Serveur d'exploration sur le renard

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 000050 ( Pmc/Corpus ); précédent : 0000499; suivant : 0000510 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">First molecular evidence of
<italic>Hepatozoon canis</italic>
infection in red foxes and golden jackals from Hungary</title>
<author>
<name sortKey="Farkas, R Bert" sort="Farkas, R Bert" uniqKey="Farkas R" first="R Bert" last="Farkas">R Bert Farkas</name>
<affiliation>
<nlm:aff id="I1">Department of Parasitology and Zoology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Solymosi, Norbert" sort="Solymosi, Norbert" uniqKey="Solymosi N" first="Norbert" last="Solymosi">Norbert Solymosi</name>
<affiliation>
<nlm:aff id="I2">Department of Animal Hygiene, Herd-health and Veterinary Ethology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Takacs, N Ra" sort="Takacs, N Ra" uniqKey="Takacs N" first="N Ra" last="Takács">N Ra Takács</name>
<affiliation>
<nlm:aff id="I1">Department of Parasitology and Zoology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hornyak, Akos" sort="Hornyak, Akos" uniqKey="Hornyak A" first="Ákos" last="Hornyák">Ákos Hornyák</name>
<affiliation>
<nlm:aff id="I3">Veterinary Diagnostic Directorate, National Food Chain Safety Office, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hornok, Sandor" sort="Hornok, Sandor" uniqKey="Hornok S" first="Sándor" last="Hornok">Sándor Hornok</name>
<affiliation>
<nlm:aff id="I1">Department of Parasitology and Zoology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Nachum Biala, Yaarit" sort="Nachum Biala, Yaarit" uniqKey="Nachum Biala Y" first="Yaarit" last="Nachum-Biala">Yaarit Nachum-Biala</name>
<affiliation>
<nlm:aff id="I4">School of Veterinary Medicine, Hebrew University of Jerusalem, Jerusalem, Israel</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Baneth, Gad" sort="Baneth, Gad" uniqKey="Baneth G" first="Gad" last="Baneth">Gad Baneth</name>
<affiliation>
<nlm:aff id="I4">School of Veterinary Medicine, Hebrew University of Jerusalem, Jerusalem, Israel</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">24985073</idno>
<idno type="pmc">4086283</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4086283</idno>
<idno type="RBID">PMC:4086283</idno>
<idno type="doi">10.1186/1756-3305-7-303</idno>
<date when="2014">2014</date>
<idno type="wicri:Area/Pmc/Corpus">000050</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000050</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">First molecular evidence of
<italic>Hepatozoon canis</italic>
infection in red foxes and golden jackals from Hungary</title>
<author>
<name sortKey="Farkas, R Bert" sort="Farkas, R Bert" uniqKey="Farkas R" first="R Bert" last="Farkas">R Bert Farkas</name>
<affiliation>
<nlm:aff id="I1">Department of Parasitology and Zoology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Solymosi, Norbert" sort="Solymosi, Norbert" uniqKey="Solymosi N" first="Norbert" last="Solymosi">Norbert Solymosi</name>
<affiliation>
<nlm:aff id="I2">Department of Animal Hygiene, Herd-health and Veterinary Ethology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Takacs, N Ra" sort="Takacs, N Ra" uniqKey="Takacs N" first="N Ra" last="Takács">N Ra Takács</name>
<affiliation>
<nlm:aff id="I1">Department of Parasitology and Zoology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hornyak, Akos" sort="Hornyak, Akos" uniqKey="Hornyak A" first="Ákos" last="Hornyák">Ákos Hornyák</name>
<affiliation>
<nlm:aff id="I3">Veterinary Diagnostic Directorate, National Food Chain Safety Office, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hornok, Sandor" sort="Hornok, Sandor" uniqKey="Hornok S" first="Sándor" last="Hornok">Sándor Hornok</name>
<affiliation>
<nlm:aff id="I1">Department of Parasitology and Zoology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Nachum Biala, Yaarit" sort="Nachum Biala, Yaarit" uniqKey="Nachum Biala Y" first="Yaarit" last="Nachum-Biala">Yaarit Nachum-Biala</name>
<affiliation>
<nlm:aff id="I4">School of Veterinary Medicine, Hebrew University of Jerusalem, Jerusalem, Israel</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Baneth, Gad" sort="Baneth, Gad" uniqKey="Baneth G" first="Gad" last="Baneth">Gad Baneth</name>
<affiliation>
<nlm:aff id="I4">School of Veterinary Medicine, Hebrew University of Jerusalem, Jerusalem, Israel</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Parasites & Vectors</title>
<idno type="eISSN">1756-3305</idno>
<imprint>
<date when="2014">2014</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>Recently,
<italic>Hepatozoon canis</italic>
infection has been detected among shepherd, hunting and stray dogs in the southern part of Hungary, which is considered to be free of
<italic>Rhipicephalus sanguineus</italic>
sensu lato and close to the border with Croatia. The aim of this study was to acquire information on the possibility that red foxes and/or golden jackals could play a role in the appearance and spread of
<italic>H. canis</italic>
in Hungary.</p>
</sec>
<sec>
<title>Methods</title>
<p>A conventional PCR was used to amplify a 666 bp long fragment of the
<italic>Hepatozoon</italic>
18S rRNA gene from blood samples collected from 334 foxes shot in 231 locations in 16 counties and 15 golden jackals shot in 9 locations in two southwestern counties close to Croatia. A second PCR assay was performed in some of the samples positive by the first PCR to amplify a larger segment (approximately 1500 bp) of the 18S rRNA gene of
<italic>Hepatozoon</italic>
spp. for further phylogenetic analysis.</p>
</sec>
<sec>
<title>Results</title>
<p>
<italic>Hepatozoon</italic>
infection was detected in canids shot in 30 locations and 9 counties. Altogether 26 foxes (8.0%, 95% CI: 5-11%) and 9 jackals (60%, 95% CI: 33-81%) were PCR positive.
<italic>Hepatozoon canis</italic>
sequences were obtained from 12 foxes and 7 jackals. DNA sequences from 16 animals were 99-100% similar to
<italic>H. canis</italic>
from Croatian foxes or dogs while two of the sequences were 99% similar to an Italian fox. Half (13/26) of the infected red foxes and all golden jackals were shot in the two southwestern counties.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>This is the first report on molecular evidence of
<italic>H. canis</italic>
in red foxes (
<italic>Vulpes vulpes</italic>
) and golden jackals (
<italic>Canis aureus</italic>
) from Hungary, which is considered free from the tick vector of
<italic>H. canis</italic>
,
<italic>R. sanguineus</italic>
. Although no
<italic>R. sanguineus</italic>
sensu lato had been found on infected or non-infected wild canids, the detection of authochnous canine hepatozoonosis in Hungary might imply that the range of
<italic>R. sanguineus</italic>
sensu lato has reached this country.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Smith, Tg" uniqKey="Smith T">TG Smith</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
<author>
<name sortKey="Samish, M" uniqKey="Samish M">M Samish</name>
</author>
<author>
<name sortKey="Shkap, V" uniqKey="Shkap V">V Shkap</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Giannelli, A" uniqKey="Giannelli A">A Giannelli</name>
</author>
<author>
<name sortKey="Ramos, Ra" uniqKey="Ramos R">RA Ramos</name>
</author>
<author>
<name sortKey="Di Paola, G" uniqKey="Di Paola G">G Di Paola</name>
</author>
<author>
<name sortKey="Mencke, N" uniqKey="Mencke N">N Mencke</name>
</author>
<author>
<name sortKey="Dantas Torres, F" uniqKey="Dantas Torres F">F Dantas-Torres</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
<author>
<name sortKey="Otranto, D" uniqKey="Otranto D">D Otranto</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
<author>
<name sortKey="Samish, M" uniqKey="Samish M">M Samish</name>
</author>
<author>
<name sortKey="Alekseev, E" uniqKey="Alekseev E">E Alekseev</name>
</author>
<author>
<name sortKey="Aroch, I" uniqKey="Aroch I">I Aroch</name>
</author>
<author>
<name sortKey="Shkap, V" uniqKey="Shkap V">V Shkap</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dantas Torres, F" uniqKey="Dantas Torres F">F Dantas-Torres</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Estrada Pe A, A" uniqKey="Estrada Pe A A">A Estrada-Peña</name>
</author>
<author>
<name sortKey="Jaenson, Tgt" uniqKey="Jaenson T">TGT Jaenson</name>
</author>
<author>
<name sortKey="Farkas, R" uniqKey="Farkas R">R Farkas</name>
</author>
<author>
<name sortKey="Pascucci, I" uniqKey="Pascucci I">I Pascucci</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Murata, T" uniqKey="Murata T">T Murata</name>
</author>
<author>
<name sortKey="Inoue, M" uniqKey="Inoue M">M Inoue</name>
</author>
<author>
<name sortKey="Tateyama, S" uniqKey="Tateyama S">S Tateyama</name>
</author>
<author>
<name sortKey="Taura, Y" uniqKey="Taura Y">Y Taura</name>
</author>
<author>
<name sortKey="Nakama, S" uniqKey="Nakama S">S Nakama</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Otranto, D" uniqKey="Otranto D">D Otranto</name>
</author>
<author>
<name sortKey="Dantas Torres, F" uniqKey="Dantas Torres F">F Dantas-Torres</name>
</author>
<author>
<name sortKey="Weigl, S" uniqKey="Weigl S">S Weigl</name>
</author>
<author>
<name sortKey="Latrofa, Ms" uniqKey="Latrofa M">MS Latrofa</name>
</author>
<author>
<name sortKey="Stanneck, D" uniqKey="Stanneck D">D Stanneck</name>
</author>
<author>
<name sortKey="Decaprariis, D" uniqKey="Decaprariis D">D Decaprariis</name>
</author>
<author>
<name sortKey="Capelli, G" uniqKey="Capelli G">G Capelli</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
<author>
<name sortKey="Weigler, B" uniqKey="Weigler B">B Weigler</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rioux, Ja" uniqKey="Rioux J">JA Rioux</name>
</author>
<author>
<name sortKey="Golvan, Yj" uniqKey="Golvan Y">YJ Golvan</name>
</author>
<author>
<name sortKey="Honin, R" uniqKey="Honin R">R Honin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Conceicao Silva, Fm" uniqKey="Conceicao Silva F">FM Conceicão-Silva</name>
</author>
<author>
<name sortKey="Abranches, P" uniqKey="Abranches P">P Abranches</name>
</author>
<author>
<name sortKey="Silva Pereira, Mc" uniqKey="Silva Pereira M">MC Silva-Pereira</name>
</author>
<author>
<name sortKey="Janz, Jg" uniqKey="Janz J">JG Janz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Criado Fornelio, A" uniqKey="Criado Fornelio A">A Criado-Fornelio</name>
</author>
<author>
<name sortKey="Martinez Marcos, A" uniqKey="Martinez Marcos A">A Martinez-Marcos</name>
</author>
<author>
<name sortKey="Buling Sarana, A" uniqKey="Buling Sarana A">A Buling-Sarana</name>
</author>
<author>
<name sortKey="Barba Carretero, Jc" uniqKey="Barba Carretero J">JC Barba-Carretero</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gimenez, C" uniqKey="Gimenez C">C Gimenez</name>
</author>
<author>
<name sortKey="Casado, N" uniqKey="Casado N">N Casado</name>
</author>
<author>
<name sortKey="Criado Fornelio, A" uniqKey="Criado Fornelio A">A Criado-Fornelio</name>
</author>
<author>
<name sortKey="De Muguel, Fa" uniqKey="De Muguel F">FA de Muguel</name>
</author>
<author>
<name sortKey="Dominguez Pe Afiel, G" uniqKey="Dominguez Pe Afiel G">G Dominguez-Peñafiel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dezdek, D" uniqKey="Dezdek D">D Dezdek</name>
</author>
<author>
<name sortKey="Vojta, L" uniqKey="Vojta L">L Vojta</name>
</author>
<author>
<name sortKey="Curkovi, S" uniqKey="Curkovi S">S Curković</name>
</author>
<author>
<name sortKey="Lipej, Z" uniqKey="Lipej Z">Z Lipej</name>
</author>
<author>
<name sortKey="Mihaljevi, Z" uniqKey="Mihaljevi Z">Z Mihaljević</name>
</author>
<author>
<name sortKey="Cvetni, Z" uniqKey="Cvetni Z">Z Cvetnić</name>
</author>
<author>
<name sortKey="Beck, R" uniqKey="Beck R">R Beck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gabrielli, S" uniqKey="Gabrielli S">S Gabrielli</name>
</author>
<author>
<name sortKey="Kumlien, S" uniqKey="Kumlien S">S Kumlien</name>
</author>
<author>
<name sortKey="Calderini, P" uniqKey="Calderini P">P Calderini</name>
</author>
<author>
<name sortKey="Brozzi, A" uniqKey="Brozzi A">A Brozzi</name>
</author>
<author>
<name sortKey="Iori, A" uniqKey="Iori A">A Iori</name>
</author>
<author>
<name sortKey="Cancrini, G" uniqKey="Cancrini G">G Cancrini</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Maede, Y" uniqKey="Maede Y">Y Maede</name>
</author>
<author>
<name sortKey="Ohsugi, T" uniqKey="Ohsugi T">T Ohsugi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fishman, Z" uniqKey="Fishman Z">Z Fishman</name>
</author>
<author>
<name sortKey="Gonen, L" uniqKey="Gonen L">L Gonen</name>
</author>
<author>
<name sortKey="Harrus, S" uniqKey="Harrus S">S Harrus</name>
</author>
<author>
<name sortKey="Strauss Ayali, D" uniqKey="Strauss Ayali D">D Strauss-Ayali</name>
</author>
<author>
<name sortKey="King, R" uniqKey="King R">R King</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Allen, Ke" uniqKey="Allen K">KE Allen</name>
</author>
<author>
<name sortKey="Yabsley, Mj" uniqKey="Yabsley M">MJ Yabsley</name>
</author>
<author>
<name sortKey="Johnson, Em" uniqKey="Johnson E">EM Johnson</name>
</author>
<author>
<name sortKey="Reichard, Mv" uniqKey="Reichard M">MV Reichard</name>
</author>
<author>
<name sortKey="Panciera, Rj" uniqKey="Panciera R">RJ Panciera</name>
</author>
<author>
<name sortKey="Ewing, Sa" uniqKey="Ewing S">SA Ewing</name>
</author>
<author>
<name sortKey="Little, Se" uniqKey="Little S">SE Little</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Giannitti, F" uniqKey="Giannitti F">F Giannitti</name>
</author>
<author>
<name sortKey="Diab, Ss" uniqKey="Diab S">SS Diab</name>
</author>
<author>
<name sortKey="Uzal, Fa" uniqKey="Uzal F">FA Uzal</name>
</author>
<author>
<name sortKey="Fresneda, K" uniqKey="Fresneda K">K Fresneda</name>
</author>
<author>
<name sortKey="Rossi, D" uniqKey="Rossi D">D Rossi</name>
</author>
<author>
<name sortKey="Talmi Frank, D" uniqKey="Talmi Frank D">D Talmi-Frank</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shamir, M" uniqKey="Shamir M">M Shamir</name>
</author>
<author>
<name sortKey="Yakobson, B" uniqKey="Yakobson B">B Yakobson</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
<author>
<name sortKey="King, R" uniqKey="King R">R King</name>
</author>
<author>
<name sortKey="Dar Verker, S" uniqKey="Dar Verker S">S Dar-Verker</name>
</author>
<author>
<name sortKey="Markovics, A" uniqKey="Markovics A">A Markovics</name>
</author>
<author>
<name sortKey="Aroch, L" uniqKey="Aroch L">L Aroch</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Duscher, G" uniqKey="Duscher G">G Duscher</name>
</author>
<author>
<name sortKey="Kubber Heiss, A" uniqKey="Kubber Heiss A">A Kübber-Heiss</name>
</author>
<author>
<name sortKey="Richter, B" uniqKey="Richter B">B Richter</name>
</author>
<author>
<name sortKey="Suchentrunk, F" uniqKey="Suchentrunk F">F Suchentrunk</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Heerden, J" uniqKey="Van Heerden J">J Van Heerden</name>
</author>
<author>
<name sortKey="Mills, Mg" uniqKey="Mills M">MG Mills</name>
</author>
<author>
<name sortKey="Van Vuuren, Mj" uniqKey="Van Vuuren M">MJ Van Vuuren</name>
</author>
<author>
<name sortKey="Kelly, Pj" uniqKey="Kelly P">PJ Kelly</name>
</author>
<author>
<name sortKey="Dreyer, Mj" uniqKey="Dreyer M">MJ Dreyer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Davis, Ds" uniqKey="Davis D">DS Davis</name>
</author>
<author>
<name sortKey="Robinson, Rm" uniqKey="Robinson R">RM Robinson</name>
</author>
<author>
<name sortKey="Craig, Tm" uniqKey="Craig T">TM Craig</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Starkey, La" uniqKey="Starkey L">LA Starkey</name>
</author>
<author>
<name sortKey="Panciera, Rj" uniqKey="Panciera R">RJ Panciera</name>
</author>
<author>
<name sortKey="Paras, K" uniqKey="Paras K">K Paras</name>
</author>
<author>
<name sortKey="Allen, Ke" uniqKey="Allen K">KE Allen</name>
</author>
<author>
<name sortKey="Reiskind, Mh" uniqKey="Reiskind M">MH Reiskind</name>
</author>
<author>
<name sortKey="Reichard, Mv" uniqKey="Reichard M">MV Reichard</name>
</author>
<author>
<name sortKey="Johnson, Em" uniqKey="Johnson E">EM Johnson</name>
</author>
<author>
<name sortKey="Little, Se" uniqKey="Little S">SE Little</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="East, Ml" uniqKey="East M">ML East</name>
</author>
<author>
<name sortKey="Wibbelt, G" uniqKey="Wibbelt G">G Wibbelt</name>
</author>
<author>
<name sortKey="Lieckfeldt, D" uniqKey="Lieckfeldt D">D Lieckfeldt</name>
</author>
<author>
<name sortKey="Ludwig, A" uniqKey="Ludwig A">A Ludwig</name>
</author>
<author>
<name sortKey="Goller, K" uniqKey="Goller K">K Goller</name>
</author>
<author>
<name sortKey="Wilhelm, K" uniqKey="Wilhelm K">K Wilhelm</name>
</author>
<author>
<name sortKey="Schares, G" uniqKey="Schares G">G Schares</name>
</author>
<author>
<name sortKey="Thierer, D" uniqKey="Thierer D">D Thierer</name>
</author>
<author>
<name sortKey="Hofer, H" uniqKey="Hofer H">H Hofer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mccully, Rm" uniqKey="Mccully R">RM McCully</name>
</author>
<author>
<name sortKey="Basson, Pa" uniqKey="Basson P">PA Basson</name>
</author>
<author>
<name sortKey="Bigalke, Rd" uniqKey="Bigalke R">RD Bigalke</name>
</author>
<author>
<name sortKey="De Vos, V" uniqKey="De Vos V">V de Vos</name>
</author>
<author>
<name sortKey="Young, E" uniqKey="Young E">E Young</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hornok, S" uniqKey="Hornok S">S Hornok</name>
</author>
<author>
<name sortKey="Tanczos, B" uniqKey="Tanczos B">B Tánczos</name>
</author>
<author>
<name sortKey="Fernandez De Mera, Ig" uniqKey="Fernandez De Mera I">IG Fernández De Mera</name>
</author>
<author>
<name sortKey="De La Fuente, J" uniqKey="De La Fuente J">J de la Fuente</name>
</author>
<author>
<name sortKey="Hofmann Lehmann, R" uniqKey="Hofmann Lehmann R">R Hofmann- Lehmann</name>
</author>
<author>
<name sortKey="Farkas, R" uniqKey="Farkas R">R Farkas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Inokuma, H" uniqKey="Inokuma H">H Inokuma</name>
</author>
<author>
<name sortKey="Okuda, M" uniqKey="Okuda M">M Okuda</name>
</author>
<author>
<name sortKey="Ohno, K" uniqKey="Ohno K">K Ohno</name>
</author>
<author>
<name sortKey="Shimoda, K" uniqKey="Shimoda K">K Shimoda</name>
</author>
<author>
<name sortKey="Onishi, T" uniqKey="Onishi T">T Onishi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Criado Fornelio, A" uniqKey="Criado Fornelio A">A Criado-Fornelio</name>
</author>
<author>
<name sortKey="Ruas, Jl" uniqKey="Ruas J">JL Ruas</name>
</author>
<author>
<name sortKey="Casado, N" uniqKey="Casado N">N Casado</name>
</author>
<author>
<name sortKey="Farias, Na" uniqKey="Farias N">NA Farias</name>
</author>
<author>
<name sortKey="Soares, Mp" uniqKey="Soares M">MP Soares</name>
</author>
<author>
<name sortKey="Muller, G" uniqKey="Muller G">G Müller</name>
</author>
<author>
<name sortKey="Brumt, Jg" uniqKey="Brumt J">JG Brumt</name>
</author>
<author>
<name sortKey="Berne, Me" uniqKey="Berne M">ME Berne</name>
</author>
<author>
<name sortKey="Buling Sara A, A" uniqKey="Buling Sara A A">A Buling-Saraña</name>
</author>
<author>
<name sortKey="Barba Carretero, Jc" uniqKey="Barba Carretero J">JC Barba-Carretero</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sterne, Te" uniqKey="Sterne T">TE Sterne</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fischer, S" uniqKey="Fischer S">S Fischer</name>
</author>
<author>
<name sortKey="Hartmann, K" uniqKey="Hartmann K">K Hartmann</name>
</author>
<author>
<name sortKey="Gothe, R" uniqKey="Gothe R">R Gothe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Holland, M" uniqKey="Holland M">M Holland</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Majlathova, V" uniqKey="Majlathova V">V Majláthová</name>
</author>
<author>
<name sortKey="Hurnikova, Z" uniqKey="Hurnikova Z">Z Hurníková</name>
</author>
<author>
<name sortKey="Majlath, I" uniqKey="Majlath I">I Majláth</name>
</author>
<author>
<name sortKey="Petko, B" uniqKey="Petko B">B Petko</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Karbowiak, G" uniqKey="Karbowiak G">G Karbowiak</name>
</author>
<author>
<name sortKey="Majlathova, V" uniqKey="Majlathova V">V Majláthová</name>
</author>
<author>
<name sortKey="Hapunik, J" uniqKey="Hapunik J">J Hapunik</name>
</author>
<author>
<name sortKey="Pet O, B" uniqKey="Pet O B">B Pet’ko</name>
</author>
<author>
<name sortKey="Wita, I" uniqKey="Wita I">I Wita</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vojta, L" uniqKey="Vojta L">L Vojta</name>
</author>
<author>
<name sortKey="Mrljak, Vc" uniqKey="Mrljak V">VC Mrljak</name>
</author>
<author>
<name sortKey="Urkovic, S" uniqKey="Urkovic S">S Urkovic’</name>
</author>
<author>
<name sortKey="Zivi Cnjak, T" uniqKey="Zivi Cnjak T">T Ziviˇcnjak</name>
</author>
<author>
<name sortKey="Marinculi, Ca" uniqKey="Marinculi C">CA Marinculi’</name>
</author>
<author>
<name sortKey="Beck, R" uniqKey="Beck R">R Beck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arnold, J" uniqKey="Arnold J">J Arnold</name>
</author>
<author>
<name sortKey="Humer, A" uniqKey="Humer A">A Humer</name>
</author>
<author>
<name sortKey="Heltai, A" uniqKey="Heltai A">A Heltai</name>
</author>
<author>
<name sortKey="Murariu, D" uniqKey="Murariu D">D Murariu</name>
</author>
<author>
<name sortKey="Spassov, N" uniqKey="Spassov N">N Spassov</name>
</author>
<author>
<name sortKey="Hackl Nder, K" uniqKey="Hackl Nder K">K Hackländer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Szab, L" uniqKey="Szab L">L Szabó</name>
</author>
<author>
<name sortKey="Heltai, M" uniqKey="Heltai M">M Heltai</name>
</author>
<author>
<name sortKey="Sz Cs, E" uniqKey="Sz Cs E">E Szűcs</name>
</author>
<author>
<name sortKey="Lanszki, J" uniqKey="Lanszki J">J Lanszki</name>
</author>
<author>
<name sortKey="Lehoczki, R" uniqKey="Lehoczki R">R Lehoczki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Cortes, Hc" uniqKey="Cortes H">HC Cortes</name>
</author>
<author>
<name sortKey="Eyal, O" uniqKey="Eyal O">O Eyal</name>
</author>
<author>
<name sortKey="Reis, A" uniqKey="Reis A">A Reis</name>
</author>
<author>
<name sortKey="Lopes, Ap" uniqKey="Lopes A">AP Lopes</name>
</author>
<author>
<name sortKey="Vila Vicosa, Mj" uniqKey="Vila Vicosa M">MJ Vila-Viçosa</name>
</author>
<author>
<name sortKey="Rodrigues, Pa" uniqKey="Rodrigues P">PA Rodrigues</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hornok, S" uniqKey="Hornok S">S Hornok</name>
</author>
<author>
<name sortKey="Farkas, R" uniqKey="Farkas R">R Farkas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sreter, T" uniqKey="Sreter T">T Sréter</name>
</author>
<author>
<name sortKey="Szell, Z" uniqKey="Szell Z">Z Széll</name>
</author>
<author>
<name sortKey="Varga, I" uniqKey="Varga I">I Varga</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Murata, T" uniqKey="Murata T">T Murata</name>
</author>
<author>
<name sortKey="Inoue, M" uniqKey="Inoue M">M Inoue</name>
</author>
<author>
<name sortKey="Taura, Y" uniqKey="Taura Y">Y Taura</name>
</author>
<author>
<name sortKey="Nakama, S" uniqKey="Nakama S">S Nakama</name>
</author>
<author>
<name sortKey="Abe, H" uniqKey="Abe H">H Abe</name>
</author>
<author>
<name sortKey="Fujisaki, K" uniqKey="Fujisaki K">K Fujisaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pfister, K" uniqKey="Pfister K">K Pfister</name>
</author>
<author>
<name sortKey="Beelitz, P" uniqKey="Beelitz P">P Beelitz</name>
</author>
<author>
<name sortKey="Beck, W" uniqKey="Beck W">W Beck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Forlano, M" uniqKey="Forlano M">M Forlano</name>
</author>
<author>
<name sortKey="Scofield, A" uniqKey="Scofield A">A Scofield</name>
</author>
<author>
<name sortKey="Elisei, C" uniqKey="Elisei C">C Elisei</name>
</author>
<author>
<name sortKey="Fernandes, Kr" uniqKey="Fernandes K">KR Fernandes</name>
</author>
<author>
<name sortKey="Pereira, Am" uniqKey="Pereira A">AM Pereira</name>
</author>
<author>
<name sortKey="Velho, Pb" uniqKey="Velho P">PB Velho</name>
</author>
<author>
<name sortKey="Rubini, As" uniqKey="Rubini A">AS Rubini</name>
</author>
<author>
<name sortKey="Almosny, Nrp" uniqKey="Almosny N">NRP Almosny</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Giannelli, A" uniqKey="Giannelli A">A Giannelli</name>
</author>
<author>
<name sortKey="Ramosa, Rfn" uniqKey="Ramosa R">RFN Ramosa</name>
</author>
<author>
<name sortKey="Dantas Torresa, F" uniqKey="Dantas Torresa F">F Dantas-Torresa</name>
</author>
<author>
<name sortKey="Mencke, N" uniqKey="Mencke N">N Mencke</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
<author>
<name sortKey="Otranto, D" uniqKey="Otranto D">D Otranto</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="De Miranda, Rl" uniqKey="De Miranda R">RL de Miranda</name>
</author>
<author>
<name sortKey="De Castro, Jr" uniqKey="De Castro J">JR de Castro</name>
</author>
<author>
<name sortKey="Olegario, Mm" uniqKey="Olegario M">MM Olegário</name>
</author>
<author>
<name sortKey="Beletti, Me" uniqKey="Beletti M">ME Beletti</name>
</author>
<author>
<name sortKey="Mundim, Av" uniqKey="Mundim A">AV Mundim</name>
</author>
<author>
<name sortKey="O Wyer, Lh" uniqKey="O Wyer L">LH O’Dwyer</name>
</author>
<author>
<name sortKey="Eyal, O" uniqKey="Eyal O">O Eyal</name>
</author>
<author>
<name sortKey="Talmi Frank, D" uniqKey="Talmi Frank D">D Talmi-Frank</name>
</author>
<author>
<name sortKey="Cury, Mc" uniqKey="Cury M">MC Cury</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article" xml:lang="en">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Parasit Vectors</journal-id>
<journal-id journal-id-type="iso-abbrev">Parasit Vectors</journal-id>
<journal-title-group>
<journal-title>Parasites & Vectors</journal-title>
</journal-title-group>
<issn pub-type="epub">1756-3305</issn>
<publisher>
<publisher-name>BioMed Central</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">24985073</article-id>
<article-id pub-id-type="pmc">4086283</article-id>
<article-id pub-id-type="publisher-id">1756-3305-7-303</article-id>
<article-id pub-id-type="doi">10.1186/1756-3305-7-303</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>First molecular evidence of
<italic>Hepatozoon canis</italic>
infection in red foxes and golden jackals from Hungary</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes" id="A1">
<name>
<surname>Farkas</surname>
<given-names>Róbert</given-names>
</name>
<xref ref-type="aff" rid="I1">1</xref>
<email>Farkas.Robert@aotk.szie.hu</email>
</contrib>
<contrib contrib-type="author" id="A2">
<name>
<surname>Solymosi</surname>
<given-names>Norbert</given-names>
</name>
<xref ref-type="aff" rid="I2">2</xref>
<email>solymosi@wavesandbox.com</email>
</contrib>
<contrib contrib-type="author" id="A3">
<name>
<surname>Takács</surname>
<given-names>Nóra</given-names>
</name>
<xref ref-type="aff" rid="I1">1</xref>
<email>Takacs.Nora@aotk.szie.hu</email>
</contrib>
<contrib contrib-type="author" id="A4">
<name>
<surname>Hornyák</surname>
<given-names>Ákos</given-names>
</name>
<xref ref-type="aff" rid="I3">3</xref>
<email>Hornyakak@nebih.gov.hu</email>
</contrib>
<contrib contrib-type="author" id="A5">
<name>
<surname>Hornok</surname>
<given-names>Sándor</given-names>
</name>
<xref ref-type="aff" rid="I1">1</xref>
<email>Hornok.Sandor@aotk.szie.hu</email>
</contrib>
<contrib contrib-type="author" id="A6">
<name>
<surname>Nachum-Biala</surname>
<given-names>Yaarit</given-names>
</name>
<xref ref-type="aff" rid="I4">4</xref>
<email>yaaritna@gmail.com</email>
</contrib>
<contrib contrib-type="author" id="A7">
<name>
<surname>Baneth</surname>
<given-names>Gad</given-names>
</name>
<xref ref-type="aff" rid="I4">4</xref>
<email>gad.baneth@mail.huji.ac.il</email>
</contrib>
</contrib-group>
<aff id="I1">
<label>1</label>
Department of Parasitology and Zoology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</aff>
<aff id="I2">
<label>2</label>
Department of Animal Hygiene, Herd-health and Veterinary Ethology, Faculty of Veterinary Science, Szent István University, Budapest, Hungary</aff>
<aff id="I3">
<label>3</label>
Veterinary Diagnostic Directorate, National Food Chain Safety Office, Budapest, Hungary</aff>
<aff id="I4">
<label>4</label>
School of Veterinary Medicine, Hebrew University of Jerusalem, Jerusalem, Israel</aff>
<pub-date pub-type="collection">
<year>2014</year>
</pub-date>
<pub-date pub-type="epub">
<day>2</day>
<month>7</month>
<year>2014</year>
</pub-date>
<volume>7</volume>
<fpage>303</fpage>
<lpage>303</lpage>
<history>
<date date-type="received">
<day>19</day>
<month>5</month>
<year>2014</year>
</date>
<date date-type="accepted">
<day>26</day>
<month>6</month>
<year>2014</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright © 2014 Farkas et al.; licensee BioMed Central Ltd.</copyright-statement>
<copyright-year>2014</copyright-year>
<copyright-holder>Farkas et al.; licensee BioMed Central Ltd.</copyright-holder>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/4.0">
<license-p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0">http://creativecommons.org/licenses/by/4.0</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<self-uri xlink:href="http://www.parasitesandvectors.com/content/7/1/303"></self-uri>
<abstract>
<sec>
<title>Background</title>
<p>Recently,
<italic>Hepatozoon canis</italic>
infection has been detected among shepherd, hunting and stray dogs in the southern part of Hungary, which is considered to be free of
<italic>Rhipicephalus sanguineus</italic>
sensu lato and close to the border with Croatia. The aim of this study was to acquire information on the possibility that red foxes and/or golden jackals could play a role in the appearance and spread of
<italic>H. canis</italic>
in Hungary.</p>
</sec>
<sec>
<title>Methods</title>
<p>A conventional PCR was used to amplify a 666 bp long fragment of the
<italic>Hepatozoon</italic>
18S rRNA gene from blood samples collected from 334 foxes shot in 231 locations in 16 counties and 15 golden jackals shot in 9 locations in two southwestern counties close to Croatia. A second PCR assay was performed in some of the samples positive by the first PCR to amplify a larger segment (approximately 1500 bp) of the 18S rRNA gene of
<italic>Hepatozoon</italic>
spp. for further phylogenetic analysis.</p>
</sec>
<sec>
<title>Results</title>
<p>
<italic>Hepatozoon</italic>
infection was detected in canids shot in 30 locations and 9 counties. Altogether 26 foxes (8.0%, 95% CI: 5-11%) and 9 jackals (60%, 95% CI: 33-81%) were PCR positive.
<italic>Hepatozoon canis</italic>
sequences were obtained from 12 foxes and 7 jackals. DNA sequences from 16 animals were 99-100% similar to
<italic>H. canis</italic>
from Croatian foxes or dogs while two of the sequences were 99% similar to an Italian fox. Half (13/26) of the infected red foxes and all golden jackals were shot in the two southwestern counties.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>This is the first report on molecular evidence of
<italic>H. canis</italic>
in red foxes (
<italic>Vulpes vulpes</italic>
) and golden jackals (
<italic>Canis aureus</italic>
) from Hungary, which is considered free from the tick vector of
<italic>H. canis</italic>
,
<italic>R. sanguineus</italic>
. Although no
<italic>R. sanguineus</italic>
sensu lato had been found on infected or non-infected wild canids, the detection of authochnous canine hepatozoonosis in Hungary might imply that the range of
<italic>R. sanguineus</italic>
sensu lato has reached this country.</p>
</sec>
</abstract>
<kwd-group>
<kwd>Fox</kwd>
<kwd>Golden jackal</kwd>
<kwd>
<italic>Hepatozoon canis</italic>
</kwd>
<kwd>Hungary</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec>
<title>Background</title>
<p>
<italic>Hepatozoon canis</italic>
(Eucoccidiorida: Hepatozoidae) is an apicomplexan protozoan species, which is one of the most widespread tick-borne protozoa infecting domestic dogs and wild canids worldwide [
<xref ref-type="bibr" rid="B1">1</xref>
,
<xref ref-type="bibr" rid="B2">2</xref>
]. The life cycle of
<italic>H. canis</italic>
requires two hosts, merogony occurs in an intermediate vertebrate host, and gametogony and sporogony take place in the haematophagous invertebrate definitive hosts.
<italic>Rhipicephalus sanguineus</italic>
, commonly referred to as the “kennel tick” or “brown dog tick”, is considered as the major vector of
<italic>H. canis</italic>
[
<xref ref-type="bibr" rid="B3">3</xref>
]. The role of this tick species, which is the definitive host, as a vector has been reinforced by the evidence of transstadial transmission from tick larvae to nymphs, in addition to transmission from the nymph to the adult stage [
<xref ref-type="bibr" rid="B4">4</xref>
]. Furthermore, transovarial transmission of
<italic>H. canis</italic>
could not be demonstrated [
<xref ref-type="bibr" rid="B5">5</xref>
].</p>
<p>The occurrence of canine hepatozoonosis is closely related to the geographical distribution of the definitive tick host, which is considered to be one of the most prevalent tick species worldwide [
<xref ref-type="bibr" rid="B2">2</xref>
,
<xref ref-type="bibr" rid="B6">6</xref>
]. In Europe the geographical distribution of
<italic>H. canis</italic>
is restricted to the Mediterranean region, Balkan, and Iberian peninsulas where
<italic>R. sanguineus</italic>
sensu lato is frequent [
<xref ref-type="bibr" rid="B7">7</xref>
]. The vector tick becomes infected in the larval or nymph stages by ingesting blood of an intermediate host (dogs and wild canids) containing
<italic>H. canis</italic>
gamonts within leukocytes. The principal route of infection of dogs or other intermediate hosts is ingestion of a tick or parts of ticks containing mature oocysts, which is different from transmission of other arthropod-borne pathogens transmitted during blood-sucking by vectors (2,3). Salivary transfer of
<italic>Hepatozoon</italic>
spp. from the final hematophagenous vector host to the vertebrate intermediate host during the blood meal has not been demonstrated [
<xref ref-type="bibr" rid="B1">1</xref>
,
<xref ref-type="bibr" rid="B2">2</xref>
]. The intermediate vertebrate hosts of
<italic>H. canis</italic>
can also be infected through vertical transmission of the parasite from the bitch to its offspring [
<xref ref-type="bibr" rid="B8">8</xref>
]. Animals from neonatal to adult age can be infected [
<xref ref-type="bibr" rid="B9">9</xref>
]. The infection could be subclinical with low levels of parasitaemia or could be manifested as a severe life-threatening disease with fever, lethargy, anaemia, cachexia, weight loss, and lymphadenopathy with high parasitaemia [
<xref ref-type="bibr" rid="B10">10</xref>
]. Severe co-infections of
<italic>H. canis</italic>
with other concomitant pathogens transmitted by
<italic>R. sanguineus</italic>
sensu lato or other vectors are especially frequent involving
<italic>Babesia vogeli</italic>
,
<italic>Ehrlichia canis</italic>
and
<italic>Anaplasma platys</italic>
[
<xref ref-type="bibr" rid="B9">9</xref>
,
<xref ref-type="bibr" rid="B11">11</xref>
].</p>
<p>The potential of
<italic>H. canis</italic>
to infect a wide range of carnivorous species genetically close to domestic dogs is considerable. Hepatozoonosis has been detected where its tick vector is present in red foxes (
<italic>Vulpes vulpes</italic>
) in the following European countries: France [
<xref ref-type="bibr" rid="B12">12</xref>
], Portugal [
<xref ref-type="bibr" rid="B13">13</xref>
], Spain [
<xref ref-type="bibr" rid="B14">14</xref>
,
<xref ref-type="bibr" rid="B15">15</xref>
], Croatia [
<xref ref-type="bibr" rid="B16">16</xref>
], and Italy [
<xref ref-type="bibr" rid="B17">17</xref>
]. Infected foxes were also described in Japan [
<xref ref-type="bibr" rid="B18">18</xref>
] and Israel [
<xref ref-type="bibr" rid="B19">19</xref>
].
<italic>Hepatozoon</italic>
spp. infection have also been detected in other wild canids such as in the gray fox (
<italic>Urocyon cinereoargenteus</italic>
) [
<xref ref-type="bibr" rid="B20">20</xref>
], Pampas gray fox (
<italic>Lycalopex gymnocercus</italic>
) [
<xref ref-type="bibr" rid="B21">21</xref>
], golden jackal (
<italic>Canis aureus</italic>
) [
<xref ref-type="bibr" rid="B22">22</xref>
,
<xref ref-type="bibr" rid="B23">23</xref>
], African wild dog (
<italic>Lycaon pictus</italic>
) [
<xref ref-type="bibr" rid="B24">24</xref>
], coyote (
<italic>Canis latrans</italic>
) [
<xref ref-type="bibr" rid="B25">25</xref>
,
<xref ref-type="bibr" rid="B26">26</xref>
], spotted hyena (
<italic>Crocuta crocuta</italic>
) [
<xref ref-type="bibr" rid="B27">27</xref>
], cheetah (
<italic>Acinonyx jubatus</italic>
), leopard (
<italic>Panthera iridus</italic>
) and lion (
<italic>Panthera leo</italic>
) [
<xref ref-type="bibr" rid="B28">28</xref>
].</p>
<p>Recently,
<italic>H. canis</italic>
infection has been detected among shepherd, hunting and stray dogs in the southern part of Hungary close to the border with Croatia, which is considered to be free of
<italic>R. sanguineus</italic>
sensu lato [
<xref ref-type="bibr" rid="B29">29</xref>
]. The aim of this study was to acquire information on the possibility that red foxes and/or golden jackals could play a role in the appearance and spread of
<italic>H. canis</italic>
in Hungary.</p>
</sec>
<sec sec-type="methods">
<title>Methods</title>
<sec>
<title>Collection of samples</title>
<p>The blood samples originated from 334 red foxes (
<italic>V. vulpes</italic>
) representing 231 locations of all seven Hungarian regions (Figure 
<xref ref-type="fig" rid="F1">1</xref>
). The foxes were shot and the carcasses were sent to the National Food Safety Office, Veterinary Diagnostic Directorate, Budapest as part of a control program on oral immunization of foxes against rabies. Blood samples were also collected from 15 golden jackals (
<italic>C. aureus</italic>
) shot in nine locations of two southwestern counties close to Croatia belonging to the Southern Transdanubia region (Figure 
<xref ref-type="fig" rid="F1">1</xref>
). After opening the thoracic cavity of the jackals and foxes, blood was collected from the heart and stored at -18°C. Ticks were searched for only on golden jackals. The study was carried out by observing the hunting regulations of the Hungarian Ministry of Agriculture and Rural Development (No. 79/2004.[V.4.] FVM).</p>
<fig id="F1" position="float">
<label>Figure 1</label>
<caption>
<p>
<bold>Geographical locations where red foxes and golden jackals were sampled and </bold>
<bold>
<italic>H. canis </italic>
</bold>
<bold>infected canids occurred in Hungary.</bold>
</p>
</caption>
<graphic xlink:href="1756-3305-7-303-1"></graphic>
</fig>
</sec>
<sec>
<title>DNA isolation, amplification and sequencing</title>
<p>DNA was extracted from each blood sample using the QIAamp DNA Mini Kit (QIAgen GmbH., Hilden, Germany) following the “Blood and body fluid” protocol instructions by the manufacturer.</p>
<p>A conventional PCR modified from Inokuma
<italic>et al</italic>
. [
<xref ref-type="bibr" rid="B30">30</xref>
] was used to amplify a 666 bp long fragment of the
<italic>Hepatozoon</italic>
18S rRNA gene with primers HepF (5’-ATA CAT GAG CAA AAT CTC AAC-3’) and HepR (5’-CTT ATT ATT CCA TGC TGC AG-3’). Two and a half μl of extracted DNA were added to 22.5 μl of reaction mixture containing 1.0 U HotStar Taq DNA Plus Polymerase (5 U/μl), 0.5 μl dNTPs (10 mM), 0.2 μl of each primer (50 μM), 2.5 μl of 10× Coral Load PCR buffer (15 mM MgCl
<sub>2</sub>
included), 1 μl MgCl
<sub>2</sub>
(25 mM) and 17.9 μl DW.</p>
<p>Amplification was performed in a T-personal thermal cycler (Biometra, Goettingen, Germany). An initial denaturation step at 95°C for 5 min was followed by 35 cycles of denaturation at 95°C for 40 s, annealing at 57°C for 40 s and extension at 72°C for 60 s. Final extension was performed at 72°C for 7 min then held at 11°C. DNA of
<italic>Hepatozoon</italic>
sp. found in a rodent served as positive control. PCR products were visualized under ultra-violet light on 1.5% agarose gel (100 V, 30 min) stained with ethidium–bromide, and were sized by comparison with Gene Ruler 100-bp DNA Ladder (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA) as molecular marker.</p>
<p>A second PCR assay was performed in some of the samples which were previously positive by the first PCR in order to amplify a larger segment (approximately 1500 bp) of the 18S rRNA gene of
<italic>Hepatozoon</italic>
spp. for further phylogenetic analysis. This assay used primers HAM-1 F GCCAGTAGTCATATGCTTGTC and HPF-2R GACTTCTCCTTCGTCTAAG [
<xref ref-type="bibr" rid="B31">31</xref>
]. The amplification conditions for this reaction were: 95°C, 5 min; (34× [95°C 20 sec, 56°C, 30 sec, 72°, 90 sec]; 72°C, 5 min).</p>
<p>Selected PCR products were purified and sequenced at Macrogen Inc. (Seoul, South Korea) or at the Hebrew University (Jerusalem, Israel). Sequences were determined in both directions (using the same primers individually as for the PCR). Sequences were compared with 18S rRNA gene sequences of
<italic>Hepatozoon</italic>
species available in GenBank.</p>
</sec>
<sec>
<title>Phylogenetic analysis</title>
<p>A phylogenetic analysis, which included DNA sequences from the blood of jackals and foxes from the study, was carried out to compare these sequences to
<italic>Hepatozoon</italic>
spp. sequences that had previously been deposited in GenBank. Sequences were analyzed using the MEGA version 5.1 (
<ext-link ext-link-type="uri" xlink:href="http://www.megasoftware.net">http://www.megasoftware.net</ext-link>
) and phylogenetic trees were constructed by the Maximum-Likelihood algorithms using the Tamura-3-Parameter model. Bootstrap replicates were performed to estimate the node reliability, and values were obtained from 500 randomly selected samples of the aligned sequence data.</p>
</sec>
<sec>
<title>Statistical analysis</title>
<p>Confidence intervals were calculated by the Sterne method [
<xref ref-type="bibr" rid="B32">32</xref>
]. All statistical analyses and mapping were performed using the R-environment [
<xref ref-type="bibr" rid="B33">33</xref>
].</p>
</sec>
</sec>
<sec>
<title>Results and discussion</title>
<p>
<italic>Hepatozoon</italic>
infection was detected in both red foxes and golden jackals shot in 30 locations in 9 counties (Figure 
<xref ref-type="fig" rid="F1">1</xref>
). Altogether 26 foxes and 9 jackals were PCR positive of which half of the infected red foxes and all golden jackals were shot in two southwestern counties close to Croatia. The other infected red foxes, except for two animals, were shot close to the borders with Austria and Slovenia, Serbia, Romania and Ukraine. The observed prevalence of
<italic>H. canis</italic>
was 8% (95% CI: 5-11%) in red foxes and 60% (95% CI: 33-81%) in golden jackals. Seven out of 15 golden jackals were infested with
<italic>Ixodes ricinus</italic>
,
<italic>Dermacentor reticulatus</italic>
or
<italic>Haemaphysalis concinna</italic>
ticks.</p>
<p>
<italic>Hepatozoon canis</italic>
sequences were obtained from 14 red foxes [GenBank: KC886720, KC886722-28, KF322141-144, KJ572978-79], and 9 golden jackals [GenBank: KC886721, KC886729-33, KJ572975-77]. BLAST search revealed that 16 out of 19 sequences obtained in the study were 99-100% similar to
<italic>H. canis</italic>
from Croatian foxes or dogs while two of sequences [GenBank: KC886722 from a fox and KC886729 from a jackal] were 99% similar to a sequence from an Italian fox [GenBank: GU371447]. A 1545 bp sequence of
<italic>H. canis</italic>
amplified from a jackal using the HAM-1 F and HPF-2R and comprising almost all of the 18S rRNA gene was submitted to GenBank [KJ634654] and found to be 99% similar to
<italic>H. canis</italic>
from a Spanish fox [GenBank: AY150067].</p>
<p>A phylogenetic tree constructed by comparison of 660 bp sequences from the 18S rRNA gene (Figure 
<xref ref-type="fig" rid="F2">2</xref>
) indicated that
<italic>H. canis</italic>
sequences from the Hungarian jackals and red foxes clustered together with other
<italic>H. canis</italic>
sequences from dogs, jackals and foxes from other countries in Europe and from Brazil and away from
<italic>Hepatozoon americanum</italic>
and
<italic>Hepatozoon felis</italic>
sequences. However, sequences of
<italic>H. canis</italic>
from Hungarian jackals clustered separately from those of Hungarian foxes, which grouped together with a sequence from an Austrian jackal.</p>
<fig id="F2" position="float">
<label>Figure 2</label>
<caption>
<p>
<bold>
<italic>Maximum likelihood 18S tree; </italic>
</bold>
<bold>A </bold>
<bold>
<italic>Maximum likelihood </italic>
</bold>
<bold>tree phylogram comparing 660 bp </bold>
<bold>
<italic>18S Hepatozoon </italic>
</bold>
<bold>DNA sequences from Hungarian golden jackals and red foxes to other related </bold>
<bold>
<italic>Hepatozoon </italic>
</bold>
<bold>spp.</bold>
DNA sequences from GenBank. The GenBank accession numbers,
<italic>Hepatozoon</italic>
species, host species and country of origin from which the sequences were derived are included for each sequence. New sequences derived from the present study are designated as being from Hungary.</p>
</caption>
<graphic xlink:href="1756-3305-7-303-2"></graphic>
</fig>
<p>A second phylogenetic tree compared 1382 bp sequences of the
<italic>Hepatozoon</italic>
18S rRNA gene and included the long sequence of the 18S rRNA gene amplified from a Hungarian jackal [GenBank: KJ634654] (Figure 
<xref ref-type="fig" rid="F3">3</xref>
). This analysis found that all
<italic>H. canis</italic>
sequences clustered separately from
<italic>H. felis</italic>
; however, there were separate clusters within
<italic>H. canis</italic>
. The
<italic>H. canis</italic>
sequence from the Hungarian jackal clustered close to
<italic>H. canis</italic>
from foxes from Brazil and Spain.</p>
<fig id="F3" position="float">
<label>Figure 3</label>
<caption>
<p>
<bold>
<italic>Maximum likelihood 18S tree; </italic>
</bold>
<bold>A </bold>
<bold>
<italic>Maximum likelihood </italic>
</bold>
<bold>tree phylogram comparing 1382 bp </bold>
<bold>
<italic>18S </italic>
</bold>
<bold>DNA sequences of </bold>
<bold>
<italic>Hepatozoon canis and Hepatozoon felis </italic>
</bold>
<bold>to </bold>
<bold>
<italic>H. canis </italic>
</bold>
<bold>from a Hungarian jackal.</bold>
The GenBank accession numbers,
<italic>Hepatozoon</italic>
species, host species and country of origin from which the sequences were derived are included for each sequence.</p>
</caption>
<graphic xlink:href="1756-3305-7-303-3"></graphic>
</fig>
<p>
<italic>Hepatozoon canis</italic>
has been reported previously outside the Mediterranean areas of Europe in imported dogs [
<xref ref-type="bibr" rid="B34">34</xref>
,
<xref ref-type="bibr" rid="B35">35</xref>
]. However, in the last few years,
<italic>H. canis</italic>
infection of local wild canids was reported for the first time from Slovakia [
<xref ref-type="bibr" rid="B36">36</xref>
], Poland [
<xref ref-type="bibr" rid="B37">37</xref>
] and Austria [
<xref ref-type="bibr" rid="B23">23</xref>
] which were previously considered non-endemic for this parasite due to the absence of
<italic>R. sanguineus</italic>
sensu lato in these areas. We assume that if these carnivorous species can be sylvatic reservoirs of this apicomplexan parasite they may play a role in the appearance of canine hepatozoonosis in Hungary. Our findings confirm this hypothesis because many red foxes and golden jackals were found to be infected with
<italic>H. canis</italic>
. Based on the high percentage (60%, 9/15) of the infected golden jackals in the two southern counties neighbouring with Croatia we suppose that they might have brought the parasite to Hungary from that country where dogs and red foxes are infected with
<italic>H. canis</italic>
and
<italic>R. sanguineus</italic>
sensu lato is widespread [
<xref ref-type="bibr" rid="B16">16</xref>
,
<xref ref-type="bibr" rid="B38">38</xref>
]. It is unknown how long
<italic>H. canis</italic>
has been present in Hungary. It is possible that this protozoan parasite arrived in the last decade of the twentieth century when golden jackals started to spread from the Balkan toward Hungary [
<xref ref-type="bibr" rid="B39">39</xref>
], especially from Croatia, and settled in the southwestern part of Hungary [
<xref ref-type="bibr" rid="B40">40</xref>
]. The parasite might have also arrived to the country by infected red foxes from the neighbouring country. In other countries, foxes seem to be very susceptible hosts for this infection, for instance, the prevalence in Portugal was found to be 48% (143/301) in one study [
<xref ref-type="bibr" rid="B13">13</xref>
] and 76% in a second survey [
<xref ref-type="bibr" rid="B41">41</xref>
], in Croatia [
<xref ref-type="bibr" rid="B16">16</xref>
] it was 23% and in Israel, an ELISA survey found that 24% of the foxes were seropositive [
<xref ref-type="bibr" rid="B19">19</xref>
]. However, more data should be collected to answer whether the golden jackal could be more susceptible than the red fox.</p>
<p>Concerning the origin of the parasites detected in Hungary, our hypothesis that this infection came from Croatia was strengthened by the PCR detection of
<italic>H. canis</italic>
in 13 red foxes and 9 golden jackals shot in the counties neighbouring Croatia. The origin of the local
<italic>H. canis</italic>
was further substantiated by sequencing
<italic>H. canis</italic>
of 12 red foxes and 7 golden jackals. Except for three samples, all others were 99-100% similar to
<italic>H. canis</italic>
from Croatian red foxes or dogs.</p>
<p>The question is where and how these wild animals became infected because
<italic>R. sanguineus</italic>
sensu lato has not been found in Hungary except for in an imported case [
<xref ref-type="bibr" rid="B42">42</xref>
]. It can be assumed that some golden jackals and/or red foxes might have become infected in Croatia by ingesting
<italic>R. sanguineus</italic>
ticks containing mature oocysts of
<italic>H. canis</italic>
or by preying on other animals infested with this vector harbouring infective stages of the parasite. Vertical transmission of the parasite [
<xref ref-type="bibr" rid="B8">8</xref>
] may also help to explain why so many animals were found to be PCR positive. The other question that arose in this study and remains without answer is whether the red foxes shot close to the borders with 5 other neighbouring countries became infected in Hungary or not.</p>
<p>There has been no explanation on how 33 local shepherd, hunting and stray dogs acquired
<italic>H. canis</italic>
[
<xref ref-type="bibr" rid="B29">29</xref>
]. We think that so many dogs could not be infected by ingesting infected ticks that arrived with golden jackals, red foxes or rodents from the neighbouring countries. Although no
<italic>R. sanguineus</italic>
sensu lato has been found on infected and non-infected domestic and wild animals, the detection of autochthonous canine hepatozoonosis in Hungary might imply that the range of
<italic>R. sanguineus</italic>
sensu lato has reached this country. The vector tick might be present at least during the hot summer months suitable for this tick species to establish an endemic focus. In this case the question is whether
<italic>R. sanguineus</italic>
sensu lato can survive year round and reproduce in Hungary. Further studies should be conducted in the southern part of Hungary in order to answer this question. Another possible explanation is also available. Although the major vector of
<italic>H. canis</italic>
is
<italic>R. sanguineus</italic>
sensu lato, the invertebrate host range of this parasite has not yet been fully elucidated. Taking into account that the same tick species can infest dogs [
<xref ref-type="bibr" rid="B29">29</xref>
] and red foxes [
<xref ref-type="bibr" rid="B43">43</xref>
] in Hungary and
<italic>H. concinna</italic>
nymphs removed from a PCR-negative dog were found positive for
<italic>H. canis</italic>
[
<xref ref-type="bibr" rid="B29">29</xref>
], the transmission of
<italic>H. canis</italic>
by other tick species cannot be excluded. In Japan, potential and additional tick vectors,
<italic>Haemaphysalis longicornis</italic>
and
<italic>Haemaphysalis flava</italic>
were found [
<xref ref-type="bibr" rid="B44">44</xref>
]. Pfister
<italic>et al</italic>
. [
<xref ref-type="bibr" rid="B45">45</xref>
] reported that the hedgehog tick,
<italic>Ixodes hexagonus</italic>
could be a vector of
<italic>H. canis</italic>
. Forlano
<italic>et al</italic>
. [
<xref ref-type="bibr" rid="B46">46</xref>
] experimentally proved that
<italic>Amblyomma ovale</italic>
transmitted the parasite in Brazil. Furthermore, Italian and Austrian scientists suggested the potential role of
<italic>I. ricinus</italic>
as a vector of
<italic>H. canis</italic>
among domestic and wild canids [
<xref ref-type="bibr" rid="B17">17</xref>
,
<xref ref-type="bibr" rid="B23">23</xref>
]. However, the results of a later study indicated that
<italic>I. ricinus</italic>
ingested
<italic>H. canis</italic>
gamonts during the blood meal but further development and sporogony did not occur suggesting that
<italic>I. ricinus</italic>
does not act as a vector [
<xref ref-type="bibr" rid="B47">47</xref>
].
<italic>Hepatozoon canis</italic>
oocysts have also been found in
<italic>Rhipicephalus microplus</italic>
(formerly
<italic>Boophilus microplus</italic>
) but the vector role of this tick species has not been confirmed [
<xref ref-type="bibr" rid="B48">48</xref>
].</p>
<p>Although the first analysis (Figure 
<xref ref-type="fig" rid="F2">2</xref>
) showed that
<italic>H. canis</italic>
from Hungarian foxes clustered separately from Hungarian jackals, they did cluster together with
<italic>H. canis</italic>
from a jackal from neighbouring Austria. Overall,
<italic>H. canis</italic>
18S rRNA sequences from different locations and continents including Taiwan in Asia, Brazil in South America, Spain and central European countries, and from different canine hosts such as the domestic dog, golden jackal and red fox, clustered without obvious geographical and host-related division patterns. This may suggest that
<italic>H. canis</italic>
is a ubiquitous canine parasite which crosses between canine host species and is also transferred successfully between geographic regions by the movement and importation of these hosts.</p>
</sec>
<sec sec-type="conclusions">
<title>Conclusions</title>
<p>To our best knowledge, this is the first report on detection of
<italic>H. canis</italic>
in red foxes and golden jackals in Hungary. Further investigation should elucidate the routes of
<italic>H. canis</italic>
transmission amongst wild carnivores and between them and local dogs. Besides
<italic>H. canis</italic>
, ectoparasite vectors can also transmit several other pathogens from wild canids to dogs. Therefore, the increased activity of vector species due to the climate changes with increasing urbanization and the more common contact between domestic and wild animals stresses the need to study the vector-borne pathogens of red foxes, golden jackals and other carnivore species.</p>
</sec>
<sec>
<title>Competing interests</title>
<p>The authors declare that they have no competing interests.</p>
</sec>
<sec>
<title>Authors’ contributions</title>
<p>Designed the study: RF, SH, GB. Collected samples: RF, SH, ÁH. Processed samples: RF, NT, ÁH. Performed PCR: NT, YNB. Analyzed sequences: RF, GB, NT, YNB. Analyzed the data: NS. Wrote the paper: RF, GB. All authors read and approved the final version of the manuscript.</p>
</sec>
</body>
<back>
<sec>
<title>Acknowledgments</title>
<p>The authors are grateful to Mónika Gyurkovszky (Faculty of Veterinary Science, Budapest) for helping in laboratory work. The authors thank the European Cooperation in Science and Technology (COST) action TD1303 EURNEGVEC.</p>
</sec>
<ref-list>
<ref id="B1">
<mixed-citation publication-type="journal">
<name>
<surname>Smith</surname>
<given-names>TG</given-names>
</name>
<article-title>The genus
<italic>Hepatozoon</italic>
(Apicomplexa: Adeleina)</article-title>
<source>J Parasitol</source>
<year>1996</year>
<volume>82</volume>
<fpage>565</fpage>
<lpage>585</lpage>
<pub-id pub-id-type="doi">10.2307/3283781</pub-id>
<pub-id pub-id-type="pmid">8691364</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<article-title>Perspectives on canine and feline hepatozoonosis</article-title>
<source>Vet Parasitol</source>
<year>2011</year>
<volume>181</volume>
<fpage>3</fpage>
<lpage>11</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2011.04.015</pub-id>
<pub-id pub-id-type="pmid">21620568</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Samish</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Shkap</surname>
<given-names>V</given-names>
</name>
<article-title>Life cycle of
<italic>Hepatozoon canis</italic>
(Apicomplexa: Adeleorina: Hepatozoidae) in the tick
<italic>Rhipicephalus sanguineus</italic>
and domestic dog (Canis familiaris)</article-title>
<source>J Parasitol</source>
<year>2007</year>
<volume>93</volume>
<fpage>283</fpage>
<lpage>299</lpage>
<pub-id pub-id-type="doi">10.1645/GE-494R.1</pub-id>
<pub-id pub-id-type="pmid">17539411</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<name>
<surname>Giannelli</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Ramos</surname>
<given-names>RA</given-names>
</name>
<name>
<surname>Di Paola</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Mencke</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Dantas-Torres</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Otranto</surname>
<given-names>D</given-names>
</name>
<article-title>Transstadial transmission of
<italic>Hepatozoon canis </italic>
from larvae to nymphs of
<italic>Rhipicephalus sanguineus</italic>
</article-title>
<source>Vet Parasitol</source>
<year>2013</year>
<volume>196</volume>
<issue>1–2</issue>
<fpage>1</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="pmid">23537949</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Samish</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Alekseev</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Aroch</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Shkap</surname>
<given-names>V</given-names>
</name>
<article-title>Transmission of
<italic>Hepatozoon canis</italic>
to dogs by naturally-fed or percutaneously-injected
<italic>Rhipicephalus sanguineus</italic>
ticks</article-title>
<source>J Parasitol</source>
<year>2001</year>
<volume>187</volume>
<fpage>606</fpage>
<lpage>611</lpage>
<pub-id pub-id-type="pmid">11426725</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<name>
<surname>Dantas-Torres</surname>
<given-names>F</given-names>
</name>
<article-title>Biology and ecology of the brown dog tick,
<italic>Rhipicephalus sanguineus</italic>
</article-title>
<source>Parasit Vectors</source>
<year>2010</year>
<volume>3</volume>
<fpage>26</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-3-26</pub-id>
<pub-id pub-id-type="pmid">20377860</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="book">
<name>
<surname>Estrada-Peña</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Jaenson</surname>
<given-names>TGT</given-names>
</name>
<name>
<surname>Farkas</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Pascucci</surname>
<given-names>I</given-names>
</name>
<person-group person-group-type="editor">Salman M, Tarres-Call J</person-group>
<article-title>Maps of reported occurrence of ticks</article-title>
<source>Ticks and Tick-Borne Diseases: Geographical Distribution and Control Strategies in the Euro-Asia Region</source>
<year>2013</year>
<publisher-name>Wallingford, UK: CABI (CAB International)</publisher-name>
<fpage>89</fpage>
<lpage>97</lpage>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<name>
<surname>Murata</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Inoue</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Tateyama</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Taura</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Nakama</surname>
<given-names>S</given-names>
</name>
<article-title>Vertical transmission of
<italic>Hepatozoon canis</italic>
in dogs</article-title>
<source>J Vet Med Sci</source>
<year>1993</year>
<volume>55</volume>
<fpage>867</fpage>
<lpage>868</lpage>
<pub-id pub-id-type="doi">10.1292/jvms.55.867</pub-id>
<pub-id pub-id-type="pmid">8286548</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<name>
<surname>Otranto</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Dantas-Torres</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Weigl</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Latrofa</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>Stanneck</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Decaprariis</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Capelli</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<article-title>Diagnosis of
<italic>Hepatozoon canis</italic>
in young dogs by cytology and PCR</article-title>
<source>Parasit Vectors</source>
<year>2011</year>
<volume>4</volume>
<fpage>55</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-4-55</pub-id>
<pub-id pub-id-type="pmid">21489247</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Weigler</surname>
<given-names>B</given-names>
</name>
<article-title>Retrospective case–control study of hepatozoonosis in dogs in Israel</article-title>
<source>J Vet Intern Med</source>
<year>1997</year>
<volume>11</volume>
<fpage>365</fpage>
<lpage>370</lpage>
<pub-id pub-id-type="doi">10.1111/j.1939-1676.1997.tb00482.x</pub-id>
<pub-id pub-id-type="pmid">9470163</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="book">
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<person-group person-group-type="editor">Beugnet F, Beugnet F</person-group>
<article-title>Hepatozoonosis</article-title>
<source>Guide to vector borne diseases of pets</source>
<year>2013</year>
<publisher-name>Lyon: MERIAL</publisher-name>
<fpage>281</fpage>
<lpage>291</lpage>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<name>
<surname>Rioux</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Golvan</surname>
<given-names>YJ</given-names>
</name>
<name>
<surname>Honin</surname>
<given-names>R</given-names>
</name>
<article-title>Mixed
<italic>Hepatozoon canis</italic>
and
<italic>Leishmania canis</italic>
infection in a dog in the Sets area, France. Ann</article-title>
<source>Parasitol Hum Comp</source>
<year>1964</year>
<volume>39</volume>
<fpage>131</fpage>
<lpage>135</lpage>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<name>
<surname>Conceicão-Silva</surname>
<given-names>FM</given-names>
</name>
<name>
<surname>Abranches</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Silva-Pereira</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Janz</surname>
<given-names>JG</given-names>
</name>
<article-title>Hepatozoonosis in foxes from Portugal</article-title>
<source>J Wildl Dis</source>
<year>1988</year>
<volume>24</volume>
<fpage>344</fpage>
<lpage>347</lpage>
<pub-id pub-id-type="doi">10.7589/0090-3558-24.2.344</pub-id>
<pub-id pub-id-type="pmid">3373641</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<name>
<surname>Criado-Fornelio</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Martinez-Marcos</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Buling-Sarana</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Barba-Carretero</surname>
<given-names>JC</given-names>
</name>
<article-title>Molecular studies on
<italic>Babesia</italic>
,
<italic>Theileria</italic>
and
<italic>Hepatozoon</italic>
in southern Europe. Part I. Epizootiological aspects</article-title>
<source>Vet Parasitol</source>
<year>2003</year>
<volume>113</volume>
<fpage>189</fpage>
<lpage>201</lpage>
<pub-id pub-id-type="doi">10.1016/S0304-4017(03)00078-5</pub-id>
<pub-id pub-id-type="pmid">12719133</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<name>
<surname>Gimenez</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Casado</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Criado-Fornelio</surname>
<given-names>A</given-names>
</name>
<name>
<surname>de Muguel</surname>
<given-names>FA</given-names>
</name>
<name>
<surname>Dominguez-Peñafiel</surname>
<given-names>G</given-names>
</name>
<article-title>A molecular survey of Piroplasmida and
<italic>Hepatozoon </italic>
isolated from domestic and wild animals in Burgos (northern Spain).</article-title>
<source>Vet Parasitol</source>
<year>2009</year>
<volume>162</volume>
<fpage>147</fpage>
<lpage>150</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2009.02.021</pub-id>
<pub-id pub-id-type="pmid">19297099</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<name>
<surname>Dezdek</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Vojta</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Curković</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Lipej</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Mihaljević</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Cvetnić</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Beck</surname>
<given-names>R</given-names>
</name>
<article-title>Molecular detection of
<italic>Theileria annae</italic>
and
<italic>Hepatozoon canis</italic>
in foxes (
<italic>Vulpes vulpes</italic>
) in Croatia</article-title>
<source>Vet Parasitol</source>
<year>2010</year>
<volume>172</volume>
<fpage>333</fpage>
<lpage>336</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2010.05.022</pub-id>
<pub-id pub-id-type="pmid">20646832</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<name>
<surname>Gabrielli</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Kumlien</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Calderini</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Brozzi</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Iori</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Cancrini</surname>
<given-names>G</given-names>
</name>
<article-title>The first report of
<italic>Hepatozoon canis</italic>
identified in
<italic>Vulpes vulpes</italic>
and ticks from Italy</article-title>
<source>Vector Borne Zoonotic Dis</source>
<year>2010</year>
<volume>10</volume>
<fpage>855</fpage>
<lpage>859</lpage>
<pub-id pub-id-type="doi">10.1089/vbz.2009.0182</pub-id>
<pub-id pub-id-type="pmid">20420538</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<name>
<surname>Maede</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Ohsugi</surname>
<given-names>T</given-names>
</name>
<article-title>
<italic>Hepatozoon</italic>
infection in a wild fox (
<italic>Vulpes vulpes</italic>
schrencki Kishida) in Japan</article-title>
<source>Japan J Vet Sci</source>
<year>1982</year>
<volume>44</volume>
<fpage>137</fpage>
<lpage>142</lpage>
<pub-id pub-id-type="doi">10.1292/jvms1939.44.137</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<name>
<surname>Fishman</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Gonen</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Harrus</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Strauss-Ayali</surname>
<given-names>D</given-names>
</name>
<name>
<surname>King</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<article-title>A serosurvey of
<italic>Hepatozoon canis</italic>
and
<italic>Ehrlichia canis</italic>
antibodies in wild red foxes (
<italic>Vulpes vulpes</italic>
) from Israel</article-title>
<source>Vet Parasitol</source>
<year>2004</year>
<volume>119</volume>
<fpage>21</fpage>
<lpage>26</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2003.08.012</pub-id>
<pub-id pub-id-type="pmid">15036573</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<name>
<surname>Allen</surname>
<given-names>KE</given-names>
</name>
<name>
<surname>Yabsley</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>EM</given-names>
</name>
<name>
<surname>Reichard</surname>
<given-names>MV</given-names>
</name>
<name>
<surname>Panciera</surname>
<given-names>RJ</given-names>
</name>
<name>
<surname>Ewing</surname>
<given-names>SA</given-names>
</name>
<name>
<surname>Little</surname>
<given-names>SE</given-names>
</name>
<article-title>Novel
<italic>Hepatozoon</italic>
in vertebrates from the southern United States</article-title>
<source>J Parasitol</source>
<year>2011</year>
<volume>97</volume>
<fpage>648</fpage>
<lpage>653</lpage>
<pub-id pub-id-type="doi">10.1645/GE-2672.1</pub-id>
<pub-id pub-id-type="pmid">21506825</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<name>
<surname>Giannitti</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Diab</surname>
<given-names>SS</given-names>
</name>
<name>
<surname>Uzal</surname>
<given-names>FA</given-names>
</name>
<name>
<surname>Fresneda</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Rossi</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Talmi-Frank</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<article-title>Infection with a
<italic>Hepatozoon </italic>
sp. closely related to
<italic>Hepatozoon felis </italic>
in a wild Pampas gray fox (
<italic>Lycalopex -Pseudalopex -gymnocercus</italic>
) co-infected with canine distemper virus.</article-title>
<source>Vet Parasitol</source>
<year>2012</year>
<volume>186</volume>
<fpage>497</fpage>
<lpage>502</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2011.11.006</pub-id>
<pub-id pub-id-type="pmid">22112977</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<name>
<surname>Shamir</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Yakobson</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<name>
<surname>King</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Dar-Verker</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Markovics</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Aroch</surname>
<given-names>L</given-names>
</name>
<article-title>Antibodies to selected canine pathogens and infestation with intestinal helminths in golden jackals (Canis aureus) in Israel</article-title>
<source>Vet J</source>
<year>2001</year>
<volume>162</volume>
<fpage>66</fpage>
<lpage>72</lpage>
<pub-id pub-id-type="doi">10.1053/tvjl.2000.0572</pub-id>
<pub-id pub-id-type="pmid">11409931</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<name>
<surname>Duscher</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Kübber-Heiss</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Richter</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Suchentrunk</surname>
<given-names>F</given-names>
</name>
<article-title>A golden jackal (
<italic>Canis aureus</italic>
) from Austria bearing
<italic>Hepatozoon canis </italic>
– import due to immigration into a non-endemic area?</article-title>
<source>Ticks Tick Borne Dis</source>
<year>2013</year>
<volume>4</volume>
<fpage>133</fpage>
<lpage>137</lpage>
<pub-id pub-id-type="doi">10.1016/j.ttbdis.2012.10.040</pub-id>
<pub-id pub-id-type="pmid">23306030</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<name>
<surname>Van Heerden</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Mills</surname>
<given-names>MG</given-names>
</name>
<name>
<surname>Van Vuuren</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Kelly</surname>
<given-names>PJ</given-names>
</name>
<name>
<surname>Dreyer</surname>
<given-names>MJ</given-names>
</name>
<article-title>An investigation into the health status and diseases of wild dogs (
<italic>Lycaon pictus</italic>
) in the Kruger National Park</article-title>
<source>J S Afr Vet Assoc</source>
<year>1995</year>
<volume>66</volume>
<fpage>18</fpage>
<lpage>27</lpage>
<pub-id pub-id-type="pmid">7629782</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<name>
<surname>Davis</surname>
<given-names>DS</given-names>
</name>
<name>
<surname>Robinson</surname>
<given-names>RM</given-names>
</name>
<name>
<surname>Craig</surname>
<given-names>TM</given-names>
</name>
<article-title>Naturally occurring hepatozoonosis in a coyote</article-title>
<source>J Wildl Dis</source>
<year>1978</year>
<volume>14</volume>
<fpage>244</fpage>
<lpage>246</lpage>
<pub-id pub-id-type="doi">10.7589/0090-3558-14.2.244</pub-id>
<pub-id pub-id-type="pmid">650792</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<name>
<surname>Starkey</surname>
<given-names>LA</given-names>
</name>
<name>
<surname>Panciera</surname>
<given-names>RJ</given-names>
</name>
<name>
<surname>Paras</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Allen</surname>
<given-names>KE</given-names>
</name>
<name>
<surname>Reiskind</surname>
<given-names>MH</given-names>
</name>
<name>
<surname>Reichard</surname>
<given-names>MV</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>EM</given-names>
</name>
<name>
<surname>Little</surname>
<given-names>SE</given-names>
</name>
<article-title>Genetic diversity of
<italic>Hepatozoon</italic>
spp. in coyotes from the south central United States</article-title>
<source>J Parasitol</source>
<year>2013</year>
<volume>99</volume>
<fpage>375</fpage>
<lpage>378</lpage>
<pub-id pub-id-type="doi">10.1645/GE-3104.1</pub-id>
<pub-id pub-id-type="pmid">22924920</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<name>
<surname>East</surname>
<given-names>ML</given-names>
</name>
<name>
<surname>Wibbelt</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Lieckfeldt</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Ludwig</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Goller</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Wilhelm</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Schares</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Thierer</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Hofer</surname>
<given-names>H</given-names>
</name>
<article-title>A
<italic>Hepatozoon</italic>
species genetically distinct from
<italic>H. canis</italic>
infecting spotted hyenas in the Serengeti ecosystem, Tanzania</article-title>
<source>J Wildl Dis</source>
<year>2008</year>
<volume>44</volume>
<fpage>45</fpage>
<lpage>52</lpage>
<pub-id pub-id-type="doi">10.7589/0090-3558-44.1.45</pub-id>
<pub-id pub-id-type="pmid">18263820</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<name>
<surname>McCully</surname>
<given-names>RM</given-names>
</name>
<name>
<surname>Basson</surname>
<given-names>PA</given-names>
</name>
<name>
<surname>Bigalke</surname>
<given-names>RD</given-names>
</name>
<name>
<surname>de Vos</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Young</surname>
<given-names>E</given-names>
</name>
<article-title>Observation on naturally acquired hepatozoonosis of wild carnivores and dogs in the Republic of South Africa</article-title>
<source>Onderstepoort J Vet Res</source>
<year>1975</year>
<volume>42</volume>
<fpage>117</fpage>
<lpage>133</lpage>
<pub-id pub-id-type="pmid">1221330</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<name>
<surname>Hornok</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Tánczos</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Fernández De Mera</surname>
<given-names>IG</given-names>
</name>
<name>
<surname>de la Fuente</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Hofmann- Lehmann</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Farkas</surname>
<given-names>R</given-names>
</name>
<article-title>High prevalence of
<italic>Hepatozoon</italic>
-infection among shepherd dogs in a region considered to be free of
<italic>Rhipicephalus sanguineus</italic>
</article-title>
<source>Vet Parasitol</source>
<year>2013</year>
<volume>196</volume>
<fpage>189</fpage>
<lpage>193</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2013.02.009</pub-id>
<pub-id pub-id-type="pmid">23499483</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<name>
<surname>Inokuma</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Okuda</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ohno</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Shimoda</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Onishi</surname>
<given-names>T</given-names>
</name>
<article-title>Analysis of the 18S rRNA gene sequence of a
<italic>Hepatozoon</italic>
detected in two Japanese dogs</article-title>
<source>Vet Parasitol</source>
<year>2002</year>
<volume>106</volume>
<fpage>265</fpage>
<lpage>271</lpage>
<pub-id pub-id-type="doi">10.1016/S0304-4017(02)00065-1</pub-id>
<pub-id pub-id-type="pmid">12062514</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<name>
<surname>Criado-Fornelio</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Ruas</surname>
<given-names>JL</given-names>
</name>
<name>
<surname>Casado</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Farias</surname>
<given-names>NA</given-names>
</name>
<name>
<surname>Soares</surname>
<given-names>MP</given-names>
</name>
<name>
<surname>Müller</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Brumt</surname>
<given-names>JG</given-names>
</name>
<name>
<surname>Berne</surname>
<given-names>ME</given-names>
</name>
<name>
<surname>Buling-Saraña</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Barba-Carretero</surname>
<given-names>JC</given-names>
</name>
<article-title>New molecular data on mammalian
<italic>Hepatozoon</italic>
species (Apicomplexa: Adeleorina) from Brazil and Spain</article-title>
<source>J Parasitol</source>
<year>2006</year>
<volume>92</volume>
<fpage>93</fpage>
<lpage>99</lpage>
<pub-id pub-id-type="doi">10.1645/GE-464R.1</pub-id>
<pub-id pub-id-type="pmid">16629322</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<name>
<surname>Sterne</surname>
<given-names>TE</given-names>
</name>
<article-title>Some remarks on confidence or fiducial limits</article-title>
<source>Biometrika</source>
<year>1954</year>
<volume>41</volume>
<fpage>275</fpage>
<lpage>278</lpage>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="book">
<collab>R Core Team R</collab>
<source>A language and environment for statistical computing</source>
<year>2014</year>
<publisher-name>Vienna, Austria: R Foundation for Statistical Computing</publisher-name>
<comment>
<ext-link ext-link-type="uri" xlink:href="http://www.R-project.org/">http://www.R-project.org/</ext-link>
</comment>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<name>
<surname>Fischer</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Hartmann</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Gothe</surname>
<given-names>R</given-names>
</name>
<article-title>
<italic>Hepatozoon canis</italic>
: eine importierte parasitare Infektion bei Hunden</article-title>
<source>Tier Prax</source>
<year>1994</year>
<volume>22</volume>
<fpage>172</fpage>
<lpage>180</lpage>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<name>
<surname>Holland</surname>
<given-names>M</given-names>
</name>
<article-title>Emerging diseases in Northern Europe</article-title>
<source>J Small Anim Pract</source>
<year>2001</year>
<volume>42</volume>
<fpage>205</fpage>
<lpage>206</lpage>
<pub-id pub-id-type="pmid">11327670</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<name>
<surname>Majláthová</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Hurníková</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Majláth</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Petko</surname>
<given-names>B</given-names>
</name>
<article-title>
<italic>Hepatozoon canis</italic>
infection in Slovakia: imported or autochthonous?</article-title>
<source>Vector Borne Zoonotic Dis</source>
<year>2007</year>
<volume>7</volume>
<fpage>199</fpage>
<lpage>202</lpage>
<pub-id pub-id-type="doi">10.1089/vbz.2006.0598</pub-id>
<pub-id pub-id-type="pmid">17627439</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<name>
<surname>Karbowiak</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Majláthová</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Hapunik</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Pet’ko</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Wita</surname>
<given-names>I</given-names>
</name>
<article-title>Apicomplexan parasites of red foxes (
<italic>Vulpes vulpes</italic>
) in northeastern Poland</article-title>
<source>Acta Parasitologica</source>
<year>2010</year>
<volume>55</volume>
<fpage>210</fpage>
<lpage>214</lpage>
<pub-id pub-id-type="doi">10.2478/s11686-010-0030-6</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<name>
<surname>Vojta</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Mrljak</surname>
<given-names>VC</given-names>
</name>
<name>
<surname>Urkovic’</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Ziviˇcnjak</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Marinculi’</surname>
<given-names>CA</given-names>
</name>
<name>
<surname>Beck</surname>
<given-names>R</given-names>
</name>
<article-title>Molecular epizootiology of canine hepatozoonosis in Croatia</article-title>
<source>Int J Parasitol</source>
<year>2009</year>
<volume>39</volume>
<fpage>1129</fpage>
<lpage>1136</lpage>
<pub-id pub-id-type="doi">10.1016/j.ijpara.2009.02.007</pub-id>
<pub-id pub-id-type="pmid">19249302</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<name>
<surname>Arnold</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Humer</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Heltai</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Murariu</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Spassov</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Hackländer</surname>
<given-names>K</given-names>
</name>
<article-title>Current status and distribution of golden jackals
<italic>Canis aureus</italic>
in Europe. Review</article-title>
<source>Mammal Rev</source>
<year>2012</year>
<volume>42</volume>
<fpage>1</fpage>
<lpage>11</lpage>
<pub-id pub-id-type="doi">10.1111/j.1365-2907.2011.00185.x</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="journal">
<name>
<surname>Szabó</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Heltai</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Szűcs</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Lanszki</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Lehoczki</surname>
<given-names>R</given-names>
</name>
<article-title>Expansion range of the golden jackal in Hungary between 1997 and 2006</article-title>
<source>Mammalia</source>
<year>2009</year>
<volume>73</volume>
<fpage>307</fpage>
<lpage>311</lpage>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Cortes</surname>
<given-names>HC</given-names>
</name>
<name>
<surname>Eyal</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Reis</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Lopes</surname>
<given-names>AP</given-names>
</name>
<name>
<surname>Vila-Viçosa</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>PA</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<article-title>Molecular and histopathological detection of
<italic>Hepatozoon canis</italic>
in red foxes (
<italic>Vulpes vulpes</italic>
) from Portugal</article-title>
<source>Parasit Vectors</source>
<year>2014</year>
<volume>7</volume>
<fpage>113</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-7-113</pub-id>
<pub-id pub-id-type="pmid">24655375</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<name>
<surname>Hornok</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Farkas</surname>
<given-names>R</given-names>
</name>
<article-title>First autochthonous infestation of dogs with
<italic>Rhipicephalus sanguineus</italic>
(Acari: Ixodidae) in Hungary: case report and review of current knowledge on this tick species [in Hungarian with English abstract]</article-title>
<source>Magy Allatorv Lap</source>
<year>2005</year>
<volume>127</volume>
<fpage>623</fpage>
<lpage>629</lpage>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<name>
<surname>Sréter</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Széll</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Varga</surname>
<given-names>I</given-names>
</name>
<article-title>Ectoparasite infestations of red foxes (
<italic>Vulpes vulpes</italic>
) in Hungary</article-title>
<source>Vet Parasitol</source>
<year>2003</year>
<volume>115</volume>
<fpage>349</fpage>
<lpage>354</lpage>
<pub-id pub-id-type="doi">10.1016/S0304-4017(03)00216-4</pub-id>
<pub-id pub-id-type="pmid">12944049</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<mixed-citation publication-type="journal">
<name>
<surname>Murata</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Inoue</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Taura</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Nakama</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Abe</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Fujisaki</surname>
<given-names>K</given-names>
</name>
<article-title>Detection of
<italic>Hepatozoon canis</italic>
oocyst from ticks collected from the infected dogs</article-title>
<source>J Vet Med Sci</source>
<year>1995</year>
<volume>57</volume>
<fpage>111</fpage>
<lpage>112</lpage>
<pub-id pub-id-type="doi">10.1292/jvms.57.111</pub-id>
<pub-id pub-id-type="pmid">7756400</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="book">
<name>
<surname>Pfister</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Beelitz</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Beck</surname>
<given-names>W</given-names>
</name>
<person-group person-group-type="editor">Kraft W, Dürr U</person-group>
<article-title>Parasitologische Diagnostik</article-title>
<source>Klinische Labordiagnositik in der Tiermedizin</source>
<year>2005</year>
<publisher-name>New York: Schattauer, Stuttgart</publisher-name>
<fpage>371</fpage>
<lpage>428</lpage>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<name>
<surname>Forlano</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Scofield</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Elisei</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Fernandes</surname>
<given-names>KR</given-names>
</name>
<name>
<surname>Pereira</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Velho</surname>
<given-names>PB</given-names>
</name>
<name>
<surname>Rubini</surname>
<given-names>AS</given-names>
</name>
<name>
<surname>Almosny</surname>
<given-names>NRP</given-names>
</name>
<article-title>Diagnosis of
<italic>Hepatozoon</italic>
spp. in
<italic>Amblyomma ovale</italic>
and its experimental transmission in domestic dogs in Brazil</article-title>
<source>Vet Parasitol</source>
<year>2005</year>
<volume>134</volume>
<fpage>1</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2005.05.066</pub-id>
<pub-id pub-id-type="pmid">16081219</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<mixed-citation publication-type="journal">
<name>
<surname>Giannelli</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Ramosa</surname>
<given-names>RFN</given-names>
</name>
<name>
<surname>Dantas-Torresa</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Mencke</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Otranto</surname>
<given-names>D</given-names>
</name>
<article-title>Experimental evidence against transmission of
<italic>Hepatozoon canis</italic>
by
<italic>Ixodes ricinus</italic>
.</article-title>
<source>Ticks Tick Borne Dis</source>
<year>2013</year>
<volume>4</volume>
<fpage>391</fpage>
<lpage>394</lpage>
<pub-id pub-id-type="doi">10.1016/j.ttbdis.2013.03.001</pub-id>
<pub-id pub-id-type="pmid">23727151</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<mixed-citation publication-type="journal">
<name>
<surname>de Miranda</surname>
<given-names>RL</given-names>
</name>
<name>
<surname>de Castro</surname>
<given-names>JR</given-names>
</name>
<name>
<surname>Olegário</surname>
<given-names>MM</given-names>
</name>
<name>
<surname>Beletti</surname>
<given-names>ME</given-names>
</name>
<name>
<surname>Mundim</surname>
<given-names>AV</given-names>
</name>
<name>
<surname>O’Dwyer</surname>
<given-names>LH</given-names>
</name>
<name>
<surname>Eyal</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Talmi-Frank</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Cury</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<article-title>Oocysts of
<italic>Hepatozoon canis</italic>
in
<italic>Rhipicephalus</italic>
(
<italic>Boophilus</italic>
)
<italic>microplus</italic>
collected from a naturally infected dog</article-title>
<source>Vet Parasitol</source>
<year>2011</year>
<volume>177</volume>
<fpage>392</fpage>
<lpage>396</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2011.01.044</pub-id>
<pub-id pub-id-type="pmid">21324597</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/RenardV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000050  | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000050  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    RenardV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.27.
Data generation: Tue Mar 28 00:55:51 2017. Site generation: Thu Jan 4 16:57:14 2024