populations were unaffected by the IgY treatment. Larger (
<italic>p</italic>
 < 0.05)
<italic>Enterococcus</italic>
populations and lower (
<italic>p</italic>
 < 0.05) expression levels of heat‐stable enterotoxin b (STb) were observed in IgY‐fed EWP caecal digesta compared to the control group. Enteric
<italic>Lactobacillus</italic>
significantly decreased (
<italic>p</italic>
 < 0.05) in EWPs fed antibiotics while it was unaffected by IgY treatment. Dietary supplementation with anti‐
<italic>E. coli</italic>
IgY has the potential to suppress enteric
<italic>E. coli</italic>
growth, but not
<italic>Lactobacillus</italic>
,
<italic> Clostridium</italic>
and
<italic> Bifidobacterium</italic>
. This promotes and maintains a healthy EWP intestinal environment. These findings suggest that IgY may be used as an alternative to antibiotics in EWP diets.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">J Anim Physiol Anim Nutr (Berl)</journal-id>
<journal-id journal-id-type="iso-abbrev">J Anim Physiol Anim Nutr (Berl)</journal-id>
<journal-id journal-id-type="doi">10.1111/(ISSN)1439-0396</journal-id>
<journal-id journal-id-type="publisher-id">JPN</journal-id>
<journal-title-group>
<journal-title>Journal of Animal Physiology and Animal Nutrition</journal-title>
</journal-title-group>
<issn pub-type="ppub">0931-2439</issn>
<issn pub-type="epub">1439-0396</issn>
<publisher>
<publisher-name>John Wiley and Sons Inc.</publisher-name>
<publisher-loc>Hoboken</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">31144409</article-id>
<article-id pub-id-type="pmc">7166376</article-id>
<article-id pub-id-type="doi">10.1111/jpn.13129</article-id>
<article-id pub-id-type="publisher-id">JPN13129</article-id>
<article-categories>
<subj-group subj-group-type="overline">
<subject>Original Article</subject>
</subj-group>
<subj-group subj-group-type="heading">
<subject>Original Articles</subject>
<subj-group subj-group-type="heading">
<subject>Pigs</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Effect of chicken egg yolk immunoglobulins on serum biochemical profiles and intestinal bacterial populations in early‐weaned piglets</article-title>
<alt-title alt-title-type="left-running-head">TAN et al.</alt-title>
</title-group>
<contrib-group>
<contrib id="jpn13129-cr-0001" contrib-type="author">
<name>
<surname>Tan</surname>
<given-names>Xian</given-names>
</name>
<xref ref-type="aff" rid="jpn13129-aff-0001">
<sup>1</sup>
</xref>
</contrib>
<contrib id="jpn13129-cr-0002" contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Jia</given-names>
</name>
<xref ref-type="aff" rid="jpn13129-aff-0001">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="jpn13129-aff-0002">
<sup>2</sup>
</xref>
</contrib>
<contrib id="jpn13129-cr-0003" contrib-type="author" corresp="yes">
<name>
<surname>Li</surname>
<given-names>Yali</given-names>
</name>
<xref ref-type="aff" rid="jpn13129-aff-0001">
<sup>1</sup>
</xref>
<address>
<email>liyali06@163.com</email>
</address>
</contrib>
<contrib id="jpn13129-cr-0004" contrib-type="author" corresp="yes">
<name>
<surname>Li</surname>
<given-names>Jianzhong</given-names>
</name>
<xref ref-type="aff" rid="jpn13129-aff-0001">
<sup>1</sup>
</xref>
<address>
<email>ljzhong@hunnu.edu.cn</email>
</address>
</contrib>
<contrib id="jpn13129-cr-0005" contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Qingping</given-names>
</name>
<xref ref-type="aff" rid="jpn13129-aff-0003">
<sup>3</sup>
</xref>
</contrib>
<contrib id="jpn13129-cr-0006" contrib-type="author">
<name>
<surname>Fang</surname>
<given-names>Lin</given-names>
</name>
<xref ref-type="aff" rid="jpn13129-aff-0003">
<sup>3</sup>
</xref>
</contrib>
<contrib id="jpn13129-cr-0007" contrib-type="author">
<name>
<surname>Ding</surname>
<given-names>Xueqin</given-names>
</name>
<xref ref-type="aff" rid="jpn13129-aff-0001">
<sup>1</sup>
</xref>
</contrib>
<contrib id="jpn13129-cr-0008" contrib-type="author">
<name>
<surname>Huang</surname>
<given-names>Pengfei</given-names>
</name>
<xref ref-type="aff" rid="jpn13129-aff-0001">
<sup>1</sup>
</xref>
</contrib>
<contrib id="jpn13129-cr-0009" contrib-type="author" corresp="yes">
<name>
<surname>Yang</surname>
<given-names>Huansheng</given-names>
</name>
<contrib-id contrib-id-type="orcid" authenticated="false">https://orcid.org/0000-0003-1164-5771</contrib-id>
<xref ref-type="aff" rid="jpn13129-aff-0001">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="jpn13129-aff-0002">
<sup>2</sup>
</xref>
<address>
<email>yhs@hunnu.edu.cn</email>
</address>
</contrib>
<contrib id="jpn13129-cr-0010" contrib-type="author">
<name>
<surname>Yin</surname>
<given-names>Yulong</given-names>
</name>
<xref ref-type="aff" rid="jpn13129-aff-0001">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="jpn13129-aff-0002">
<sup>2</sup>
</xref>
</contrib>
</contrib-group>
<aff id="jpn13129-aff-0001">
<label>
<sup>1</sup>
</label>
<named-content content-type="organisation-division">Hunan International Joint Laboratory of Animal Intestinal Ecology and Health, Animal Nutrition and Human Health Laboratory, School of Life Sciences</named-content>
<institution>Hunan Normal University</institution>
<city>Changsha</city>
<country country="CN">China</country>
</aff>
<aff id="jpn13129-aff-0002">
<label>
<sup>2</sup>
</label>
<named-content content-type="organisation-division">Hunan Provincial Key Laboratory of Animal Nutritional Physiology and Metabolic Process, Scientific Observing and Experimental Station of Animal Nutrition and Feed Science in South‐Central, Ministry of Agriculture, Hunan Provincial Engineering Research Center for Healthy Livestock and Poultry Production, Key Laboratory of Agro‐ecological Processes in Subtropical Region, Institute of Subtropical Agriculture</named-content>
<institution>Chinese Academy of Sciences</institution>
<city>Changsha</city>
<country country="CN">China</country>
</aff>
<aff id="jpn13129-aff-0003">
<label>
<sup>3</sup>
</label>
<institution>Zyme Fast (Changsha) Biotechnology Co., Ltd.</institution>
<city>Changsha</city>
<country country="CN">China</country>
</aff>
<author-notes>
<corresp id="correspondenceTo">
<label>*</label>
<bold>Correspondence</bold>
<break></break>
Yali Li, Jianzhong Li and Huansheng Yang, College of Life Sciences, Hunan Normal University, 122 Xiaoxiang Middle Road, Changsha 410006, China.
<break></break>
Emails:
<email>liyali06@163.com</email>
(Y.L.);
<email>ljzhong@hunnu.edu.cn</email>
(J.L.);
<email>yhs@hunnu.edu.cn</email>
(H.Y.)
<break></break>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>30</day>
<month>5</month>
<year>2019</year>
</pub-date>
<pub-date pub-type="ppub">
<month>9</month>
<year>2019</year>
</pub-date>
<volume>103</volume>
<issue>5</issue>
<issue-id pub-id-type="doi">10.1111/jpn.v103.5</issue-id>
<fpage>1503</fpage>
<lpage>1511</lpage>
<history>
<date date-type="received">
<day>12</day>
<month>1</month>
<year>2019</year>
</date>
<date date-type="rev-recd">
<day>23</day>
<month>4</month>
<year>2019</year>
</date>
<date date-type="accepted">
<day>04</day>
<month>5</month>
<year>2019</year>
</date>
</history>
<permissions>
<pmc-comment> © 2019 Blackwell Verlag GmbH </pmc-comment>
<copyright-statement content-type="article-copyright">© 2019 Blackwell Verlag GmbH</copyright-statement>
<license>
<license-p>This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.</license-p>
</license>
</permissions>
<self-uri content-type="pdf" xlink:href="file:JPN-103-1503.pdf"></self-uri>
<abstract id="jpn13129-abs-0001">
<title>Abstract</title>
<p>This study was conducted to test the hypothesis that dietary supplementation with anti‐
<italic>E. coli</italic>
, chicken egg yolk immunoglobulins (IgY), may affect early weaned piglet (EWP) intestinal functions and enteric micro‐organisms. One hundred and forty‐eight ([Landrace × Yorkshire] × Duroc) piglets, weaned at age day 21, were randomly assigned to receive one of three diets for 14 days. Treatment group one (control group) was fed the base diet. Treatment group two (antibiotics group) was fed the base diet which was supplemented with 100 ppm colistin sulphate and 15 ppm enramycin; treatment group three (IgY group) was fed the base diet which was supplemented with 500 mg/kg anti‐
<italic>E. coli</italic>
IgY. The study evaluated the effects on EWPs of IgY on growth, serum biochemical, inflammatory profiles and also digestion content intestinal bacterial populations. Results showed no significant difference in diarrhoea rates between IgY‐fed EWPs and antibiotic‐treated EWPs. Serum biochemical analysis showed that EWPs fed an IgY‐containing diet had both lower (
<italic>p</italic>
 < 0.05) cholesterol and low‐density lipoprotein compared to antibiotic‐treated EWPs.
<italic>Escherichia coli</italic>
populations measured in IgY‐fed EWP ileal contents, compared to the control group, were significantly reduced (
<italic>p</italic>
 < 0.05).
<italic>Enterococcus</italic>
,
<italic>Lactobacillus</italic>
,
<italic>Clostridium</italic>
and
<italic>Bifidobacterium</italic>
populations were unaffected by the IgY treatment. Larger (
<italic>p</italic>
 < 0.05)
<italic>Enterococcus</italic>
populations and lower (
<italic>p</italic>
 < 0.05) expression levels of heat‐stable enterotoxin b (STb) were observed in IgY‐fed EWP caecal digesta compared to the control group. Enteric
<italic>Lactobacillus</italic>
significantly decreased (
<italic>p</italic>
 < 0.05) in EWPs fed antibiotics while it was unaffected by IgY treatment. Dietary supplementation with anti‐
<italic>E. coli</italic>
IgY has the potential to suppress enteric
<italic>E. coli</italic>
growth, but not
<italic>Lactobacillus</italic>
,
<italic> Clostridium</italic>
and
<italic> Bifidobacterium</italic>
. This promotes and maintains a healthy EWP intestinal environment. These findings suggest that IgY may be used as an alternative to antibiotics in EWP diets.</p>
</abstract>
<kwd-group kwd-group-type="author-generated">
<kwd id="jpn13129-kwd-0001">antibiotic</kwd>
<kwd id="jpn13129-kwd-0002">diarrhoea</kwd>
<kwd id="jpn13129-kwd-0003">early weaned piglets</kwd>
<kwd id="jpn13129-kwd-0004">egg yolk immunoglobulins</kwd>
<kwd id="jpn13129-kwd-0005">gut microflora</kwd>
</kwd-group>
<funding-group>
<award-group id="funding-0001">
<funding-source>Young Elite Scientists Sponsorship Program by CAST</funding-source>
<award-id>YESS20160086</award-id>
</award-group>
<award-group id="funding-0002">
<funding-source>Key Programs of Frontier Scientific Research of the Chinese Academy of Sciences</funding-source>
<award-id>QYZDY-SSW-SMC008</award-id>
</award-group>
<award-group id="funding-0003">
<funding-source>Natural Science Foundation of Hunan Province</funding-source>
<award-id>2017JJ1020</award-id>
</award-group>
</funding-group>
<counts>
<fig-count count="0"></fig-count>
<table-count count="7"></table-count>
<page-count count="9"></page-count>
<word-count count="6390"></word-count>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>source-schema-version-number</meta-name>
<meta-value>2.0</meta-value>
</custom-meta>
<custom-meta>
<meta-name>cover-date</meta-name>
<meta-value>September 2019</meta-value>
</custom-meta>
<custom-meta>
<meta-name>details-of-publishers-convertor</meta-name>
<meta-value>Converter:WILEY_ML3GV2_TO_JATSPMC version:5.8.0 mode:remove_FC converted:15.04.2020</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
<notes>
<p content-type="self-citation">
<mixed-citation publication-type="journal" id="jpn13129-cit-1001">
<string-name>
<surname>Tan</surname>
<given-names>X</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
<given-names>J</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
<given-names>Y</given-names>
</string-name>
, et al.
<article-title>Effect of chicken egg yolk immunoglobulins on serum biochemical profiles and intestinal bacterial populations in early weaned piglets</article-title>
.
<source xml:lang="en">J Anim Physiol Anim Nutr</source>
.
<year>2019</year>
;
<volume>103</volume>
:
<fpage>1503</fpage>
<lpage>1511</lpage>
.
<pub-id pub-id-type="doi">10.1111/jpn.13129</pub-id>
</mixed-citation>
</p>
<fn-group id="jpn13129-ntgp-0001">
<fn fn-type="equal" id="jpn13129-note-0001">
<p>Xian Tan and Jia Li contributed equally to this work.</p>
</fn>
</fn-group>
</notes>
</front>
<body id="jpn13129-body-0001">
<sec id="jpn13129-sec-0001">
<label>1</label>
<title>INTRODUCTION</title>
<p>Weaning triggers significant psychosocial, and physical, stress in piglets including maternal and littermate separation, and abrupt diet change (Campbell, Crenshaw, & Polo,
<xref rid="jpn13129-bib-0005" ref-type="ref">2013</xref>
; Qiao, Li, Wang, & Wang,
<xref rid="jpn13129-bib-0030" ref-type="ref">2015</xref>
; Xiong et al.,
<xref rid="jpn13129-bib-0040" ref-type="ref">2015</xref>
). Abrupt weaning can contribute to intestinal and immune system dysfunctions and lead to diarrhoea (Kuang et al.,
<xref rid="jpn13129-bib-0023" ref-type="ref">2015</xref>
; Pluske, Hampson, & Williams,
<xref rid="jpn13129-bib-0028" ref-type="ref">1997</xref>
). In order to address problems caused by weaning, antibiotics have been widely used (Cromwell,
<xref rid="jpn13129-bib-0010" ref-type="ref">2002</xref>
; Yin et al.,
<xref rid="jpn13129-bib-0044" ref-type="ref">2009</xref>
). Misuse of antibiotics in feed has resulted in serious complications due to drug residues in animal products and increased bacterial resistance (Yen, Lai, Lin, & Chiang,
<xref rid="jpn13129-bib-0043" ref-type="ref">2015</xref>
). Dietary antibiotics change enteric microflora that are important maintaining intestinal health and function (Guarner & Malagelada,
<xref rid="jpn13129-bib-0013" ref-type="ref">2003</xref>
).</p>
<p>IgY derived from egg yolks by immunizing hens. It is actively transported from hen serum into the embryo via the egg yolk and provides passive immunity to embryos and offspring (Muller, Schubert, Zajac, Dyck, & Oelkrug,
<xref rid="jpn13129-bib-0026" ref-type="ref">2015</xref>
; Sui, Cao, & Lin,
<xref rid="jpn13129-bib-0031" ref-type="ref">2011</xref>
). IgY is resistant against specific pathogens based on the antigen the hens are immunized against. It has been shown to be effective against a variety of intestinal pathogens particularly diarrhoea pathogens such as bovine and human rotaviruses, bovine coronavirus, enterotoxigenic
<italic>Escherichia coli</italic>
(ETEC) and
<italic>Salmonella</italic>
(Diraviyam et al.,
<xref rid="jpn13129-bib-0011" ref-type="ref">2014</xref>
; Muller et al.,
<xref rid="jpn13129-bib-0026" ref-type="ref">2015</xref>
; Sui et al.,
<xref rid="jpn13129-bib-0031" ref-type="ref">2011</xref>
; Thu et al.,
<xref rid="jpn13129-bib-0032" ref-type="ref">2017</xref>
; Xu et al.,
<xref rid="jpn13129-bib-0041" ref-type="ref">2011</xref>
). IgY has attracted considerable interest as an alternative to antibiotics for the control of infectious diseases in the alimentary tract (Li, Wang, Zhen, Li, & Xu,
<xref rid="jpn13129-bib-0025" ref-type="ref">2015</xref>
). The present study was conducted to test the hypothesis that supplementing early weaned piglet (EWP) diets with anti‐
<italic>E. coli</italic>
IgY may affect their enteric
<italic>Escherichia coli</italic>
, without affecting other micro‐organisms, and also beneficially intestinal function.</p>
</sec>
<sec sec-type="materials-and-methods" id="jpn13129-sec-0002">
<label>2</label>
<title>MATERIALS AND METHODS</title>
<sec id="jpn13129-sec-0003">
<label>2.1</label>
<title>Animals, housing and experimental treatments</title>
<p>One hundred and forty‐eight (148) ([Landrace × Yorkshire] × Duroc) piglets were weaned day 21. Their initial body weight (BW) was 7.37 ± 0.26 kg. They were used in a 14‐day feeding trial. EWPs were assigned to one of three possible treatments (3 replicate/treatment; 13–17 piglets/replicate). They were the control group (base diet), the antibiotics group (base diet + 100 ppm colistin sulphate + 15 ppm enramycin) and the IgY group (base diet + 500 ppm specific IgY). The base diet formulation (Table
<xref rid="jpn13129-tbl-0001" ref-type="table">1</xref>
) met nutrient requirements of weaned pigs as recommended by the National Research Council (NRC,
<xref rid="jpn13129-bib-0027" ref-type="ref">2012</xref>
). Specific IgY with high titres of anti‐
<italic>E. coli</italic>
(50 000) was provided by Zyme Fast (Changsha) Biotechnology. Throughout the experimental period, feed and water were available ad libitum. At the end of the trial, seven EWPs from each group were randomly selected and sacrificed for sampling. The experimental design and procedures in this study were reviewed and approved by the Animal Care and Use Committee of Hunan Normal University, Changsha City, Hunan, China.</p>
<table-wrap id="jpn13129-tbl-0001" xml:lang="en" orientation="portrait" position="float">
<label>Table 1</label>
<caption>
<p>Diet composition as fed</p>
</caption>
<table frame="hsides" rules="groups">
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<thead valign="top">
<tr style="border-bottom:solid 1px #000000">
<th align="left" valign="top" rowspan="1" colspan="1">Component</th>
<th align="left" valign="top" rowspan="1" colspan="1">Content (%)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">Corn</td>
<td align="char" char="." rowspan="1" colspan="1">37.66</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Extruded corn</td>
<td align="char" char="." rowspan="1" colspan="1">20.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Soybean meal, 43% CP</td>
<td align="char" char="." rowspan="1" colspan="1">8.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Concentrated soy protein</td>
<td align="char" char="." rowspan="1" colspan="1">7.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Whey</td>
<td align="char" char="." rowspan="1" colspan="1">10.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Fish meal, 63% CP</td>
<td align="char" char="." rowspan="1" colspan="1">5.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Plasma protein powder</td>
<td align="char" char="." rowspan="1" colspan="1">4.50</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<sc>l</sc>
‐lysine HCl, 98%</td>
<td align="char" char="." rowspan="1" colspan="1">0.33</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<sc>dl</sc>
‐methionine</td>
<td align="char" char="." rowspan="1" colspan="1">0.08</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<sc>l</sc>
‐threonine</td>
<td align="char" char="." rowspan="1" colspan="1">0.03</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<sc>l</sc>
‐tryptophan</td>
<td align="char" char="." rowspan="1" colspan="1">0.01</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Glucose</td>
<td align="char" char="." rowspan="1" colspan="1">2.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Soybean oil</td>
<td align="char" char="." rowspan="1" colspan="1">2.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Limestone</td>
<td align="char" char="." rowspan="1" colspan="1">1.04</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Monocalcium phosphate</td>
<td align="char" char="." rowspan="1" colspan="1">0.50</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Choline chloride, 50%</td>
<td align="char" char="." rowspan="1" colspan="1">0.10</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Antioxidants</td>
<td align="char" char="." rowspan="1" colspan="1">0.05</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Zinc oxide</td>
<td align="char" char="." rowspan="1" colspan="1">0.30</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Citric acid</td>
<td align="char" char="." rowspan="1" colspan="1">0.30</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Vitamin–mineral premix
<xref ref-type="fn" rid="jpn13129-note-0003">a</xref>
</td>
<td align="char" char="." rowspan="1" colspan="1">1.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">IgY premix or carrier
<xref ref-type="fn" rid="jpn13129-note-0004">b</xref>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.10</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Total</td>
<td align="char" char="." rowspan="1" colspan="1">100</td>
</tr>
<tr>
<td align="left" colspan="2" rowspan="1">Calculated composition</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">CP, %</td>
<td align="char" char="." rowspan="1" colspan="1">18.0</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">ME, MJ/kg</td>
<td align="char" char="." rowspan="1" colspan="1">14.2</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Lysine
<xref ref-type="fn" rid="jpn13129-note-0005">c</xref>
%</td>
<td align="char" char="." rowspan="1" colspan="1">1.35</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Methionine
<xref ref-type="fn" rid="jpn13129-note-0005">c</xref>
%</td>
<td align="char" char="." rowspan="1" colspan="1">0.39</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Methionine + cystine
<xref ref-type="fn" rid="jpn13129-note-0005">c</xref>
%</td>
<td align="char" char="." rowspan="1" colspan="1">0.74</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Threonine
<xref ref-type="fn" rid="jpn13129-note-0005">c</xref>
%</td>
<td align="char" char="." rowspan="1" colspan="1">0.79</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Tryptophan
<xref ref-type="fn" rid="jpn13129-note-0005">c</xref>
%</td>
<td align="char" char="." rowspan="1" colspan="1">0.22</td>
</tr>
</tbody>
</table>
<table-wrap-foot id="jpn13129-ntgp-0002">
<fn id="jpn13129-note-0002">
<p>Abbreviations: CP, crude protein; ME, metabolizable energy.</p>
</fn>
<fn id="jpn13129-note-0003">
<label>a</label>
<p>Vitamin–mineral premix supplied per kilogram of feed: 10,000 IU of vitamin A, 1,000 IU of vitamin D
<sub>3</sub>
, 80 IU of vitamin E, 2.0 mg of vitamin K
<sub>3</sub>
, 0.03 mg of vitamin B
<sub>12</sub>
, 12 mg of riboflavin, 40 mg of niacin, 25 mg of d‐pantothenic acid, 0.25 mg of biotin, 1.6 mg of folic acid, 3.0 mg of thiamine, 2.25 mg of pyridoxine, 300 mg of choline chloride, 150 mg of Fe (FeSO
<sub>4</sub>
), 100 mg of Zn (ZnSO
<sub>4</sub>
), 30 mg of Mn (MnSO
<sub>4</sub>
), 25 mg of Cu (CuSO
<sub>4</sub>
), 0.5 mg of I (KIO
<sub>3</sub>
), 0.3 mg of Co (CoSO
<sub>4</sub>
), 0.3 mg of Se (Na
<sub>2</sub>
SeO
<sub>3</sub>
) and 4.0 mg of ethoxyquin.</p>
</fn>
<fn id="jpn13129-note-0004">
<label>b</label>
<p>IgY = chicken egg yolk immunoglobulins; dried, egg yolk powder spray was used as carrier.</p>
</fn>
<fn id="jpn13129-note-0005">
<label>c</label>
<p>Standardized ileal digestible.</p>
</fn>
</table-wrap-foot>
<permissions>
<copyright-holder>John Wiley & Sons, Ltd</copyright-holder>
<license>
<license-p>This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.</license-p>
</license>
</permissions>
</table-wrap>
</sec>
<sec id="jpn13129-sec-0004">
<label>2.2</label>
<title>Growth performance and diarrhoea rate</title>
<p>Initial and final body weight and feed consumption were recorded throughout the trial. Average daily gain (ADG), average daily feed intake (ADFI) and feed/gain (F:G) ratio were calculated. Each pig was clinically monitored throughout the experiment. Diarrhoea score was recorded as (0), normal; (1), soft; (2), mild diarrhoea; and (3), severe diarrhoea (watery stool) (Alustiza et al.,
<xref rid="jpn13129-bib-0002" ref-type="ref">2016</xref>
). Diarrhoea rate was calculated according to this formula. Diarrhoea rate (%) = number of EWPs with diarrhoea within a treatment/(number of EWPs × total experimental days) × 100%. “Number of EWPs with diarrhoea” was the total number of EWPs with diarrhoea observed on a particular day (Wan et al.,
<xref rid="jpn13129-bib-0036" ref-type="ref">2016</xref>
).</p>
</sec>
<sec id="jpn13129-sec-0005">
<label>2.3</label>
<title>Collection of serum, digesta and jejunal mucosal samples</title>
<p>Blood was sampled via 10‐ml vacutainer tubes that contained EDTA as an anticoagulant. They were centrifuged at 3,000 × 
<italic>g</italic>
for 10 min at 4°C (Yin et al.,
<xref rid="jpn13129-bib-0044" ref-type="ref">2009</xref>
) and stored at −80°C until the biochemical profile analysis was performed. Total protein (TP), alanine transaminase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), glucose (GLU), triglycerides (TG), cholesterol (CHOL), high‐density lipoprotein (HDL), low‐density lipoprotein (LDL), diamine oxidase (DAO), Complement C
<sub>4</sub>
, immunoglobulin M (IgM) and NH
<sub>3</sub>
in serum were examined. Digesta samples from the ileum, caecum and colon were collected, quick‐frozen in liquid nitrogen and stored at −80°C (Kuang et al.,
<xref rid="jpn13129-bib-0023" ref-type="ref">2015</xref>
). Mid‐jejunum intestinal tissues (approximately 20 cm) were collected. Mucosa samples were scraped using sterilized glass slides, frozen in liquid nitrogen and stored at ‐80°C for further processing (Xiong et al.,
<xref rid="jpn13129-bib-0040" ref-type="ref">2015</xref>
).</p>
</sec>
<sec id="jpn13129-sec-0006">
<label>2.4</label>
<title>RNA isolation and real‐time quantitative PCR analysis</title>
<p>Total RNA was isolated from jejunal mucosal samples using a TRIzol reagent (100 mg tissue per 1 ml TRIzol; Invitrogen Life Technologies) following manufacturer instructions. RNA integrity was checked using 1% agarose gel electrophoresis stained with 10 µg/ml ethidium bromide. The quantity and quality of RNA were determined using a NanoDrop ND‐2000 spectrophotometer system (Thermo Fisher Scientific). All RNA samples were reverse transcribed into cDNA using a Superscript First‐Strand Synthesis System (Invitrogen Life Technologies) with a PrimeScript RT‐PCR kit (TaKaRa) using OligodT Primer. cDNA samples were then tested for
<italic>IL‐1β</italic>
,
<italic>IL‐6</italic>
,
<italic>IFN‐r</italic>
,
<italic>TNF‐α</italic>
,
<italic>ZO‐1</italic>
,
<italic>Claudin‐1</italic>
and
<italic>Occludin‐1</italic>
expressions via real‐time RT‐PCR performed as described by Yang, Wang, Xiong, and Yin (
<xref rid="jpn13129-bib-0042" ref-type="ref">2016</xref>
). Results were normalized to
<italic>β‐actin</italic>
expression. Relative quantification was calculated using the 2
<sup>−ΔΔCT</sup>
method. The sequences for the sense and antisense primers used to quantify mRNA were designed using Oligo 6.0 (Molecular Biology Insights) and appear in Table
<xref rid="jpn13129-tbl-0002" ref-type="table">2</xref>
.</p>
<table-wrap id="jpn13129-tbl-0002" xml:lang="en" orientation="portrait" position="float">
<label>Table 2</label>
<caption>
<p>Cytokines primers and tight junction proteins used</p>
</caption>
<table frame="hsides" rules="groups">
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<thead valign="top">
<tr style="border-bottom:solid 1px #000000">
<th align="left" valign="top" rowspan="1" colspan="1">Target gene</th>
<th align="left" valign="top" rowspan="1" colspan="1">Orientation</th>
<th align="left" valign="top" rowspan="1" colspan="1">Sequence (5′–3′)</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<italic>T</italic>
<sub>m</sub>
(°C)</th>
<th align="left" valign="top" rowspan="1" colspan="1">Product size (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>β‐actin</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">AGTTGAAGGTGGTCTCGTGG</td>
<td align="left" rowspan="2" colspan="1">57.4</td>
<td align="char" char="." rowspan="2" colspan="1">216</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">TGCGGGACATCAAGGAGAAG</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>IL‐1β</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">CCTGGACCTTGGTTCTCT</td>
<td align="left" rowspan="2" colspan="1">53</td>
<td align="char" char="." rowspan="2" colspan="1">123</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">GGATTCTTCATCGGCTTCT</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>IL‐6</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">GGCAAAAGGGAAAGAATCCAG</td>
<td align="left" rowspan="2" colspan="1">57</td>
<td align="char" char="." rowspan="2" colspan="1">87</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">CGTTCTGTGACTGCAGCTTATCC</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>IFN‐r</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">CCATTCAAAGGAGCATGGAT</td>
<td align="left" rowspan="2" colspan="1">55</td>
<td align="char" char="." rowspan="2" colspan="1">146</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">GAGTTCACTGATGGCTTTGC</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>TNF‐α</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">ACAGGCCAGCTCCCTCTTAT</td>
<td align="left" rowspan="2" colspan="1">53.9</td>
<td align="char" char="." rowspan="2" colspan="1">102</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">CCTCGCCCTCCTGAATAAAT</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>ZO‐1</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">TTGATAGTGGCGTTGACA</td>
<td align="left" rowspan="2" colspan="1">52</td>
<td align="char" char="." rowspan="2" colspan="1">126</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">CCTCATCTTCATCATCTTCTAC</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>Claudin‐1</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">CTAGTGATGAGGCAGATGAA</td>
<td align="left" rowspan="2" colspan="1">59</td>
<td align="char" char="." rowspan="2" colspan="1">250</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">AGATAGGTCCGAAGCAGAT</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>Occludin</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">GAGTGATTCGGATTCTGTCT</td>
<td align="left" rowspan="2" colspan="1">54</td>
<td align="char" char="." rowspan="2" colspan="1">181</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">TAGCCATAACCATAGCCATAG</td>
</tr>
</tbody>
</table>
<table-wrap-foot id="jpn13129-ntgp-0003">
<fn id="jpn13129-note-0006">
<p>Abbreviations:
<italic>IL‐1β</italic>
, interleukin 1β;
<italic>IL‐6</italic>
, interleukin 6;
<italic>IFN‐r</italic>
, interferon‐γ; Tm, melting temperature;
<italic>TNF‐α</italic>
, tumour necrosis factor alpha;
<italic>ZO‐1</italic>
, Zonula occludens‐1.</p>
</fn>
</table-wrap-foot>
<permissions>
<copyright-holder>John Wiley & Sons, Ltd</copyright-holder>
<license>
<license-p>This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.</license-p>
</license>
</permissions>
</table-wrap>
</sec>
<sec id="jpn13129-sec-0007">
<label>2.5</label>
<title>Bacterial quantification by real‐time PCR</title>
<p>Intestinal digesta samples were collected after sacrifice. Total bacteria DNA was extracted using a QIAamp DNA stool mini kit (Qiagen) following manufacturer's instructions. DNA concentration and quality were checked using NanoDrop ND‐2000 spectrophotometer system (Fisher Scientific) prior to the samples being adjusted to a concentration of 10 ng/µl.
<italic>Enterococcus</italic>
,
<italic>E. coli</italic>
,
<italic>Lactobacillus</italic>
,
<italic>Clostridium</italic>
,
<italic>Bifidobacterium</italic>
and enterotoxins quantifications were conducted using real‐time PCR, according to the methods described in Wang, Zijlstra, and Ganzle (
<xref rid="jpn13129-bib-0037" ref-type="ref">2017</xref>
). Results were normalized total bacteria expression and relative fold changes calculated by the 2
<sup>−ΔΔCT</sup>
method. PCR primers are listed in Table
<xref rid="jpn13129-tbl-0003" ref-type="table">3</xref>
.</p>
<table-wrap id="jpn13129-tbl-0003" xml:lang="en" orientation="portrait" position="float">
<label>Table 3</label>
<caption>
<p>Primers used to amplify bacteria and enterotoxins in digesta samples</p>
</caption>
<table frame="hsides" rules="groups">
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<thead valign="top">
<tr style="border-bottom:solid 1px #000000">
<th align="left" valign="top" rowspan="1" colspan="1">Target gene</th>
<th align="left" valign="top" rowspan="1" colspan="1">Orientation</th>
<th align="left" valign="top" rowspan="1" colspan="1">Sequence (5′–3′)</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<italic>T</italic>
<sub>m</sub>
(°C)</th>
<th align="left" valign="top" rowspan="1" colspan="1">Product size (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>Total bacteria</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">CGGTCCAGACTCCTACGGG</td>
<td align="char" char="." rowspan="2" colspan="1">63</td>
<td align="char" char="." rowspan="2" colspan="1">200</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">TTACCGCGGCTGCTGGCAC</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>Enterococcus</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">CCCTTATTGTTAGTTGCCATCATT</td>
<td align="char" char="." rowspan="2" colspan="1">63</td>
<td align="char" char="." rowspan="2" colspan="1">144</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">ACTCGTTGTACTTCCCATTGT</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>Escherichia coli</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">CCGATACGCTGCCAATCAGT</td>
<td align="char" char="." rowspan="2" colspan="1">65</td>
<td align="char" char="." rowspan="2" colspan="1">884</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">ACGCAGACCGTAGGCCAGAT</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>Lactobacillus</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">AGCAGTAGGGAATCTTCCA</td>
<td align="char" char="." rowspan="2" colspan="1">59</td>
<td align="char" char="." rowspan="2" colspan="1">341</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">CACCGCTACACATGGAG</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>Clostridium</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">AATGACGGTACCTGACTAA</td>
<td align="char" char="." rowspan="2" colspan="1">63</td>
<td align="char" char="." rowspan="2" colspan="1">439</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">CTTTGAGTTTCATTCTTGCGAA</td>
</tr>
<tr>
<td align="left" rowspan="2" colspan="1">
<italic>Bifidobacterium</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">CGCGTCCGGTGTGAAAG</td>
<td align="char" char="." rowspan="2" colspan="1">51</td>
<td align="char" char="." rowspan="2" colspan="1">121</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">CTTCCCGATATCTACACATTCCA</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Heat‐labile</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">CCGTGCTGACTCTAGACCCCCA</td>
<td align="char" char="." rowspan="2" colspan="1">68</td>
<td align="char" char="." rowspan="2" colspan="1">480</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Enterotoxin</italic>
</td>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">CCTGCTAATCTGTAACCATCCTCTGC</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Heat‐stable</italic>
</td>
<td align="left" rowspan="1" colspan="1">Forward</td>
<td align="left" rowspan="1" colspan="1">TGCCTATGCATCTACACAAT</td>
<td align="char" char="." rowspan="2" colspan="1">63</td>
<td align="char" char="." rowspan="2" colspan="1">110</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Enterotoxin b</italic>
</td>
<td align="left" rowspan="1" colspan="1">Reverse</td>
<td align="left" rowspan="1" colspan="1">CTCCAGCAGTACCATCTCTA</td>
</tr>
</tbody>
</table>
<table-wrap-foot id="jpn13129-ntgp-0004">
<fn id="jpn13129-note-0007">
<p>Abbreviation:
<italic>T</italic>
<sub>m</sub>
, melting temperature.</p>
</fn>
</table-wrap-foot>
<permissions>
<copyright-holder>John Wiley & Sons, Ltd</copyright-holder>
<license>
<license-p>This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.</license-p>
</license>
</permissions>
</table-wrap>
</sec>
<sec id="jpn13129-sec-0008">
<label>2.6</label>
<title>Statistical analysis</title>
<p>Results were expressed as mean ± 
<italic>SEM</italic>
. Statistical differences were determined using one‐way ANOVA with
<sc>spss</sc>
22.0 software (SPSS). Duncan differences were determined to compare differences among the groups. Values were considered significantly different at
<italic>p</italic>
 < 0.05, while 0.05 < 
<italic>p</italic>
 < 0.10 was used to indicate a tendency towards significance.</p>
</sec>
</sec>
<sec sec-type="results" id="jpn13129-sec-0009">
<label>3</label>
<title>RESULTS</title>
<sec id="jpn13129-sec-0010">
<label>3.1</label>
<title>Growth performance and diarrhoea rates</title>
<p>Early weaned piglet growth during the 14‐day experimental period appears in Table
<xref rid="jpn13129-tbl-0004" ref-type="table">4</xref>
. ADG, ADFI and F:G were similar for all dietary treatments. EWPS fed antibiotic‐containing diets had lower (
<italic>p</italic>
 < 0.05) diarrhoea rates than controls. There were no diarrhoea rate differences between antibiotic‐treated and IgY‐fed EWPs.</p>
<table-wrap id="jpn13129-tbl-0004" xml:lang="en" orientation="portrait" position="float">
<label>Table 4</label>
<caption>
<p>Effects of antibiotics or IgY on early weaned piglet growth</p>
</caption>
<table frame="hsides" rules="groups">
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<thead valign="top">
<tr style="border-bottom:solid 1px #000000">
<th align="left" valign="top" rowspan="1" colspan="1">Item</th>
<th align="left" valign="top" rowspan="1" colspan="1">Control</th>
<th align="left" valign="top" rowspan="1" colspan="1">Antibiotics</th>
<th align="left" valign="top" rowspan="1" colspan="1">IgY</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<italic>p</italic>
‐Values</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">Initial weight/kg</td>
<td align="char" char="±" rowspan="1" colspan="1">7.38 ± 0.73</td>
<td align="char" char="±" rowspan="1" colspan="1">7.36 ± 0.28</td>
<td align="char" char="±" rowspan="1" colspan="1">7.37 ± 0.44</td>
<td align="char" char="." rowspan="1" colspan="1">0.999</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Final weight/kg</td>
<td align="char" char="±" rowspan="1" colspan="1">8.35 ± 0.75</td>
<td align="char" char="±" rowspan="1" colspan="1">8.38 ± 0.25</td>
<td align="char" char="±" rowspan="1" colspan="1">8.58 ± 0.28</td>
<td align="char" char="." rowspan="1" colspan="1">0.938</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">ADG (g/day)</td>
<td align="char" char="±" rowspan="1" colspan="1">69.34 ± 9.47</td>
<td align="char" char="±" rowspan="1" colspan="1">73.04 ± 6.94</td>
<td align="char" char="±" rowspan="1" colspan="1">86.66 ± 33.87</td>
<td align="char" char="." rowspan="1" colspan="1">0.958</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">ADFI (g/day)</td>
<td align="char" char="±" rowspan="1" colspan="1">197.28 ± 36.52</td>
<td align="char" char="±" rowspan="1" colspan="1">210.39 ± 5.23</td>
<td align="char" char="±" rowspan="1" colspan="1">171.33 ± 18.25</td>
<td align="char" char="." rowspan="1" colspan="1">0.252</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">F:G</td>
<td align="char" char="±" rowspan="1" colspan="1">2.82 ± 0.26</td>
<td align="char" char="±" rowspan="1" colspan="1">2.93 ± 0.3</td>
<td align="char" char="±" rowspan="1" colspan="1">2.43 ± 0.58</td>
<td align="char" char="." rowspan="1" colspan="1">0.674</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Diarrhoea ratio (%)</td>
<td align="char" char="±" rowspan="1" colspan="1">3.7 ± 0.53
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.51 ± 0.57
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">3.15 ± 0.84
<sup>ab</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.020</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Diarrhoea index</td>
<td align="char" char="±" rowspan="1" colspan="1">0.079 ± 0.01
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.032 ± 0.014
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.07 ± 0.02
<sup>ab</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.049</td>
</tr>
</tbody>
</table>
<table-wrap-foot id="jpn13129-ntgp-0005">
<title>Note</title>
<fn id="jpn13129-note-0008">
<p>Values are expressed as mean ± 
<italic>SEM</italic>
,
<italic>n</italic>
 = 3.</p>
</fn>
<fn id="jpn13129-note-0009">
<p>Abbreviations: ADG, average daily gain; ADFI, average daily feed intake; F:G, feed/gain.</p>
</fn>
<fn id="jpn13129-note-0010">
<p>Means within each row, values not labelled with the same superscript letters are significantly different at
<italic>p</italic>
 < 0.05 or show a tendency towards differing at
<italic>p</italic>
 < 0.10.</p>
</fn>
</table-wrap-foot>
<permissions>
<copyright-holder>John Wiley & Sons, Ltd</copyright-holder>
<license>
<license-p>This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.</license-p>
</license>
</permissions>
</table-wrap>
</sec>
<sec id="jpn13129-sec-0011">
<label>3.2</label>
<title>Serum biochemical indexes</title>
<p>Serum biochemical analysis showed that EWPs fed an IgY‐containing diet had lower (
<italic>p</italic>
 < 0.05) CHOL and LDL than did antibiotic‐treated EWPs. There were no differences in serum TP, ALT, AST, BUN, GLU, TG, HDL, DAO, C
<sub>4</sub>
, IgM or NH
<sub>3</sub>
among the three treatment groups (Table
<xref rid="jpn13129-tbl-0005" ref-type="table">5</xref>
).</p>
<table-wrap id="jpn13129-tbl-0005" xml:lang="en" orientation="portrait" position="float">
<label>Table 5</label>
<caption>
<p>EWP serum biochemical profiles</p>
</caption>
<table frame="hsides" rules="groups">
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<thead valign="top">
<tr style="border-bottom:solid 1px #000000">
<th align="left" valign="top" rowspan="1" colspan="1">Item</th>
<th align="left" valign="top" rowspan="1" colspan="1">Control</th>
<th align="left" valign="top" rowspan="1" colspan="1">Antibiotics</th>
<th align="left" valign="top" rowspan="1" colspan="1">IgY</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<italic>p</italic>
‐Values</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">TP (g/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">49.01 ± 1.25</td>
<td align="char" char="±" rowspan="1" colspan="1">50.17 ± 0.63</td>
<td align="char" char="±" rowspan="1" colspan="1">52.00 ± 1.27</td>
<td align="char" char="." rowspan="1" colspan="1">0.187</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">ALT (U/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">41.41 ± 4.91</td>
<td align="char" char="±" rowspan="1" colspan="1">36.31 ± 1.83</td>
<td align="char" char="±" rowspan="1" colspan="1">35.41 ± 3.47</td>
<td align="char" char="." rowspan="1" colspan="1">0.467</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">AST (U/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">52 ± 4.71</td>
<td align="char" char="±" rowspan="1" colspan="1">48.5 ± 4.42</td>
<td align="char" char="±" rowspan="1" colspan="1">50.2 ± 4.88</td>
<td align="char" char="." rowspan="1" colspan="1">0.867</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">BUN (mmol/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">3.99 ± 0.37</td>
<td align="char" char="±" rowspan="1" colspan="1">4.36 ± 0.19</td>
<td align="char" char="±" rowspan="1" colspan="1">4.11 ± 0.35</td>
<td align="char" char="." rowspan="1" colspan="1">0.703</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">GLU (mmol/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">6.71 ± 0.47</td>
<td align="char" char="±" rowspan="1" colspan="1">6.7 ± 0.40</td>
<td align="char" char="±" rowspan="1" colspan="1">5.41 ± 0.55</td>
<td align="char" char="." rowspan="1" colspan="1">0.116</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">TG (mmol/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">0.53 ± 0.04</td>
<td align="char" char="±" rowspan="1" colspan="1">0.56 ± 0.05</td>
<td align="char" char="±" rowspan="1" colspan="1">0.54 ± 0.04</td>
<td align="char" char="." rowspan="1" colspan="1">0.858</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">CHOL (mmol/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">1.93 ± 0.12
<sup>ab</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">2.28 ± 0.16
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.76 ± 0.12
<sup>b</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.039</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">HDL (mmol/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">0.85 ± 0.09</td>
<td align="char" char="±" rowspan="1" colspan="1">0.99 ± 0.07</td>
<td align="char" char="±" rowspan="1" colspan="1">0.73 ± 0.07</td>
<td align="char" char="." rowspan="1" colspan="1">0.108</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">LDL (mmol/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">1.02 ± 0.06
<sup>ab</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.23 ± 0.10
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.93 ± 0.07
<sup>b</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.036</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">DAO (mmol/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">1.43 ± 0.24</td>
<td align="char" char="±" rowspan="1" colspan="1">1.34 ± 0.16</td>
<td align="char" char="±" rowspan="1" colspan="1">1.1 ± 0.09</td>
<td align="char" char="." rowspan="1" colspan="1">0.663</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">C
<sub>4</sub>
(g/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">0.03 ± 0.001</td>
<td align="char" char="±" rowspan="1" colspan="1">0.03 ± 0.004</td>
<td align="char" char="±" rowspan="1" colspan="1">0.03 ± 0.002</td>
<td align="char" char="." rowspan="1" colspan="1">0.605</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">IgM (g/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">0.56 ± 0.04</td>
<td align="char" char="±" rowspan="1" colspan="1">0.53 ± 0.06</td>
<td align="char" char="±" rowspan="1" colspan="1">0.57 ± 0.06</td>
<td align="char" char="." rowspan="1" colspan="1">0.854</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">NH
<sub>3 </sub>
(µmol/L)</td>
<td align="char" char="±" rowspan="1" colspan="1">306 ± 22.82</td>
<td align="char" char="±" rowspan="1" colspan="1">301.83 ± 15.99</td>
<td align="char" char="±" rowspan="1" colspan="1">261.56 ± 10.37</td>
<td align="char" char="." rowspan="1" colspan="1">0.156</td>
</tr>
</tbody>
</table>
<table-wrap-foot id="jpn13129-ntgp-0006">
<title>Note</title>
<fn id="jpn13129-note-0011">
<p>Values are expressed as mean ± 
<italic>SEM</italic>
,
<italic>n</italic>
 = 7.</p>
</fn>
<fn id="jpn13129-note-0012">
<p>Abbreviations: ALT, alanine transaminase; AST, aspartate aminotransferase; BUN, blood urea nitrogen; C4, Complement C4; CHOL, cholesterol; DAO, diamine oxidase; GLU, glucose; HDL, high‐density lipoprotein; IgM, immunoglobulin M; LDL, low‐density lipoprotein; NH3, ammonia; TG, triglycerides; TP, total protein.</p>
</fn>
<fn id="jpn13129-note-0013">
<p>Means within each row, values not labelled with the same superscript letters are significantly different at
<italic>p</italic>
 < 0.05 or show a tendency towards differing at
<italic>p</italic>
 < 0.10.</p>
</fn>
</table-wrap-foot>
<permissions>
<copyright-holder>John Wiley & Sons, Ltd</copyright-holder>
<license>
<license-p>This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.</license-p>
</license>
</permissions>
</table-wrap>
</sec>
<sec id="jpn13129-sec-0012">
<label>3.3</label>
<title>Gene expression of pro‐inflammatory cytokine and tight junction protein in jejunal mucosa</title>
<p>
<italic>IL‐1β</italic>
gene expression decreased (
<italic>p</italic>
 < 0.1) in the groups receiving antibiotics compared to the control group and the IgY group. There were no significant differences in the mRNA expression of pro‐inflammatory cytokines (
<italic>IL‐6</italic>
,
<italic>IFN‐r</italic>
and
<italic>TNF‐α</italic>
). Tight junction proteins (
<italic>ZO‐1</italic>
,
<italic>Claudin‐1</italic>
and
<italic>Occludin‐1</italic>
) were observed in all treatment groups (Table
<xref rid="jpn13129-tbl-0006" ref-type="table">6</xref>
).</p>
<table-wrap id="jpn13129-tbl-0006" xml:lang="en" orientation="portrait" position="float">
<label>Table 6</label>
<caption>
<p>Gene expression in jejunal mucosa of inflammatory profiles and tight junction proteins</p>
</caption>
<table frame="hsides" rules="groups">
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<thead valign="top">
<tr style="border-bottom:solid 1px #000000">
<th align="left" valign="top" rowspan="1" colspan="1">Item</th>
<th align="left" valign="top" rowspan="1" colspan="1">Control</th>
<th align="left" valign="top" rowspan="1" colspan="1">Antibiotics</th>
<th align="left" valign="top" rowspan="1" colspan="1">IgY</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<italic>p</italic>
‐Values</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>IL‐1β</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.04 ± 0.10</td>
<td align="char" char="±" rowspan="1" colspan="1">0.59 ± 0.15</td>
<td align="char" char="±" rowspan="1" colspan="1">0.81 ± 0.13</td>
<td align="char" char="." rowspan="1" colspan="1">0.071</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>IL‐6</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.06 ± 0.13</td>
<td align="char" char="±" rowspan="1" colspan="1">0.69 ± 0.12</td>
<td align="char" char="±" rowspan="1" colspan="1">1.01 ± 0.26</td>
<td align="char" char="." rowspan="1" colspan="1">0.340</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>IFN‐r</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.09 ± 0.21</td>
<td align="char" char="±" rowspan="1" colspan="1">1.44 ± 0.41</td>
<td align="char" char="±" rowspan="1" colspan="1">1.32 ± 0.28</td>
<td align="char" char="." rowspan="1" colspan="1">0.803</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>TNF‐α</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.06 ± 0.10</td>
<td align="char" char="±" rowspan="1" colspan="1">0.98 ± 0.24</td>
<td align="char" char="±" rowspan="1" colspan="1">0.88 ± 0.17</td>
<td align="char" char="." rowspan="1" colspan="1">0.624</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Z0‐1</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.07 ± 0.15</td>
<td align="char" char="±" rowspan="1" colspan="1">1.01 ± 0.07</td>
<td align="char" char="±" rowspan="1" colspan="1">1.16 ± 0.09</td>
<td align="char" char="." rowspan="1" colspan="1">0.595</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Claudin‐1</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.20 ± 0.26</td>
<td align="char" char="±" rowspan="1" colspan="1">1.26 ± 0.14</td>
<td align="char" char="±" rowspan="1" colspan="1">1.38 ± 0.23</td>
<td align="char" char="." rowspan="1" colspan="1">0.828</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Occludin‐1</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.09 ± 0.18</td>
<td align="char" char="±" rowspan="1" colspan="1">1.04 ± 0.19</td>
<td align="char" char="±" rowspan="1" colspan="1">1.05 ± 0.15</td>
<td align="char" char="." rowspan="1" colspan="1">0.984</td>
</tr>
</tbody>
</table>
<table-wrap-foot id="jpn13129-ntgp-0007">
<title>Note</title>
<fn id="jpn13129-note-0014">
<p>Values are expressed as mean ± 
<italic>SEM</italic>
,
<italic>n</italic>
 = 7.</p>
</fn>
<fn id="jpn13129-note-0015">
<p>Abbreviations:
<italic>IL‐1β</italic>
, interleukin 1β;
<italic>IL‐6</italic>
, interleukin 6;
<italic>INF‐r</italic>
, interferon‐γ;
<italic>TNF‐α</italic>
, tumour necrosis factor alpha;
<italic>ZO‐1</italic>
, Zonula occludens‐1.</p>
</fn>
</table-wrap-foot>
<permissions>
<copyright-holder>John Wiley & Sons, Ltd</copyright-holder>
<license>
<license-p>This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.</license-p>
</license>
</permissions>
</table-wrap>
</sec>
<sec id="jpn13129-sec-0013">
<label>3.4</label>
<title>Intestinal bacterial population changes</title>
<p>In‐feed antibiotics significantly decreased (
<italic>p</italic>
 < 0.05)
<italic>E. coli</italic>
and
<italic>Lactobacillus</italic>
populations as well as heat‐stable enterotoxin b (STb) expression in ileal contents compared to the control group (Table
<xref rid="jpn13129-tbl-0007" ref-type="table">7</xref>
).
<italic>E. coli</italic>
population significantly (
<italic>p</italic>
 < 0.05) reduced in IgY‐fed EWP ileal contents compared to the control group.
<italic>Enterococcus</italic>
,
<italic> Lactobacillus</italic>
,
<italic>Clostridium</italic>
,
<italic>Bifidobacterium</italic>
populations as well as enterotoxin expressions were unaffected by IgY treatment. Dietary antibiotics significantly decreased (
<italic>p</italic>
 < 0.05)
<italic>E. coli</italic>
and
<italic>Lactobacillus</italic>
in caecal digesta as well as STb expression levels compared to the control group (
<italic>p</italic>
 < 0.05). Greater (
<italic>p</italic>
 < 0.05)
<italic>Enterococcus</italic>
populations and lower (
<italic>p</italic>
 < 0.05) STb expression levels were observed in EWPs fed IgY compared to the control diet (
<italic>p</italic>
 < 0.05).
<italic>Lactobacillus</italic>
expression levels in colonic digesta significantly decreased (
<italic>p</italic>
 < 0.05) in EWPs fed diets containing antibiotics compared to the control group. No significant differences in bacterial populations in IgY group colonic contents were measured compared to the control group.</p>
<table-wrap id="jpn13129-tbl-0007" xml:lang="en" orientation="portrait" position="float">
<label>Table 7</label>
<caption>
<p>Changes in early weaned piglet intestinal bacterial populations</p>
</caption>
<table frame="hsides" rules="groups">
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<col style="border-right:solid 1px #000000" span="1"></col>
<thead valign="top">
<tr style="border-bottom:solid 1px #000000">
<th align="left" valign="top" rowspan="1" colspan="1">Item</th>
<th align="left" valign="top" rowspan="1" colspan="1">Control</th>
<th align="left" valign="top" rowspan="1" colspan="1">Antibiotics</th>
<th align="left" valign="top" rowspan="1" colspan="1">IgY</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<italic>p</italic>
‐Values</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" colspan="5" rowspan="1">Ileum</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Enterococcus</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.17 ± 0.23</td>
<td align="char" char="±" rowspan="1" colspan="1">0.89 ± 0.34</td>
<td align="char" char="±" rowspan="1" colspan="1">1.78 ± 0.53</td>
<td align="char" char="." rowspan="1" colspan="1">0.293</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Escherichia coli</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.20 ± 0.30
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.12 ± 0.05
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.25 ± 0.12
<sup>b</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.018</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Lactobacillus</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.06 ± 0.15
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.50 ± 0.28
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.99 ± 0.15
<sup>a</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.040</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Clostridium</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.03 ± 0.08</td>
<td align="char" char="±" rowspan="1" colspan="1">0.92 ± 0.33</td>
<td align="char" char="±" rowspan="1" colspan="1">1.10 ± 0.31</td>
<td align="char" char="." rowspan="1" colspan="1">0.904</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Bifidobacterium</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.01 ± 0.13</td>
<td align="char" char="±" rowspan="1" colspan="1">1.05 ± 0.44</td>
<td align="char" char="±" rowspan="1" colspan="1">0.98 ± 0.17</td>
<td align="char" char="." rowspan="1" colspan="1">0.948</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Heat‐labile enterotoxin</td>
<td align="char" char="±" rowspan="1" colspan="1">1.27 ± 0.27</td>
<td align="char" char="±" rowspan="1" colspan="1">0.74 ± 0.40</td>
<td align="char" char="±" rowspan="1" colspan="1">1.75 ± 0.63</td>
<td align="char" char="." rowspan="1" colspan="1">0.203</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Heat‐stable enterotoxin b</td>
<td align="char" char="±" rowspan="1" colspan="1">1.17 ± 0.26
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.25 ± 0.18
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.73 ± 0.24
<sup>ab</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.039</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">Caecum</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Enterococcus</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.11 ± 0.20
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.86 ± 0.20
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">2.01 ± 0.44
<sup>a</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.041</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Escherichia coli</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.11 ± 0.22
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.08 ± 0.03
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">4.22 ± 1.57
<sup>a</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.005</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Lactobacillus</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.14 ± 0.22
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.31 ± 0.14
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.75 ± 0.38
<sup>a</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.002</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Clostridium</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.05 ± 0.13</td>
<td align="char" char="±" rowspan="1" colspan="1">0.84 ± 0.20</td>
<td align="char" char="±" rowspan="1" colspan="1">0.75 ± 0.11</td>
<td align="char" char="." rowspan="1" colspan="1">0.340</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Bifidobacterium</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.04 ± 0.01</td>
<td align="char" char="±" rowspan="1" colspan="1">0.86 ± 0.14</td>
<td align="char" char="±" rowspan="1" colspan="1">0.88 ± 0.15</td>
<td align="char" char="." rowspan="1" colspan="1">0.569</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Heat‐labile enterotoxin</td>
<td align="char" char="±" rowspan="1" colspan="1">1.42 ± 0.60</td>
<td align="char" char="±" rowspan="1" colspan="1">6.84 ± 2.38</td>
<td align="char" char="±" rowspan="1" colspan="1">6.34 ± 2.33</td>
<td align="char" char="." rowspan="1" colspan="1">0.355</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Heat‐stable enterotoxin b</td>
<td align="char" char="±" rowspan="1" colspan="1">1.32 ± 0.47
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.39 ± 0.12
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.43 ± 0.17
<sup>b</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.063</td>
</tr>
<tr>
<td align="left" colspan="5" rowspan="1">Colon</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Enterococcus</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.11 ± 0.0.13</td>
<td align="char" char="±" rowspan="1" colspan="1">1.27 ± 0.51</td>
<td align="char" char="±" rowspan="1" colspan="1">1.04 ± 0.11</td>
<td align="char" char="." rowspan="1" colspan="1">0.581</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Escherichia coli</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.22 ± 0.36</td>
<td align="char" char="±" rowspan="1" colspan="1">0.66 ± 0.35</td>
<td align="char" char="±" rowspan="1" colspan="1">1.95 ± 0.91</td>
<td align="char" char="." rowspan="1" colspan="1">0.195</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Lactobacillus</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.45 ± 0.48
<sup>a</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">0.23 ± 0.11
<sup>b</sup>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.36 ± 0.42
<sup>ab</sup>
</td>
<td align="char" char="." rowspan="1" colspan="1">0.028</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Clostridium</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.11 ± 0.16</td>
<td align="char" char="±" rowspan="1" colspan="1">1.36 ± 0.25</td>
<td align="char" char="±" rowspan="1" colspan="1">1.06 ± 0.15</td>
<td align="char" char="." rowspan="1" colspan="1">0.506</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">
<italic>Bifidobacterium</italic>
</td>
<td align="char" char="±" rowspan="1" colspan="1">1.13 ± 0.18</td>
<td align="char" char="±" rowspan="1" colspan="1">1.40 ± 0.22</td>
<td align="char" char="±" rowspan="1" colspan="1">1.01 ± 0.17</td>
<td align="char" char="." rowspan="1" colspan="1">0.358</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Heat‐labile enterotoxin</td>
<td align="char" char="±" rowspan="1" colspan="1">1.35 ± 0.46</td>
<td align="char" char="±" rowspan="1" colspan="1">3.80 ± 1.41</td>
<td align="char" char="±" rowspan="1" colspan="1">5.30 ± 1.77</td>
<td align="char" char="." rowspan="1" colspan="1">0.344</td>
</tr>
<tr>
<td align="left" style="padding-left:10%" rowspan="1" colspan="1">Heat‐stable enterotoxin b</td>
<td align="char" char="±" rowspan="1" colspan="1">1.14 ± 0.30</td>
<td align="char" char="±" rowspan="1" colspan="1">1.53 ± 0.94</td>
<td align="char" char="±" rowspan="1" colspan="1">1.70 ± 0.70</td>
<td align="char" char="." rowspan="1" colspan="1">0.926</td>
</tr>
</tbody>
</table>
<table-wrap-foot id="jpn13129-ntgp-0008">
<title>Note</title>
<fn id="jpn13129-note-0016">
<p>Values are expressed as mean ± 
<italic>SEM</italic>
,
<italic>n</italic>
 = 7.</p>
</fn>
<fn id="jpn13129-note-0017">
<p>Means within each row, values not labelled with the same superscript letters are significantly different at
<italic>p</italic>
 < 0.05 or show a tendency towards differing at
<italic>p</italic>
 < 0.10.</p>
</fn>
</table-wrap-foot>
<permissions>
<copyright-holder>John Wiley & Sons, Ltd</copyright-holder>
<license>
<license-p>This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.</license-p>
</license>
</permissions>
</table-wrap>
</sec>
</sec>
<sec sec-type="discussion" id="jpn13129-sec-0014">
<label>4</label>
<title>DISCUSSION</title>
<p>Enterotoxigenic
<italic>E. coli</italic>
is a major cause of diarrhoea and death in neonatal and EWPs (Wu et al.,
<xref rid="jpn13129-bib-0039" ref-type="ref">2012</xref>
).
<italic>E. coli</italic>
can adhere to the intestinal epithelial cells and elaborate enterotoxins (LT, STa or STb). This induces diarrhoea and intestinal inflammation (Heo et al.,
<xref rid="jpn13129-bib-0014" ref-type="ref">2013</xref>
; Wang et al.,
<xref rid="jpn13129-bib-0037" ref-type="ref">2017</xref>
). In the experiments described here, dietary supplementation of antibiotics or
<italic>E. coli</italic>
K88‐specific IgY had no effect on ADG or ADFI compared to the control group. Heo et al. (
<xref rid="jpn13129-bib-0015" ref-type="ref">2015</xref>
) reported that egg antibodies did not significantly affect growth performance in 21‐day‐old EWPs in the first phase (14‐day period and unchallenged) of the investigation.</p>
<p>It has been reported that pro‐inflammatory cytokines, such as
<italic>TNF‐α</italic>
,
<italic>IFN‐r</italic>
,
<italic>IL‐6</italic>
and
<italic>IL‐1β</italic>
, play a crucial role in the modulating inflammatory response (Al‐Sadi, Boivin, & Ma,
<xref rid="jpn13129-bib-0001" ref-type="ref">2009</xref>
) and also participate in intestinal barrier integrity regulation (Hu, Xiao, Luan, & Song,
<xref rid="jpn13129-bib-0018" ref-type="ref">2013</xref>
; Wang et al.,
<xref rid="jpn13129-bib-0038" ref-type="ref">2016</xref>
). The present study analysed gene expressions of pro‐inflammatory cytokines and tight junction proteins in the EWP intestines. No significant differences were observed. This demonstrates that adding antibiotics or IgY to diets results in no differences in intestinal inflammatory responses or intestinal barrier integrity.</p>
<p>Digestive system microflora play important roles in maintaining intestinal health and function (Dowarah, Verma, & Agarwal,
<xref rid="jpn13129-bib-0012" ref-type="ref">2017</xref>
). A previous study on intestinal microbiota of weaned piglets has shown that after weaning,
<italic>E. coli</italic>
concentrations increased while the number of
<italic>Lactobacillus</italic>
decreased (Konstantinov et al.,
<xref rid="jpn13129-bib-0022" ref-type="ref">2006</xref>
). As we know,
<italic>E. coli</italic>
is one of the major sources of intestinal pathogens, and a few strains can induce serious illness, including diarrhoea (Hu et al.,
<xref rid="jpn13129-bib-0019" ref-type="ref">2014</xref>
). The improvement of the immunoglobulins is required to regulate and enhance immune function, which provides health benefits, diminished weaning stress and improved health status and performance of weaning pigs. This study detected significantly decreased
<italic>E. coli</italic>
in ileal digesta in IgY‐fed EWPs and antibiotic‐fed EWPs compared to controls. This suggests that IgY has the similar effect to antibiotic against
<italic>E. coli</italic>
. Antibiotic feed reduced
<italic>E. coli</italic>
populations in the caecum which is consistent with Wu et al. (
<xref rid="jpn13129-bib-0039" ref-type="ref">2012</xref>
), who reported that antibiotics reduced
<italic>E. coli</italic>
populations in the caecum compared to control EWPs. Dietary IgY supplements increased
<italic>Lactobacillus</italic>
population in the ileum and caecum compared with the antibiotic group and significantly decreased enterotoxin STb in caecum digesta compared to the control group. These results show that the inclusion of antibiotic in the diet reduced the proliferation of both harmful coliform bacteria and beneficial
<italic>Lactobacillus</italic>
in the pig's gut. Antibiotics seriously affect the activity and composition of the gut microflora. It is reported that most cases of antibiotic‐associated diarrhoea (AAD) may be due to direct toxics effects of antibiotics on the intestine, altered digestive function secondary to reduced concentrations of gut bacteria or overgrowth of pathogenic micro‐organisms (Beaugerie & Petit,
<xref rid="jpn13129-bib-0003" ref-type="ref">2004</xref>
). Additionally, it has been reported that an increment of
<italic>Lactobacillus</italic>
results in competitively exclude potentially pathogenic species from colonizing the intestine (Collier et al.,
<xref rid="jpn13129-bib-0009" ref-type="ref">2003</xref>
). In our study,
<italic>Clostridium</italic>
and
<italic>Bifidobacterium</italic>
are not affected by IgY supplementation.</p>
<p>In healthy intestinal tracts,
<italic>Lactobacillus</italic>
dominates (Dowarah et al.,
<xref rid="jpn13129-bib-0012" ref-type="ref">2017</xref>
).
<italic>Lactobacillus</italic>
is considered to produce lactate from sugars as the only or major end product with some minor products such as acetate, formate or ethanol (Tsukahara & Ushida,
<xref rid="jpn13129-bib-0035" ref-type="ref">2002</xref>
). Previous studies demonstrated
<italic>Lactobacillus</italic>
potential to increase beneficial bacteria and inhibit pathogenic bacteria (Hossain, Begum, & Kim,
<xref rid="jpn13129-bib-0017" ref-type="ref">2015</xref>
; Qi et al.,
<xref rid="jpn13129-bib-0029" ref-type="ref">2011</xref>
).
<italic>Lactobacillus</italic>
produced lactic acid, hydrogen peroxide and lactoferrin which may exhibit antagonistic activity against
<italic>E. coli</italic>
(Li, Ni, et al.,
<xref rid="jpn13129-bib-0024" ref-type="ref">2015</xref>
). IgY supplementation significantly decreased cholesterol and low‐density lipoprotein concentrations and confirms this positive effect of IgY. Jeon, Kang, Kim, Hwangbo, and Park (
<xref rid="jpn13129-bib-0020" ref-type="ref">2016</xref>
) reported findings consistent with this report that IgY significantly decreases total cholesterol compared to the control group. The decreased cholesterol concentration could be attributed to assimilation (or uptake) by
<italic>Lactobacillus</italic>
(Buck & Gilliland,
<xref rid="jpn13129-bib-0004" ref-type="ref">1994</xref>
) or to coprecipitate of cholesterol with deconjugated bile salts (Jin, Ho, Abdullah, & Jalaludin,
<xref rid="jpn13129-bib-0021" ref-type="ref">1998</xref>
). Chen, Wang, Yan, and Huang (
<xref rid="jpn13129-bib-0007" ref-type="ref">2013</xref>
) reported probiotics reduced serum cholesterol and inhibit hydroxyl‐methyl‐glutaryl coenzyme‐A, which is involved in cholesterol synthesis. Thus, the decreased cholesterol concentration could be attributed to the reduced synthesis of cholesterol. Low‐density lipoprotein (LDL) is also referred to as “bad” cholesterol, because it constitutes a major risk factor for cardiovascular disease (Toth et al.,
<xref rid="jpn13129-bib-0034" ref-type="ref">2013</xref>
).</p>
<p>In order to prevent or treat enteric infections, IgY must resist degradation and reach the small intestine without activity loss (Hong et al.,
<xref rid="jpn13129-bib-0016" ref-type="ref">2004</xref>
). Several strategies to protect IgY from hydrolysis have been developed including liposomes (Chang, Lee, Chen, & Tu,
<xref rid="jpn13129-bib-0006" ref-type="ref">2002</xref>
), polymeric microspheres (Torche et al.,
<xref rid="jpn13129-bib-0033" ref-type="ref">2006</xref>
) and multiple emulsifications (Cho et al.,
<xref rid="jpn13129-bib-0008" ref-type="ref">2005</xref>
). Further investigations are indispensable to determine how robust of IgY application can be. Optimizing IgY dose effectiveness via a suitable formulation to withstand the gastric environment is warranted, and we hope explore any synergistic effects of combining IgY with other therapeutic strategies, such as probiotics or plant extracts in order to improve performance.</p>
</sec>
<sec sec-type="conclusions" id="jpn13129-sec-0015">
<label>5</label>
<title>CONCLUSION</title>
<p>In this work, dietary supplementation with IgY has the potential to suppress the growth of bacterial pathogens, thus promoting and maintaining a healthy EWP intestinal environments. These findings suggest that IgY may be used as an alternative to the use of antibiotics in diets for weaned EWPs.</p>
</sec>
</body>
<back>
<ack id="jpn13129-sec-0016">
<title>ACKNOWLEDGEMENTS</title>
<p>This work was supported by Key Programs of Frontier Scientific Research of the Chinese Academy of Sciences (QYZDY‐SSW‐SMC008), Natural Science Foundation of Hunan Province (2017JJ1020) and Young Elite Scientists Sponsorship Program by CAST (YESS20160086).</p>
</ack>
<ref-list content-type="cited-references" id="jpn13129-bibl-0001">
<title>REFERENCES</title>
<ref id="jpn13129-bib-0001">
<mixed-citation publication-type="journal" id="jpn13129-cit-0001">
<string-name>
<surname>Al‐Sadi</surname>
,
<given-names>R.</given-names>
</string-name>
,
<string-name>
<surname>Boivin</surname>
,
<given-names>M.</given-names>
</string-name>
, &
<string-name>
<surname>Ma</surname>
,
<given-names>T.</given-names>
</string-name>
(
<year>2009</year>
).
<article-title>Mechanism of cytokine modulation of epithelial tight junction barrier</article-title>
.
<source xml:lang="en">Frontiers in Bioscience</source>
,
<volume>14</volume>
,
<fpage>2765</fpage>
<lpage>2778</lpage>
.
<pub-id pub-id-type="doi">10.2741/3413</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0002">
<mixed-citation publication-type="journal" id="jpn13129-cit-0002">
<string-name>
<surname>Alustiza</surname>
,
<given-names>F.</given-names>
</string-name>
,
<string-name>
<surname>Bellingeri</surname>
,
<given-names>R.</given-names>
</string-name>
,
<string-name>
<surname>Picco</surname>
,
<given-names>N.</given-names>
</string-name>
,
<string-name>
<surname>Motta</surname>
,
<given-names>C.</given-names>
</string-name>
,
<string-name>
<surname>Grosso</surname>
,
<given-names>M. C.</given-names>
</string-name>
,
<string-name>
<surname>Barbero</surname>
,
<given-names>C. A.</given-names>
</string-name>
, …
<string-name>
<surname>Vivas</surname>
,
<given-names>A.</given-names>
</string-name>
(
<year>2016</year>
).
<article-title>IgY against enterotoxigenic
<italic>Escherichia coli</italic>
administered byhydrogel‐carbon nanotubes composites to prevent neonatal diarrhoea in experimentally challenged piglets</article-title>
.
<source xml:lang="en">Vaccine</source>
,
<volume>34</volume>
,
<fpage>3291</fpage>
<lpage>3297</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.vaccine.2016.05.004</pub-id>
<pub-id pub-id-type="pmid">27166825</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0003">
<mixed-citation publication-type="journal" id="jpn13129-cit-0003">
<string-name>
<surname>Beaugerie</surname>
,
<given-names>L.</given-names>
</string-name>
, &
<string-name>
<surname>Petit</surname>
,
<given-names>J. C.</given-names>
</string-name>
(
<year>2004</year>
).
<article-title>Antibiotic‐associated diarrhoea</article-title>
.
<source xml:lang="en">Best Practice & Research Clinical Gastroenterology</source>
,
<volume>18</volume>
,
<fpage>337</fpage>
<lpage>352</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.bpg.2003.10.002</pub-id>
<pub-id pub-id-type="pmid">15123074</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0004">
<mixed-citation publication-type="journal" id="jpn13129-cit-0004">
<string-name>
<surname>Buck</surname>
,
<given-names>L. M.</given-names>
</string-name>
, &
<string-name>
<surname>Gilliland</surname>
,
<given-names>S. E.</given-names>
</string-name>
(
<year>1994</year>
).
<article-title>Comparisons of freshly isolated strains of
<italic>Lactobacillus acidophilus</italic>
of human intestinal origin for ability to assimilate cholesterol during growth</article-title>
.
<source xml:lang="en">Journal of Dairy Science</source>
,
<volume>77</volume>
,
<fpage>2925</fpage>
<lpage>2933</lpage>
.
<pub-id pub-id-type="doi">10.3168/jds.S0022-0302(94)77233-7</pub-id>
<pub-id pub-id-type="pmid">7836579</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0005">
<mixed-citation publication-type="journal" id="jpn13129-cit-0005">
<string-name>
<surname>Campbell</surname>
,
<given-names>J. M.</given-names>
</string-name>
,
<string-name>
<surname>Crenshaw</surname>
,
<given-names>J. D.</given-names>
</string-name>
, &
<string-name>
<surname>Polo</surname>
,
<given-names>J.</given-names>
</string-name>
(
<year>2013</year>
).
<article-title>The biological stress of early weaned piglets</article-title>
.
<source xml:lang="en">Journal of Animal Science and Biotechnology</source>
,
<volume>4</volume>
,
<fpage>19</fpage>
<pub-id pub-id-type="doi">10.1186/2049-1891-4-19</pub-id>
<pub-id pub-id-type="pmid">23631414</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0006">
<mixed-citation publication-type="journal" id="jpn13129-cit-0006">
<string-name>
<surname>Chang</surname>
,
<given-names>H. M.</given-names>
</string-name>
,
<string-name>
<surname>Lee</surname>
,
<given-names>Y. C.</given-names>
</string-name>
,
<string-name>
<surname>Chen</surname>
,
<given-names>C. C.</given-names>
</string-name>
, &
<string-name>
<surname>Tu</surname>
,
<given-names>Y. Y.</given-names>
</string-name>
(
<year>2002</year>
).
<article-title>Microencapsulation protects immunoglobulin in yolk (IgY) specific against
<italic>Helicobacter pylori</italic>
urease</article-title>
.
<source xml:lang="en">Journal of Food Science</source>
,
<volume>67</volume>
,
<fpage>15</fpage>
<lpage>20</lpage>
.
<pub-id pub-id-type="doi">10.1111/j.1365-2621.2002.tb11351.x</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0007">
<mixed-citation publication-type="journal" id="jpn13129-cit-0007">
<string-name>
<surname>Chen</surname>
,
<given-names>W.</given-names>
</string-name>
,
<string-name>
<surname>Wang</surname>
,
<given-names>J. P.</given-names>
</string-name>
,
<string-name>
<surname>Yan</surname>
,
<given-names>L.</given-names>
</string-name>
, &
<string-name>
<surname>Huang</surname>
,
<given-names>Y. Q.</given-names>
</string-name>
(
<year>2013</year>
).
<article-title>Evaluation of probiotics in diets with different nutrient densities on growth performance, blood characteristics, relative organ weight and breast meat characteristics in broilers</article-title>
.
<source xml:lang="en">British Poultry Science</source>
,
<volume>54</volume>
,
<fpage>635</fpage>
<lpage>641</lpage>
.
<pub-id pub-id-type="doi">10.1080/00071668.2013.825369</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0008">
<mixed-citation publication-type="journal" id="jpn13129-cit-0008">
<string-name>
<surname>Cho</surname>
,
<given-names>Y. H.</given-names>
</string-name>
,
<string-name>
<surname>Lee</surname>
,
<given-names>J. J.</given-names>
</string-name>
,
<string-name>
<surname>Park</surname>
,
<given-names>I. B.</given-names>
</string-name>
,
<string-name>
<surname>Huh</surname>
,
<given-names>C. S.</given-names>
</string-name>
,
<string-name>
<surname>Baek</surname>
,
<given-names>Y. J.</given-names>
</string-name>
, &
<string-name>
<surname>Park</surname>
,
<given-names>J.</given-names>
</string-name>
(
<year>2005</year>
).
<article-title>Protective effect of microencapsulation consisting of multiple emulsification and heat gelation processes on immunoglobulin in yolk</article-title>
.
<source xml:lang="en">Journal of Food Science</source>
,
<volume>70</volume>
,
<fpage>E148</fpage>
<lpage>E151</lpage>
.
<pub-id pub-id-type="doi">10.1111/j.1365-2621.2005.tb07088.x</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0009">
<mixed-citation publication-type="journal" id="jpn13129-cit-0009">
<string-name>
<surname>Collier</surname>
,
<given-names>C. T.</given-names>
</string-name>
,
<string-name>
<surname>Smiricky‐Tjardes</surname>
,
<given-names>M. R.</given-names>
</string-name>
,
<string-name>
<surname>Albin</surname>
,
<given-names>D. M.</given-names>
</string-name>
,
<string-name>
<surname>Wubben</surname>
,
<given-names>J. E.</given-names>
</string-name>
,
<string-name>
<surname>Gabert</surname>
,
<given-names>V. M.</given-names>
</string-name>
,
<string-name>
<surname>Deplancke</surname>
,
<given-names>B.</given-names>
</string-name>
, …
<string-name>
<surname>Gaskins</surname>
,
<given-names>H. R.</given-names>
</string-name>
(
<year>2003</year>
).
<article-title>Molecular ecological analysis of porcine ileal microbiota responses to antimicrobial growth promoters</article-title>
.
<source xml:lang="en">Journal of Animal Science</source>
,
<volume>81</volume>
,
<fpage>3035</fpage>
<lpage>3045</lpage>
.
<pub-id pub-id-type="doi">10.2527/2003.81123035x</pub-id>
<pub-id pub-id-type="pmid">14677859</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0010">
<mixed-citation publication-type="journal" id="jpn13129-cit-0010">
<string-name>
<surname>Cromwell</surname>
,
<given-names>G. L.</given-names>
</string-name>
(
<year>2002</year>
).
<article-title>Why and how antibiotics are used in swine production</article-title>
.
<source xml:lang="en">Animal Biotechnology</source>
,
<volume>13</volume>
,
<fpage>7</fpage>
<lpage>27</lpage>
.
<pub-id pub-id-type="doi">10.1081/ABIO-120005767</pub-id>
<pub-id pub-id-type="pmid">12212945</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0011">
<mixed-citation publication-type="journal" id="jpn13129-cit-0011">
<string-name>
<surname>Diraviyam</surname>
,
<given-names>T.</given-names>
</string-name>
,
<string-name>
<surname>Zhao</surname>
,
<given-names>B.</given-names>
</string-name>
,
<string-name>
<surname>Wang</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Schade</surname>
,
<given-names>R.</given-names>
</string-name>
,
<string-name>
<surname>Michael</surname>
,
<given-names>A.</given-names>
</string-name>
, &
<string-name>
<surname>Zhang</surname>
,
<given-names>X.</given-names>
</string-name>
(
<year>2014</year>
).
<article-title>Effect of chicken egg yolk antibodies (IgY) against diarrhea in domesticated animals: A systematic review and meta‐analysis</article-title>
.
<source xml:lang="en">PLoS ONE</source>
,
<volume>9</volume>
,
<fpage>e97716</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0097716</pub-id>
<pub-id pub-id-type="pmid">24846286</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0012">
<mixed-citation publication-type="journal" id="jpn13129-cit-0012">
<string-name>
<surname>Dowarah</surname>
,
<given-names>R.</given-names>
</string-name>
,
<string-name>
<surname>Verma</surname>
,
<given-names>A. K.</given-names>
</string-name>
, &
<string-name>
<surname>Agarwal</surname>
,
<given-names>N.</given-names>
</string-name>
(
<year>2017</year>
).
<article-title>The use of
<italic>Lactobacillus</italic>
as an alternative of antibiotic growth promoters in pigs: A review</article-title>
.
<source xml:lang="en">Animal Nutrition</source>
,
<volume>3</volume>
,
<fpage>1</fpage>
<lpage>6</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.aninu.2016.11.002</pub-id>
<pub-id pub-id-type="pmid">29767055</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0013">
<mixed-citation publication-type="journal" id="jpn13129-cit-0013">
<string-name>
<surname>Guarner</surname>
,
<given-names>F.</given-names>
</string-name>
, &
<string-name>
<surname>Malagelada</surname>
,
<given-names>J. R.</given-names>
</string-name>
(
<year>2003</year>
).
<article-title>Gut flora in health and disease</article-title>
.
<source xml:lang="en">Lancet</source>
,
<volume>361</volume>
,
<fpage>512</fpage>
<lpage>519</lpage>
.
<pub-id pub-id-type="doi">10.1016/S0140-6736(03)12489-0</pub-id>
<pub-id pub-id-type="pmid">12583961</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0014">
<mixed-citation publication-type="journal" id="jpn13129-cit-0014">
<string-name>
<surname>Heo</surname>
,
<given-names>J. M.</given-names>
</string-name>
,
<string-name>
<surname>Opapeju</surname>
,
<given-names>F. O.</given-names>
</string-name>
,
<string-name>
<surname>Pluske</surname>
,
<given-names>J. R.</given-names>
</string-name>
,
<string-name>
<surname>Kim</surname>
,
<given-names>J. C.</given-names>
</string-name>
,
<string-name>
<surname>Hampson</surname>
,
<given-names>D. J.</given-names>
</string-name>
, &
<string-name>
<surname>Nyachoti</surname>
,
<given-names>C. M.</given-names>
</string-name>
(
<year>2013</year>
).
<article-title>Gastrointestinal health and function in weaned pigs: A review of feeding strategies to control post‐weaning diarrhoea without using in‐feed antimicrobial compounds</article-title>
.
<source xml:lang="en">Journal of Animal Physiology and Animal Nutrition</source>
,
<volume>97</volume>
,
<fpage>207</fpage>
<lpage>237</lpage>
.
<pub-id pub-id-type="doi">10.1111/j.1439-0396.2012.01284.x</pub-id>
<pub-id pub-id-type="pmid">22416941</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0015">
<mixed-citation publication-type="journal" id="jpn13129-cit-0015">
<string-name>
<surname>Heo</surname>
,
<given-names>J. M.</given-names>
</string-name>
,
<string-name>
<surname>Woyengo</surname>
,
<given-names>T. A.</given-names>
</string-name>
,
<string-name>
<surname>Kahindi</surname>
,
<given-names>R. K.</given-names>
</string-name>
,
<string-name>
<surname>Kiarie</surname>
,
<given-names>E.</given-names>
</string-name>
,
<string-name>
<surname>Maiti</surname>
,
<given-names>P. K.</given-names>
</string-name>
, &
<string-name>
<surname>Nyachoti</surname>
,
<given-names>C. M.</given-names>
</string-name>
(
<year>2015</year>
).
<article-title>Ileal amino acid digestibility in egg from hyperimmunized‐hens fed to weaned pigs and piglet response to diets contain egg products</article-title>
.
<source xml:lang="en">Animal Feed Science and Technology</source>
,
<volume>204</volume>
,
<fpage>52</fpage>
<lpage>61</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.anifeedsci.2015.03.006</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0016">
<mixed-citation publication-type="journal" id="jpn13129-cit-0016">
<string-name>
<surname>Hong</surname>
,
<given-names>J. W.</given-names>
</string-name>
,
<string-name>
<surname>Kwon</surname>
,
<given-names>O. S.</given-names>
</string-name>
,
<string-name>
<surname>Min</surname>
,
<given-names>B. J.</given-names>
</string-name>
,
<string-name>
<surname>Lee</surname>
,
<given-names>W. B.</given-names>
</string-name>
,
<string-name>
<surname>Shon</surname>
,
<given-names>K. S.</given-names>
</string-name>
,
<string-name>
<surname>Kim</surname>
,
<given-names>I. H.</given-names>
</string-name>
, &
<string-name>
<surname>Kim</surname>
,
<given-names>J. W.</given-names>
</string-name>
(
<year>2004</year>
).
<article-title>Evaluation effects of spray‐dried egg protein containing specific egg yolk antibodies as a substitute for spray‐dried plasma protein or antibiotics in weaned pigs</article-title>
.
<source xml:lang="en">Asian‐Australasian Journal of Animal Sciences</source>
,
<volume>17</volume>
,
<fpage>1139</fpage>
<lpage>1144</lpage>
.
<pub-id pub-id-type="doi">10.5713/ajas.2004.1139</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0017">
<mixed-citation publication-type="journal" id="jpn13129-cit-0017">
<string-name>
<surname>Hossain</surname>
,
<given-names>M. M.</given-names>
</string-name>
,
<string-name>
<surname>Begum</surname>
,
<given-names>M.</given-names>
</string-name>
, &
<string-name>
<surname>Kim</surname>
,
<given-names>I. H.</given-names>
</string-name>
(
<year>2015</year>
).
<article-title>Effect of
<italic>Bacillus subtilis</italic>
,
<italic>Clostridium butyricum</italic>
and
<italic>Lactobacillus acidophilus</italic>
endospores on growth performance, nutrient digestibility, meat quality, relative organ weight, microbial shedding and excreta noxious gas emission in broilers</article-title>
.
<source xml:lang="en">Veterinární Medicína</source>
,
<volume>60</volume>
,
<fpage>77</fpage>
<lpage>86</lpage>
.
<pub-id pub-id-type="doi">10.17221/7981-VETMED</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0018">
<mixed-citation publication-type="journal" id="jpn13129-cit-0018">
<string-name>
<surname>Hu</surname>
,
<given-names>C. H.</given-names>
</string-name>
,
<string-name>
<surname>Xiao</surname>
,
<given-names>K.</given-names>
</string-name>
,
<string-name>
<surname>Luan</surname>
,
<given-names>Z. S.</given-names>
</string-name>
, &
<string-name>
<surname>Song</surname>
,
<given-names>J.</given-names>
</string-name>
(
<year>2013</year>
).
<article-title>Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen‐activated protein kinases in pigs</article-title>
.
<source xml:lang="en">Journal of Animal Science</source>
,
<volume>91</volume>
,
<fpage>1094</fpage>
<lpage>1101</lpage>
.
<pub-id pub-id-type="doi">10.2527/jas.2012-5796</pub-id>
<pub-id pub-id-type="pmid">23230104</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0019">
<mixed-citation publication-type="journal" id="jpn13129-cit-0019">
<string-name>
<surname>Hu</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Dun</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
,
<given-names>S.</given-names>
</string-name>
,
<string-name>
<surname>Zhao</surname>
,
<given-names>S.</given-names>
</string-name>
,
<string-name>
<surname>Peng</surname>
,
<given-names>N.</given-names>
</string-name>
, &
<string-name>
<surname>Liang</surname>
,
<given-names>Y.</given-names>
</string-name>
(
<year>2014</year>
).
<article-title>Effects of
<italic>Bacillus subtilis</italic>
KN‐42 on growth performance, diarrhea and faecal bacterial flora of weaned piglets</article-title>
.
<source xml:lang="en">Asian Australasian Journal of Animal Sciences</source>
,
<volume>27</volume>
,
<fpage>1131</fpage>
<lpage>1140</lpage>
.
<pub-id pub-id-type="doi">10.5713/ajas.2013.13737</pub-id>
<pub-id pub-id-type="pmid">25083107</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0020">
<mixed-citation publication-type="journal" id="jpn13129-cit-0020">
<string-name>
<surname>Jeon</surname>
,
<given-names>I. S.</given-names>
</string-name>
,
<string-name>
<surname>Kang</surname>
,
<given-names>H. K.</given-names>
</string-name>
,
<string-name>
<surname>Kim</surname>
,
<given-names>C. H.</given-names>
</string-name>
,
<string-name>
<surname>Hwangbo</surname>
,
<given-names>J.</given-names>
</string-name>
, &
<string-name>
<surname>Park</surname>
,
<given-names>S. B.</given-names>
</string-name>
(
<year>2016</year>
).
<article-title>Effects of egg yolk antibody powder (IgY) supplementation on growth performance, blood component profile, intestinal microflora, and immunoglobulin G in meat ducks</article-title>
.
<source xml:lang="en">Korean Journal of Poultry Science</source>
,
<volume>43</volume>
,
<fpage>143</fpage>
<lpage>148</lpage>
.
<pub-id pub-id-type="doi">10.5536/KJPS.2016.43.3.143</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0021">
<mixed-citation publication-type="journal" id="jpn13129-cit-0021">
<string-name>
<surname>Jin</surname>
,
<given-names>L. Z.</given-names>
</string-name>
,
<string-name>
<surname>Ho</surname>
,
<given-names>Y. W.</given-names>
</string-name>
,
<string-name>
<surname>Abdullah</surname>
,
<given-names>N.</given-names>
</string-name>
, &
<string-name>
<surname>Jalaludin</surname>
,
<given-names>S.</given-names>
</string-name>
(
<year>1998</year>
).
<article-title>Growth performance, intestinal microbial populations, and serum cholesterol of broilers fed diets containing
<italic>Lactobacillus</italic>
cultures</article-title>
.
<source xml:lang="en">Poultry Science</source>
,
<volume>77</volume>
,
<fpage>1259</fpage>
<lpage>1265</lpage>
.
<pub-id pub-id-type="doi">10.1093/ps/77.9.1259</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0022">
<mixed-citation publication-type="journal" id="jpn13129-cit-0022">
<string-name>
<surname>Konstantinov</surname>
,
<given-names>S. R.</given-names>
</string-name>
,
<string-name>
<surname>Awati</surname>
,
<given-names>A. A.</given-names>
</string-name>
,
<string-name>
<surname>Williams</surname>
,
<given-names>B. A.</given-names>
</string-name>
,
<string-name>
<surname>Miller</surname>
,
<given-names>B. G.</given-names>
</string-name>
,
<string-name>
<surname>Jones</surname>
,
<given-names>P.</given-names>
</string-name>
,
<string-name>
<surname>Stokes</surname>
,
<given-names>C. R.</given-names>
</string-name>
, …
<string-name>
<surname>de Vos</surname>
,
<given-names>W. M.</given-names>
</string-name>
(
<year>2006</year>
).
<article-title>Post‐natal development of the porcine microbiota composition and activities</article-title>
.
<source xml:lang="en">Environmental Microbiology</source>
,
<volume>8</volume>
,
<fpage>1191</fpage>
<lpage>1199</lpage>
.
<pub-id pub-id-type="doi">10.1111/j.1462-2920.2006.01009.x</pub-id>
<pub-id pub-id-type="pmid">16817927</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0023">
<mixed-citation publication-type="journal" id="jpn13129-cit-0023">
<string-name>
<surname>Kuang</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Wang</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Zhang</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Song</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Zhang</surname>
,
<given-names>X.</given-names>
</string-name>
,
<string-name>
<surname>Lin</surname>
,
<given-names>Y.</given-names>
</string-name>
, …
<string-name>
<surname>Fang</surname>
,
<given-names>Z.</given-names>
</string-name>
(
<year>2015</year>
).
<article-title>Effects of dietary combinations of organic acids and medium chain fatty acids as a replacement of zinc oxide on growth, digestibility and immunity of weaned pigs</article-title>
.
<source xml:lang="en">Animal Feed Science and Technology</source>
,
<volume>208</volume>
,
<fpage>145</fpage>
<lpage>157</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.anifeedsci.2015.07.010</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0024">
<mixed-citation publication-type="journal" id="jpn13129-cit-0024">
<string-name>
<surname>Li</surname>
,
<given-names>D.</given-names>
</string-name>
,
<string-name>
<surname>Ni</surname>
,
<given-names>K.</given-names>
</string-name>
,
<string-name>
<surname>Pang</surname>
,
<given-names>H.</given-names>
</string-name>
,
<string-name>
<surname>Wang</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Cai</surname>
,
<given-names>Y.</given-names>
</string-name>
, &
<string-name>
<surname>Jin</surname>
,
<given-names>Q.</given-names>
</string-name>
(
<year>2015</year>
).
<article-title>Identification and antimicrobial activity detection of lactic acid bacteria isolated from corn stover silage</article-title>
.
<source xml:lang="en">Asian‐Australasian Journal of Animal Sciences</source>
,
<volume>28</volume>
,
<fpage>620</fpage>
<lpage>631</lpage>
.
<pub-id pub-id-type="doi">10.5713/ajas.14.0439</pub-id>
<pub-id pub-id-type="pmid">25924957</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0025">
<mixed-citation publication-type="journal" id="jpn13129-cit-0025">
<string-name>
<surname>Li</surname>
,
<given-names>X.</given-names>
</string-name>
,
<string-name>
<surname>Wang</surname>
,
<given-names>L.</given-names>
</string-name>
,
<string-name>
<surname>Zhen</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
,
<given-names>S.</given-names>
</string-name>
, &
<string-name>
<surname>Xu</surname>
,
<given-names>Y.</given-names>
</string-name>
(
<year>2015</year>
).
<article-title>Chicken egg yolk antibodies (IgY) as non‐antibiotic production enhancers for use in swine production: A review</article-title>
.
<source xml:lang="en">Journal of Animal Science and Biotechnology</source>
,
<volume>6</volume>
,
<fpage>40</fpage>
<pub-id pub-id-type="doi">10.1186/s40104-015-0038-8</pub-id>
<pub-id pub-id-type="pmid">26309735</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0026">
<mixed-citation publication-type="journal" id="jpn13129-cit-0026">
<string-name>
<surname>Muller</surname>
,
<given-names>S.</given-names>
</string-name>
,
<string-name>
<surname>Schubert</surname>
,
<given-names>A.</given-names>
</string-name>
,
<string-name>
<surname>Zajac</surname>
,
<given-names>J.</given-names>
</string-name>
,
<string-name>
<surname>Dyck</surname>
,
<given-names>T.</given-names>
</string-name>
, &
<string-name>
<surname>Oelkrug</surname>
,
<given-names>C.</given-names>
</string-name>
(
<year>2015</year>
).
<article-title>IgY antibodies in human nutrition for disease prevention</article-title>
.
<source xml:lang="en">Nutrition Journal</source>
,
<volume>14</volume>
,
<fpage>109</fpage>
<pub-id pub-id-type="doi">10.1186/s12937-015-0067-3</pub-id>
<pub-id pub-id-type="pmid">26487372</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0027">
<mixed-citation publication-type="book" id="jpn13129-cit-0027">
<collab collab-type="authors">National Research Council</collab>
(
<year>2012</year>
).
<source xml:lang="en">Nutrient requirements of swine</source>
(
<edition>11th ed.</edition>
).
<publisher-loc>Washington, DC</publisher-loc>
:
<publisher-name>National Academies Press</publisher-name>
.</mixed-citation>
</ref>
<ref id="jpn13129-bib-0028">
<mixed-citation publication-type="journal" id="jpn13129-cit-0028">
<string-name>
<surname>Pluske</surname>
,
<given-names>J. R.</given-names>
</string-name>
,
<string-name>
<surname>Hampson</surname>
,
<given-names>D. J.</given-names>
</string-name>
, &
<string-name>
<surname>Williams</surname>
,
<given-names>I. H.</given-names>
</string-name>
(
<year>1997</year>
).
<article-title>Factors influencing the structure and function of the small intestine in the weaned pig: A review</article-title>
.
<source xml:lang="en">Livestock Production Science</source>
,
<volume>51</volume>
,
<fpage>215</fpage>
<lpage>236</lpage>
.
<pub-id pub-id-type="doi">10.1016/S0301-6226(97)00057-2</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0029">
<mixed-citation publication-type="journal" id="jpn13129-cit-0029">
<string-name>
<surname>Qi</surname>
,
<given-names>H. W.</given-names>
</string-name>
,
<string-name>
<surname>Xiang</surname>
,
<given-names>Z. T.</given-names>
</string-name>
,
<string-name>
<surname>Han</surname>
,
<given-names>G. Q.</given-names>
</string-name>
,
<string-name>
<surname>Yu</surname>
,
<given-names>B.</given-names>
</string-name>
,
<string-name>
<surname>Huang</surname>
,
<given-names>Z. Q.</given-names>
</string-name>
, &
<string-name>
<surname>Chen</surname>
,
<given-names>D. W.</given-names>
</string-name>
(
<year>2011</year>
).
<article-title>Effects of different dietary protein sources on cecal microflora in rats</article-title>
.
<source xml:lang="en">African Journal of Biotechnology</source>
,
<volume>10</volume>
,
<fpage>3704</fpage>
<lpage>3708</lpage>
.
<pub-id pub-id-type="doi">10.5897/AJB10.2677</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0030">
<mixed-citation publication-type="journal" id="jpn13129-cit-0030">
<string-name>
<surname>Qiao</surname>
,
<given-names>J.</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
,
<given-names>H.</given-names>
</string-name>
,
<string-name>
<surname>Wang</surname>
,
<given-names>Z.</given-names>
</string-name>
, &
<string-name>
<surname>Wang</surname>
,
<given-names>W.</given-names>
</string-name>
(
<year>2015</year>
).
<article-title>Effects of
<italic>Lactobacillus acidophilus</italic>
dietary supplementation on the performance, intestinal barrier function, rectal microflora and serum immune function in weaned piglets challenged with
<italic>Escherichia coli</italic>
lipopolysaccharide</article-title>
.
<source xml:lang="en">Antonie Van Leeuwenhoek</source>
,
<volume>107</volume>
,
<fpage>883</fpage>
<lpage>891</lpage>
.
<pub-id pub-id-type="doi">10.1007/s10482-015-0380-z</pub-id>
<pub-id pub-id-type="pmid">25577203</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0031">
<mixed-citation publication-type="journal" id="jpn13129-cit-0031">
<string-name>
<surname>Sui</surname>
,
<given-names>J.</given-names>
</string-name>
,
<string-name>
<surname>Cao</surname>
,
<given-names>L.</given-names>
</string-name>
, &
<string-name>
<surname>Lin</surname>
,
<given-names>H.</given-names>
</string-name>
(
<year>2011</year>
).
<article-title>Antibacterial activity of egg yolk antibody (Ig Y)against
<italic>Listeria</italic>
monocytogenes and preliminary evaluation of its potential for food preservation</article-title>
.
<source xml:lang="en">Journal of the Science of Food and Agriculture</source>
,
<volume>91</volume>
,
<fpage>1946</fpage>
<lpage>1950</lpage>
.
<pub-id pub-id-type="doi">10.1002/jsfa.4381</pub-id>
<pub-id pub-id-type="pmid">21495036</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0032">
<mixed-citation publication-type="journal" id="jpn13129-cit-0032">
<string-name>
<surname>Thu</surname>
,
<given-names>H. M.</given-names>
</string-name>
,
<string-name>
<surname>Myat</surname>
,
<given-names>T. W.</given-names>
</string-name>
,
<string-name>
<surname>Win</surname>
,
<given-names>M. M.</given-names>
</string-name>
,
<string-name>
<surname>Thant</surname>
,
<given-names>K. Z.</given-names>
</string-name>
,
<string-name>
<surname>Rahman</surname>
,
<given-names>S.</given-names>
</string-name>
,
<string-name>
<surname>Umeda</surname>
,
<given-names>K.</given-names>
</string-name>
, …
<string-name>
<surname>Choi</surname>
,
<given-names>H. J.</given-names>
</string-name>
(
<year>2017</year>
).
<article-title>Chicken egg yolk antibodies (IgY) for prophylaxis and treatment of rotavirus diarrhea in human and animal neonates: A concise review</article-title>
.
<source xml:lang="en">Korean Journal for Food Science of Animal Resources</source>
,
<volume>37</volume>
,
<fpage>1</fpage>
<lpage>9</lpage>
.
<pub-id pub-id-type="doi">10.5851/kosfa.2017.37.1.1</pub-id>
<pub-id pub-id-type="pmid">28316465</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0033">
<mixed-citation publication-type="journal" id="jpn13129-cit-0033">
<string-name>
<surname>Torche</surname>
,
<given-names>A. M.</given-names>
</string-name>
,
<string-name>
<surname>Le Dimna</surname>
,
<given-names>M.</given-names>
</string-name>
,
<string-name>
<surname>Le Corre</surname>
,
<given-names>P.</given-names>
</string-name>
,
<string-name>
<surname>Mesplede</surname>
,
<given-names>A.</given-names>
</string-name>
,
<string-name>
<surname>Le Gal</surname>
,
<given-names>S.</given-names>
</string-name>
,
<string-name>
<surname>Cariolet</surname>
,
<given-names>R.</given-names>
</string-name>
, &
<string-name>
<surname>Le Potier</surname>
,
<given-names>M. F.</given-names>
</string-name>
(
<year>2006</year>
).
<article-title>Immune responses after local administration of IgY loaded‐PLGA microspheres in gut‐associated lymphoid tissue in pigs</article-title>
.
<source xml:lang="en">Veterinary Immunology and Immunopathology</source>
,
<volume>109</volume>
,
<fpage>209</fpage>
<lpage>217</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.vetimm.2005.08.016</pub-id>
<pub-id pub-id-type="pmid">16219363</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0034">
<mixed-citation publication-type="journal" id="jpn13129-cit-0034">
<string-name>
<surname>Toth</surname>
,
<given-names>P. P.</given-names>
</string-name>
,
<string-name>
<surname>Barter</surname>
,
<given-names>P. J.</given-names>
</string-name>
,
<string-name>
<surname>Rosenson</surname>
,
<given-names>R. S.</given-names>
</string-name>
,
<string-name>
<surname>Boden</surname>
,
<given-names>W. E.</given-names>
</string-name>
,
<string-name>
<surname>Chapman</surname>
,
<given-names>M. J.</given-names>
</string-name>
,
<string-name>
<surname>Cuchel</surname>
,
<given-names>M.</given-names>
</string-name>
, …
<string-name>
<surname>Rader</surname>
,
<given-names>D. J.</given-names>
</string-name>
(
<year>2013</year>
).
<article-title>High‐density lipoproteins: A consensus statement from the National Lipid Association</article-title>
.
<source xml:lang="en">Journal of Clinical Lipidology</source>
,
<volume>7</volume>
,
<fpage>484</fpage>
<lpage>525</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.jacl.2013.08.001</pub-id>
<pub-id pub-id-type="pmid">24079290</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0035">
<mixed-citation publication-type="journal" id="jpn13129-cit-0035">
<string-name>
<surname>Tsukahara</surname>
,
<given-names>T.</given-names>
</string-name>
, &
<string-name>
<surname>Ushida</surname>
,
<given-names>K.</given-names>
</string-name>
(
<year>2002</year>
).
<article-title>Succinate accumulation in pig large intestine during antibiotic‐associated diarrhea and the constitution of succinate‐producing flora</article-title>
.
<source xml:lang="en">Journal of General and Applied Microbiology</source>
,
<volume>48</volume>
,
<fpage>143</fpage>
<lpage>154</lpage>
.
<pub-id pub-id-type="doi">10.2323/jgam.48.143</pub-id>
<pub-id pub-id-type="pmid">12469297</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0036">
<mixed-citation publication-type="journal" id="jpn13129-cit-0036">
<string-name>
<surname>Wan</surname>
,
<given-names>J.</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Chen</surname>
,
<given-names>D.</given-names>
</string-name>
,
<string-name>
<surname>Yu</surname>
,
<given-names>B.</given-names>
</string-name>
,
<string-name>
<surname>Chen</surname>
,
<given-names>G.</given-names>
</string-name>
,
<string-name>
<surname>Zheng</surname>
,
<given-names>P.</given-names>
</string-name>
, …
<string-name>
<surname>He</surname>
,
<given-names>J.</given-names>
</string-name>
(
<year>2016</year>
).
<article-title>Recombinant plectasin elicits similar improvements in the performance and intestinal mucosa growth and activity in weaned pigs as an antibiotic</article-title>
.
<source xml:lang="en">Animal Feed Science and Technology</source>
,
<volume>211</volume>
,
<fpage>216</fpage>
<lpage>226</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.anifeedsci.2015.12.003</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0037">
<mixed-citation publication-type="journal" id="jpn13129-cit-0037">
<string-name>
<surname>Wang</surname>
,
<given-names>W.</given-names>
</string-name>
,
<string-name>
<surname>Zijlstra</surname>
,
<given-names>R. T.</given-names>
</string-name>
, &
<string-name>
<surname>Ganzle</surname>
,
<given-names>M. G.</given-names>
</string-name>
(
<year>2017</year>
).
<article-title>Identification and quantification of virulence factors of enterotoxigenic
<italic>Escherichia coli</italic>
by high‐resolution melting curve quantitative PCR</article-title>
.
<source xml:lang="en">BMC Microbiology</source>
,
<volume>17</volume>
,
<fpage>114</fpage>
<pub-id pub-id-type="doi">10.1186/s12866-017-1023-5</pub-id>
<pub-id pub-id-type="pmid">28506262</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0038">
<mixed-citation publication-type="journal" id="jpn13129-cit-0038">
<string-name>
<surname>Wang</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Kuang</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Zhang</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Song</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Zhang</surname>
,
<given-names>X.</given-names>
</string-name>
,
<string-name>
<surname>Lin</surname>
,
<given-names>Y.</given-names>
</string-name>
, …
<string-name>
<surname>Fang</surname>
,
<given-names>Z.</given-names>
</string-name>
(
<year>2016</year>
).
<article-title>Rearing conditions affected responses of weaned pigs to organic acids showing a positive effect on digestibility, microflora and immunity</article-title>
.
<source xml:lang="en">Animal Science Journal</source>
,
<volume>87</volume>
,
<fpage>1267</fpage>
<lpage>1280</lpage>
.
<pub-id pub-id-type="doi">10.1111/asj.12544</pub-id>
<pub-id pub-id-type="pmid">26800117</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0039">
<mixed-citation publication-type="journal" id="jpn13129-cit-0039">
<string-name>
<surname>Wu</surname>
,
<given-names>S.</given-names>
</string-name>
,
<string-name>
<surname>Zhang</surname>
,
<given-names>F.</given-names>
</string-name>
,
<string-name>
<surname>Huang</surname>
,
<given-names>Z.</given-names>
</string-name>
,
<string-name>
<surname>Liu</surname>
,
<given-names>H.</given-names>
</string-name>
,
<string-name>
<surname>Xie</surname>
,
<given-names>C.</given-names>
</string-name>
,
<string-name>
<surname>Zhang</surname>
,
<given-names>J.</given-names>
</string-name>
, …
<string-name>
<surname>Qiao</surname>
,
<given-names>S.</given-names>
</string-name>
(
<year>2012</year>
).
<article-title>Effects of the antimicrobial peptide cecropin AD on performance and intestinal health in weaned piglets challenged with
<italic>Escherichia coli</italic>
</article-title>
.
<source xml:lang="en">Peptides</source>
,
<volume>35</volume>
,
<fpage>225</fpage>
<lpage>230</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.peptides.2012.03.030</pub-id>
<pub-id pub-id-type="pmid">22490448</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0040">
<mixed-citation publication-type="journal" id="jpn13129-cit-0040">
<string-name>
<surname>Xiong</surname>
,
<given-names>X.</given-names>
</string-name>
,
<string-name>
<surname>Yang</surname>
,
<given-names>H.</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
,
<given-names>B.</given-names>
</string-name>
,
<string-name>
<surname>Liu</surname>
,
<given-names>G.</given-names>
</string-name>
,
<string-name>
<surname>Huang</surname>
,
<given-names>R.</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
,
<given-names>F.</given-names>
</string-name>
, …
<string-name>
<surname>Deng</surname>
,
<given-names>D.</given-names>
</string-name>
(
<year>2015</year>
).
<article-title>Dietary supplementation with yeast product improves intestinal function, and serum and ileal amino acid contents in weaned piglets</article-title>
.
<source xml:lang="en">Livestock Science</source>
,
<volume>171</volume>
,
<fpage>20</fpage>
<lpage>27</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.livsci.2014.10.012</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0041">
<mixed-citation publication-type="journal" id="jpn13129-cit-0041">
<string-name>
<surname>Xu</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
,
<given-names>X.</given-names>
</string-name>
,
<string-name>
<surname>Jin</surname>
,
<given-names>L.</given-names>
</string-name>
,
<string-name>
<surname>Zhen</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Lu</surname>
,
<given-names>Y.</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
,
<given-names>S.</given-names>
</string-name>
, …
<string-name>
<surname>Wang</surname>
,
<given-names>L.</given-names>
</string-name>
(
<year>2011</year>
).
<article-title>Application of chicken egg yolk immunoglobulins in the control of terrestrial and aquatic animal diseases: A review</article-title>
.
<source xml:lang="en">Biotechnology Advances</source>
,
<volume>29</volume>
,
<fpage>860</fpage>
<lpage>868</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.biotechadv.2011.07.003</pub-id>
<pub-id pub-id-type="pmid">21787857</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0042">
<mixed-citation publication-type="journal" id="jpn13129-cit-0042">
<string-name>
<surname>Yang</surname>
,
<given-names>H.</given-names>
</string-name>
,
<string-name>
<surname>Wang</surname>
,
<given-names>X.</given-names>
</string-name>
,
<string-name>
<surname>Xiong</surname>
,
<given-names>X.</given-names>
</string-name>
, &
<string-name>
<surname>Yin</surname>
,
<given-names>Y.</given-names>
</string-name>
(
<year>2016</year>
).
<article-title>Energy metabolism in intestinal epithelial cells during maturation along the crypt‐villus axis</article-title>
.
<source xml:lang="en">Scientific Reports</source>
,
<volume>6</volume>
,
<fpage>31917</fpage>
<pub-id pub-id-type="doi">10.1038/s41598-018-31068-3</pub-id>
<pub-id pub-id-type="pmid">27558220</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0043">
<mixed-citation publication-type="journal" id="jpn13129-cit-0043">
<string-name>
<surname>Yen</surname>
,
<given-names>H. C.</given-names>
</string-name>
,
<string-name>
<surname>Lai</surname>
,
<given-names>W. K.</given-names>
</string-name>
,
<string-name>
<surname>Lin</surname>
,
<given-names>C. S.</given-names>
</string-name>
, &
<string-name>
<surname>Chiang</surname>
,
<given-names>S. H.</given-names>
</string-name>
(
<year>2015</year>
).
<article-title>Medium‐chain triglyceride as an alternative of in‐feedcolistin sulfate to improve growth performance and intestinal microbial environment in newly weaned pigs</article-title>
.
<source xml:lang="en">Animal Science Journal</source>
,
<volume>86</volume>
,
<fpage>99</fpage>
<lpage>104</lpage>
.
<pub-id pub-id-type="doi">10.1111/asj.12248</pub-id>
<pub-id pub-id-type="pmid">25039368</pub-id>
</mixed-citation>
</ref>
<ref id="jpn13129-bib-0044">
<mixed-citation publication-type="journal" id="jpn13129-cit-0044">
<string-name>
<surname>Yin</surname>
,
<given-names>F. G.</given-names>
</string-name>
,
<string-name>
<surname>Liu</surname>
,
<given-names>Y. L.</given-names>
</string-name>
,
<string-name>
<surname>Yin</surname>
,
<given-names>Y. L.</given-names>
</string-name>
,
<string-name>
<surname>Kong</surname>
,
<given-names>X. F.</given-names>
</string-name>
,
<string-name>
<surname>Huang</surname>
,
<given-names>R. L.</given-names>
</string-name>
,
<string-name>
<surname>Li</surname>
,
<given-names>T. J.</given-names>
</string-name>
, …
<string-name>
<surname>Hou</surname>
,
<given-names>Y.</given-names>
</string-name>
(
<year>2009</year>
).
<article-title>Dietary supplementation with
<italic>Astragalus</italic>
polysaccharide enhances ileal digestibilities and serum concentrations of amino acids in early weaned piglets</article-title>
.
<source xml:lang="en">Amino Acids</source>
,
<volume>37</volume>
,
<fpage>263</fpage>
<lpage>270</lpage>
.
<pub-id pub-id-type="doi">10.1007/s00726-008-0142-6</pub-id>
<pub-id pub-id-type="pmid">18622730</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Sante/explor/StressCovidV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000702  | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000702  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Sante
   |area=    StressCovidV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.33.
Data generation: Wed May 6 16:44:09 2020. Site generation: Sun Mar 28 08:26:57 2021