Serveur d'exploration sur le renard

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 000017 ( Pmc/Corpus ); précédent : 0000169; suivant : 0000180 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">First report of
<italic>Anaplasma platys</italic>
infection in red foxes (
<italic>Vulpes vulpes</italic>
) and molecular detection of
<italic>Ehrlichia canis</italic>
and
<italic>Leishmania infantum</italic>
in foxes from Portugal</title>
<author>
<name sortKey="Cardoso, Luis" sort="Cardoso, Luis" uniqKey="Cardoso L" first="Luís" last="Cardoso">Luís Cardoso</name>
<affiliation>
<nlm:aff id="Aff1">Department of Veterinary Sciences, School of Agrarian and Veterinary Sciences, Universidade de Trás-os-Montes e Alto Douro (UTAD), Vila Real, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Gilad, Matan" sort="Gilad, Matan" uniqKey="Gilad M" first="Matan" last="Gilad">Matan Gilad</name>
<affiliation>
<nlm:aff id="Aff2">Koret School of Veterinary Medicine, The Hebrew University of Jerusalem, Rehovot, Israel</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Cortes, Helder Ce" sort="Cortes, Helder Ce" uniqKey="Cortes H" first="Helder Ce" last="Cortes">Helder Ce Cortes</name>
<affiliation>
<nlm:aff id="Aff3">Victor Caeiro Laboratory of Parasitology, Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM), University of Évora, Évora, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Nachum Biala, Yaarit" sort="Nachum Biala, Yaarit" uniqKey="Nachum Biala Y" first="Yaarit" last="Nachum-Biala">Yaarit Nachum-Biala</name>
<affiliation>
<nlm:aff id="Aff2">Koret School of Veterinary Medicine, The Hebrew University of Jerusalem, Rehovot, Israel</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lopes, Ana Patricia" sort="Lopes, Ana Patricia" uniqKey="Lopes A" first="Ana Patrícia" last="Lopes">Ana Patrícia Lopes</name>
<affiliation>
<nlm:aff id="Aff1">Department of Veterinary Sciences, School of Agrarian and Veterinary Sciences, Universidade de Trás-os-Montes e Alto Douro (UTAD), Vila Real, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff4">Animal and Veterinary Research Centre, UTAD, Vila Real, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Vila Vicosa, Maria Joao" sort="Vila Vicosa, Maria Joao" uniqKey="Vila Vicosa M" first="Maria João" last="Vila-Viçosa">Maria João Vila-Viçosa</name>
<affiliation>
<nlm:aff id="Aff3">Victor Caeiro Laboratory of Parasitology, Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM), University of Évora, Évora, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sim Es, Margarida" sort="Sim Es, Margarida" uniqKey="Sim Es M" first="Margarida" last="Sim Es">Margarida Sim Es</name>
<affiliation>
<nlm:aff id="Aff3">Victor Caeiro Laboratory of Parasitology, Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM), University of Évora, Évora, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Rodrigues, Paula A" sort="Rodrigues, Paula A" uniqKey="Rodrigues P" first="Paula A" last="Rodrigues">Paula A. Rodrigues</name>
<affiliation>
<nlm:aff id="Aff1">Department of Veterinary Sciences, School of Agrarian and Veterinary Sciences, Universidade de Trás-os-Montes e Alto Douro (UTAD), Vila Real, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Baneth, Gad" sort="Baneth, Gad" uniqKey="Baneth G" first="Gad" last="Baneth">Gad Baneth</name>
<affiliation>
<nlm:aff id="Aff2">Koret School of Veterinary Medicine, The Hebrew University of Jerusalem, Rehovot, Israel</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">25889750</idno>
<idno type="pmc">4369893</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4369893</idno>
<idno type="RBID">PMC:4369893</idno>
<idno type="doi">10.1186/s13071-015-0756-y</idno>
<date when="2015">2015</date>
<idno type="wicri:Area/Pmc/Corpus">000017</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000017</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">First report of
<italic>Anaplasma platys</italic>
infection in red foxes (
<italic>Vulpes vulpes</italic>
) and molecular detection of
<italic>Ehrlichia canis</italic>
and
<italic>Leishmania infantum</italic>
in foxes from Portugal</title>
<author>
<name sortKey="Cardoso, Luis" sort="Cardoso, Luis" uniqKey="Cardoso L" first="Luís" last="Cardoso">Luís Cardoso</name>
<affiliation>
<nlm:aff id="Aff1">Department of Veterinary Sciences, School of Agrarian and Veterinary Sciences, Universidade de Trás-os-Montes e Alto Douro (UTAD), Vila Real, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Gilad, Matan" sort="Gilad, Matan" uniqKey="Gilad M" first="Matan" last="Gilad">Matan Gilad</name>
<affiliation>
<nlm:aff id="Aff2">Koret School of Veterinary Medicine, The Hebrew University of Jerusalem, Rehovot, Israel</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Cortes, Helder Ce" sort="Cortes, Helder Ce" uniqKey="Cortes H" first="Helder Ce" last="Cortes">Helder Ce Cortes</name>
<affiliation>
<nlm:aff id="Aff3">Victor Caeiro Laboratory of Parasitology, Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM), University of Évora, Évora, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Nachum Biala, Yaarit" sort="Nachum Biala, Yaarit" uniqKey="Nachum Biala Y" first="Yaarit" last="Nachum-Biala">Yaarit Nachum-Biala</name>
<affiliation>
<nlm:aff id="Aff2">Koret School of Veterinary Medicine, The Hebrew University of Jerusalem, Rehovot, Israel</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Lopes, Ana Patricia" sort="Lopes, Ana Patricia" uniqKey="Lopes A" first="Ana Patrícia" last="Lopes">Ana Patrícia Lopes</name>
<affiliation>
<nlm:aff id="Aff1">Department of Veterinary Sciences, School of Agrarian and Veterinary Sciences, Universidade de Trás-os-Montes e Alto Douro (UTAD), Vila Real, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff4">Animal and Veterinary Research Centre, UTAD, Vila Real, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Vila Vicosa, Maria Joao" sort="Vila Vicosa, Maria Joao" uniqKey="Vila Vicosa M" first="Maria João" last="Vila-Viçosa">Maria João Vila-Viçosa</name>
<affiliation>
<nlm:aff id="Aff3">Victor Caeiro Laboratory of Parasitology, Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM), University of Évora, Évora, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Sim Es, Margarida" sort="Sim Es, Margarida" uniqKey="Sim Es M" first="Margarida" last="Sim Es">Margarida Sim Es</name>
<affiliation>
<nlm:aff id="Aff3">Victor Caeiro Laboratory of Parasitology, Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM), University of Évora, Évora, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Rodrigues, Paula A" sort="Rodrigues, Paula A" uniqKey="Rodrigues P" first="Paula A" last="Rodrigues">Paula A. Rodrigues</name>
<affiliation>
<nlm:aff id="Aff1">Department of Veterinary Sciences, School of Agrarian and Veterinary Sciences, Universidade de Trás-os-Montes e Alto Douro (UTAD), Vila Real, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Baneth, Gad" sort="Baneth, Gad" uniqKey="Baneth G" first="Gad" last="Baneth">Gad Baneth</name>
<affiliation>
<nlm:aff id="Aff2">Koret School of Veterinary Medicine, The Hebrew University of Jerusalem, Rehovot, Israel</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Parasites & Vectors</title>
<idno type="eISSN">1756-3305</idno>
<imprint>
<date when="2015">2015</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>The bacteria
<italic>Anaplasma platys</italic>
and
<italic>Ehrlichia canis</italic>
and the protozoan
<italic>Leishmania infantum</italic>
are vector-borne agents that cause canine vector-borne diseases, some of which are zoonotic. The present survey investigated the prevalence of
<italic>Anaplasma</italic>
,
<italic>Ehrlichia</italic>
and
<italic>Leishmania</italic>
in red foxes (
<italic>Vulpes vulpes</italic>
) from Portugal by molecular analysis, in order to evaluate the epidemiological role of these canids as reservoirs of infection.</p>
</sec>
<sec>
<title>Methods</title>
<p>Blood and/or bone marrow samples were collected from 78 red foxes obtained in eight districts of northern, central and southern Portugal. Real-time polymerase chain reactions (PCR) amplified a 123 bp fragment of the 16S rRNA gene of
<italic>Anaplasma</italic>
spp. and
<italic>Ehrlichia</italic>
spp. and a 265 bp fragment of the
<italic>L. infantum</italic>
internal transcribed spacer one (ITS1) region of the rRNA operon evaluated by PCR-high resolution melt analysis (PCR-HRM), with sequencing of the DNA products. A phylogenetic analysis was carried out to compare these to other sequences from
<italic>Anaplasma</italic>
spp. and
<italic>Ehrlichia</italic>
spp. deposited in GenBank®.</p>
</sec>
<sec>
<title>Results</title>
<p>
<italic>A. platys</italic>
was detected in 10 (14.5%) and
<italic>E. canis</italic>
in two (2.9%) out of 69 foxes; and
<italic>L. infantum</italic>
was detected in one (1.3%) of the 78 foxes. The prevalence of
<italic>A. platys</italic>
was significantly different from the prevalence of
<italic>E. canis</italic>
(
<italic>p</italic>
=0.016) and from that of
<italic>L. infantum</italic>
(
<italic>p</italic>
=0.002). No co-infections were found in any one of the 78 foxes. No statistically significant differences were found between the type of sample (blood and bone marrow), geographic regions (north/centre and south), age (<2 years and ≥2 years) and gender for any one of the agents.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>This is the first known report of
<italic>A. platys</italic>
in red foxes worldwide, as well as the first molecular evidence of
<italic>E. canis</italic>
in foxes from Portugal. The moderate prevalence of
<italic>A. platys</italic>
suggests that red foxes may play a role in the epidemiology of infection with this bacterium and serve as a reservoir for domestic dogs.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Otranto, D" uniqKey="Otranto D">D Otranto</name>
</author>
<author>
<name sortKey="Dantas Torres, F" uniqKey="Dantas Torres F">F Dantas-Torres</name>
</author>
<author>
<name sortKey="Breitschwerdt, Eb" uniqKey="Breitschwerdt E">EB Breitschwerdt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dantas Torres, F" uniqKey="Dantas Torres F">F Dantas-Torres</name>
</author>
<author>
<name sortKey="Latrofa, Ms" uniqKey="Latrofa M">MS Latrofa</name>
</author>
<author>
<name sortKey="Annoscia, G" uniqKey="Annoscia G">G Annoscia</name>
</author>
<author>
<name sortKey="Giannelli, A" uniqKey="Giannelli A">A Giannelli</name>
</author>
<author>
<name sortKey="Parisi, A" uniqKey="Parisi A">A Parisi</name>
</author>
<author>
<name sortKey="Otranto, D" uniqKey="Otranto D">D Otranto</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shaw, Se" uniqKey="Shaw S">SE Shaw</name>
</author>
<author>
<name sortKey="Day, Mj" uniqKey="Day M">MJ Day</name>
</author>
<author>
<name sortKey="Birtles, Rj" uniqKey="Birtles R">RJ Birtles</name>
</author>
<author>
<name sortKey="Breitschwerdt, Eb" uniqKey="Breitschwerdt E">EB Breitschwerdt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Alleman, Ar" uniqKey="Alleman A">AR Alleman</name>
</author>
<author>
<name sortKey="Wamsley, Hl" uniqKey="Wamsley H">HL Wamsley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Harrus, S" uniqKey="Harrus S">S Harrus</name>
</author>
<author>
<name sortKey="Aroch, I" uniqKey="Aroch I">I Aroch</name>
</author>
<author>
<name sortKey="Lavy, E" uniqKey="Lavy E">E Lavy</name>
</author>
<author>
<name sortKey="Bark, H" uniqKey="Bark H">H Bark</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="De Tommasi, As" uniqKey="De Tommasi A">AS De Tommasi</name>
</author>
<author>
<name sortKey="Otranto, D" uniqKey="Otranto D">D Otranto</name>
</author>
<author>
<name sortKey="Furlanello, T" uniqKey="Furlanello T">T Furlanello</name>
</author>
<author>
<name sortKey="Tasca, S" uniqKey="Tasca S">S Tasca</name>
</author>
<author>
<name sortKey="Cantacessi, C" uniqKey="Cantacessi C">C Cantacessi</name>
</author>
<author>
<name sortKey="Breitschwerdt, Eb" uniqKey="Breitschwerdt E">EB Breitschwerdt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Maggi, Rg" uniqKey="Maggi R">RG Maggi</name>
</author>
<author>
<name sortKey="Mascarelli, Pe" uniqKey="Mascarelli P">PE Mascarelli</name>
</author>
<author>
<name sortKey="Havenga, Ln" uniqKey="Havenga L">LN Havenga</name>
</author>
<author>
<name sortKey="Naidoo, V" uniqKey="Naidoo V">V Naidoo</name>
</author>
<author>
<name sortKey="Breitschwerdt, Eb" uniqKey="Breitschwerdt E">EB Breitschwerdt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Breitschwerdt, Eb" uniqKey="Breitschwerdt E">EB Breitschwerdt</name>
</author>
<author>
<name sortKey="Hegarty, Bc" uniqKey="Hegarty B">BC Hegarty</name>
</author>
<author>
<name sortKey="Qurollo, Ba" uniqKey="Qurollo B">BA Qurollo</name>
</author>
<author>
<name sortKey="Saito, Tb" uniqKey="Saito T">TB Saito</name>
</author>
<author>
<name sortKey="Maggi, Rg" uniqKey="Maggi R">RG Maggi</name>
</author>
<author>
<name sortKey="Blanton, Ls" uniqKey="Blanton L">LS Blanton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arraga Alvarado, Cm" uniqKey="Arraga Alvarado C">CM Arraga-Alvarado</name>
</author>
<author>
<name sortKey="Qurollo, Ba" uniqKey="Qurollo B">BA Qurollo</name>
</author>
<author>
<name sortKey="Parra, Oc" uniqKey="Parra O">OC Parra</name>
</author>
<author>
<name sortKey="Berrueta, Ma" uniqKey="Berrueta M">MA Berrueta</name>
</author>
<author>
<name sortKey="Hegarty, Bc" uniqKey="Hegarty B">BC Hegarty</name>
</author>
<author>
<name sortKey="Breitschwerdt, Eb" uniqKey="Breitschwerdt E">EB Breitschwerdt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Neer, Tm" uniqKey="Neer T">TM Neer</name>
</author>
<author>
<name sortKey="Breitschwerdt, Eb" uniqKey="Breitschwerdt E">EB Breitschwerdt</name>
</author>
<author>
<name sortKey="Greene, Rt" uniqKey="Greene R">RT Greene</name>
</author>
<author>
<name sortKey="Lappin, Mr" uniqKey="Lappin M">MR Lappin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Harrus, S" uniqKey="Harrus S">S Harrus</name>
</author>
<author>
<name sortKey="Bark, H" uniqKey="Bark H">H Bark</name>
</author>
<author>
<name sortKey="Waner, T" uniqKey="Waner T">T Waner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fishman, Z" uniqKey="Fishman Z">Z Fishman</name>
</author>
<author>
<name sortKey="Gonen, L" uniqKey="Gonen L">L Gonen</name>
</author>
<author>
<name sortKey="Harrus, S" uniqKey="Harrus S">S Harrus</name>
</author>
<author>
<name sortKey="Strauss Ayali, D" uniqKey="Strauss Ayali D">D Strauss-Ayali</name>
</author>
<author>
<name sortKey="King, R" uniqKey="King R">R King</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Maia, C" uniqKey="Maia C">C Maia</name>
</author>
<author>
<name sortKey="Ramos, C" uniqKey="Ramos C">C Ramos</name>
</author>
<author>
<name sortKey="Coimbra, M" uniqKey="Coimbra M">M Coimbra</name>
</author>
<author>
<name sortKey="Bastos, F" uniqKey="Bastos F">F Bastos</name>
</author>
<author>
<name sortKey="Martins, A" uniqKey="Martins A">A Martins</name>
</author>
<author>
<name sortKey="Pinto, P" uniqKey="Pinto P">P Pinto</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Perez, M" uniqKey="Perez M">M Perez</name>
</author>
<author>
<name sortKey="Bodor, M" uniqKey="Bodor M">M Bodor</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C Zhang</name>
</author>
<author>
<name sortKey="Xiong, Q" uniqKey="Xiong Q">Q Xiong</name>
</author>
<author>
<name sortKey="Rikihisa, Y" uniqKey="Rikihisa Y">Y Rikihisa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schallig, Hd" uniqKey="Schallig H">HD Schallig</name>
</author>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Semiao Santos, Sj" uniqKey="Semiao Santos S">SJ Semião-Santos</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bourdeau, P" uniqKey="Bourdeau P">P Bourdeau</name>
</author>
<author>
<name sortKey="Saridomichelakis, Mn" uniqKey="Saridomichelakis M">MN Saridomichelakis</name>
</author>
<author>
<name sortKey="Oliveira, A" uniqKey="Oliveira A">A Oliveira</name>
</author>
<author>
<name sortKey="Oliva, G" uniqKey="Oliva G">G Oliva</name>
</author>
<author>
<name sortKey="Kotnik, T" uniqKey="Kotnik T">T Kotnik</name>
</author>
<author>
<name sortKey="Galvez, R" uniqKey="Galvez R">R Gálvez</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Desjeux, P" uniqKey="Desjeux P">P Desjeux</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Koutinas, Af" uniqKey="Koutinas A">AF Koutinas</name>
</author>
<author>
<name sortKey="Polizopoulou, Zs" uniqKey="Polizopoulou Z">ZS Polizopoulou</name>
</author>
<author>
<name sortKey="Saridomichelakis, Mn" uniqKey="Saridomichelakis M">MN Saridomichelakis</name>
</author>
<author>
<name sortKey="Argyriadis, D" uniqKey="Argyriadis D">D Argyriadis</name>
</author>
<author>
<name sortKey="Fytianou, A" uniqKey="Fytianou A">A Fytianou</name>
</author>
<author>
<name sortKey="Plevraki, Kg" uniqKey="Plevraki K">KG Plevraki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Solano Gallego, L" uniqKey="Solano Gallego L">L Solano-Gallego</name>
</author>
<author>
<name sortKey="Mir, G" uniqKey="Mir G">G Miró</name>
</author>
<author>
<name sortKey="Koutinas, A" uniqKey="Koutinas A">A Koutinas</name>
</author>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Pennisi, Mg" uniqKey="Pennisi M">MG Pennisi</name>
</author>
<author>
<name sortKey="Ferrer, L" uniqKey="Ferrer L">L Ferrer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
<author>
<name sortKey="Dank, G" uniqKey="Dank G">G Dank</name>
</author>
<author>
<name sortKey="Keren Kornblatt, E" uniqKey="Keren Kornblatt E">E Keren-Kornblatt</name>
</author>
<author>
<name sortKey="Sekeles, E" uniqKey="Sekeles E">E Sekeles</name>
</author>
<author>
<name sortKey="Adini, I" uniqKey="Adini I">I Adini</name>
</author>
<author>
<name sortKey="Eisenberger, Cl" uniqKey="Eisenberger C">CL Eisenberger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Duscher, G" uniqKey="Duscher G">G Duscher</name>
</author>
<author>
<name sortKey="Fuehrer, Hp" uniqKey="Fuehrer H">HP Fuehrer</name>
</author>
<author>
<name sortKey="Kubber Heiss, A" uniqKey="Kubber Heiss A">A Kübber-Heiss</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Tuna, J" uniqKey="Tuna J">J Tuna</name>
</author>
<author>
<name sortKey="Vieira, L" uniqKey="Vieira L">L Vieira</name>
</author>
<author>
<name sortKey="Yisaschar Mekuzas, Y" uniqKey="Yisaschar Mekuzas Y">Y Yisaschar-Mekuzas</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Yisaschar Mekuzas, Y" uniqKey="Yisaschar Mekuzas Y">Y Yisaschar-Mekuzas</name>
</author>
<author>
<name sortKey="Rodrigues, Ft" uniqKey="Rodrigues F">FT Rodrigues</name>
</author>
<author>
<name sortKey="Costa, A" uniqKey="Costa A">A Costa</name>
</author>
<author>
<name sortKey="Machado, J" uniqKey="Machado J">J Machado</name>
</author>
<author>
<name sortKey="Diz Lopes, D" uniqKey="Diz Lopes D">D Diz-Lopes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rene Martellet, M" uniqKey="Rene Martellet M">M René-Martellet</name>
</author>
<author>
<name sortKey="Lebert, I" uniqKey="Lebert I">I Lebert</name>
</author>
<author>
<name sortKey="Chene, J" uniqKey="Chene J">J Chêne</name>
</author>
<author>
<name sortKey="Massot, R" uniqKey="Massot R">R Massot</name>
</author>
<author>
<name sortKey="Leon, M" uniqKey="Leon M">M Leon</name>
</author>
<author>
<name sortKey="Leal, A" uniqKey="Leal A">A Leal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Cortes, Hc" uniqKey="Cortes H">HC Cortes</name>
</author>
<author>
<name sortKey="Eyal, O" uniqKey="Eyal O">O Eyal</name>
</author>
<author>
<name sortKey="Reis, A" uniqKey="Reis A">A Reis</name>
</author>
<author>
<name sortKey="Lopes, Ap" uniqKey="Lopes A">AP Lopes</name>
</author>
<author>
<name sortKey="Vila Vicosa, Mj" uniqKey="Vila Vicosa M">MJ Vila-Viçosa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Saenz De Buruaga, M" uniqKey="Saenz De Buruaga M">M Saénz-de-Buruaga</name>
</author>
<author>
<name sortKey="Lucio, Aj" uniqKey="Lucio A">AJ Lucio</name>
</author>
<author>
<name sortKey="Purroy, J" uniqKey="Purroy J">J Purroy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Davidson, Rk" uniqKey="Davidson R">RK Davidson</name>
</author>
<author>
<name sortKey="Gjerde, B" uniqKey="Gjerde B">B Gjerde</name>
</author>
<author>
<name sortKey="Vik Ren, T" uniqKey="Vik Ren T">T Vikøren</name>
</author>
<author>
<name sortKey="Lillehaug, A" uniqKey="Lillehaug A">A Lillehaug</name>
</author>
<author>
<name sortKey="Handeland, K" uniqKey="Handeland K">K Handeland</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Peleg, O" uniqKey="Peleg O">O Peleg</name>
</author>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
<author>
<name sortKey="Eyal, O" uniqKey="Eyal O">O Eyal</name>
</author>
<author>
<name sortKey="Inbar, J" uniqKey="Inbar J">J Inbar</name>
</author>
<author>
<name sortKey="Harrus, S" uniqKey="Harrus S">S Harrus</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Waner, T" uniqKey="Waner T">T Waner</name>
</author>
<author>
<name sortKey="Nachum Biala, Y" uniqKey="Nachum Biala Y">Y Nachum-Biala</name>
</author>
<author>
<name sortKey="Harrus, S" uniqKey="Harrus S">S Harrus</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Roux, V" uniqKey="Roux V">V Roux</name>
</author>
<author>
<name sortKey="Camicas, Jl" uniqKey="Camicas J">JL Camicas</name>
</author>
<author>
<name sortKey="Baradji, I" uniqKey="Baradji I">I Baradji</name>
</author>
<author>
<name sortKey="Brouqui, P" uniqKey="Brouqui P">P Brouqui</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Talmi Frank, D" uniqKey="Talmi Frank D">D Talmi-Frank</name>
</author>
<author>
<name sortKey="Nasereddin, A" uniqKey="Nasereddin A">A Nasereddin</name>
</author>
<author>
<name sortKey="Schnur, Lf" uniqKey="Schnur L">LF Schnur</name>
</author>
<author>
<name sortKey="Schonian, G" uniqKey="Schonian G">G Schönian</name>
</author>
<author>
<name sortKey="Toz, So" uniqKey="Toz S">SO Töz</name>
</author>
<author>
<name sortKey="Jaffe, Cl" uniqKey="Jaffe C">CL Jaffe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tamura, K" uniqKey="Tamura K">K Tamura</name>
</author>
<author>
<name sortKey="Stecher, G" uniqKey="Stecher G">G Stecher</name>
</author>
<author>
<name sortKey="Peterson, D" uniqKey="Peterson D">D Peterson</name>
</author>
<author>
<name sortKey="Filipski, A" uniqKey="Filipski A">A Filipski</name>
</author>
<author>
<name sortKey="Kumar, S" uniqKey="Kumar S">S Kumar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Petrie, A" uniqKey="Petrie A">A Petrie</name>
</author>
<author>
<name sortKey="Watson, P" uniqKey="Watson P">P Watson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Cortes, Hc" uniqKey="Cortes H">HC Cortes</name>
</author>
<author>
<name sortKey="Reis, A" uniqKey="Reis A">A Reis</name>
</author>
<author>
<name sortKey="Rodrigues, P" uniqKey="Rodrigues P">P Rodrigues</name>
</author>
<author>
<name sortKey="Sim Es, M" uniqKey="Sim Es M">M Simões</name>
</author>
<author>
<name sortKey="Lopes, Ap" uniqKey="Lopes A">AP Lopes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Maia, C" uniqKey="Maia C">C Maia</name>
</author>
<author>
<name sortKey="Ferreira, A" uniqKey="Ferreira A">A Ferreira</name>
</author>
<author>
<name sortKey="Nunes, M" uniqKey="Nunes M">M Nunes</name>
</author>
<author>
<name sortKey="Vieira, Ml" uniqKey="Vieira M">ML Vieira</name>
</author>
<author>
<name sortKey="Campino, L" uniqKey="Campino L">L Campino</name>
</author>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Caeiro, V" uniqKey="Caeiro V">V Caeiro</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Santos Silva, Mm" uniqKey="Santos Silva M">MM Santos-Silva</name>
</author>
<author>
<name sortKey="Beati, L" uniqKey="Beati L">L Beati</name>
</author>
<author>
<name sortKey="Santos, As" uniqKey="Santos A">AS Santos</name>
</author>
<author>
<name sortKey="De Sousa, R" uniqKey="De Sousa R">R De Sousa</name>
</author>
<author>
<name sortKey="Nuncio, Ms" uniqKey="Nuncio M">MS Núncio</name>
</author>
<author>
<name sortKey="Melo, P" uniqKey="Melo P">P Melo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Santos, As" uniqKey="Santos A">AS Santos</name>
</author>
<author>
<name sortKey="Alexandre, N" uniqKey="Alexandre N">N Alexandre</name>
</author>
<author>
<name sortKey="Sousa, R" uniqKey="Sousa R">R Sousa</name>
</author>
<author>
<name sortKey="Nuncio, Ms" uniqKey="Nuncio M">MS Núncio</name>
</author>
<author>
<name sortKey="Bacellar, F" uniqKey="Bacellar F">F Bacellar</name>
</author>
<author>
<name sortKey="Dumler, Js" uniqKey="Dumler J">JS Dumler</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Alexandre, N" uniqKey="Alexandre N">N Alexandre</name>
</author>
<author>
<name sortKey="Santos, As" uniqKey="Santos A">AS Santos</name>
</author>
<author>
<name sortKey="Nuncio, Ms" uniqKey="Nuncio M">MS Núncio</name>
</author>
<author>
<name sortKey="De Sousa, R" uniqKey="De Sousa R">R De Sousa</name>
</author>
<author>
<name sortKey="Boinas, F" uniqKey="Boinas F">F Boinas</name>
</author>
<author>
<name sortKey="Bacellar, F" uniqKey="Bacellar F">F Bacellar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Millan, J" uniqKey="Millan J">J Millán</name>
</author>
<author>
<name sortKey="Candela, Mg" uniqKey="Candela M">MG Candela</name>
</author>
<author>
<name sortKey="Palomares, F" uniqKey="Palomares F">F Palomares</name>
</author>
<author>
<name sortKey="Cubero, Mj" uniqKey="Cubero M">MJ Cubero</name>
</author>
<author>
<name sortKey="Rodriguez, A" uniqKey="Rodriguez A">A Rodríguez</name>
</author>
<author>
<name sortKey="Barral, M" uniqKey="Barral M">M Barral</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ebani, Vv" uniqKey="Ebani V">VV Ebani</name>
</author>
<author>
<name sortKey="Verin, R" uniqKey="Verin R">R Verin</name>
</author>
<author>
<name sortKey="Fratini, F" uniqKey="Fratini F">F Fratini</name>
</author>
<author>
<name sortKey="Poli, A" uniqKey="Poli A">A Poli</name>
</author>
<author>
<name sortKey="Cerri, D" uniqKey="Cerri D">D Cerri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Torina, A" uniqKey="Torina A">A Torina</name>
</author>
<author>
<name sortKey="Blanda, V" uniqKey="Blanda V">V Blanda</name>
</author>
<author>
<name sortKey="Antoci, F" uniqKey="Antoci F">F Antoci</name>
</author>
<author>
<name sortKey="Scimeca, S" uniqKey="Scimeca S">S Scimeca</name>
</author>
<author>
<name sortKey="D Gostino, R" uniqKey="D Gostino R">R D’Agostino</name>
</author>
<author>
<name sortKey="Scariano, E" uniqKey="Scariano E">E Scariano</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cortes, S" uniqKey="Cortes S">S Cortes</name>
</author>
<author>
<name sortKey="Vaz, Y" uniqKey="Vaz Y">Y Vaz</name>
</author>
<author>
<name sortKey="Neves, R" uniqKey="Neves R">R Neves</name>
</author>
<author>
<name sortKey="Maia, C" uniqKey="Maia C">C Maia</name>
</author>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Campino, L" uniqKey="Campino L">L Campino</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Maia, C" uniqKey="Maia C">C Maia</name>
</author>
<author>
<name sortKey="Gomes, J" uniqKey="Gomes J">J Gomes</name>
</author>
<author>
<name sortKey="Crist Vao, J" uniqKey="Crist Vao J">J Cristóvão</name>
</author>
<author>
<name sortKey="Nunes, M" uniqKey="Nunes M">M Nunes</name>
</author>
<author>
<name sortKey="Martins, A" uniqKey="Martins A">A Martins</name>
</author>
<author>
<name sortKey="Rebelo, E" uniqKey="Rebelo E">E Rebêlo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vilhena, H" uniqKey="Vilhena H">H Vilhena</name>
</author>
<author>
<name sortKey="Martinez Diaz, Vl" uniqKey="Martinez Diaz V">VL Martinez-Díaz</name>
</author>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Vieira, L" uniqKey="Vieira L">L Vieira</name>
</author>
<author>
<name sortKey="Altet, L" uniqKey="Altet L">L Altet</name>
</author>
<author>
<name sortKey="Francino, O" uniqKey="Francino O">O Francino</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abranches, P" uniqKey="Abranches P">P Abranches</name>
</author>
<author>
<name sortKey="Conceicao Silva, Fm" uniqKey="Conceicao Silva F">FM Conceição-Silva</name>
</author>
<author>
<name sortKey="Silva Pereira, Mc" uniqKey="Silva Pereira M">MC Silva-Pereira</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rioux, Ja" uniqKey="Rioux J">JA Rioux</name>
</author>
<author>
<name sortKey="Albaret, Jl" uniqKey="Albaret J">JL Albaret</name>
</author>
<author>
<name sortKey="Houin, R" uniqKey="Houin R">R Houin</name>
</author>
<author>
<name sortKey="Dedet, Jp" uniqKey="Dedet J">JP Dedet</name>
</author>
<author>
<name sortKey="Lanotte, G" uniqKey="Lanotte G">G Lanotte</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bettini, S" uniqKey="Bettini S">S Bettini</name>
</author>
<author>
<name sortKey="Pozio, E" uniqKey="Pozio E">E Pozio</name>
</author>
<author>
<name sortKey="Gradoni, L" uniqKey="Gradoni L">L Gradoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Martin Iniesta, F" uniqKey="Martin Iniesta F">F Martín-Iniesta</name>
</author>
<author>
<name sortKey="Martin Iniesta, E" uniqKey="Martin Iniesta E">E Martín-Iniesta</name>
</author>
<author>
<name sortKey="Martin Luengo, F" uniqKey="Martin Luengo F">F Martin-Luengo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sobrino, R" uniqKey="Sobrino R">R Sobrino</name>
</author>
<author>
<name sortKey="Ferroglio, E" uniqKey="Ferroglio E">E Ferroglio</name>
</author>
<author>
<name sortKey="Oleaga, A" uniqKey="Oleaga A">A Oleaga</name>
</author>
<author>
<name sortKey="Romano, A" uniqKey="Romano A">A Romano</name>
</author>
<author>
<name sortKey="Millan, J" uniqKey="Millan J">J Millan</name>
</author>
<author>
<name sortKey="Revilla, M" uniqKey="Revilla M">M Revilla</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Davoust, B" uniqKey="Davoust B">B Davoust</name>
</author>
<author>
<name sortKey="Mary, C" uniqKey="Mary C">C Mary</name>
</author>
<author>
<name sortKey="Marie, Jl" uniqKey="Marie J">JL Marié</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dipineto, L" uniqKey="Dipineto L">L Dipineto</name>
</author>
<author>
<name sortKey="Manna, L" uniqKey="Manna L">L Manna</name>
</author>
<author>
<name sortKey="Baiano, A" uniqKey="Baiano A">A Baiano</name>
</author>
<author>
<name sortKey="Gala, M" uniqKey="Gala M">M Gala</name>
</author>
<author>
<name sortKey="Fioretti, A" uniqKey="Fioretti A">A Fioretti</name>
</author>
<author>
<name sortKey="Gravino, Ae" uniqKey="Gravino A">AE Gravino</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Verin, R" uniqKey="Verin R">R Verin</name>
</author>
<author>
<name sortKey="Poli, A" uniqKey="Poli A">A Poli</name>
</author>
<author>
<name sortKey="Ariti, G" uniqKey="Ariti G">G Ariti</name>
</author>
<author>
<name sortKey="Nardoni, S" uniqKey="Nardoni S">S Nardoni</name>
</author>
<author>
<name sortKey="Fanucchi Bertuccelli, M" uniqKey="Fanucchi Bertuccelli M">M Fanucchi Bertuccelli</name>
</author>
<author>
<name sortKey="Mancianti, F" uniqKey="Mancianti F">F Mancianti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rioux, Ja" uniqKey="Rioux J">JA Rioux</name>
</author>
<author>
<name sortKey="Lanotte, G" uniqKey="Lanotte G">G Lanotte</name>
</author>
<author>
<name sortKey="Destombes, P" uniqKey="Destombes P">P Destombes</name>
</author>
<author>
<name sortKey="Vollhardt, Y" uniqKey="Vollhardt Y">Y Vollhardt</name>
</author>
<author>
<name sortKey="Croset, H" uniqKey="Croset H">H Croset</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Millan, J" uniqKey="Millan J">J Millán</name>
</author>
<author>
<name sortKey="Ferroglio, E" uniqKey="Ferroglio E">E Ferroglio</name>
</author>
<author>
<name sortKey="Solano Gallego, L" uniqKey="Solano Gallego L">L Solano-Gallego</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cardoso, L" uniqKey="Cardoso L">L Cardoso</name>
</author>
<author>
<name sortKey="Mendao, C" uniqKey="Mendao C">C Mendão</name>
</author>
<author>
<name sortKey="Madeira De Carvalho, L" uniqKey="Madeira De Carvalho L">L Madeira De Carvalho</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Campino, L" uniqKey="Campino L">L Campino</name>
</author>
<author>
<name sortKey="Maia, C" uniqKey="Maia C">C Maia</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Parasit Vectors</journal-id>
<journal-id journal-id-type="iso-abbrev">Parasit Vectors</journal-id>
<journal-title-group>
<journal-title>Parasites & Vectors</journal-title>
</journal-title-group>
<issn pub-type="epub">1756-3305</issn>
<publisher>
<publisher-name>BioMed Central</publisher-name>
<publisher-loc>London</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">25889750</article-id>
<article-id pub-id-type="pmc">4369893</article-id>
<article-id pub-id-type="publisher-id">756</article-id>
<article-id pub-id-type="doi">10.1186/s13071-015-0756-y</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>First report of
<italic>Anaplasma platys</italic>
infection in red foxes (
<italic>Vulpes vulpes</italic>
) and molecular detection of
<italic>Ehrlichia canis</italic>
and
<italic>Leishmania infantum</italic>
in foxes from Portugal</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes" equal-contrib="yes">
<name>
<surname>Cardoso</surname>
<given-names>Luís</given-names>
</name>
<address>
<email>lcardoso@utad.pt</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Gilad</surname>
<given-names>Matan</given-names>
</name>
<address>
<email>matangilaad@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Cortes</surname>
<given-names>Helder CE</given-names>
</name>
<address>
<email>heldercortes@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Nachum-Biala</surname>
<given-names>Yaarit</given-names>
</name>
<address>
<email>yaarit.biala@mail.huji.ac.il</email>
</address>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Lopes</surname>
<given-names>Ana Patrícia</given-names>
</name>
<address>
<email>aplopes@utad.pt</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
<xref ref-type="aff" rid="Aff4"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Vila-Viçosa</surname>
<given-names>Maria João</given-names>
</name>
<address>
<email>mjoaovv@uevora.pt</email>
</address>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Simões</surname>
<given-names>Margarida</given-names>
</name>
<address>
<email>maggiesimo@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Rodrigues</surname>
<given-names>Paula A</given-names>
</name>
<address>
<email>pavelar@utad.pt</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Baneth</surname>
<given-names>Gad</given-names>
</name>
<address>
<email>gad.baneth@mail.huji.ac.il</email>
</address>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<aff id="Aff1">
<label></label>
Department of Veterinary Sciences, School of Agrarian and Veterinary Sciences, Universidade de Trás-os-Montes e Alto Douro (UTAD), Vila Real, Portugal</aff>
<aff id="Aff2">
<label></label>
Koret School of Veterinary Medicine, The Hebrew University of Jerusalem, Rehovot, Israel</aff>
<aff id="Aff3">
<label></label>
Victor Caeiro Laboratory of Parasitology, Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM), University of Évora, Évora, Portugal</aff>
<aff id="Aff4">
<label></label>
Animal and Veterinary Research Centre, UTAD, Vila Real, Portugal</aff>
</contrib-group>
<pub-date pub-type="epub">
<day>23</day>
<month>3</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="pmc-release">
<day>23</day>
<month>3</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="collection">
<year>2015</year>
</pub-date>
<volume>8</volume>
<elocation-id>144</elocation-id>
<history>
<date date-type="received">
<day>29</day>
<month>1</month>
<year>2015</year>
</date>
<date date-type="accepted">
<day>20</day>
<month>2</month>
<year>2015</year>
</date>
</history>
<permissions>
<copyright-statement>© Cardoso et al.; licensee BioMed Central. 2015</copyright-statement>
<license license-type="open-access">
<license-p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0">http://creativecommons.org/licenses/by/4.0</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<abstract id="Abs1">
<sec>
<title>Background</title>
<p>The bacteria
<italic>Anaplasma platys</italic>
and
<italic>Ehrlichia canis</italic>
and the protozoan
<italic>Leishmania infantum</italic>
are vector-borne agents that cause canine vector-borne diseases, some of which are zoonotic. The present survey investigated the prevalence of
<italic>Anaplasma</italic>
,
<italic>Ehrlichia</italic>
and
<italic>Leishmania</italic>
in red foxes (
<italic>Vulpes vulpes</italic>
) from Portugal by molecular analysis, in order to evaluate the epidemiological role of these canids as reservoirs of infection.</p>
</sec>
<sec>
<title>Methods</title>
<p>Blood and/or bone marrow samples were collected from 78 red foxes obtained in eight districts of northern, central and southern Portugal. Real-time polymerase chain reactions (PCR) amplified a 123 bp fragment of the 16S rRNA gene of
<italic>Anaplasma</italic>
spp. and
<italic>Ehrlichia</italic>
spp. and a 265 bp fragment of the
<italic>L. infantum</italic>
internal transcribed spacer one (ITS1) region of the rRNA operon evaluated by PCR-high resolution melt analysis (PCR-HRM), with sequencing of the DNA products. A phylogenetic analysis was carried out to compare these to other sequences from
<italic>Anaplasma</italic>
spp. and
<italic>Ehrlichia</italic>
spp. deposited in GenBank®.</p>
</sec>
<sec>
<title>Results</title>
<p>
<italic>A. platys</italic>
was detected in 10 (14.5%) and
<italic>E. canis</italic>
in two (2.9%) out of 69 foxes; and
<italic>L. infantum</italic>
was detected in one (1.3%) of the 78 foxes. The prevalence of
<italic>A. platys</italic>
was significantly different from the prevalence of
<italic>E. canis</italic>
(
<italic>p</italic>
=0.016) and from that of
<italic>L. infantum</italic>
(
<italic>p</italic>
=0.002). No co-infections were found in any one of the 78 foxes. No statistically significant differences were found between the type of sample (blood and bone marrow), geographic regions (north/centre and south), age (<2 years and ≥2 years) and gender for any one of the agents.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>This is the first known report of
<italic>A. platys</italic>
in red foxes worldwide, as well as the first molecular evidence of
<italic>E. canis</italic>
in foxes from Portugal. The moderate prevalence of
<italic>A. platys</italic>
suggests that red foxes may play a role in the epidemiology of infection with this bacterium and serve as a reservoir for domestic dogs.</p>
</sec>
</abstract>
<kwd-group xml:lang="en">
<title>Keywords</title>
<kwd>
<italic>Anaplasma platys</italic>
</kwd>
<kwd>
<italic>Ehrlichia canis</italic>
</kwd>
<kwd>
<italic>Leishmania infantum</italic>
</kwd>
<kwd>Polymerase chain reaction</kwd>
<kwd>Portugal</kwd>
<kwd>Red foxes</kwd>
<kwd>Canine vector-borne diseases</kwd>
<kwd>
<italic>Vulpes vulpes</italic>
</kwd>
</kwd-group>
<custom-meta-group>
<custom-meta>
<meta-name>issue-copyright-statement</meta-name>
<meta-value>© The Author(s) 2015</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="Sec1" sec-type="introduction">
<title>Background</title>
<p>The intracellular bacteria
<italic>Anaplasma platys</italic>
and
<italic>Ehrlichia canis</italic>
, and the protozoan
<italic>Leishmania infantum</italic>
are among the diverse range of vector-borne agents that cause canine vector-borne diseases (CVBD) [
<xref ref-type="bibr" rid="CR1">1</xref>
].
<italic>A. platys</italic>
is presumed to be transmitted by the
<italic>Rhipicephalus sanguineus</italic>
group ticks (
<italic>R. sanguineus</italic>
sensu lato [
<xref ref-type="bibr" rid="CR2">2</xref>
]), infects platelets and causes canine infectious cyclic thrombocytopenia [
<xref ref-type="bibr" rid="CR3">3</xref>
,
<xref ref-type="bibr" rid="CR4">4</xref>
]. Canine infections with
<italic>A. platys</italic>
are mostly subclinical but clinical signs including lymphadenomegaly and pale mucous membranes have been reported in domestic dogs [
<xref ref-type="bibr" rid="CR5">5</xref>
]. Although its virulence is generally low,
<italic>A. platys</italic>
might play a role in co-infections with other vector-borne agents [
<xref ref-type="bibr" rid="CR6">6</xref>
]. Molecular evidence of
<italic>A. platys</italic>
was reported in a veterinarian co-infected with
<italic>Bartonella henselae</italic>
and
<italic>Candidatus</italic>
Mycoplasma haematoparvum [
<xref ref-type="bibr" rid="CR7">7</xref>
], in two seronegative humans living in Midwestern USA and also in their dog [
<xref ref-type="bibr" rid="CR8">8</xref>
], and in two women from Venezuela [
<xref ref-type="bibr" rid="CR9">9</xref>
].</p>
<p>In Europe,
<italic>E. canis</italic>
is the etiological agent of canine monocytic ehrlichiosis and its confirmed vectors are
<italic>R. sanguineus</italic>
ticks [
<xref ref-type="bibr" rid="CR3">3</xref>
]. Dogs can be subclinically infected with
<italic>E. canis</italic>
or present a spectrum of clinical manifestations that may reach fatal illness [
<xref ref-type="bibr" rid="CR10">10</xref>
]. Clinical signs often include lethargy, anorexia, weight loss, fever, epistaxis and other haemorrhagic disorders, pale mucous membranes and lymphadenomegaly [
<xref ref-type="bibr" rid="CR11">11</xref>
].
<italic>E. canis</italic>
can also infect cats and wild canids [
<xref ref-type="bibr" rid="CR12">12</xref>
,
<xref ref-type="bibr" rid="CR13">13</xref>
], and human infections of a specific
<italic>E. canis</italic>
strain have been reported from Venezuela, revealing a zoonotic potential [
<xref ref-type="bibr" rid="CR14">14</xref>
].</p>
<p>Leishmaniosis due to
<italic>L. infantum</italic>
is a major zoonosis potentially fatal to dogs and humans, representing an important veterinary medical and public health problem [
<xref ref-type="bibr" rid="CR15">15</xref>
]. Phlebotomine sand flies (
<italic>Phlebotomus</italic>
spp.) are vectors and domestic dogs the main reservoir of the protozoan [
<xref ref-type="bibr" rid="CR16">16</xref>
]. In humans, visceral leishmaniosis is the most severe clinical syndrome resulting from infections with
<italic>L. infantum</italic>
, and in southern Europe it is observed mainly in children and immunocompromised adults [
<xref ref-type="bibr" rid="CR17">17</xref>
]. Canine leishmaniosis is a systemic chronic disease whose clinical manifestations usually include lymphadenomegally, dermatitis, alopecia, cutaneous ulceration, onychogryphosis, lameness, anorexia, weight loss, cachexia, ocular lesions, epistaxis, anaemia, diarrhoea and renal failure [
<xref ref-type="bibr" rid="CR18">18</xref>
,
<xref ref-type="bibr" rid="CR19">19</xref>
]. In addition to dogs, wild canids such as red foxes (
<italic>Vulpes vulpes</italic>
) might serve as hosts for
<italic>L. infantum</italic>
[
<xref ref-type="bibr" rid="CR20">20</xref>
].</p>
<p>By harboring vector-transmitted pathogens, wild canids may constitute a potential reservoir for CVBD, some of which are zoonotic diseases. Red foxes are the most abundant wild carnivore in Europe and, due to a good adaptation to human environments, are invading many urban areas [
<xref ref-type="bibr" rid="CR21">21</xref>
]. In Portugal,
<italic>A. platys</italic>
,
<italic>E. canis</italic>
and
<italic>L. infantum</italic>
have been reported as agents of CVBD in dogs [
<xref ref-type="bibr" rid="CR22">22</xref>
-
<xref ref-type="bibr" rid="CR24">24</xref>
], but no data are available regarding infection with the two bacterial pathogens in red fox populations. The present survey aimed at investigating the prevalence of
<italic>Anaplasma</italic>
,
<italic>Ehrlichia</italic>
and
<italic>Leishmania</italic>
spp. in red foxes from Portugal, by means of molecular analysis, in order to evaluate their role in the epidemiology of these infections.</p>
</sec>
<sec id="Sec2" sec-type="materials|methods">
<title>Methods</title>
<sec id="Sec3">
<title>Foxes and samples</title>
<p>Seventy-five carcasses of apparently healthy wild red foxes shot during the official hunting season or killed on the road due to traffic accidents were obtained between November 2008 and March 2010. The animals came from the districts of Viana do Castelo (n=9), Bragança (n=13), Vila Real (n=20), Braga (n=3) and Porto (n=2), in northern; Aveiro (n=2), in central; and Évora (n=26), in southern Portugal. Two additional red foxes from the southern district of Setúbal and one from Bragança were presented alive to the Center for Wildlife Rehabilitation, Veterinary Hospital of the University of Trás-os-Montes e Alto Douro, whose ethical committee approved the study as complying with the Portuguese legislation for the protection of animals (Law no. 92/1995).</p>
<p>The fox carcasses were refrigerated at 4°C, for no more than 72 h, or kept frozen at –20°C and thawed before sampling. During necropsy, clotted blood was collected from the right atrium or chest cavity and bone marrow from a femur, with sterile equipment, and stored at –20°C until further processing. Blood from the jugular or cephalic veins of the three living foxes was collected into EDTA tubes and also kept under the same frozen conditions as above. DNA was extracted from blood and bone marrow samples with commercial purification kits (QIAamp® DNA Blood Mini and QIAamp® DNA Mini; Qiagen, Valencia, CA, USA), as previously described [
<xref ref-type="bibr" rid="CR25">25</xref>
].</p>
<p>Of 52 foxes whose gender was observed, there were 23 females and 29 males; gender was not recorded for 26 of the 78 foxes. Age was determined by morphologic characteristics and teeth eruption pattern and wear [
<xref ref-type="bibr" rid="CR26">26</xref>
] in 48 foxes and ranged from 1.0 to 7.5 years, with a median value of 2.5 years (interquartile range: 1.5-3.5). Fourteen foxes were classified as juveniles (less than 2 years of age) and 34 as adults (2 years or more) [
<xref ref-type="bibr" rid="CR27">27</xref>
].</p>
</sec>
<sec id="Sec4">
<title>DNA amplification and sequencing</title>
<p>A 123 bp fragment within the 16S gene of both
<italic>Anaplasma</italic>
spp. and
<italic>Ehrlichia</italic>
spp. was amplified by real-time PCR using primers E.c-16S fwd and E.c-16S rev (Table 
<xref rid="Tab1" ref-type="table">1</xref>
) as previously described [
<xref ref-type="bibr" rid="CR28">28</xref>
,
<xref ref-type="bibr" rid="CR29">29</xref>
]. PCR was performed in a total volume of 20 μl containing 5 μl DNA, 400 nM of each primer, 10 μl Maxima Hot Start PCR Master Mix (2x) (Thermo Scientific, Epsom, Surrey, UK), 50 μM of SYTO9 solution (Invitrogen, Carlsbad, CA, USA) and sterile DNase/RNase-free water (Sigma, St. Louis, MO, USA), using the Corbett Research Rotor-Gene 6000 cycler (Corbett Research Pty Ltd, Sydney, Australia). Initial denaturation for 5 min at 95°C was followed by 45 cycles of denaturation at 95°C for 15 s, annealing and extension at 60°C for 30 s, and final extension at 72°C for 30 s. Amplicons were subsequently subjected to a melt step with the temperature raised to 95°C for 10 s and then lowered to 60°C for 1 min. The temperature was then raised to 95°C at a rate of 1°C per second. Amplification and melt profiles were analyzed using the Rotor-gene 6000 series software (Corbett Research Pty Ltd., Sydney, Australia). Positive samples from this reaction were further analyzed by conventional PCR using primers EHR16SD and EHR16SR (Table 
<xref rid="Tab1" ref-type="table">1</xref>
), which amplify a 345-bp fragment of the 16S rRNA gene found in the genera
<italic>Anaplasma</italic>
and
<italic>Ehrlichia</italic>
[
<xref ref-type="bibr" rid="CR30">30</xref>
]. The PCR was performed in a total volume of 25 μl using PCR-ready High Specificity mix (Syntezza Bioscience, Jerusalem, Israel) with 500 nM of each primers and sterile DNase/RNase-free water (Sigma, St. Louis, MO, USA). Amplification was performed using a programmable conventional thermocycler (Biometra, Göttingen, Germany). Initial denaturation was at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing and extension at 55°C for 30 s, and final extension at 72°C for 30 s. After the last cycle, the extension step was continued for a further 5 min. PCR products were electrophoresed on 1.5% agarose gels stained with ethidium bromide and checked under UV light for the size of amplified fragments by comparison to a 100 bp DNA molecular weight marker.
<table-wrap id="Tab1">
<label>Table 1</label>
<caption>
<p>
<bold>Targeted genes and list of primers used in this study</bold>
</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>
<bold>Pathogen</bold>
</th>
<th>
<bold>Gene</bold>
</th>
<th>
<bold>Primer</bold>
</th>
<th>
<bold>Size (bp)</bold>
</th>
<th>
<bold>Location in locus/gene</bold>
</th>
<th>
<bold>Fragment length (bp)</bold>
</th>
<th>
<bold>References</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="2">
<italic>Anaplasma</italic>
spp./
<italic>Ehrlichia</italic>
spp.</td>
<td rowspan="2">16S</td>
<td>E.c-16S fwd</td>
<td>TCGCTATTAGATGAGCCTACGT</td>
<td rowspan="2">285-408</td>
<td rowspan="2">123</td>
<td rowspan="2">[
<xref ref-type="bibr" rid="CR28">28</xref>
,
<xref ref-type="bibr" rid="CR29">29</xref>
]</td>
</tr>
<tr valign="top">
<td>E.c-16S rev</td>
<td>GAGTCTGGACCGTATCTCAGT</td>
</tr>
<tr valign="top">
<td>
<italic>Anaplasma</italic>
spp./
<italic>Ehrlichia</italic>
spp.</td>
<td rowspan="2">16S</td>
<td>EHR16SD</td>
<td>TAGCACTCATCGTTTACAGC</td>
<td rowspan="2">525-870</td>
<td rowspan="2">345</td>
<td rowspan="2">[
<xref ref-type="bibr" rid="CR30">30</xref>
]</td>
</tr>
<tr valign="top">
<td></td>
<td>EHR16SR</td>
<td>GGTACCYACAGAAGAAGTCC</td>
</tr>
<tr valign="top">
<td rowspan="2">
<italic>Leishmania</italic>
spp.</td>
<td rowspan="2">ITS</td>
<td>ITS-219F</td>
<td>AGCTGGATCATTTTCCGATG</td>
<td rowspan="2">219-484</td>
<td rowspan="2">265</td>
<td rowspan="2">[
<xref ref-type="bibr" rid="CR31">31</xref>
]</td>
</tr>
<tr valign="top">
<td>ITS-219R</td>
<td>ATCGCGACACGTTATGTGAG</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p>A 265 bp fragment of the
<italic>Leishmania</italic>
internal transcribed spacer 1 (ITS1) region of the
<italic>L. infantum</italic>
rRNA operon was amplified by real-time polymerase chain reaction (PCR) using primers ITS-219 F and ITS-219R (Table 
<xref rid="Tab1" ref-type="table">1</xref>
) and then evaluated by high resolution melt (HRM) analysis [
<xref ref-type="bibr" rid="CR31">31</xref>
]. The PCR was performed in a total volume of 20 μl containing 5 μl DNA, 200 nM of each primer, 10 μl Maxima Hot Start PCR Master Mix (2x) (Thermo Scientific, Epsom, Surrey, UK), 50 μM of SYTO9 solution (Invitrogen, Carlsbad, CA, USA) and sterile DNase/RNase-free water (Sigma, St. Louis, MO, USA), using the Corbett Research Rotor-Gene 6000 cycler (Corbett Research Pty Ltd, Sydney, Australia). Initial denaturation for 5 min at 95°C was followed by 50 cycles of denaturation at 95°C for 5 s, annealing and extension at 59°C for 30 s, and final extension at 76°C for 10 s. Amplicons were subsequently subjected to a HRM step with the temperature raised to 95°C for 10 s and then lowered to 60°C for 1 min. The temperature was then raised to 95°C at a rate of 0.3°C per second. Amplification and HRM profiles were analyzed using the Rotor-gene 6000 series software (Corbett Research Pty Ltd., Sydney, Australia).</p>
<p>DNA samples extracted from cell cultures of
<italic>L. infantum</italic>
,
<italic>Leishmania tropica</italic>
,
<italic>Leishmania major</italic>
and
<italic>E. canis</italic>
were used as positive controls for each corresponding PCR reaction and DNA from colony-bred dogs negative by PCR for vector-borne pathogens was used as negative control. A non-template control (NTC) with the same reagents described above but without DNA was added to each PCR to rule out contamination.</p>
<p>All positive PCR products were sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA), at the Center for Genomic Technologies, Hebrew University of Jerusalem, Israel. DNA sequences were evaluated with the ChromasPro software version 2. 1.1 (Technelysium Pty Ltd., Australia) and compared for similarity with sequences available in GenBank®, using BLAST program (
<ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/BLAST/">http://www.ncbi.nlm.nih.gov/BLAST/</ext-link>
).</p>
</sec>
<sec id="Sec5">
<title>Phylogenetic analysis</title>
<p>A phylogenetic analysis, which included DNA sequences obtained from foxes from this study, was carried out to compare these sequences to other sequences from
<italic>Anaplasma</italic>
spp. and
<italic>Ehrlichia</italic>
spp. that had previously been deposited in GenBank®. Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 6.06 (
<ext-link ext-link-type="uri" xlink:href="http://www.megasoftware.net/">http://www.megasoftware.net</ext-link>
) [
<xref ref-type="bibr" rid="CR32">32</xref>
] and a phylogenetic tree was constructed by the Maximum-Likelihood algorithms using the Kimura-2-Parameter model. Bootstrap replicates were performed to estimate the node reliability, and values were obtained from 1000 randomly selected samples of the aligned sequence data.</p>
</sec>
<sec id="Sec6">
<title>Statistical analysis</title>
<p>The Chi-squared or Fisher’s exact tests were used to compare proportions of positive results by gender and age group (juvenile vs. adults). McNemar’s test compared proportions in paired results, i.e. data obtained from blood and bone marrow of the same fox. A
<italic>p</italic>
value < 0.05 was considered as statistically significant [
<xref ref-type="bibr" rid="CR33">33</xref>
]. The exact binomial test estimated confidence intervals (CI) for proportions, with a 95% confidence level. Analyses were performed with StatLib and IBM SPSS 20 software for Windows.</p>
</sec>
</sec>
<sec id="Sec7" sec-type="results">
<title>Results</title>
<p>Out of 69 foxes, 10 (14.5%; CI: 7.2-25.0%) were found infected with
<italic>A. platys</italic>
; and two (2.9%; CI: 0.4-10.1%) with
<italic>E. canis</italic>
. Out of all the 78 foxes, one (1.3%; CI: 0.03-6.9%) was infected with
<italic>L. infantum</italic>
(Table 
<xref rid="Tab2" ref-type="table">2</xref>
). The prevalence of
<italic>A. platys</italic>
was significantly different from the prevalence of
<italic>E. canis</italic>
and from that of
<italic>L. infantum</italic>
(
<italic>p</italic>
=0.016 and
<italic>p</italic>
=0.002, respectively). The prevalence values of
<italic>E. canis</italic>
and
<italic>L. infantum</italic>
were not statistically different from each other (
<italic>p</italic>
=0.489).
<table-wrap id="Tab2">
<label>Table 2</label>
<caption>
<p>
<bold>PCR and sequencing for detection of</bold>
<bold>
<italic>Anaplasma</italic>
</bold>
<bold>spp.,</bold>
<bold>
<italic>Ehrlichia</italic>
</bold>
<bold>spp. and</bold>
<bold>
<italic>Leishmania</italic>
</bold>
<bold>spp. in red foxes (</bold>
<bold>
<italic>Vulpes vulpes</italic>
</bold>
<bold>) from Portugal</bold>
</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>
<bold>Region/sample</bold>
</th>
<th colspan="3">
<bold>PCR and sequencing: no. of positive foxes/no. of foxes tested (%)</bold>
</th>
</tr>
<tr valign="top">
<th></th>
<th>
<bold>
<italic>Anaplasma platys</italic>
</bold>
</th>
<th>
<bold>
<italic>Ehrlichia canis</italic>
</bold>
</th>
<th>
<bold>
<italic>Leishmania infantum</italic>
</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td>North and centre</td>
<td>9/50 (18.0)</td>
<td>1/50 (2.0)</td>
<td>1/50 (2.0)</td>
</tr>
<tr valign="top">
<td>Blood</td>
<td>3/50 (6.0)</td>
<td>1/50 (2.0)</td>
<td>1/50 (2.0)</td>
</tr>
<tr valign="top">
<td>Bone marrow</td>
<td>6/47 (12.8)</td>
<td>0/47 (0.0)</td>
<td>1/47 (2.0)</td>
</tr>
<tr valign="top">
<td>South</td>
<td>1/19 (5.3)</td>
<td>1/19 (5.3)</td>
<td>0/28 (0.0)</td>
</tr>
<tr valign="top">
<td>Blood</td>
<td>1/14 (7.1)</td>
<td>1/14 (7.1)</td>
<td>0/14 (0.0)</td>
</tr>
<tr valign="top">
<td>Bone marrow</td>
<td>0/10 (0.0)</td>
<td>0/10 (0.0)</td>
<td>0/19 (0.0)</td>
</tr>
<tr valign="top">
<td>Total</td>
<td>10/69 (14.5)</td>
<td>2/69 (2.9)</td>
<td>1/78 (1.3)</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p>
<italic>A. platys</italic>
was detected in nine foxes from all the five northern districts and in one fox from the southern district of Setúbal.
<italic>E. canis</italic>
was found in one fox from the northern district of Vila Real and in another fox from the southern district of Évora, and
<italic>L. infantum</italic>
was detected in one fox from the district of Vila Real. No co-infections were found in any one of the 78 foxes.</p>
<p>Paired blood and bone marrow samples (i.e. from the same animal) were available from 52 foxes (47 from the north and five from the south). The percentage of positive results to
<italic>A. platys</italic>
was 3.8% in blood and 11.5% in bone marrow, but the difference was statistically not significant (
<italic>p</italic>
=0.289). Positive results to
<italic>E. canis</italic>
among paired samples were not compared, as the agent was found only in two blood samples. The fox found infected with
<italic>L. infantum</italic>
was positive both in blood and bone marrow (1.9%;
<italic>p</italic>
=1.0).</p>
<p>Due to the discrepancy in the number of paired samples (i.e. blood and bone marrow from the same fox) between the north/centre and south regions of Portugal, statistical comparison of results by geographical region was done between blood and bone marrow separately. With blood, the prevalences of
<italic>A. platys</italic>
(6.0% vs. 7.1%;
<italic>p</italic>
=1.0),
<italic>E. canis</italic>
(2.0% vs. 7.1%;
<italic>p</italic>
=0.392) and
<italic>L. infantum</italic>
(2.0% vs. 0.0%;
<italic>p</italic>
=1.0) were not significantly different between the northern/central and southern districts (respectively). With bone marrow, similarly non-significant differences were found for the prevalences of
<italic>A. platys</italic>
(12.8% vs. 0.0%;
<italic>p</italic>
=0.171),
<italic>E. canis</italic>
(0.0% vs. 0.0%;
<italic>p</italic>
value not computed) and
<italic>L. infantum</italic>
(2.0% vs. 0.0%;
<italic>p</italic>
=1.0).</p>
<p>No statistically significant differences were found between genders for the positive results to
<italic>A. platys</italic>
(17.4% for female vs. 20.7% for male foxes;
<italic>p</italic>
=1.0), to
<italic>E. canis</italic>
(0.0% vs. 3.4%;
<italic>p</italic>
=1.0) or to
<italic>L. infantum</italic>
(4.3% vs. 0.0%;
<italic>p</italic>
=0.442). Likewise, the differences of positive results between age groups were not significant for any one of the three agents:
<italic>A. platys</italic>
(14.3% for juvenile vs. 20.6% for adult foxes;
<italic>p</italic>
=1.0),
<italic>E. canis</italic>
(0.0% vs. 2.9%;
<italic>p</italic>
=1.0) and
<italic>L. infantum</italic>
(7.1% vs. 0.0%;
<italic>p</italic>
=0.292).</p>
<p>The foxes were apparently in a healthy body condition, and gross examination and histopathology findings demonstrated a population that seemed not to suffer from histological abnormalities due to infection with
<italic>A. platys</italic>
,
<italic>E. canis</italic>
or
<italic>L. infantum</italic>
(data not shown). However, some samples showed autolytic alterations, in spite of the attempts to minimize post-mortem effects. Moreover, by PCR and DNA sequencing the parasite
<italic>Babesia</italic>
cf.
<italic>microti</italic>
was detected in 63 out of 91 (69.2%; CI: 58.7-78.5%) [
<xref ref-type="bibr" rid="CR34">34</xref>
] and
<italic>Hepatozoon canis</italic>
in 68 out of 90 foxes (75.6%; CI: 64.5-83.2%) [
<xref ref-type="bibr" rid="CR25">25</xref>
]. The 91 foxes include the 90 foxes and these further include all the 78 foxes from the present study.</p>
<p>The 230 bp DNA sequences of
<italic>L. infantum</italic>
from the infected Portuguese foxes obtained using the ITS-219 F/ITS-219R primer had 100% identity with the closest GenBank® accession no. GU591397. The DNA sequences of
<italic>E. canis</italic>
from the infected Portuguese fox had 100% identity with the closest GenBank® accession no. KJ659037. Moreover, sequences from the 16S rRNA fragment amplified by the E.c-16S fwd/E.c-16S rev primers of
<italic>Anaplasma</italic>
spp. had 100% identity to
<italic>A. platys</italic>
(KJ659045.1). A longer fragment (303 bp) of the 16S rRNA was amplified from two foxes by the EHR16SD/EHR16SR primers and showed 100% identity with
<italic>A. platys</italic>
(KM401447). A maximum likelihood tree phylogram based on 385 bp sequences was formed by a combination of the two 16S rRNA fragments amplified by the E.c-16S fwd/E.c-16S rev primers and by the EHR16SD/EHR16SR primers which did not overlap (Figure 
<xref rid="Fig1" ref-type="fig">1</xref>
). It indicated that the
<italic>Anaplasma</italic>
spp. sequences detected in this study from foxes clustered together with
<italic>A. platys</italic>
sequences deposited in GenBank® and separately from other
<italic>Anaplasma</italic>
spp., including
<italic>A. phagocytophylum. E. canis</italic>
sequences from this study clustered with sequences of
<italic>E. canis</italic>
and other
<italic>Ehrlichia</italic>
spp. and separately from canine
<italic>Anaplasma</italic>
spp. (Figure 
<xref rid="Fig1" ref-type="fig">1</xref>
). Sequences of pathogens derived from foxes in this study were deposited in GenBank® under the following accession numbers: KP717550, KP717551 (
<italic>A. platys</italic>
); KP717552 (
<italic>E. canis</italic>
); and KP738165, KP738166 (
<italic>L. infantum</italic>
).
<fig id="Fig1">
<label>Figure 1</label>
<caption>
<p>
<bold>Maximum likelihood tree phylogram comparing 385 bp sequences of the 16S DNA sequences from</bold>
<bold>
<italic>Anaplasma</italic>
</bold>
<bold>spp. and</bold>
<bold>
<italic>Ehrlichia</italic>
</bold>
<bold>spp. deposited in GenBank®.</bold>
The GenBank® accession numbers, animal source and country of origin from which the sequences were derived are included for each sequence. Bootstrap values higher than 60% are indicated. New sequences derived from the present study are marked in bold letters. The 385 bp sequences included in the phylogenetic analysis were formed by a combination of two non-overlapping 16S rRNA fragments amplified by the E.c-16S fwd/E.c-16S rev primers and EHR16SD/EHR16SR primers. 305 bp DNA sequences included in the phylogram from one fragment of the combined fragment sequences were deposited in GenBank® as accession numbers KP717550, KP717551 (R02B, R16B) for
<italic>A. platys</italic>
and KP717552 (07B_UE08) for
<italic>E. canis</italic>
.</p>
</caption>
<graphic xlink:href="13071_2015_756_Fig1_HTML" id="MO1"></graphic>
</fig>
</p>
</sec>
<sec id="Sec8" sec-type="discussion">
<title>Discussion</title>
<p>Infections with
<italic>A. platys</italic>
,
<italic>E. canis</italic>
and
<italic>L. infantum</italic>
are well documented in domestic dogs, but information on the occurrence of these agents in wild animals is sparse. This is the first known report of
<italic>A. platys</italic>
in red foxes worldwide, as well as the first molecular evidence of
<italic>E. canis</italic>
in red foxes from Portugal. In the present study, PCR and subsequent DNA sequencing provided detection and allowed the identification of infectious agents, i.e.
<italic>A. platys</italic>
and
<italic>E. canis</italic>
, belonging to genetically close bacterial genera.</p>
<p>The detection of
<italic>A. platys</italic>
in a moderate proportion of the sampled foxes denotes that these canids are exposed to the agent and suggests that a sylvatic life cycle of this pathogen may exist in vulpine populations in Portugal.
<italic>A. platys</italic>
appears to be endemic in foxes as it was found in both northern and southern regions of Portugal, and foxes may play a role in the epidemiology of infection with this bacterium and serve as a reservoir for domestic dogs. In addition, the similar prevalence of
<italic>A. platys</italic>
in foxes from the northern/central and southern regions may be attributable to a relatively homogeneous distribution of the bacterium in its presumed tick vector populations in these areas [
<xref ref-type="bibr" rid="CR35">35</xref>
]. In fact,
<italic>R. sanguineus</italic>
group ticks have been found in mammalian hosts from all the eight districts sampled for the present study [
<xref ref-type="bibr" rid="CR36">36</xref>
,
<xref ref-type="bibr" rid="CR37">37</xref>
]. The virulence of
<italic>A. platys</italic>
to red foxes requires further investigation. A non-significant difference between the detection percentage of
<italic>A. platys</italic>
in blood and bone marrow samples indicates, due to its practicability, that blood is a preferred sample to be collected in living animals. Nevertheless, when sampling corpses it is convenient to obtain samples from more than one tissue, in order to increase the sensitivity of detection [
<xref ref-type="bibr" rid="CR25">25</xref>
].</p>
<p>In Portugal,
<italic>A. platys</italic>
has previously been detected by molecular methods in dogs from the north [
<xref ref-type="bibr" rid="CR22">22</xref>
-
<xref ref-type="bibr" rid="CR24">24</xref>
], centre [
<xref ref-type="bibr" rid="CR24">24</xref>
] and south [
<xref ref-type="bibr" rid="CR24">24</xref>
,
<xref ref-type="bibr" rid="CR38">38</xref>
,
<xref ref-type="bibr" rid="CR39">39</xref>
]. The bacterium has also been detected in
<italic>R. sanguineus</italic>
group ticks from southern Portugal by PCR and DNA sequencing [
<xref ref-type="bibr" rid="CR35">35</xref>
]. Some of the partial
<italic>A. platys</italic>
16S rRNA gene sequences obtained from foxes in the present study are most similar to those previously identified in dogs from Spain and Germany, among other countries (Figure 
<xref rid="Fig1" ref-type="fig">1</xref>
).</p>
<p>Molecular identification of
<italic>E. canis</italic>
has been reported in dogs from northeastern [
<xref ref-type="bibr" rid="CR22">22</xref>
,
<xref ref-type="bibr" rid="CR23">23</xref>
], central [
<xref ref-type="bibr" rid="CR24">24</xref>
] and southern Portugal [
<xref ref-type="bibr" rid="CR39">39</xref>
,
<xref ref-type="bibr" rid="CR40">40</xref>
]; and also in one cat from the south of the country [
<xref ref-type="bibr" rid="CR13">13</xref>
]. There are some reports on the presence of antibodies to
<italic>E. canis</italic>
in red foxes from Europe and the Mediterranean [
<xref ref-type="bibr" rid="CR12">12</xref>
,
<xref ref-type="bibr" rid="CR41">41</xref>
], but molecular studies on this infection in foxes are more scarce. In central Italy, none of 150 hunted red fox spleens were PCR-positive for
<italic>E. canis</italic>
DNA [
<xref ref-type="bibr" rid="CR42">42</xref>
]. However, in southern Italy the PCR prevalence of this pathogen was 30.8% in 13 red foxes from Sicily [
<xref ref-type="bibr" rid="CR43">43</xref>
].</p>
<p>The proven vector of
<italic>E. canis</italic>
(
<italic>R. sanguineus</italic>
s.l. [
<xref ref-type="bibr" rid="CR2">2</xref>
]), is the most prevalent tick in Portugal and has been found on mammals throughout the country [
<xref ref-type="bibr" rid="CR36">36</xref>
,
<xref ref-type="bibr" rid="CR37">37</xref>
]. The
<italic>E. canis</italic>
sequences obtained from the two foxes in this study were identical to the ones previously identified in Portuguese, Spanish and Greek dogs, among sequences from other continents (Figure 
<xref rid="Fig1" ref-type="fig">1</xref>
).</p>
<p>The prevalence of
<italic>L. infantum</italic>
infection detected by means of PCR in the present study (1.3%) is in line with the low level (1.1%) found also by PCR in dogs from southern Portugal [
<xref ref-type="bibr" rid="CR39">39</xref>
]. The overall national seroprevalence in dogs has recently been estimated to be 6.3%, with 3.8% in northern Portugal, 5.0% in the district of Setúbal and 2.5% in the district of Évora included in the present fox study [
<xref ref-type="bibr" rid="CR44">44</xref>
]. Specific seropositivity in dogs from the municipality of Évora, within the namesake district, was 3.9% in the year 1990, 9.4% in 1999 and 5.6% in 2010 [
<xref ref-type="bibr" rid="CR15">15</xref>
]. However, in a close by geographic area of southern Portugal, an indirect immunofluorescence antibody test (IFAT) revealed that 20.4% of 152 dogs had antibodies to
<italic>Leishmania</italic>
, and PCR detected leishmanial DNA in blood from 34.9% of the same animals [
<xref ref-type="bibr" rid="CR45">45</xref>
]. In cats, the molecular prevalence of
<italic>L. infantum</italic>
in blood was 0.3% out of 320 animals from northern/central [
<xref ref-type="bibr" rid="CR46">46</xref>
] and 9.9% in 649 from southern Portugal [
<xref ref-type="bibr" rid="CR13">13</xref>
].</p>
<p>In a survey carried out 30 years ago in foxes from the district of Setúbal, 23.0% out of 61 animals tested by an indirect immunofluorescence assay had antibodies to
<italic>Leishmania</italic>
, and parasites were isolated from tissues of 5.6% of 71 foxes. The prevalence of 5.6% was suggested as sufficient to maintain endemicity of the infection within a semi-autonomic sylvatic cycle in the area [
<xref ref-type="bibr" rid="CR47">47</xref>
].</p>
<p>
<italic>Leishmania</italic>
spp. infection has been reported in red foxes from Italy, France and Spain [
<xref ref-type="bibr" rid="CR48">48</xref>
-
<xref ref-type="bibr" rid="CR50">50</xref>
]. Different prevalences of fox infection with
<italic>Leishmania</italic>
have been reported from these countries in southern Europe. The molecular prevalence of
<italic>L. infantum</italic>
observed in foxes in the present study (1.3%) is much lower than those previously obtained by PCR in blood and spleen samples from the same host species (n=162) in several regions of Spain (14.1% [
<xref ref-type="bibr" rid="CR51">51</xref>
]). In the report from Spain, no statistically significant sex or age differences in prevalence were observed in foxes, but there was a significant difference among regions. Interestingly, out of 47 fox serum samples analysed by western blot only one tested positive (2.1%) and DNA restriction patterns differed between red foxes and dogs in two regions [
<xref ref-type="bibr" rid="CR51">51</xref>
]. In southern France, among 92 red foxes screened, the PCR prevalence of
<italic>L. infantum</italic>
was 9%, with DNA found in the spleen and liver, but not in blood, skin or kidney [
<xref ref-type="bibr" rid="CR52">52</xref>
]. In southern Italy, 20 (40.0%) out of 50 foxes were PCR-positive simultaneously in lymph node and bone marrow samples, whereas just 17 out of the 20 animals were positive in skin samples [
<xref ref-type="bibr" rid="CR53">53</xref>
]. In contrast, Verin et al. [
<xref ref-type="bibr" rid="CR54">54</xref>
] failed to find
<italic>Leishmania</italic>
DNA in red fox skin specimens from central Italy, which may indicate that the parasite had not colonized the tegument of these animals, thereby suggesting that they may only play a minor role as a reservoir in an area that is not highly endemic.</p>
<p>Manifestations of disease in red foxes experimentally infected with
<italic>L. infantum</italic>
were similar to those found in sick dogs and included skin ulceration, furfuraceous dermatitis, alopecia, weight loss and onychogryphosis [
<xref ref-type="bibr" rid="CR55">55</xref>
], but foxes were postulated to have some degree of resistance to
<italic>L. infantum</italic>
infection [
<xref ref-type="bibr" rid="CR56">56</xref>
].</p>
<p>The infection found in the fox in the present study might have been acquired from vectors which fed on dogs, as
<italic>L. infantum</italic>
is highly prevalent in dog populations in northern Portugal [
<xref ref-type="bibr" rid="CR57">57</xref>
]. The phlebotomine sand fly species
<italic>Phlebotomus perniciosus</italic>
and
<italic>Phlebotomus ariasi</italic>
are the vectors of
<italic>L. infantum</italic>
in Portugal [
<xref ref-type="bibr" rid="CR58">58</xref>
]. Transmission from foxes to sand flies has not been documented, and studies are necessary to elucidate whether foxes can be infectious to these insects. The role of red foxes as reservoir hosts in the epidemiological cycle of
<italic>L. infantum</italic>
in Portugal seems to be secondary or even minimal compared to that of dogs. In effect, it is difficult to determine whether fox populations are able to maintain
<italic>Leishmania</italic>
infection by themselves in the absence of dogs, and this should be studied further.</p>
<p>Altogether, the differences between reports of infection with
<italic>L. infantum</italic>
from other parts of southern Europe may represent distinct levels of prevalence by geographical location, but may also be due to the distinct assays used, such as serology indicating exposure or PCR detecting infection, or to the different tissues sampled [
<xref ref-type="bibr" rid="CR25">25</xref>
]. The different findings on prevalences between
<italic>A. platys</italic>
and
<italic>E. canis</italic>
in foxes in the present study could derive from a lower susceptibility of red foxes to the latter, or could be related to a heterogeneous distribution of the agents within the vector populations [
<xref ref-type="bibr" rid="CR35">35</xref>
]. In Portugal, where red foxes are abundantly distributed throughout rural and periurban environments, they can serve as a possible reservoir of some pathogens for domestic pets and also to human beings [
<xref ref-type="bibr" rid="CR21">21</xref>
,
<xref ref-type="bibr" rid="CR34">34</xref>
,
<xref ref-type="bibr" rid="CR43">43</xref>
]. However, further studies are needed to evaluate the role of foxes in the epidemiology of
<italic>A. platys</italic>
,
<italic>E. canis</italic>
and
<italic>L. infantum</italic>
in Europe and the Mediterranean area.</p>
</sec>
<sec id="Sec9" sec-type="conclusion">
<title>Conclusions</title>
<p>In conclusion, the present study demonstrates that infection with
<italic>A. platys</italic>
is prevalent in red fox populations in Portugal, whereas
<italic>E. canis</italic>
and
<italic>L. infantum</italic>
are present but less frequent. The moderate prevalence of
<italic>A. platys</italic>
in red foxes suggests that they might be a reservoir of this bacterium and a source of infection to dogs.</p>
</sec>
</body>
<back>
<fn-group>
<fn>
<p>Luís Cardoso, Matan Gilaad and Helder CE Cortes contributed equally to this work.</p>
</fn>
<fn>
<p>
<bold>Competing interests</bold>
</p>
<p>The authors declare that they have no competing interests.</p>
</fn>
<fn>
<p>
<bold>Authors’ contributions</bold>
</p>
<p>LC designed the study, collected samples, analysed data and wrote the manuscript; MG performed PCR and sequencing, constructed phylogenetic trees and assisted in drafting the manuscript; HCEC designed the study, collected samples and analysed data; YNB performed PCR and sequencing, and analysed data; APL, MJVV and MS collected and characterized samples; PAR collected samples and analysed data; GB designed the study, performed PCR and sequencing, analysed data and revised the manuscript. All authors read and approved the final version of the manuscript.</p>
</fn>
</fn-group>
<ack>
<p>The authors wish to acknowledge the following persons for their assistance in obtaining red fox samples: Eng. Teresa Coutinho, Dr. Roberto Sargo, Prof. Adelina Gama and Prof. Carlos Venâncio (UTAD), Dr. Antónia Reis (University of Évora), Eng. Rogério Rodrigues, Eng. Vítor Rego, Eng. Álvaro Gonçalves, Eng. Augusto Maia and Mr. Manuel Pinho (Forestry Regional Directorate of North, National Forestry Authority, Ministry of Agriculture), Captain Diamantino Fernandes (National Gendarmerie, Territorial Detachment of Vila Real), Mr. Miguel Arantes (Hunters Association of Vitorino dos Piães, Ponte de Lima), Chief Domingos Morais (Hunting and Fishing Recreational Club of Amares), Mr. Vasco Vaz (Hunting and Fishing Association of the Parish of Donai, Bragança), Mr. Vítor Pires (“São Martinhense” Hunting and Fishing Association, Miranda do Douro), Eng. Inácio Alves and Mr. Raul Fernandes (Hunting and Fishing Association of the Parish of Salselas, Macedo de Cavaleiros), Mr. Licínio Inocentes (Hunting and Fishing Club of Tâmega Raia Norte, Chaves), Dr. Mafalda Pinto-Basto (Faculty of Sciences, University of Lisbon), and fox hunting expert Dr. Miguel Fernandes and his dedicated team (Évora).</p>
<p>The authors acknowledge Bayer Health Care–Animal Health division for kindly supporting the publication of this manuscript in the framework of the 10th CVBD World Forum Symposium.</p>
</ack>
<ref-list id="Bib1">
<title>References</title>
<ref id="CR1">
<label>1.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Otranto</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Dantas-Torres</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Breitschwerdt</surname>
<given-names>EB</given-names>
</name>
</person-group>
<article-title>Managing canine vector-borne diseases of zoonotic concern: part one</article-title>
<source>Trends Parasitol</source>
<year>2009</year>
<volume>25</volume>
<fpage>157</fpage>
<lpage>63</lpage>
<pub-id pub-id-type="doi">10.1016/j.pt.2009.01.003</pub-id>
<pub-id pub-id-type="pmid">19269898</pub-id>
</element-citation>
</ref>
<ref id="CR2">
<label>2.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dantas-Torres</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Latrofa</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>Annoscia</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Giannelli</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Parisi</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Otranto</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Morphological and genetic diversity of
<italic>Rhipicephalus sanguineus</italic>
sensu lato from the New and Old Worlds</article-title>
<source>Parasit Vectors</source>
<year>2013</year>
<volume>6</volume>
<fpage>213</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-6-213</pub-id>
<pub-id pub-id-type="pmid">23880226</pub-id>
</element-citation>
</ref>
<ref id="CR3">
<label>3.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shaw</surname>
<given-names>SE</given-names>
</name>
<name>
<surname>Day</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Birtles</surname>
<given-names>RJ</given-names>
</name>
<name>
<surname>Breitschwerdt</surname>
<given-names>EB</given-names>
</name>
</person-group>
<article-title>Tick-borne infectious diseases of dogs</article-title>
<source>Trends Parasitol</source>
<year>2001</year>
<volume>17</volume>
<fpage>74</fpage>
<lpage>80</lpage>
<pub-id pub-id-type="doi">10.1016/S1471-4922(00)01856-0</pub-id>
<pub-id pub-id-type="pmid">11228013</pub-id>
</element-citation>
</ref>
<ref id="CR4">
<label>4.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alleman</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Wamsley</surname>
<given-names>HL</given-names>
</name>
</person-group>
<article-title>An update on anaplasmosis in dogs</article-title>
<source>Vet Med</source>
<year>2008</year>
<volume>103</volume>
<fpage>212</fpage>
<lpage>20</lpage>
</element-citation>
</ref>
<ref id="CR5">
<label>5.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harrus</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Aroch</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Lavy</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Bark</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Clinical manifestations of infectious canine cyclic thrombocytopenia</article-title>
<source>Vet Rec</source>
<year>1997</year>
<volume>141</volume>
<fpage>247</fpage>
<lpage>50</lpage>
<pub-id pub-id-type="doi">10.1136/vr.141.10.247</pub-id>
<pub-id pub-id-type="pmid">9308149</pub-id>
</element-citation>
</ref>
<ref id="CR6">
<label>6.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>De Tommasi</surname>
<given-names>AS</given-names>
</name>
<name>
<surname>Otranto</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Furlanello</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Tasca</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Cantacessi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Breitschwerdt</surname>
<given-names>EB</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Evaluation of blood and bone marrow in selected canine vector-borne diseases</article-title>
<source>Parasit Vectors</source>
<year>2014</year>
<volume>7</volume>
<fpage>534</fpage>
<pub-id pub-id-type="doi">10.1186/s13071-014-0534-2</pub-id>
<pub-id pub-id-type="pmid">25441458</pub-id>
</element-citation>
</ref>
<ref id="CR7">
<label>7.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maggi</surname>
<given-names>RG</given-names>
</name>
<name>
<surname>Mascarelli</surname>
<given-names>PE</given-names>
</name>
<name>
<surname>Havenga</surname>
<given-names>LN</given-names>
</name>
<name>
<surname>Naidoo</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Breitschwerdt</surname>
<given-names>EB</given-names>
</name>
</person-group>
<article-title>Co-infection with
<italic>Anaplasma platys</italic>
,
<italic>Bartonella henselae</italic>
and
<italic>Candidatus</italic>
Mycoplasma haematoparvum in a veterinarian</article-title>
<source>Parasit Vectors</source>
<year>2013</year>
<volume>6</volume>
<fpage>103</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-6-103</pub-id>
<pub-id pub-id-type="pmid">23587235</pub-id>
</element-citation>
</ref>
<ref id="CR8">
<label>8.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Breitschwerdt</surname>
<given-names>EB</given-names>
</name>
<name>
<surname>Hegarty</surname>
<given-names>BC</given-names>
</name>
<name>
<surname>Qurollo</surname>
<given-names>BA</given-names>
</name>
<name>
<surname>Saito</surname>
<given-names>TB</given-names>
</name>
<name>
<surname>Maggi</surname>
<given-names>RG</given-names>
</name>
<name>
<surname>Blanton</surname>
<given-names>LS</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Intravascular persistence of
<italic>Anaplasma platys</italic>
,
<italic>Ehrlichia chaffeensis</italic>
, and
<italic>Ehrlichia ewingii</italic>
DNA in the blood of a dog and two family members</article-title>
<source>Parasit Vectors</source>
<year>2014</year>
<volume>7</volume>
<fpage>298</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-7-298</pub-id>
<pub-id pub-id-type="pmid">24984562</pub-id>
</element-citation>
</ref>
<ref id="CR9">
<label>9.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arraga-Alvarado</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Qurollo</surname>
<given-names>BA</given-names>
</name>
<name>
<surname>Parra</surname>
<given-names>OC</given-names>
</name>
<name>
<surname>Berrueta</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Hegarty</surname>
<given-names>BC</given-names>
</name>
<name>
<surname>Breitschwerdt</surname>
<given-names>EB</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Molecular evidence of
<italic>Anaplasma platys</italic>
infection in two women from Venezuela</article-title>
<source>Am J Trop Med Hyg</source>
<year>2014</year>
<volume>91</volume>
<fpage>1161</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="doi">10.4269/ajtmh.14-0372</pub-id>
<pub-id pub-id-type="pmid">25266347</pub-id>
</element-citation>
</ref>
<ref id="CR10">
<label>10.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Neer</surname>
<given-names>TM</given-names>
</name>
<name>
<surname>Breitschwerdt</surname>
<given-names>EB</given-names>
</name>
<name>
<surname>Greene</surname>
<given-names>RT</given-names>
</name>
<name>
<surname>Lappin</surname>
<given-names>MR</given-names>
</name>
</person-group>
<article-title>Consensus statement on ehrlichial disease of small animals from the infectious disease study group of the ACVIM</article-title>
<source>J Vet Intern Med</source>
<year>2002</year>
<volume>16</volume>
<fpage>309</fpage>
<lpage>15</lpage>
<pub-id pub-id-type="pmid">12041661</pub-id>
</element-citation>
</ref>
<ref id="CR11">
<label>11.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harrus</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Bark</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Waner</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Canine monocytic ehrlichiosis: an update</article-title>
<source>Comp Cont Educ Pract Vet</source>
<year>1997</year>
<volume>19</volume>
<fpage>431</fpage>
<lpage>44</lpage>
</element-citation>
</ref>
<ref id="CR12">
<label>12.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fishman</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Gonen</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Harrus</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Strauss-Ayali</surname>
<given-names>D</given-names>
</name>
<name>
<surname>King</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>A serosurvey of
<italic>Hepatozoon canis</italic>
and
<italic>Ehrlichia canis</italic>
antibodies in wild red foxes (
<italic>Vulpes vulpes</italic>
) from Israel</article-title>
<source>Vet Parasitol</source>
<year>2004</year>
<volume>119</volume>
<fpage>21</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2003.08.012</pub-id>
<pub-id pub-id-type="pmid">15036573</pub-id>
</element-citation>
</ref>
<ref id="CR13">
<label>13.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maia</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ramos</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Coimbra</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Bastos</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Martins</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Pinto</surname>
<given-names>P</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal</article-title>
<source>Parasit Vectors</source>
<year>2014</year>
<volume>7</volume>
<fpage>115</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-7-115</pub-id>
<pub-id pub-id-type="pmid">24655431</pub-id>
</element-citation>
</ref>
<ref id="CR14">
<label>14.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Perez</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Bodor</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Rikihisa</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Human infection with
<italic>Ehrlichia canis</italic>
accompanied by clinical signs in Venezuela</article-title>
<source>Ann N Y Acad Sci</source>
<year>2006</year>
<volume>1078</volume>
<fpage>110</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="doi">10.1196/annals.1374.016</pub-id>
<pub-id pub-id-type="pmid">17114689</pub-id>
</element-citation>
</ref>
<ref id="CR15">
<label>15.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schallig</surname>
<given-names>HD</given-names>
</name>
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Semião-Santos</surname>
<given-names>SJ</given-names>
</name>
</person-group>
<article-title>Seroepidemiology of canine leishmaniosis in Évora (southern Portugal): 20-year trends</article-title>
<source>Parasit Vectors</source>
<year>2013</year>
<volume>6</volume>
<fpage>100</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-6-100</pub-id>
<pub-id pub-id-type="pmid">23587181</pub-id>
</element-citation>
</ref>
<ref id="CR16">
<label>16.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bourdeau</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Saridomichelakis</surname>
<given-names>MN</given-names>
</name>
<name>
<surname>Oliveira</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Oliva</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Kotnik</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Gálvez</surname>
<given-names>R</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Management of canine leishmaniosis in endemic SW European regions: a questionnaire-based multinational survey</article-title>
<source>Parasit Vectors</source>
<year>2014</year>
<volume>7</volume>
<fpage>110</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-7-110</pub-id>
<pub-id pub-id-type="pmid">24656172</pub-id>
</element-citation>
</ref>
<ref id="CR17">
<label>17.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Desjeux</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Worldwide increasing risk factors for leishmaniasis</article-title>
<source>Med Microbiol Immunol</source>
<year>2001</year>
<volume>190</volume>
<fpage>77</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="doi">10.1007/s004300100085</pub-id>
<pub-id pub-id-type="pmid">11770116</pub-id>
</element-citation>
</ref>
<ref id="CR18">
<label>18.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koutinas</surname>
<given-names>AF</given-names>
</name>
<name>
<surname>Polizopoulou</surname>
<given-names>ZS</given-names>
</name>
<name>
<surname>Saridomichelakis</surname>
<given-names>MN</given-names>
</name>
<name>
<surname>Argyriadis</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Fytianou</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Plevraki</surname>
<given-names>KG</given-names>
</name>
</person-group>
<article-title>Clinical considerations on canine visceral leishmaniasis in Greece: a retrospective study of 158 cases (1989–1996)</article-title>
<source>J Am Anim Hosp Assoc</source>
<year>1999</year>
<volume>35</volume>
<fpage>376</fpage>
<lpage>83</lpage>
<pub-id pub-id-type="doi">10.5326/15473317-35-5-376</pub-id>
<pub-id pub-id-type="pmid">10493412</pub-id>
</element-citation>
</ref>
<ref id="CR19">
<label>19.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Solano-Gallego</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Miró</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Koutinas</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Pennisi</surname>
<given-names>MG</given-names>
</name>
<name>
<surname>Ferrer</surname>
<given-names>L</given-names>
</name>
<etal></etal>
</person-group>
<article-title>LeishVet guidelines for the practical management of canine leishmaniosis</article-title>
<source>Parasit Vectors</source>
<year>2011</year>
<volume>4</volume>
<fpage>86</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-4-86</pub-id>
<pub-id pub-id-type="pmid">21599936</pub-id>
</element-citation>
</ref>
<ref id="CR20">
<label>20.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Dank</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Keren-Kornblatt</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Sekeles</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Adini</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Eisenberger</surname>
<given-names>CL</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Emergence of visceral leishmaniasis in central Israel</article-title>
<source>Am J Trop Med Hyg</source>
<year>1998</year>
<volume>59</volume>
<fpage>722</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="pmid">9840588</pub-id>
</element-citation>
</ref>
<ref id="CR21">
<label>21.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Duscher</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Fuehrer</surname>
<given-names>HP</given-names>
</name>
<name>
<surname>Kübber-Heiss</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Fox on the run–molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria</article-title>
<source>Parasit Vectors</source>
<year>2014</year>
<volume>7</volume>
<fpage>521</fpage>
<pub-id pub-id-type="pmid">25413694</pub-id>
</element-citation>
</ref>
<ref id="CR22">
<label>22.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Tuna</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Vieira</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Yisaschar-Mekuzas</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Molecular detection of
<italic>Anaplasma platys</italic>
and
<italic>Ehrlichia canis</italic>
in dogs from the North of Portugal</article-title>
<source>Vet J</source>
<year>2010</year>
<volume>183</volume>
<fpage>232</fpage>
<lpage>3</lpage>
<pub-id pub-id-type="doi">10.1016/j.tvjl.2008.10.009</pub-id>
<pub-id pub-id-type="pmid">19056304</pub-id>
</element-citation>
</ref>
<ref id="CR23">
<label>23.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Yisaschar-Mekuzas</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>FT</given-names>
</name>
<name>
<surname>Costa</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Diz-Lopes</surname>
<given-names>D</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Canine babesiosis in northern Portugal and molecular characterization of vector-borne co-infections</article-title>
<source>Parasit Vectors</source>
<year>2010</year>
<volume>3</volume>
<fpage>27</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-3-27</pub-id>
<pub-id pub-id-type="pmid">20377861</pub-id>
</element-citation>
</ref>
<ref id="CR24">
<label>24.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>René-Martellet</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Lebert</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Chêne</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Massot</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Leon</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Leal</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Diagnosis and incidence risk of clinical canine monocytic ehrlichiosis under field conditions in Southern Europe</article-title>
<source>Parasit Vectors</source>
<year>2015</year>
<volume>8</volume>
<fpage>3</fpage>
<pub-id pub-id-type="doi">10.1186/s13071-014-0613-4</pub-id>
<pub-id pub-id-type="pmid">25561342</pub-id>
</element-citation>
</ref>
<ref id="CR25">
<label>25.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Cortes</surname>
<given-names>HC</given-names>
</name>
<name>
<surname>Eyal</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Reis</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Lopes</surname>
<given-names>AP</given-names>
</name>
<name>
<surname>Vila-Viçosa</surname>
<given-names>MJ</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Molecular and histopathological detection of
<italic>Hepatozoon canis</italic>
in red foxes (
<italic>Vulpes vulpes</italic>
) from Portugal</article-title>
<source>Parasit Vectors</source>
<year>2014</year>
<volume>7</volume>
<fpage>113</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-7-113</pub-id>
<pub-id pub-id-type="pmid">24655375</pub-id>
</element-citation>
</ref>
<ref id="CR26">
<label>26.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Saénz-de-Buruaga</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Lucio</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Purroy</surname>
<given-names>J</given-names>
</name>
</person-group>
<source>Reconocimiento de Sexo y Edad en Especies Cinegéticas</source>
<year>1991</year>
<publisher-loc>Vitoria-Gasteiz</publisher-loc>
<publisher-name>Gobierno Provincial de Álava</publisher-name>
</element-citation>
</ref>
<ref id="CR27">
<label>27.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Davidson</surname>
<given-names>RK</given-names>
</name>
<name>
<surname>Gjerde</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Vikøren</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Lillehaug</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Handeland</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Prevalence of
<italic>Trichinella</italic>
larvae and extra-intestinal nematodes in Norwegian red foxes (
<italic>Vulpes vulpes</italic>
)</article-title>
<source>Vet Parasitol</source>
<year>2006</year>
<volume>136</volume>
<fpage>307</fpage>
<lpage>16</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2005.11.015</pub-id>
<pub-id pub-id-type="pmid">16378689</pub-id>
</element-citation>
</ref>
<ref id="CR28">
<label>28.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peleg</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Eyal</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Inbar</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Harrus</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Multiplex real-time qPCR for the detection of
<italic>Ehrlichia canis</italic>
and
<italic>Babesia canis vogeli</italic>
</article-title>
<source>Vet Parasitol</source>
<year>2010</year>
<volume>173</volume>
<fpage>292</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2010.06.039</pub-id>
<pub-id pub-id-type="pmid">20674177</pub-id>
</element-citation>
</ref>
<ref id="CR29">
<label>29.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Waner</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Nachum-Biala</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Harrus</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Evaluation of a commercial in-clinic point-of-care polymerase chain reaction test for
<italic>Ehrlichia canis</italic>
DNA in artificially infected dogs</article-title>
<source>Vet J</source>
<year>2014</year>
<volume>202</volume>
<fpage>618</fpage>
<lpage>21</lpage>
<pub-id pub-id-type="doi">10.1016/j.tvjl.2014.10.004</pub-id>
<pub-id pub-id-type="pmid">25453243</pub-id>
</element-citation>
</ref>
<ref id="CR30">
<label>30.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Roux</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Camicas</surname>
<given-names>JL</given-names>
</name>
<name>
<surname>Baradji</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Brouqui</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Detection of ehrlichiae in African ticks by polymerase chain reaction</article-title>
<source>Trans R Soc Trop Med Hyg</source>
<year>2000</year>
<volume>94</volume>
<fpage>707</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="doi">10.1016/S0035-9203(00)90243-8</pub-id>
<pub-id pub-id-type="pmid">11198664</pub-id>
</element-citation>
</ref>
<ref id="CR31">
<label>31.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Talmi-Frank</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Nasereddin</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Schnur</surname>
<given-names>LF</given-names>
</name>
<name>
<surname>Schönian</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Töz</surname>
<given-names>SO</given-names>
</name>
<name>
<surname>Jaffe</surname>
<given-names>CL</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Detection and identification of old world
<italic>Leishmania</italic>
by high resolution melt analysis</article-title>
<source>PLoS Negl Trop Dis</source>
<year>2010</year>
<volume>4</volume>
<fpage>e581</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pntd.0000581</pub-id>
<pub-id pub-id-type="pmid">20069036</pub-id>
</element-citation>
</ref>
<ref id="CR32">
<label>32.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tamura</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Stecher</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Peterson</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Filipski</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Kumar</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>MEGA6: Molecular Evolutionary Genetics Analysis version 6.0</article-title>
<source>Mol Biol Evol</source>
<year>2013</year>
<volume>30</volume>
<fpage>2725</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="doi">10.1093/molbev/mst197</pub-id>
<pub-id pub-id-type="pmid">24132122</pub-id>
</element-citation>
</ref>
<ref id="CR33">
<label>33.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Petrie</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Watson</surname>
<given-names>P</given-names>
</name>
</person-group>
<source>Statistics for Veterinary and Animal Science</source>
<year>2013</year>
<edition>3</edition>
<publisher-loc>Oxford</publisher-loc>
<publisher-name>Wiley-Blackwell</publisher-name>
</element-citation>
</ref>
<ref id="CR34">
<label>34.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Cortes</surname>
<given-names>HC</given-names>
</name>
<name>
<surname>Reis</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Simões</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Lopes</surname>
<given-names>AP</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Prevalence of
<italic>Babesia microti</italic>
-like infection in red foxes (
<italic>Vulpes vulpes</italic>
) from Portugal</article-title>
<source>Vet Parasitol</source>
<year>2013</year>
<volume>196</volume>
<fpage>90</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2012.12.060</pub-id>
<pub-id pub-id-type="pmid">23352108</pub-id>
</element-citation>
</ref>
<ref id="CR35">
<label>35.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maia</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ferreira</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Nunes</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Vieira</surname>
<given-names>ML</given-names>
</name>
<name>
<surname>Campino</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal</article-title>
<source>Ticks Tick Borne Dis</source>
<year>2014</year>
<volume>5</volume>
<fpage>409</fpage>
<lpage>14</lpage>
<pub-id pub-id-type="doi">10.1016/j.ttbdis.2014.01.009</pub-id>
<pub-id pub-id-type="pmid">24745731</pub-id>
</element-citation>
</ref>
<ref id="CR36">
<label>36.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Caeiro</surname>
<given-names>V</given-names>
</name>
</person-group>
<article-title>General review of tick species present in Portugal</article-title>
<source>Parassitologia</source>
<year>1999</year>
<volume>41</volume>
<issue>Suppl 1</issue>
<fpage>11</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="pmid">11071535</pub-id>
</element-citation>
</ref>
<ref id="CR37">
<label>37.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Santos-Silva</surname>
<given-names>MM</given-names>
</name>
<name>
<surname>Beati</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Santos</surname>
<given-names>AS</given-names>
</name>
<name>
<surname>De Sousa</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Núncio</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>Melo</surname>
<given-names>P</given-names>
</name>
<etal></etal>
</person-group>
<article-title>The hard-tick fauna of mainland Portugal (Acari: Ixodidae): an update on geographical distribution and known associations with hosts and pathogens</article-title>
<source>Exp Appl Acarol</source>
<year>2011</year>
<volume>55</volume>
<fpage>85</fpage>
<lpage>121</lpage>
<pub-id pub-id-type="doi">10.1007/s10493-011-9440-x</pub-id>
<pub-id pub-id-type="pmid">21452063</pub-id>
</element-citation>
</ref>
<ref id="CR38">
<label>38.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Santos</surname>
<given-names>AS</given-names>
</name>
<name>
<surname>Alexandre</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Sousa</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Núncio</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>Bacellar</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Dumler</surname>
<given-names>JS</given-names>
</name>
</person-group>
<article-title>Serological and molecular survey of
<italic>Anaplasma</italic>
species infection in dogs with suspected tickborne disease in Portugal</article-title>
<source>Vet Rec</source>
<year>2009</year>
<volume>164</volume>
<fpage>168</fpage>
<lpage>71</lpage>
<pub-id pub-id-type="doi">10.1136/vr.164.6.168</pub-id>
<pub-id pub-id-type="pmid">19202169</pub-id>
</element-citation>
</ref>
<ref id="CR39">
<label>39.</label>
<mixed-citation publication-type="other">Maia C, Almeida B, Coimbra M, Fernandes MC, Cristóvão JM, Ramos C, et al. Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasit Vectors. in press.</mixed-citation>
</ref>
<ref id="CR40">
<label>40.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alexandre</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Santos</surname>
<given-names>AS</given-names>
</name>
<name>
<surname>Núncio</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>De Sousa</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Boinas</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Bacellar</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Detection of
<italic>Ehrlichia canis</italic>
by polymerase chain reaction in dogs from Portugal</article-title>
<source>Vet J</source>
<year>2009</year>
<volume>181</volume>
<fpage>343</fpage>
<lpage>4</lpage>
<pub-id pub-id-type="doi">10.1016/j.tvjl.2008.03.025</pub-id>
<pub-id pub-id-type="pmid">18682335</pub-id>
</element-citation>
</ref>
<ref id="CR41">
<label>41.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Millán</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Candela</surname>
<given-names>MG</given-names>
</name>
<name>
<surname>Palomares</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Cubero</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Rodríguez</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Barral</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Disease threats to the endangered Iberian lynx (
<italic>Lynx pardinus</italic>
)</article-title>
<source>Vet J</source>
<year>2009</year>
<volume>182</volume>
<fpage>114</fpage>
<lpage>24</lpage>
<pub-id pub-id-type="doi">10.1016/j.tvjl.2008.04.005</pub-id>
<pub-id pub-id-type="pmid">18555712</pub-id>
</element-citation>
</ref>
<ref id="CR42">
<label>42.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ebani</surname>
<given-names>VV</given-names>
</name>
<name>
<surname>Verin</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Fratini</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Poli</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Cerri</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Molecular survey of
<italic>Anaplasma phagocytophilum</italic>
and
<italic>Ehrlichia canis</italic>
in red foxes (
<italic>Vulpes vulpes</italic>
) from central Italy</article-title>
<source>J Wildl Dis</source>
<year>2011</year>
<volume>47</volume>
<fpage>699</fpage>
<lpage>703</lpage>
<pub-id pub-id-type="doi">10.7589/0090-3558-47.3.699</pub-id>
<pub-id pub-id-type="pmid">21719836</pub-id>
</element-citation>
</ref>
<ref id="CR43">
<label>43.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Torina</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Blanda</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Antoci</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Scimeca</surname>
<given-names>S</given-names>
</name>
<name>
<surname>D’Agostino</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Scariano</surname>
<given-names>E</given-names>
</name>
<etal></etal>
</person-group>
<article-title>A molecular survey of
<italic>Anaplasma</italic>
spp.,
<italic>Rickettsia</italic>
spp.,
<italic>Ehrlichia canis</italic>
and
<italic>Babesia microti</italic>
in foxes and fleas from Sicily</article-title>
<source>Transbound Emerg Dis</source>
<year>2013</year>
<volume>60</volume>
<issue>Suppl 2</issue>
<fpage>125</fpage>
<lpage>30</lpage>
<pub-id pub-id-type="doi">10.1111/tbed.12137</pub-id>
<pub-id pub-id-type="pmid">24589112</pub-id>
</element-citation>
</ref>
<ref id="CR44">
<label>44.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cortes</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Vaz</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Neves</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Maia</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Campino</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Risk factors for canine leishmaniasis in an endemic Mediterranean region</article-title>
<source>Vet Parasitol</source>
<year>2012</year>
<volume>189</volume>
<fpage>189</fpage>
<lpage>96</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2012.04.028</pub-id>
<pub-id pub-id-type="pmid">22575278</pub-id>
</element-citation>
</ref>
<ref id="CR45">
<label>45.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maia</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Gomes</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Cristóvão</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Nunes</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Martins</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Rebêlo</surname>
<given-names>E</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Feline
<italic>Leishmania</italic>
infection in a canine leishmaniasis endemic region, Portugal</article-title>
<source>Vet Parasitol</source>
<year>2010</year>
<volume>174</volume>
<fpage>336</fpage>
<lpage>40</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2010.08.030</pub-id>
<pub-id pub-id-type="pmid">20869810</pub-id>
</element-citation>
</ref>
<ref id="CR46">
<label>46.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vilhena</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Martinez-Díaz</surname>
<given-names>VL</given-names>
</name>
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Vieira</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Altet</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Francino</surname>
<given-names>O</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Feline vector-borne pathogens in the north and centre of Portugal</article-title>
<source>Parasit Vectors</source>
<year>2013</year>
<volume>6</volume>
<fpage>99</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-6-99</pub-id>
<pub-id pub-id-type="pmid">23587366</pub-id>
</element-citation>
</ref>
<ref id="CR47">
<label>47.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abranches</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Conceição-Silva</surname>
<given-names>FM</given-names>
</name>
<name>
<surname>Silva-Pereira</surname>
<given-names>MC</given-names>
</name>
</person-group>
<article-title>Kala-azar in Portugal. V. The sylvatic cycle in the enzootic endemic focus of Arrabida</article-title>
<source>J Trop Med Hyg</source>
<year>1984</year>
<volume>87</volume>
<fpage>197</fpage>
<lpage>200</lpage>
<pub-id pub-id-type="pmid">6530708</pub-id>
</element-citation>
</ref>
<ref id="CR48">
<label>48.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rioux</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Albaret</surname>
<given-names>JL</given-names>
</name>
<name>
<surname>Houin</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Dedet</surname>
<given-names>JP</given-names>
</name>
<name>
<surname>Lanotte</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Écologie des leishmanioses dans le sud de la France: 2. Les réservoirs selvatiques. Infestation spontanée de renard (
<italic>Vulpes vulpes</italic>
L.)</article-title>
<source>Ann Parasitol Hum Comp</source>
<year>1968</year>
<volume>43</volume>
<fpage>421</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="pmid">5754278</pub-id>
</element-citation>
</ref>
<ref id="CR49">
<label>49.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bettini</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Pozio</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Gradoni</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Leishmaniasis in Tuscany (Italy): (II)
<italic>Leishmania</italic>
from wild Rodentia and Carnivora in a human and canine leishmaniasis focus</article-title>
<source>Trans R Soc Trop Med Hyg</source>
<year>1980</year>
<volume>74</volume>
<fpage>77</fpage>
<lpage>83</lpage>
<pub-id pub-id-type="doi">10.1016/0035-9203(80)90015-2</pub-id>
<pub-id pub-id-type="pmid">7434419</pub-id>
</element-citation>
</ref>
<ref id="CR50">
<label>50.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martín-Iniesta</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Martín-Iniesta</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Martin-Luengo</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Papel de perros y zorros como reservorio de leishmaniasis en la región murciana. Resultados preliminares</article-title>
<source>Rev Iber Parasitol</source>
<year>1982</year>
<volume>42</volume>
<fpage>307</fpage>
<lpage>13</lpage>
</element-citation>
</ref>
<ref id="CR51">
<label>51.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sobrino</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Ferroglio</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Oleaga</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Romano</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Millan</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Revilla</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Characterization of widespread canine leishmaniasis among wild carnivores from Spain</article-title>
<source>Vet Parasitol</source>
<year>2008</year>
<volume>155</volume>
<fpage>198</fpage>
<lpage>203</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetpar.2008.05.003</pub-id>
<pub-id pub-id-type="pmid">18579311</pub-id>
</element-citation>
</ref>
<ref id="CR52">
<label>52.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Davoust</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Mary</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Marié</surname>
<given-names>JL</given-names>
</name>
</person-group>
<article-title>Detection of
<italic>Leishmania</italic>
in red foxes (
<italic>Vulpes vulpes</italic>
) from southeastern France using real-time quantitative PCR</article-title>
<source>J Wildl Dis</source>
<year>2014</year>
<volume>50</volume>
<fpage>130</fpage>
<lpage>2</lpage>
<pub-id pub-id-type="doi">10.7589/2013-07-190</pub-id>
<pub-id pub-id-type="pmid">24171581</pub-id>
</element-citation>
</ref>
<ref id="CR53">
<label>53.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dipineto</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Manna</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Baiano</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Gala</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Fioretti</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Gravino</surname>
<given-names>AE</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Presence of
<italic>Leishmania infantum</italic>
in red foxes (
<italic>Vulpes vulpes</italic>
) in southern Italy</article-title>
<source>J Wildl Dis</source>
<year>2007</year>
<volume>43</volume>
<fpage>518</fpage>
<lpage>20</lpage>
<pub-id pub-id-type="doi">10.7589/0090-3558-43.3.518</pub-id>
<pub-id pub-id-type="pmid">17699092</pub-id>
</element-citation>
</ref>
<ref id="CR54">
<label>54.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verin</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Poli</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Ariti</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Nardoni</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Fanucchi Bertuccelli</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Mancianti</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Detection of
<italic>Leishmania infantum</italic>
DNA in tissues of free-ranging red foxes (
<italic>Vulpes vulpes</italic>
) in Central Italy</article-title>
<source>Eur J Wildl Res</source>
<year>2010</year>
<volume>56</volume>
<fpage>689</fpage>
<lpage>92</lpage>
<pub-id pub-id-type="doi">10.1007/s10344-010-0395-8</pub-id>
</element-citation>
</ref>
<ref id="CR55">
<label>55.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rioux</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Lanotte</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Destombes</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Vollhardt</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Croset</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Leishmaniose expérimental du renard</article-title>
<source>Rec Med Vet</source>
<year>1971</year>
<volume>147</volume>
<fpage>489</fpage>
<lpage>98</lpage>
</element-citation>
</ref>
<ref id="CR56">
<label>56.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Millán</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Ferroglio</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Solano-Gallego</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Role of wildlife in the epidemiology of
<italic>Leishmania infantum</italic>
infection in Europe</article-title>
<source>Parasitol Res</source>
<year>2014</year>
<volume>113</volume>
<fpage>2005</fpage>
<lpage>14</lpage>
<pub-id pub-id-type="doi">10.1007/s00436-014-3929-2</pub-id>
<pub-id pub-id-type="pmid">24804923</pub-id>
</element-citation>
</ref>
<ref id="CR57">
<label>57.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cardoso</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Mendão</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Madeira De Carvalho</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Prevalence of
<italic>Dirofilaria immitis</italic>
,
<italic>Ehrlichia canis</italic>
,
<italic>Borrelia burgdorferi</italic>
sensu lato,
<italic>Anaplasma</italic>
spp. and
<italic>Leishmania infantum</italic>
in apparently healthy and CVBD-suspect dogs in Portugal–a national serological study</article-title>
<source>Parasit Vectors</source>
<year>2012</year>
<volume>5</volume>
<fpage>62</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-5-62</pub-id>
<pub-id pub-id-type="pmid">22452990</pub-id>
</element-citation>
</ref>
<ref id="CR58">
<label>58.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Campino</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Maia</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Epidemiologia das leishmanioses em Portugal</article-title>
<source>Acta Med Port</source>
<year>2010</year>
<volume>23</volume>
<fpage>859</fpage>
<lpage>64</lpage>
<pub-id pub-id-type="pmid">21144327</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/RenardV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000017  | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000017  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    RenardV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.27.
Data generation: Tue Mar 28 00:55:51 2017. Site generation: Thu Jan 4 16:57:14 2024