Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 0013040 ( Pmc/Corpus ); précédent : 0013039; suivant : 0013041 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Sizing up
<italic>Septoria</italic>
</title>
<author>
<name sortKey="Quaedvlieg, W" sort="Quaedvlieg, W" uniqKey="Quaedvlieg W" first="W." last="Quaedvlieg">W. Quaedvlieg</name>
<affiliation>
<nlm:aff id="A1"> CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="A2"> Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands; Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, the Netherlands</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Verkley, G J M" sort="Verkley, G J M" uniqKey="Verkley G" first="G. J. M." last="Verkley">G. J. M. Verkley</name>
<affiliation>
<nlm:aff id="A1"> CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Shin, H D" sort="Shin, H D" uniqKey="Shin H" first="H.-D." last="Shin">H.-D. Shin</name>
<affiliation>
<nlm:aff id="A3"> Utrecht University, Department of Biology, Microbiology, Padualaan 8, 3584 CH Utrecht, The Netherlands; Division of Environmental Science and Ecological Engineering, Korea University, Seoul 136-701, Korea</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Barreto, R W" sort="Barreto, R W" uniqKey="Barreto R" first="R. W." last="Barreto">R. W. Barreto</name>
<affiliation>
<nlm:aff id="A4"> Departamento de Fitopatologia, Universidade Federal de Viçosa, 36750 Viçosa, Minas Gerais, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Alfenas, A C" sort="Alfenas, A C" uniqKey="Alfenas A" first="A. C." last="Alfenas">A. C. Alfenas</name>
<affiliation>
<nlm:aff id="A4"> Departamento de Fitopatologia, Universidade Federal de Viçosa, 36750 Viçosa, Minas Gerais, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Swart, W J" sort="Swart, W J" uniqKey="Swart W" first="W. J." last="Swart">W. J. Swart</name>
<affiliation>
<nlm:aff id="A5"> Department of Plant Sciences, University of the Free State, P.O. Box 339, Bloemfontein 9300, South Africa</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Groenewald, J Z" sort="Groenewald, J Z" uniqKey="Groenewald J" first="J. Z." last="Groenewald">J. Z. Groenewald</name>
<affiliation>
<nlm:aff id="A1"> CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Crous, P W" sort="Crous, P W" uniqKey="Crous P" first="P. W." last="Crous">P. W. Crous</name>
<affiliation>
<nlm:aff id="A1"> CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="A2"> Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands; Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, the Netherlands</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="A6"> Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">24014902</idno>
<idno type="pmc">3713890</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3713890</idno>
<idno type="RBID">PMC:3713890</idno>
<idno type="doi">10.3114/sim0017</idno>
<date when="2013">2013</date>
<idno type="wicri:Area/Pmc/Corpus">001304</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Sizing up
<italic>Septoria</italic>
</title>
<author>
<name sortKey="Quaedvlieg, W" sort="Quaedvlieg, W" uniqKey="Quaedvlieg W" first="W." last="Quaedvlieg">W. Quaedvlieg</name>
<affiliation>
<nlm:aff id="A1"> CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="A2"> Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands; Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, the Netherlands</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Verkley, G J M" sort="Verkley, G J M" uniqKey="Verkley G" first="G. J. M." last="Verkley">G. J. M. Verkley</name>
<affiliation>
<nlm:aff id="A1"> CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Shin, H D" sort="Shin, H D" uniqKey="Shin H" first="H.-D." last="Shin">H.-D. Shin</name>
<affiliation>
<nlm:aff id="A3"> Utrecht University, Department of Biology, Microbiology, Padualaan 8, 3584 CH Utrecht, The Netherlands; Division of Environmental Science and Ecological Engineering, Korea University, Seoul 136-701, Korea</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Barreto, R W" sort="Barreto, R W" uniqKey="Barreto R" first="R. W." last="Barreto">R. W. Barreto</name>
<affiliation>
<nlm:aff id="A4"> Departamento de Fitopatologia, Universidade Federal de Viçosa, 36750 Viçosa, Minas Gerais, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Alfenas, A C" sort="Alfenas, A C" uniqKey="Alfenas A" first="A. C." last="Alfenas">A. C. Alfenas</name>
<affiliation>
<nlm:aff id="A4"> Departamento de Fitopatologia, Universidade Federal de Viçosa, 36750 Viçosa, Minas Gerais, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Swart, W J" sort="Swart, W J" uniqKey="Swart W" first="W. J." last="Swart">W. J. Swart</name>
<affiliation>
<nlm:aff id="A5"> Department of Plant Sciences, University of the Free State, P.O. Box 339, Bloemfontein 9300, South Africa</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Groenewald, J Z" sort="Groenewald, J Z" uniqKey="Groenewald J" first="J. Z." last="Groenewald">J. Z. Groenewald</name>
<affiliation>
<nlm:aff id="A1"> CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Crous, P W" sort="Crous, P W" uniqKey="Crous P" first="P. W." last="Crous">P. W. Crous</name>
<affiliation>
<nlm:aff id="A1"> CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="A2"> Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands; Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, the Netherlands</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="A6"> Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Studies in Mycology</title>
<idno type="ISSN">0166-0616</idno>
<idno type="eISSN">1872-9797</idno>
<imprint>
<date when="2013">2013</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p id="P6">
<italic>Septoria</italic>
represents a genus of plant pathogenic fungi with a wide geographic distribution, commonly associated with leaf spots and stem cankers of a broad range of plant hosts. A major aim of this study was to resolve the phylogenetic generic limits of
<italic>Septoria, Stagonospora</italic>
, and other related genera such as
<italic>Sphaerulina, Phaeosphaeria</italic>
and
<italic>Phaeoseptoria</italic>
using sequences of the the partial 28S nuclear ribosomal RNA and RPB2 genes of a large set of isolates. Based on these results
<italic>Septoria</italic>
is shown to be a distinct genus in the
<italic>Mycosphaerellaceae</italic>
, which has mycosphaerella-like sexual morphs. Several septoria-like species are now accommodated in
<italic>Sphaerulina</italic>
, a genus previously linked to this complex.
<italic>Phaeosphaeria</italic>
(based on
<italic>P. oryzae</italic>
) is shown to be congeneric with
<italic>Phaeoseptoria</italic>
(based on
<italic>P. papayae</italic>
), which is reduced to synonymy under the former.
<italic>Depazea nodorum</italic>
(causal agent of nodorum blotch of cereals) and
<italic>Septoria avenae</italic>
(causal agent of avenae blotch of barley and rye) are placed in a new genus,
<italic>Parastagonospora</italic>
, which is shown to be distinct from
<italic>Stagonospora</italic>
(based on
<italic>S. paludosa</italic>
) and
<italic>Phaeosphaeria</italic>
. Partial nucleotide sequence data for five gene loci, ITS, LSU, EF-1α, RPB2 and Btub were generated for all of these isolates. A total of 47 clades or genera were resolved, leading to the introduction of 14 new genera, 36 new species, and 19 new combinations.</p>
<sec id="S1">
<title>Taxonomic novelties:</title>
<p id="P7">
<bold>New genera -</bold>
<italic>Acicuseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Cylindroseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Kirstenboschia</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neoseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neostagonospora</italic>
Quaedvlieg, Verkley & Crous,
<italic>Parastagonospora</italic>
Quaedvlieg, Verkley & Crous,
<italic>Polyphialoseptoria</italic>
Quaedvlieg, R.W. Barreto, Verkley & Crous,
<italic>Ruptoseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Septorioides</italic>
Quaedvlieg, Verkley & Crous,
<italic>Setoseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Stromatoseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Vrystaatia</italic>
Quaedvlieg, W.J. Swart, Verkley & Crous,
<italic>Xenobotryosphaeria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Xenoseptoria</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous.
<bold>New species -</bold>
<italic>Acicuseptoria rumicis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Caryophylloseptoria pseudolychnidis</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Coniothyrium sidae</italic>
Quaedvlieg, Verkley, R.W. Barreto & Crous,
<italic>Corynespora leucadendri</italic>
Quaedvlieg, Verkley & Crous,
<italic>Cylindroseptoria ceratoniae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Cylindroseptoria pistaciae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Kirstenboschia diospyri</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neoseptoria caricis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neostagonospora caricis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neostagonospora elegiae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Paraphoma dioscoreae</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Parastagonospora caricis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Parastagonospora poae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Phlyctema vincetoxici</italic>
Quaedvlieg, Verkley & Crous,
<italic>Polyphialoseptoria tabebuiae-serratifoliae</italic>
Quaedvlieg, Alfenas & Crous,
<italic>Polyphialoseptoria terminaliae</italic>
Quaedvlieg, R.W. Barreto, Verkley & Crous,
<italic>Pseudoseptoria collariana</italic>
Quaedvlieg, Verkley & Crous,
<italic>Pseudoseptoria obscura</italic>
Quaedvlieg, Verkley & Crous,
<italic>Sclerostagonospora phragmiticola</italic>
Quaedvlieg, Verkley & Crous,
<italic>Septoria cretae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Septoria glycinicola</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Septoria oenanthicola</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Septoria pseudonapelli</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Setophoma chromolaenae</italic>
Quaedvlieg, Verkley, R.W. Barreto & Crous,
<italic>Setoseptoria phragmitis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina amelanchier</italic>
Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina pseudovirgaureae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina viciae</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Stagonospora duoseptata</italic>
Quaedvlieg, Verkley & Crous,
<italic>Stagonospora perfecta</italic>
Quaedvlieg, Verkley & Crous,
<italic>Stagonospora pseudocaricis</italic>
Quaedvlieg, Verkley, Gardiennet & Crous,
<italic>Stagonospora pseudovitensis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Stagonospora uniseptata</italic>
Quaedvlieg, Verkley & Crous,
<italic>Vrystaatia aloeicola</italic>
Quaedvlieg, Verkley, W.J. Swart & Crous,
<italic>Xenobotryosphaeria calamagrostidis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Xenoseptoria neosaccardoi</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous.
<bold>New combinations -</bold>
<italic>Parastagonospora avenae</italic>
(A.B. Frank) Quaedvlieg, Verkley & Crous,
<italic>Parastagonospora nodorum</italic>
(Berk.) Quaedvlieg, Verkley & Crous,
<italic>Phaeosphaeria papayae</italic>
(Speg.) Quaedvlieg, Verkley & Crous,
<italic>Pseudocercospora domingensis</italic>
(Petr. & Cif.) Quaedvlieg, Verkley & Crous,
<italic>Ruptoseptoria unedonis</italic>
(Roberge ex Desm.) Quaedvlieg, Verkley & Crous,
<italic>Septorioides pini-thunbergii</italic>
(S. Kaneko) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina abeliceae</italic>
(Hiray.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina azaleae</italic>
(Voglino) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina berberidis</italic>
(Niessl) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina betulae</italic>
(Pass.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina cercidis</italic>
(Fr.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina menispermi</italic>
(Thüm.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina musiva</italic>
(Peck) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina oxyacanthae</italic>
(Kunze & J.C. Schmidt) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina patriniae</italic>
(Miura) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina populicola</italic>
(Peck) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina quercicola</italic>
(Desm.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina rhabdoclinis</italic>
(Butin) Quaedvlieg, Verkley & Crous,
<italic>Stromatoseptoria castaneicola</italic>
(Desm.) Quaedvlieg, Verkley & Crous.
<bold>Typifications: Epitypifications -</bold>
<italic>Phaeosphaeria oryzae</italic>
I. Miyake,
<italic>Phaeoseptoria papayae</italic>
Speg.;
<bold>Neotypification -</bold>
<italic>Hendersonia paludosa</italic>
Sacc. & Speg.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Aptroot, A" uniqKey="Aptroot A">A Aptroot</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arx, Ja Von" uniqKey="Arx J">JA von Arx</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arzanlou, M" uniqKey="Arzanlou M">M Arzanlou</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Aveskamp, M" uniqKey="Aveskamp M">M Aveskamp</name>
</author>
<author>
<name sortKey="Gruyter, H De" uniqKey="Gruyter H">H de Gruyter</name>
</author>
<author>
<name sortKey="Woudenberg, J" uniqKey="Woudenberg J">J Woudenberg</name>
</author>
<author>
<name sortKey="Verkley, G" uniqKey="Verkley G">G Verkley</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Barnes, I" uniqKey="Barnes I">I Barnes</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Wingfield, Bd" uniqKey="Wingfield B">BD Wingfield</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Beach, Ws" uniqKey="Beach W">WS Beach</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bedlan, G" uniqKey="Bedlan G">G Bedlan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bissett, J" uniqKey="Bissett J">J Bissett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Braun, U" uniqKey="Braun U">U Braun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Braun, U" uniqKey="Braun U">U Braun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Braun, U" uniqKey="Braun U">U Braun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Camara, Mps" uniqKey="Camara M">MPS Câmara</name>
</author>
<author>
<name sortKey="Ramaley, Aw" uniqKey="Ramaley A">AW Ramaley</name>
</author>
<author>
<name sortKey="Castlebury, La" uniqKey="Castlebury L">LA Castlebury</name>
</author>
<author>
<name sortKey="Palm, Me" uniqKey="Palm M">ME Palm</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Carbone, I" uniqKey="Carbone I">I Carbone</name>
</author>
<author>
<name sortKey="Kohn, Lm" uniqKey="Kohn L">LM Kohn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cheewangkoon, R" uniqKey="Cheewangkoon R">R Cheewangkoon</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Hyde, Kd" uniqKey="Hyde K">KD Hyde</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="To Anan, C" uniqKey="To Anan C">C To-anan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Constantinescu, O" uniqKey="Constantinescu O">O Constantinescu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Braun, U" uniqKey="Braun U">U Braun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Braun, U" uniqKey="Braun U">U Braun</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Braun, U" uniqKey="Braun U">U Braun</name>
</author>
<author>
<name sortKey="Hunter, Gc" uniqKey="Hunter G">GC Hunter</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Braun, U" uniqKey="Braun U">U Braun</name>
</author>
<author>
<name sortKey="Schubert, K" uniqKey="Schubert K">K Schubert</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Ferreira, Fa" uniqKey="Ferreira F">FA Ferreira</name>
</author>
<author>
<name sortKey="Sutton, Bc" uniqKey="Sutton B">BC Sutton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Gams, W" uniqKey="Gams W">W Gams</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Smith, Iw" uniqKey="Smith I">IW Smith</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Kang, Jc" uniqKey="Kang J">JC Kang</name>
</author>
<author>
<name sortKey="Braun, U" uniqKey="Braun U">U Braun</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Schoch, Cl" uniqKey="Schoch C">CL Schoch</name>
</author>
<author>
<name sortKey="Hyde, Kd" uniqKey="Hyde K">KD Hyde</name>
</author>
<author>
<name sortKey="Wood, Ar" uniqKey="Wood A">AR Wood</name>
</author>
<author>
<name sortKey="Gueidan, C" uniqKey="Gueidan C">C Gueidan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Shivas, Rg" uniqKey="Shivas R">RG Shivas</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
<author>
<name sortKey="Summerell, Ba" uniqKey="Summerell B">BA Summerell</name>
</author>
<author>
<name sortKey="Rossman, Ay" uniqKey="Rossman A">AY Rossman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Slippers, B" uniqKey="Slippers B">B Slippers</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
<author>
<name sortKey="Rheeder, J" uniqKey="Rheeder J">J Rheeder</name>
</author>
<author>
<name sortKey="Marasas, Wfo" uniqKey="Marasas W">WFO Marasas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Summerell, Ba" uniqKey="Summerell B">BA Summerell</name>
</author>
<author>
<name sortKey="Carnegie, Aj" uniqKey="Carnegie A">AJ Carnegie</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Summerell, Ba" uniqKey="Summerell B">BA Summerell</name>
</author>
<author>
<name sortKey="Carnegie, Aj" uniqKey="Carnegie A">AJ Carnegie</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
<author>
<name sortKey="Hunter, Gc" uniqKey="Hunter G">GC Hunter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Tanaka, K" uniqKey="Tanaka K">K Tanaka</name>
</author>
<author>
<name sortKey="Summerell, Ba" uniqKey="Summerell B">BA Summerell</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Christensen, M" uniqKey="Christensen M">M Christensen</name>
</author>
<author>
<name sortKey="Casta Eda Ruiz, Rf" uniqKey="Casta Eda Ruiz R">RF Castañeda-Ruiz</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Samson, Ra" uniqKey="Samson R">RA Samson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
<author>
<name sortKey="Park, Rf" uniqKey="Park R">RF Park</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cunfer, Bm" uniqKey="Cunfer B">BM Cunfer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cunfer, Bm" uniqKey="Cunfer B">BM Cunfer</name>
</author>
<author>
<name sortKey="Ueng, Pp" uniqKey="Ueng P">PP Ueng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Deighton, Fc" uniqKey="Deighton F">FC Deighton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Demaree, Jb" uniqKey="Demaree J">JB Demaree</name>
</author>
<author>
<name sortKey="Wilcox, Ms" uniqKey="Wilcox M">MS Wilcox</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Desmazieres, Jbhj" uniqKey="Desmazieres J">JBHJ Desmazières</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Donk, Ma" uniqKey="Donk M">MA Donk</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dyko, Bj" uniqKey="Dyko B">BJ Dyko</name>
</author>
<author>
<name sortKey="Sutton, Bc" uniqKey="Sutton B">BC Sutton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ellis, Mb" uniqKey="Ellis M">MB Ellis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ellis, Mb" uniqKey="Ellis M">MB Ellis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ellis, Mb" uniqKey="Ellis M">MB Ellis</name>
</author>
<author>
<name sortKey="Ellis, Jp" uniqKey="Ellis J">JP Ellis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eriksson, Oe" uniqKey="Eriksson O">OE Eriksson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Evans, Hc" uniqKey="Evans H">HC Evans</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eyal, Z" uniqKey="Eyal Z">Z Eyal</name>
</author>
<author>
<name sortKey="Sharen, Al" uniqKey="Sharen A">AL Sharen</name>
</author>
<author>
<name sortKey="Prescott, Jm" uniqKey="Prescott J">JM Prescott</name>
</author>
<author>
<name sortKey="Ginkel, M Van" uniqKey="Ginkel M">M van Ginkel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Farr, Df" uniqKey="Farr D">DF Farr</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Farr, Df" uniqKey="Farr D">DF Farr</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Farr, Df" uniqKey="Farr D">DF Farr</name>
</author>
<author>
<name sortKey="Rossman, Ay" uniqKey="Rossman A">AY Rossman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Feau, N" uniqKey="Feau N">N Feau</name>
</author>
<author>
<name sortKey="Hamelin, Rc" uniqKey="Hamelin R">RC Hamelin</name>
</author>
<author>
<name sortKey="Bernier, L" uniqKey="Bernier L">L Bernier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ferreira, Fa" uniqKey="Ferreira F">FA Ferreira</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Frank, J" uniqKey="Frank J">J Frank</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Oertel, B" uniqKey="Oertel B">B Oertel</name>
</author>
<author>
<name sortKey="Hyde, Kd" uniqKey="Hyde K">KD Hyde</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fukuhara, M" uniqKey="Fukuhara M">M Fukuhara</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Golzar, H" uniqKey="Golzar H">H Golzar</name>
</author>
<author>
<name sortKey="Wang, C" uniqKey="Wang C">C Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Goodwin, Sb" uniqKey="Goodwin S">SB Goodwin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Greene, Hc" uniqKey="Greene H">HC Greene</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Nakashima, C" uniqKey="Nakashima C">C Nakashima</name>
</author>
<author>
<name sortKey="Nishikawa, J" uniqKey="Nishikawa J">J Nishikawa</name>
</author>
<author>
<name sortKey="Shin, H D" uniqKey="Shin H">H-D Shin</name>
</author>
<author>
<name sortKey="Park, J H" uniqKey="Park J">J-H Park</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gruyter, J De" uniqKey="Gruyter J">J de Gruyter</name>
</author>
<author>
<name sortKey="Woudenberg, Jhc" uniqKey="Woudenberg J">JHC Woudenberg</name>
</author>
<author>
<name sortKey="Aveskamp, Mm" uniqKey="Aveskamp M">MM Aveskamp</name>
</author>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gruyter, J De" uniqKey="Gruyter J">J de Gruyter</name>
</author>
<author>
<name sortKey="Woudenberg, Jhc" uniqKey="Woudenberg J">JHC Woudenberg</name>
</author>
<author>
<name sortKey="Aveskamp, Mm" uniqKey="Aveskamp M">MM Aveskamp</name>
</author>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hall, Ta" uniqKey="Hall T">TA Hall</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hawksworth, Dl" uniqKey="Hawksworth D">DL Hawksworth</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Redhead, Sa" uniqKey="Redhead S">SA Redhead</name>
</author>
<author>
<name sortKey="Reynolds, Dr" uniqKey="Reynolds D">DR Reynolds</name>
</author>
<author>
<name sortKey="Samson, Ra" uniqKey="Samson R">RA Samson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Huelsenbeck, Jp" uniqKey="Huelsenbeck J">JP Huelsenbeck</name>
</author>
<author>
<name sortKey="Ronquist, F" uniqKey="Ronquist F">F Ronquist</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Inacio, Ca" uniqKey="Inacio C">CA Inácio</name>
</author>
<author>
<name sortKey="Dianese, Jc" uniqKey="Dianese J">JC Dianese</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="J Rstad, I" uniqKey="J Rstad I">I Jørstad</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="J Rstad, I" uniqKey="J Rstad I">I Jørstad</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kaneko, S" uniqKey="Kaneko S">S Kaneko</name>
</author>
<author>
<name sortKey="Fujioka, H" uniqKey="Fujioka H">H Fujioka</name>
</author>
<author>
<name sortKey="Zinno, Y" uniqKey="Zinno Y">Y Zinno</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Katoh, K" uniqKey="Katoh K">K Katoh</name>
</author>
<author>
<name sortKey="Misawa, K" uniqKey="Misawa K">K Misawa</name>
</author>
<author>
<name sortKey="Kuma, K" uniqKey="Kuma K">K Kuma</name>
</author>
<author>
<name sortKey="Miyata, T" uniqKey="Miyata T">T Miyata</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lamprecht, Sc" uniqKey="Lamprecht S">SC Lamprecht</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Tewoldemedhin, Yt" uniqKey="Tewoldemedhin Y">YT Tewoldemedhin</name>
</author>
<author>
<name sortKey="Marasas, Wfo" uniqKey="Marasas W">WFO Marasas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lee, S" uniqKey="Lee S">S Lee</name>
</author>
<author>
<name sortKey="Mel Ik, V" uniqKey="Mel Ik V">V Mel’nik</name>
</author>
<author>
<name sortKey="Taylor, Je" uniqKey="Taylor J">JE Taylor</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, Hy" uniqKey="Li H">HY Li</name>
</author>
<author>
<name sortKey="Sun, Gy" uniqKey="Sun G">GY Sun</name>
</author>
<author>
<name sortKey="Zhai, Xr" uniqKey="Zhai X">XR Zhai</name>
</author>
<author>
<name sortKey="Batzer, Jc" uniqKey="Batzer J">JC Batzer</name>
</author>
<author>
<name sortKey="Mayfield, Da" uniqKey="Mayfield D">DA Mayfield</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Jk" uniqKey="Liu J">JK Liu</name>
</author>
<author>
<name sortKey="Phookamsak, R" uniqKey="Phookamsak R">R Phookamsak</name>
</author>
<author>
<name sortKey="Mingkhuan, M" uniqKey="Mingkhuan M">M Mingkhuan</name>
</author>
<author>
<name sortKey="Wikee, S" uniqKey="Wikee S">S Wikee</name>
</author>
<author>
<name sortKey="Li, Ym" uniqKey="Li Y">YM Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y Liu</name>
</author>
<author>
<name sortKey="Whelen, S" uniqKey="Whelen S">S Whelen</name>
</author>
<author>
<name sortKey="Hall, B" uniqKey="Hall B">B Hall</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lombard, L" uniqKey="Lombard L">L Lombard</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Wingfield, Bd" uniqKey="Wingfield B">BD Wingfield</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Marincowitz, S" uniqKey="Marincowitz S">S Marincowitz</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mason Gamer, Rj" uniqKey="Mason Gamer R">RJ Mason-Gamer</name>
</author>
<author>
<name sortKey="Kellogg, Ea" uniqKey="Kellogg E">EA Kellogg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mcdonald, Mc" uniqKey="Mcdonald M">MC McDonald</name>
</author>
<author>
<name sortKey="Razavi, M" uniqKey="Razavi M">M Razavi</name>
</author>
<author>
<name sortKey="Friesen, Tl" uniqKey="Friesen T">TL Friesen</name>
</author>
<author>
<name sortKey="Brunner, Pc" uniqKey="Brunner P">PC Brunner</name>
</author>
<author>
<name sortKey="Mcdonald, Ba" uniqKey="Mcdonald B">BA McDonald</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Michaelides, T" uniqKey="Michaelides T">T Michaelides</name>
</author>
<author>
<name sortKey="Morgan, Dp" uniqKey="Morgan D">DP Morgan</name>
</author>
<author>
<name sortKey="Doster, Ma" uniqKey="Doster M">MA Doster</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Monod, M" uniqKey="Monod M">M Monod</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nag Raj, Tr" uniqKey="Nag Raj T">TR Nag Raj</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Niekerk, Jm Van" uniqKey="Niekerk J">JM van Niekerk</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Fourie, Ph" uniqKey="Fourie P">PH Fourie</name>
</author>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nylander, Jaa" uniqKey="Nylander J">JAA Nylander</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="O Onnell, K" uniqKey="O Onnell K">K O’Donnell</name>
</author>
<author>
<name sortKey="Kistler, Hc" uniqKey="Kistler H">HC Kistler</name>
</author>
<author>
<name sortKey="Cigelnik, E" uniqKey="Cigelnik E">E Cigelnik</name>
</author>
<author>
<name sortKey="Ploetz, Rc" uniqKey="Ploetz R">RC Ploetz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Petrak, F" uniqKey="Petrak F">F Petrak</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Petrak, F" uniqKey="Petrak F">F Petrak</name>
</author>
<author>
<name sortKey="Sydow, H" uniqKey="Sydow H">H Sydow</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Phillips, Ajl" uniqKey="Phillips A">AJL Phillips</name>
</author>
<author>
<name sortKey="Alves, A" uniqKey="Alves A">A Alves</name>
</author>
<author>
<name sortKey="Pennycook, Sr" uniqKey="Pennycook S">SR Pennycook</name>
</author>
<author>
<name sortKey="Johnston, Pr" uniqKey="Johnston P">PR Johnston</name>
</author>
<author>
<name sortKey="Ramaley, A" uniqKey="Ramaley A">A Ramaley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Priest, Mj" uniqKey="Priest M">MJ Priest</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Punithalingam, E" uniqKey="Punithalingam E">E Punithalingam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Quaedvlieg, W" uniqKey="Quaedvlieg W">W Quaedvlieg</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="De Jesus Ya Ez Morales, M" uniqKey="De Jesus Ya Ez Morales M">M de Jesús Yáñez-Morales</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Quaedvlieg, W" uniqKey="Quaedvlieg W">W Quaedvlieg</name>
</author>
<author>
<name sortKey="Kema, Ghj" uniqKey="Kema G">GHJ Kema</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Seifbarghi, S" uniqKey="Seifbarghi S">S Seifbarghi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rayner, Rw" uniqKey="Rayner R">RW Rayner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rogers, Dp" uniqKey="Rogers D">DP Rogers</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Saccardo, Pa" uniqKey="Saccardo P">PA Saccardo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Saccardo, Pa" uniqKey="Saccardo P">PA Saccardo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Saccardo, Pa" uniqKey="Saccardo P">PA Saccardo</name>
</author>
<author>
<name sortKey="Saccardo, D" uniqKey="Saccardo D">D Saccardo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Saccardo, Pa" uniqKey="Saccardo P">PA Saccardo</name>
</author>
<author>
<name sortKey="Trotter, A" uniqKey="Trotter A">A Trotter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shin, Hd" uniqKey="Shin H">HD Shin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shin, Hd" uniqKey="Shin H">HD Shin</name>
</author>
<author>
<name sortKey="Sameva, Ef" uniqKey="Sameva E">EF Sameva</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shin, Hd" uniqKey="Shin H">HD Shin</name>
</author>
<author>
<name sortKey="Sameva, Ef" uniqKey="Sameva E">EF Sameva</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shoemaker, Ra" uniqKey="Shoemaker R">RA Shoemaker</name>
</author>
<author>
<name sortKey="Babcock, Ce" uniqKey="Babcock C">CE Babcock</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sivanesan, A" uniqKey="Sivanesan A">A Sivanesan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Solomon, Ps" uniqKey="Solomon P">PS Solomon</name>
</author>
<author>
<name sortKey="Lowe, Rgt" uniqKey="Lowe R">RGT Lowe</name>
</author>
<author>
<name sortKey="Tan, Kc" uniqKey="Tan K">KC Tan</name>
</author>
<author>
<name sortKey="Waters, Odc" uniqKey="Waters O">ODC Waters</name>
</author>
<author>
<name sortKey="Oliver, Rp" uniqKey="Oliver R">RP Oliver</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stukenbrock, Eh" uniqKey="Stukenbrock E">EH Stukenbrock</name>
</author>
<author>
<name sortKey="Quaedvlieg, W" uniqKey="Quaedvlieg W">W Quaedvlieg</name>
</author>
<author>
<name sortKey="Javan Nikhah, M" uniqKey="Javan Nikhah M">M Javan-Nikhah</name>
</author>
<author>
<name sortKey="Zala, M" uniqKey="Zala M">M Zala</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Mcdonald, Ba" uniqKey="Mcdonald B">BA McDonald</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Summerell, Ba" uniqKey="Summerell B">BA Summerell</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Carnegie, Aj" uniqKey="Carnegie A">AJ Carnegie</name>
</author>
<author>
<name sortKey="Summerbell, Rc" uniqKey="Summerbell R">RC Summerbell</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sutton, B" uniqKey="Sutton B">B Sutton</name>
</author>
<author>
<name sortKey="Pollack, F" uniqKey="Pollack F">F Pollack</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sutton, Bc" uniqKey="Sutton B">BC Sutton</name>
</author>
<author>
<name sortKey="Pascoe, Ig" uniqKey="Pascoe I">IG Pascoe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sutton, Bc" uniqKey="Sutton B">BC Sutton</name>
</author>
<author>
<name sortKey="Pascoe, Ig" uniqKey="Pascoe I">IG Pascoe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sutton, Bc" uniqKey="Sutton B">BC Sutton</name>
</author>
<author>
<name sortKey="Swart, Hj" uniqKey="Swart H">HJ Swart</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sutton, Bc" uniqKey="Sutton B">BC Sutton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sutton, Bc" uniqKey="Sutton B">BC Sutton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sutton, Bc" uniqKey="Sutton B">BC Sutton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Teterevnikova Babayan, Dn" uniqKey="Teterevnikova Babayan D">DN Teterevnikova-Babayan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Priest, Mj" uniqKey="Priest M">MJ Priest</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
<author>
<name sortKey="Braun, U" uniqKey="Braun U">U Braun</name>
</author>
<author>
<name sortKey="Aptroot, A" uniqKey="Aptroot A">A Aptroot</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Silva Da, M" uniqKey="Silva Da M">M Silva da</name>
</author>
<author>
<name sortKey="Wicklow, Dt" uniqKey="Wicklow D">DT Wicklow</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Starink Willemse, M" uniqKey="Starink Willemse M">M Starink-Willemse</name>
</author>
<author>
<name sortKey="Van Iperen, A" uniqKey="Van Iperen A">A van Iperen</name>
</author>
<author>
<name sortKey="Abeln, Eca" uniqKey="Abeln E">ECA Abeln</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Verkley, Gjm" uniqKey="Verkley G">GJM Verkley</name>
</author>
<author>
<name sortKey="Quaedvlieg, W" uniqKey="Quaedvlieg W">W Quaedvlieg</name>
</author>
<author>
<name sortKey="Shin, Hd" uniqKey="Shin H">HD Shin</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vilgalys, R" uniqKey="Vilgalys R">R Vilgalys</name>
</author>
<author>
<name sortKey="Hester, M" uniqKey="Hester M">M Hester</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wakefield, Em" uniqKey="Wakefield E">EM Wakefield</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Walker, J" uniqKey="Walker J">J Walker</name>
</author>
<author>
<name sortKey="Sutton, Bc" uniqKey="Sutton B">BC Sutton</name>
</author>
<author>
<name sortKey="Pascoe, Ig" uniqKey="Pascoe I">IG Pascoe</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="White, Tj" uniqKey="White T">TJ White</name>
</author>
<author>
<name sortKey="Bruns, T" uniqKey="Bruns T">T Bruns</name>
</author>
<author>
<name sortKey="Lee, S" uniqKey="Lee S">S Lee</name>
</author>
<author>
<name sortKey="Taylor, J" uniqKey="Taylor J">J Taylor</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wingfield, Mj" uniqKey="Wingfield M">MJ Wingfield</name>
</author>
<author>
<name sortKey="De Beer, Zw" uniqKey="De Beer Z">ZW De Beer</name>
</author>
<author>
<name sortKey="Slippers, B" uniqKey="Slippers B">B Slippers</name>
</author>
<author>
<name sortKey="Wingfield, Bd" uniqKey="Wingfield B">BD Wingfield</name>
</author>
<author>
<name sortKey="Groenewald, Jz" uniqKey="Groenewald J">JZ Groenewald</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yoo, J J" uniqKey="Yoo J">J-J Yoo</name>
</author>
<author>
<name sortKey="Eom, A H" uniqKey="Eom A">A-H Eom</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author>
<name sortKey="Crous, Pw" uniqKey="Crous P">PW Crous</name>
</author>
<author>
<name sortKey="Schoch, Cl" uniqKey="Schoch C">CL Schoch</name>
</author>
<author>
<name sortKey="Hyde, Kd" uniqKey="Hyde K">KD Hyde</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Stud Mycol</journal-id>
<journal-id journal-id-type="iso-abbrev">Stud. Mycol</journal-id>
<journal-id journal-id-type="hwp">simycol</journal-id>
<journal-title-group>
<journal-title>Studies in Mycology</journal-title>
</journal-title-group>
<issn pub-type="ppub">0166-0616</issn>
<issn pub-type="epub">1872-9797</issn>
<publisher>
<publisher-name>CBS Fungal Biodiversity Centre</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">24014902</article-id>
<article-id pub-id-type="pmc">3713890</article-id>
<article-id pub-id-type="doi">10.3114/sim0017</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Articles</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Sizing up
<italic>Septoria</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Quaedvlieg</surname>
<given-names>W.</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
<xref ref-type="aff" rid="A2">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Verkley</surname>
<given-names>G.J.M.</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Shin</surname>
<given-names>H.-D.</given-names>
</name>
<xref ref-type="aff" rid="A3">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Barreto</surname>
<given-names>R.W.</given-names>
</name>
<xref ref-type="aff" rid="A4">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Alfenas</surname>
<given-names>A.C.</given-names>
</name>
<xref ref-type="aff" rid="A4">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Swart</surname>
<given-names>W.J.</given-names>
</name>
<xref ref-type="aff" rid="A5">5</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Groenewald</surname>
<given-names>J.Z.</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Crous</surname>
<given-names>P.W.</given-names>
</name>
<xref ref-type="aff" rid="A1">1</xref>
<xref ref-type="aff" rid="A2">2</xref>
<xref ref-type="aff" rid="A6">6</xref>
<xref ref-type="corresp" rid="cor1">*</xref>
</contrib>
<aff id="A1">
<label>1</label>
CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands</aff>
<aff id="A2">
<label>2</label>
Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands; Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, the Netherlands</aff>
<aff id="A3">
<label>3</label>
Utrecht University, Department of Biology, Microbiology, Padualaan 8, 3584 CH Utrecht, The Netherlands; Division of Environmental Science and Ecological Engineering, Korea University, Seoul 136-701, Korea</aff>
<aff id="A4">
<label>4</label>
Departamento de Fitopatologia, Universidade Federal de Viçosa, 36750 Viçosa, Minas Gerais, Brazil</aff>
<aff id="A5">
<label>5</label>
Department of Plant Sciences, University of the Free State, P.O. Box 339, Bloemfontein 9300, South Africa</aff>
<aff id="A6">
<label>6</label>
Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands</aff>
</contrib-group>
<author-notes>
<corresp id="cor1">
<label>*</label>
<italic>Correspondence</italic>
: Pedro W. Crous,
<email>p.crous@cbs.knaw.nl</email>
</corresp>
</author-notes>
<pub-date pub-type="ppub">
<day>30</day>
<month>6</month>
<year>2013</year>
</pub-date>
<pub-date pub-type="epub">
<day>30</day>
<month>6</month>
<year>2013</year>
</pub-date>
<volume>75</volume>
<issue>1</issue>
<issue-title>Phytopathogenic Dothideomycetes</issue-title>
<fpage>307</fpage>
<lpage>390</lpage>
<permissions>
<copyright-statement>Copyright 2013 CBS-KNAW Fungal Biodiversity Centre</copyright-statement>
<copyright-year>2013</copyright-year>
<license license-type="creative-commons">
<license-p>You are free to share - to copy, distribute and transmit the work, under the following conditions:</license-p>
<license-p>
<bold>Attribution:</bold>
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).</license-p>
<license-p>
<bold>Non-commercial:</bold>
You may not use this work for commercial purposes.</license-p>
<license-p>
<bold>No derivative works:</bold>
You may not alter, transform, or build upon this work.</license-p>
<license-p>For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at
<uri xlink:type="simple" xlink:href="http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode">http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode</uri>
. Any of the above conditions can be waived if you get permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.</license-p>
</license>
</permissions>
<self-uri xlink:title="pdf" xlink:type="simple" xlink:href="307.pdf"></self-uri>
<abstract>
<p id="P6">
<italic>Septoria</italic>
represents a genus of plant pathogenic fungi with a wide geographic distribution, commonly associated with leaf spots and stem cankers of a broad range of plant hosts. A major aim of this study was to resolve the phylogenetic generic limits of
<italic>Septoria, Stagonospora</italic>
, and other related genera such as
<italic>Sphaerulina, Phaeosphaeria</italic>
and
<italic>Phaeoseptoria</italic>
using sequences of the the partial 28S nuclear ribosomal RNA and RPB2 genes of a large set of isolates. Based on these results
<italic>Septoria</italic>
is shown to be a distinct genus in the
<italic>Mycosphaerellaceae</italic>
, which has mycosphaerella-like sexual morphs. Several septoria-like species are now accommodated in
<italic>Sphaerulina</italic>
, a genus previously linked to this complex.
<italic>Phaeosphaeria</italic>
(based on
<italic>P. oryzae</italic>
) is shown to be congeneric with
<italic>Phaeoseptoria</italic>
(based on
<italic>P. papayae</italic>
), which is reduced to synonymy under the former.
<italic>Depazea nodorum</italic>
(causal agent of nodorum blotch of cereals) and
<italic>Septoria avenae</italic>
(causal agent of avenae blotch of barley and rye) are placed in a new genus,
<italic>Parastagonospora</italic>
, which is shown to be distinct from
<italic>Stagonospora</italic>
(based on
<italic>S. paludosa</italic>
) and
<italic>Phaeosphaeria</italic>
. Partial nucleotide sequence data for five gene loci, ITS, LSU, EF-1α, RPB2 and Btub were generated for all of these isolates. A total of 47 clades or genera were resolved, leading to the introduction of 14 new genera, 36 new species, and 19 new combinations.</p>
<sec id="S1">
<title>Taxonomic novelties:</title>
<p id="P7">
<bold>New genera -</bold>
<italic>Acicuseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Cylindroseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Kirstenboschia</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neoseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neostagonospora</italic>
Quaedvlieg, Verkley & Crous,
<italic>Parastagonospora</italic>
Quaedvlieg, Verkley & Crous,
<italic>Polyphialoseptoria</italic>
Quaedvlieg, R.W. Barreto, Verkley & Crous,
<italic>Ruptoseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Septorioides</italic>
Quaedvlieg, Verkley & Crous,
<italic>Setoseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Stromatoseptoria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Vrystaatia</italic>
Quaedvlieg, W.J. Swart, Verkley & Crous,
<italic>Xenobotryosphaeria</italic>
Quaedvlieg, Verkley & Crous,
<italic>Xenoseptoria</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous.
<bold>New species -</bold>
<italic>Acicuseptoria rumicis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Caryophylloseptoria pseudolychnidis</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Coniothyrium sidae</italic>
Quaedvlieg, Verkley, R.W. Barreto & Crous,
<italic>Corynespora leucadendri</italic>
Quaedvlieg, Verkley & Crous,
<italic>Cylindroseptoria ceratoniae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Cylindroseptoria pistaciae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Kirstenboschia diospyri</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neoseptoria caricis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neostagonospora caricis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Neostagonospora elegiae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Paraphoma dioscoreae</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Parastagonospora caricis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Parastagonospora poae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Phlyctema vincetoxici</italic>
Quaedvlieg, Verkley & Crous,
<italic>Polyphialoseptoria tabebuiae-serratifoliae</italic>
Quaedvlieg, Alfenas & Crous,
<italic>Polyphialoseptoria terminaliae</italic>
Quaedvlieg, R.W. Barreto, Verkley & Crous,
<italic>Pseudoseptoria collariana</italic>
Quaedvlieg, Verkley & Crous,
<italic>Pseudoseptoria obscura</italic>
Quaedvlieg, Verkley & Crous,
<italic>Sclerostagonospora phragmiticola</italic>
Quaedvlieg, Verkley & Crous,
<italic>Septoria cretae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Septoria glycinicola</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Septoria oenanthicola</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Septoria pseudonapelli</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Setophoma chromolaenae</italic>
Quaedvlieg, Verkley, R.W. Barreto & Crous,
<italic>Setoseptoria phragmitis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina amelanchier</italic>
Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina pseudovirgaureae</italic>
Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina viciae</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<italic>Stagonospora duoseptata</italic>
Quaedvlieg, Verkley & Crous,
<italic>Stagonospora perfecta</italic>
Quaedvlieg, Verkley & Crous,
<italic>Stagonospora pseudocaricis</italic>
Quaedvlieg, Verkley, Gardiennet & Crous,
<italic>Stagonospora pseudovitensis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Stagonospora uniseptata</italic>
Quaedvlieg, Verkley & Crous,
<italic>Vrystaatia aloeicola</italic>
Quaedvlieg, Verkley, W.J. Swart & Crous,
<italic>Xenobotryosphaeria calamagrostidis</italic>
Quaedvlieg, Verkley & Crous,
<italic>Xenoseptoria neosaccardoi</italic>
Quaedvlieg, H.D. Shin, Verkley & Crous.
<bold>New combinations -</bold>
<italic>Parastagonospora avenae</italic>
(A.B. Frank) Quaedvlieg, Verkley & Crous,
<italic>Parastagonospora nodorum</italic>
(Berk.) Quaedvlieg, Verkley & Crous,
<italic>Phaeosphaeria papayae</italic>
(Speg.) Quaedvlieg, Verkley & Crous,
<italic>Pseudocercospora domingensis</italic>
(Petr. & Cif.) Quaedvlieg, Verkley & Crous,
<italic>Ruptoseptoria unedonis</italic>
(Roberge ex Desm.) Quaedvlieg, Verkley & Crous,
<italic>Septorioides pini-thunbergii</italic>
(S. Kaneko) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina abeliceae</italic>
(Hiray.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina azaleae</italic>
(Voglino) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina berberidis</italic>
(Niessl) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina betulae</italic>
(Pass.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina cercidis</italic>
(Fr.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina menispermi</italic>
(Thüm.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina musiva</italic>
(Peck) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina oxyacanthae</italic>
(Kunze & J.C. Schmidt) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina patriniae</italic>
(Miura) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina populicola</italic>
(Peck) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina quercicola</italic>
(Desm.) Quaedvlieg, Verkley & Crous,
<italic>Sphaerulina rhabdoclinis</italic>
(Butin) Quaedvlieg, Verkley & Crous,
<italic>Stromatoseptoria castaneicola</italic>
(Desm.) Quaedvlieg, Verkley & Crous.
<bold>Typifications: Epitypifications -</bold>
<italic>Phaeosphaeria oryzae</italic>
I. Miyake,
<italic>Phaeoseptoria papayae</italic>
Speg.;
<bold>Neotypification -</bold>
<italic>Hendersonia paludosa</italic>
Sacc. & Speg.</p>
</sec>
</abstract>
<kwd-group>
<title>Key words:</title>
<kwd>
<italic>Capnodiales</italic>
</kwd>
<kwd>Multi-Locus Sequence Typing (MLST)</kwd>
<kwd>
<italic>Mycosphaerella</italic>
</kwd>
<kwd>
<italic>Mycosphaerellaceae</italic>
</kwd>
<kwd>
<italic>Phaeoseptoria</italic>
</kwd>
<kwd>
<italic>Phaeosphaeria</italic>
</kwd>
<kwd>
<italic>Phaeosphaeriaceae</italic>
</kwd>
<kwd>
<italic>Pleosporales</italic>
</kwd>
<kwd>
<italic>Septoria</italic>
</kwd>
<kwd>
<italic>Sphaerulina</italic>
</kwd>
<kwd>
<italic>Stagonospora</italic>
</kwd>
<kwd>systematics</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec id="S2">
<title>INTRODUCTION</title>
<p id="P8">Fungal species belonging to
<italic>Septoria</italic>
are among the most common and widespread leaf-spotting fungi worldwide.
<italic>Septoria</italic>
Sacc. (
<italic>Mycosphaerella, Capnodiales, Dothideomycetes</italic>
) is based on
<italic>Septoria cytisi</italic>
, which was first described by Desmazières (
<xref ref-type="bibr" rid="R38">1847</xref>
) as a pathogen of
<italic>Cytisus laburnum</italic>
(=
<italic>Laburnum anagyroides</italic>
). The genus
<italic>Septoria</italic>
is extremely large, and during the past 150 years more than 2000 taxa have been ascribed to this asexual genus (
<xref ref-type="bibr" rid="R113">Verkley & Priest 2000</xref>
, Verkley
<italic>et al</italic>
. 2004). Presently,
<italic>Septoria s.lat</italic>
. represents a polyphyletic assembly of genera that cluster mostly in the
<italic>Mycosphaerellaceae</italic>
(a family incorporating many plant pathogenic coelomycetes), although fungi with septoria-like morphology have also evolved outside this family (Crous
<italic>et al.</italic>
<xref ref-type="bibr" rid="R25">2009a</xref>
,
<xref ref-type="bibr" rid="R29">c</xref>
). Although many species of
<italic>Septoria</italic>
have mycosphaerella-like sexual states, the name
<italic>Mycosphaerella</italic>
does not apply to them, and should not be used in this context.</p>
<p id="P9">Following a proposal accepted by the International Code of Nomenclature for algae, fungi and plants (ICN), the generic name
<italic>Septoria</italic>
Sacc. was conserved over the older synonym
<italic>Septaria</italic>
Fr. (original spelling). The arguments preceding the typification of
<italic>Septoria</italic>
and subsequent proposals for name conservation by Wakefield (
<xref ref-type="bibr" rid="R119">1940</xref>
), Rogers (
<xref ref-type="bibr" rid="R91">1949</xref>
) and Donk (
<xref ref-type="bibr" rid="R39">1964</xref>
) between
<italic>Septoria sensu</italic>
Saccardo or
<italic>Septaria</italic>
Fries were various. In the end the committee for fungi appointed by the ICN followed the recommendation of Donk (
<xref ref-type="bibr" rid="R39">1964</xref>
), and decided on
<italic>Septoria</italic>
Sacc. over
<italic>Septaria</italic>
Fr., arguing that
<italic>Septoria</italic>
Sacc. had already been in prevalent use for many years, and should therefore be accepted as the correct name.</p>
<p id="P10">After examining several herbarium specimens of
<italic>S. cytisi</italic>
, Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
) circumscribed
<italic>Septoria</italic>
as follows:
<italic>Mycelium</italic>
immersed, branched, septate, pale brown.
<italic>Conidiomata</italic>
pycnidial, immersed, separate or aggregated (but not confluent), globose, papillate (or not), brown, thin-walled of pale brown
<italic>textura angularis</italic>
, often with a smaller-celled inner layer, somewhat darker and more thick-walled around the ostiole.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
holoblastic, either determinate or indeterminate, with a limited number of sympodial proliferations. Each locus has a broad, flat, unthickened scar, discrete, hyaline, smooth, ampulliform, doliiform or lageniform to short cylindrical.
<italic>Conidia</italic>
hyaline, multiseptate, filiform, smooth and either continuous or constricted at septa. Later work by Constantinescu (
<xref ref-type="bibr" rid="R15">1984</xref>
), Sutton & Pascoe (
<xref ref-type="bibr" rid="R105">1987</xref>
,
<xref ref-type="bibr" rid="R106">1989</xref>
) and Farr (
<xref ref-type="bibr" rid="R47">1991</xref>
,
<xref ref-type="bibr" rid="R48">1992</xref>
) augmented Sutton’s previous generic circumscription by also including species with sympodial, enteroblastic and percurrent conidial proliferation. Furthermore, based on similarities in conidiomatal development, von Arx (
<xref ref-type="bibr" rid="R2">1983</xref>
) and Braun (
<xref ref-type="bibr" rid="R10">1995</xref>
) adopted an even wider concept of
<italic>Septoria</italic>
that included the acervular forms normally accommodated in
<italic>Phloeospora.</italic>
</p>
<p id="P11">Morphological traits in
<italic>Septoria</italic>
are generally conserved, and specific morphological characters by which to describe and identify
<italic>Septoria</italic>
and septoria-like species are limited. This lack of specific morphological characters caused
<italic>Septoria</italic>
taxonomy to be largely dependent on associated host data, leading to many of the described species only being identifiable by host plant, and by variation in informative supplementary characters like conidial length, width and septation (Jørstad
<xref ref-type="bibr" rid="R64">1965</xref>
,
<xref ref-type="bibr" rid="R65">1967</xref>
,
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). Of these supplementary characters, conidial width appears to be the most stable (i.e. it shows the least amount of intraspecific variation) and in most
<italic>Septoria</italic>
species, intraspecific conidial width rarely varies more than 1 μm (
<xref ref-type="bibr" rid="R86">Priest 2006</xref>
).</p>
<p id="P12">This reliance on host data in
<italic>Septoria</italic>
taxonomy is far from perfect, and should be avoided for identification purposes (see
<xref ref-type="bibr" rid="R117">Verkley
<italic>et al.</italic>
2013</xref>
, this volume). Extensive host inoculation experiments by Beach (
<xref ref-type="bibr" rid="R6">1919</xref>
) and Teterevnikova-Babayan (
<xref ref-type="bibr" rid="R111">1987</xref>
) have shown that identification of
<italic>Septoria</italic>
spp. by host specificity alone is error prone because many
<italic>Septoria</italic>
species are not restricted to a single specific host (i.e. several taxa have broader host ranges).
<italic>Septoria</italic>
species like
<italic>S. lactucicola</italic>
and
<italic>S. lycopersici</italic>
can not only infect multiple plant species within the same genus, but can also infect plants belonging to closely allied families and genera. In contrast to this, morphologically well distinguishable
<italic>Septoria</italic>
species can also parasitise the same hosts (
<italic>e.g.</italic>
multiple distinct
<italic>Septoria</italic>
species can be found on both
<italic>Chrysanthemum</italic>
and
<italic>Rubus</italic>
hosts) (
<xref ref-type="bibr" rid="R37">Demaree & Wilcox 1943</xref>
,
<xref ref-type="bibr" rid="R87">Punithalingam 1976</xref>
,
<xref ref-type="bibr" rid="R98">Shin & Sameva 2004</xref>
). Because host specificity has been one of the main criteria used for describing new, morphologically indistinguishable
<italic>Septoria</italic>
species over the past 150 years, one can expect that a certain number of described taxa are in fact synonyms of species from related hosts.</p>
<sec id="S3">
<title>
<italic>Septoria</italic>
and septoria-like genera in the molecular era</title>
<p id="P13">Although it had previously been speculated by Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
) that
<italic>Septoria</italic>
was in fact polyphyletic, definitive proof of this hypothesis awaited the introduction of molecular techniques. Cunfer & Ueng (
<xref ref-type="bibr" rid="R35">1999</xref>
) were the first to use rDNA sequence data of the internal transcribed spacer region (ITS) to postulate that
<italic>Zymoseptoria tritici</italic>
(then known as
<italic>Septoria tritici</italic>
) and several
<italic>Stagonospora</italic>
spp. (a morphologically similar genus, previously linked to
<italic>Septoria</italic>
) actually belonged to two distinct genera. Verkley
<italic>et al.</italic>
(2004) extended this study by employing a combination of 28S nrDNA (LSU) and ITS data to prove that
<italic>Septoria</italic>
was in fact both poly- and paraphyletic. Their work showed that septoria-like species such as
<italic>Z. tritici</italic>
and
<italic>Z. passerinii</italic>
were more closely related to
<italic>Ramularia</italic>
than to the majority of the other
<italic>Septoria</italic>
species used in their datasets.</p>
<p id="P14">Feau
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R50">2006</xref>
) were the first to use a multi-locus polyphasic sequencing approach to reliably identify
<italic>Septoria</italic>
spp. Besides ITS and LSU sequence data, they also used β-tubulin (Btub) sequence data to separate closely related species into distinct monophyletic groups that frequently correlated with their respective host families. These results supported the approach of using multi-gene sequence data for studying a large collection of
<italic>Septoria</italic>
strains at species level.</p>
<p id="P15">
<italic>Septoria s. str.</italic>
was finally demarcated when Quaedvlieg
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R89">2011</xref>
) managed to obtain both ITS and LSU sequence data from
<italic>S. cytisi</italic>
herbarium specimens. Phylogenetic analysis of the obtained
<italic>S. cytisi</italic>
LSU sequence data clearly proved that Z
<italic>. tritici</italic>
and
<italic>Z. passerinii</italic>
[as previously indicated by Cunfer & Ueng (
<xref ref-type="bibr" rid="R35">1999</xref>
) and Verkley
<italic>et al.</italic>
(2004)] did not belong to
<italic>Septoria s. str</italic>
., but in fact belonged to a separate genus, closely related to
<italic>Ramularia</italic>
. These two species were subsequently split off from
<italic>Septoria</italic>
and placed in a new genus,
<italic>Zymoseptoria</italic>
(named for the yeast-like state produced in culture). Since the initial
<italic>Zymoseptoria</italic>
paper, five additional species from members of
<italic>Poaceae</italic>
have been described in this genus (
<xref ref-type="bibr" rid="R26">Crous
<italic>et al</italic>
. 2012a</xref>
,
<xref ref-type="bibr" rid="R102">Stukenbrock
<italic>et al</italic>
. 2012</xref>
).</p>
</sec>
<sec id="S4">
<title>Septoria-like asexual genera</title>
<p id="P16">Since the description of
<italic>Septoria</italic>
by Desmazières (
<xref ref-type="bibr" rid="R38">1847</xref>
), several additional septoria-like genera (pycnidial/acervular/stromatic conidioma with filiform conidia) have been described which could be mistaken for
<italic>Septoria s. str</italic>
.</p>
<p id="P17">The two economically most important septoria-like genera are probably
<italic>Zymoseptoria</italic>
(sexual morph mycosphaerella-like) and
<italic>Parastagonospora</italic>
(sexual morph phaeosphaeria-like; see below). Both of these genera are pathogenic on
<italic>Poaceae</italic>
(grasses) and are directly or indirectly responsible for significant annual crop losses worldwide on cereals such as barley and wheat (
<xref ref-type="bibr" rid="R46">Eyal et al. 1987</xref>
). Quaedvlieg
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R89">2011</xref>
) determined that
<italic>Zymoseptoria</italic>
formed a distinct clade in the
<italic>Mycosphaerellaceae</italic>
, while
<italic>Stagonospora</italic>
was found to cluster in the
<italic>Phaeosphaeriaceae</italic>
within the
<italic>Pleosporales,</italic>
near other genera like
<italic>Phoma</italic>
and
<italic>Phaeosphaeria</italic>
(
<xref ref-type="bibr" rid="R35">Cunfer & Ueng 1999</xref>
,
<xref ref-type="bibr" rid="R101">Solomon
<italic>et al</italic>
. 2006</xref>
) which contain important plant pathogens. However, besides
<italic>Zymoseptoria</italic>
and
<italic>Parastagonospora</italic>
there are many other, lesser-known septoria-like genera awaiting elucidation. The goal of the present study is therefore to conduct an in-depth morphological and molecular analysis of these septoria-like genera, and resolve the affinities of
<italic>Stagonospora</italic>
and its purported sexual morph,
<italic>Phaeosphaeria</italic>
. To this end a collection of 370
<italic>Septoria</italic>
and septoria-like isolates (
<xref ref-type="table" rid="T1">Table 1</xref>
) were subjected to morphological examination and multi-gene DNA analyses.</p>
</sec>
</sec>
<sec sec-type="materials|methods" id="S5">
<title>MATERIALS AND METHODS</title>
<sec id="S6">
<title>Isolates</title>
<p id="P18">Symptomatic leaves were incubated in moist chambers for up to 1 wk to enhance sporulation before single conidial colonies were established on 2 % malt extract agar (MEA) (
<xref ref-type="bibr" rid="R32">Crous
<italic>et al</italic>
. 2009d</xref>
). Leaf spots bearing ascomata were soaked in water for approximately 2 h, after which they were attached to the inner surface of Petri dish lids over plates containing MEA. Ascospore germination patterns were examined after 24 h, and single ascospore cultures established as described previously (
<xref ref-type="bibr" rid="R33">Crous
<italic>et al</italic>
. 1991</xref>
,
<xref ref-type="bibr" rid="R16">Crous 1998</xref>
). Colonies were sub-cultured onto synthetic nutrient-poor agar (SNA) containing sterile
<italic>Hordeum vulgare</italic>
(barley) and
<italic>Urtica dioica</italic>
(stinging nettle) stems, potato-dextrose agar (PDA), oatmeal agar (OA), and MEA (
<xref ref-type="bibr" rid="R32">Crous
<italic>et al.</italic>
2009d</xref>
), and incubated at 25 °C under continuous near-ultraviolet light to promote sporulation. Isolates were also obtained from the culture collections of the CBS-KNAW Fungal Biodiversity Centre (CBS) in Utrecht, and the working collection of Pedro Crous (CPC). Reference strains were deposited CBS (
<xref ref-type="table" rid="T1">Table 1</xref>
).</p>
</sec>
<sec id="S7">
<title>DNA extraction, amplification and sequencing</title>
<p id="P19">Genomic DNA was extracted from fungal mycelium growing on MEA, using the UltraClean® Microbial DNA Isolation Kit (Mo Bio Laboratories, Inc., Solana Beach, CA, USA). Strains (
<xref ref-type="table" rid="T1">Table 1</xref>
) were screened for five loci (β-tubulin (Btub), internal transcribed spacer (ITS), Translation elongation factor 1-alpha (EF-1α) 28S nrDNA (LSU) and RNA polymerase II second largest subunit (RPB2) using the primer sets listed in
<xref ref-type="table" rid="T2">Table 2</xref>
. The PCR amplifications were performed in a total volume of 12.5 μL solution containing 10-20 ng of template DNA, 1 × PCR buffer, 0.7 μL DMSO (99.9 %), 2 mM MgCl
<sub>2</sub>
, 0.4 μM of each primer, 25 μM of each dNTP and 1.0 U Taq DNA polymerase (GoTaq, Promega). PCR amplification conditions were set as follows: an initial denaturation temperature of 96 °C for 2 min, followed by 40 cycles of denaturation temperature of 96 °C for 45 s, primer annealing at the temperature stipulated in
<xref ref-type="table" rid="T2">Table 2</xref>
, primer extension at 72 °C for 90 s and a final extension step at 72 °C for 2 min. The resulting fragments were sequenced using the PCR primers together with a BigDye Terminator Cycle Sequencing Kit v. 3.1 (Applied Biosystems, Foster City, CA). Sequencing reactions were performed as described by Cheewangkoon
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R14">2008</xref>
). All novel sequences were deposited in NCBI’s GenBank database and alignments and phylogenetic trees in TreeBASE.</p>
</sec>
<sec id="S8">
<title>Phylogenetic analyses</title>
<p id="P20">A basic alignment of the obtained sequence data was first done using MAFFT v. 7 [(
<uri xlink:type="simple" xlink:href="http://mafft.cbrc.jp/alignment/server/index.html">http://mafft.cbrc.jp/alignment/server/index.html</uri>
) (
<xref ref-type="bibr" rid="R67">Katoh
<italic>et al</italic>
. 2002</xref>
)] and if necessary, manually improved in BioEdit v. 7.0.5.2 (
<xref ref-type="bibr" rid="R60">Hall 1999</xref>
). To check the congruency of the RPB2 and LSU dataset, a 70 % neighbour-joining (NJ) reciprocal bootstrap method with maximum likelihood distance was performed (
<xref ref-type="bibr" rid="R75">Mason-Gamer & Kellogg 1996</xref>
,
<xref ref-type="bibr" rid="R73">Lombard
<italic>et al.</italic>
2010</xref>
). Bayesian analyses (critical value for the topological convergence diagnostic set to 0.01) were performed on the concatenated loci using MrBayes v. 3.2.1 (
<xref ref-type="bibr" rid="R62">Huelsenbeck & Ronquist 2001</xref>
) as described by Crous
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R27">2006</xref>
) using nucleotide substitution models that were selected using MrModeltest v.2.3 (
<xref ref-type="table" rid="T3">Table 3</xref>
) (
<xref ref-type="bibr" rid="R81">Nylander 2004</xref>
). In order to keep the trees manageable for publication, two separate Bayesian trees were run. The first tree was run with all the
<italic>Septoria</italic>
and septoria-like isolates that either belonged to, or where more closely related to the
<italic>Mycosphaerellaceae</italic>
(
<xref ref-type="fig" rid="F1">Fig. 1</xref>
) while the second tree contained all the septoria-like isolates either belonging to, or being more closely related to the
<italic>Phaeosphaeriaceae</italic>
(
<xref ref-type="fig" rid="F2">Fig. 2</xref>
).
<italic>Parastagonospora nodorum</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=259.49&link_type=cbs">CBS 259.49</ext-link>
) was used as outgroup for the
<italic>Mycosphaerellaceae</italic>
dataset, while
<italic>Dothistroma pini</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=121005&link_type=cbs">CBS 121005</ext-link>
) was used as outgroup for the
<italic>Phaeosphaeriaceae</italic>
dataset. As the novel genera and species described in this study were already clearly distinquishable in the LSU/RPB2 trees, the ITS, EF-1α and Btub sequence data of these isolates were deposited in GenBank without their subsequent trees being published in this paper.</p>
<fig id="F1" position="float">
<label>Fig. 1.</label>
<caption>
<p>A Bayesian 50 % majority rule RPB2/LSU consensus tree containing all
<italic>Septoria</italic>
and septoria-like taxa available at the CBS, which cluster in or near the
<italic>Mycosphaerellaceae</italic>
. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. A stop rule (set to 0.01) for the critical value for the topological convergence diagnostic was used for the Bayesian analysis. The tree was rooted to
<italic>Phaeosphaeria nodorum</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=259.49&link_type=cbs">CBS 259.49</ext-link>
). The scalebar indicates 0.1 expected changes per site.</p>
</caption>
<graphic xlink:href="307fig1A"></graphic>
<graphic xlink:href="307fig1B"></graphic>
<graphic xlink:href="307fig1C"></graphic>
<graphic xlink:href="307fig1D"></graphic>
<graphic xlink:href="307fig1E"></graphic>
</fig>
<fig id="F2" position="float">
<label>Fig. 2.</label>
<caption>
<p>A Bayesian 50 % majority rule RPB2/LSU consensus tree containing all
<italic>Septoria</italic>
and septoria-like taxa available at the CBS, which cluster in or near the
<italic>Phaeosphaeriaceae</italic>
. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. A stop rule (set to 0.01) for the critical value for the topological convergence diagnostic was used for the Bayesian analysis. The tree was rooted to
<italic>Dothistroma pini</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=121005&link_type=cbs">CBS 121005</ext-link>
). The scalebar indicates 0.01 expected changes per site.</p>
</caption>
<graphic xlink:href="307fig2A"></graphic>
<graphic xlink:href="307fig2B"></graphic>
</fig>
</sec>
<sec id="S9">
<title>Taxonomy</title>
<p id="P21">Taxonomic descriptions were based on isolates sporulating in culture. Diseased leaf tissue was viewed under a Zeiss V20 Discovery stereo-microscope, while a Zeiss Axio Imager 2 light microscope with differential interference contrast (DIC) illumination and an AxioCam MRc5 camera with Zen software was used to capture morphological structures. Adobe Photoshop CS3 was used for the final editing of acquired images and photographic preparations. For measurements, 30-50 replicates of all relevant morphological features were made at ×1000 magnification. Colony characters and pigment production were noted after 2-4 wk of growth on MEA, PDA and OA (
<xref ref-type="bibr" rid="R32">Crous
<italic>et al.</italic>
2009d</xref>
) incubated at 25 °C in the dark. Colony colours (surface and reverse) were rated according to the colour charts of Rayner (
<xref ref-type="bibr" rid="R90">1970</xref>
).</p>
</sec>
</sec>
<sec sec-type="results" id="S10">
<title>RESULTS</title>
<sec id="S11">
<title>DNA sequencing and phylogenetic analysis</title>
<p id="P22">The RPB2 and LSU sequence datasets did not show any conficts in both the
<italic>Mycosphaerellaceae</italic>
and
<italic>Phaeosphaeriaceae</italic>
tree topologies for the 70 % reciprocal bootstrap trees, allowing us to combine them in the multigene analyses. For the
<italic>Mycosphaerellaceae</italic>
tree, the gene boundaries were: 1-327 bp for RPB2 and 332-1120 bp for LSU. For the
<italic>Phaeosphaeriaceae</italic>
tree (
<xref ref-type="fig" rid="F2">Fig. 2</xref>
), the gene boundaries were 1-777 bp for LSU and 782-1108 bp for RPB2. During the generation of the
<italic>Mycosphaerellaceae</italic>
tree (
<xref ref-type="fig" rid="F1">Fig. 1</xref>
), a total of 57 048 trees were sampled out of the generated 76 062 trees (75 %). During the generation of the
<italic>Phaeosphaeriaceae</italic>
tree (
<xref ref-type="fig" rid="F2">Fig. 2</xref>
), a total of 2844 trees were sampled out of the generated 3792 trees (75 %).</p>
</sec>
<sec id="S12">
<title>Taxonomy</title>
<p id="P23">A total of 347 isolates representing 170 species were subjected to DNA analysis and morphological comparison. Phylogenetic analyses based on the LSU and RPB2 genes resolved a total of 47 clades of which 26 contained species belonging to the
<italic>Septoria</italic>
(-like) complex. These 47 resolved clades belong to a multitude of different families within the
<italic>Dothidiomycetes</italic>
ranging from the
<italic>Mycosphaerellaceae</italic>
in the
<italic>Capnodiales</italic>
to the
<italic>Lentitheciaceae</italic>
in the
<italic>Pleosporales</italic>
. It is still unclear within the
<italic>Dothidiomycetes</italic>
where the phylogenetic family borders are located, or even how many phylogenetically substainable families there actually are. The family annotation in the phylogenetic trees (Figs
<xref ref-type="fig" rid="F1">1</xref>
,
<xref ref-type="fig" rid="F2">2</xref>
) is therefore based on the closest LSU neighbour that was available in GenBank, with clades treated as
<italic>incertae sedis</italic>
if no closer relationship than 97 % could be found.</p>
<table-wrap id="T1" position="float">
<label>Table 1.</label>
<caption>
<p>Collection details and GenBank accession numbers of isolates included in this study.</p>
</caption>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
</colgroup>
<thead>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Species</bold>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Isolate no.</bold>
<xref ref-type="fn" rid="TFN1">
<sup>
<bold>1</bold>
</sup>
</xref>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Host</bold>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Location</bold>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Collector</bold>
</th>
<th align="center" colspan="5" rowspan="1">
<bold>GenBank accession no.</bold>
<xref ref-type="fn" rid="TFN2">
<sup>
<bold>2</bold>
</sup>
</xref>
<hr></hr>
</th>
</tr>
<tr>
<th rowspan="1" colspan="1"></th>
<th rowspan="1" colspan="1"></th>
<th rowspan="1" colspan="1"></th>
<th rowspan="1" colspan="1"></th>
<th rowspan="1" colspan="1"></th>
<th align="left" rowspan="1" colspan="1">
<bold>EF-1α</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>Btub</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>RPB2</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>LSU</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>ITS</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="1" colspan="1">
<italic>Acicuseptoria rumicis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=522.78&link_type=cbs">CBS 522.78</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rumex alpinus</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253105</td>
<td rowspan="1" colspan="1">KF252643</td>
<td rowspan="1" colspan="1">KF252153</td>
<td rowspan="1" colspan="1">KF251648</td>
<td rowspan="1" colspan="1">KF251144</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Boeremia telephii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135415&link_type=cbs">CBS 135415</ext-link>
; S670</td>
<td rowspan="1" colspan="1">
<italic>Lavatera thuringiaca</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">U. Damm</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252644</td>
<td rowspan="1" colspan="1">KF252154</td>
<td rowspan="1" colspan="1">KF251649</td>
<td rowspan="1" colspan="1">KF251145</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Caryophylloseptoria lychnidis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109098&link_type=cbs">CBS 109098</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Silene pratensis</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253234</td>
<td rowspan="1" colspan="1">KF252768</td>
<td rowspan="1" colspan="1">KF252292</td>
<td rowspan="1" colspan="1">KF251790</td>
<td rowspan="1" colspan="1">KF251286</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109099&link_type=cbs">CBS 109099</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Silene pratensis</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253235</td>
<td rowspan="1" colspan="1">KF252769</td>
<td rowspan="1" colspan="1">KF252293</td>
<td rowspan="1" colspan="1">KF251791</td>
<td rowspan="1" colspan="1">KF251287</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109101&link_type=cbs">CBS 109101</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Silene pratensis</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253236</td>
<td rowspan="1" colspan="1">KF252770</td>
<td rowspan="1" colspan="1">KF252294</td>
<td rowspan="1" colspan="1">KF251792</td>
<td rowspan="1" colspan="1">KF251288</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109102&link_type=cbs">CBS 109102</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Silene pratensis</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253237</td>
<td rowspan="1" colspan="1">KF252771</td>
<td rowspan="1" colspan="1">KF252295</td>
<td rowspan="1" colspan="1">KF251793</td>
<td rowspan="1" colspan="1">KF251289</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Car. pseudolychnidis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128614&link_type=cbs">CBS 128614</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lychnis cognata</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253238</td>
<td rowspan="1" colspan="1">KF252772</td>
<td rowspan="1" colspan="1">KF252296</td>
<td rowspan="1" colspan="1">KF251794</td>
<td rowspan="1" colspan="1">KF251290</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128630&link_type=cbs">CBS 128630</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lychnis cognata</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253239</td>
<td rowspan="1" colspan="1">KF252773</td>
<td rowspan="1" colspan="1">KF252297</td>
<td rowspan="1" colspan="1">KF251795</td>
<td rowspan="1" colspan="1">KF251291</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Car. silenes</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109100&link_type=cbs">CBS 109100</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Silene nutans</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253240</td>
<td rowspan="1" colspan="1">KF252774</td>
<td rowspan="1" colspan="1">KF252298</td>
<td rowspan="1" colspan="1">KF251796</td>
<td rowspan="1" colspan="1">KF251292</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109103&link_type=cbs">CBS 109103</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Silene pratensis</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253241</td>
<td rowspan="1" colspan="1">KF252775</td>
<td rowspan="1" colspan="1">KF252299</td>
<td rowspan="1" colspan="1">KF251797</td>
<td rowspan="1" colspan="1">KF251293</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Car. spergulae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=397.52&link_type=cbs">CBS 397.52</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Dianthus caryophyllus</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">Schouten</td>
<td rowspan="1" colspan="1">KF253243</td>
<td rowspan="1" colspan="1">KF252777</td>
<td rowspan="1" colspan="1">KF252301</td>
<td rowspan="1" colspan="1">KF251799</td>
<td rowspan="1" colspan="1">KF251295</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109010&link_type=cbs">CBS 109010</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Spergula morisonii</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">A. Aptroot</td>
<td rowspan="1" colspan="1">KF253242</td>
<td rowspan="1" colspan="1">KF252776</td>
<td rowspan="1" colspan="1">KF252300</td>
<td rowspan="1" colspan="1">KF251798</td>
<td rowspan="1" colspan="1">KF251294</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cercospora beticola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=124.31&link_type=cbs">CBS 124.31</ext-link>
; CPC 5070</td>
<td rowspan="1" colspan="1">
<italic>Beta vulgaris</italic>
</td>
<td rowspan="1" colspan="1">Romania</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253106</td>
<td rowspan="1" colspan="1">KF252645</td>
<td rowspan="1" colspan="1">KF252155</td>
<td rowspan="1" colspan="1">KF251650</td>
<td rowspan="1" colspan="1">KF251146</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cer. capsici</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=118712&link_type=cbs">CBS 118712</ext-link>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Fiji</td>
<td rowspan="1" colspan="1">P. Tyler</td>
<td rowspan="1" colspan="1">KF253244</td>
<td rowspan="1" colspan="1">KF252778</td>
<td rowspan="1" colspan="1">KF252302</td>
<td rowspan="1" colspan="1">KF251800</td>
<td rowspan="1" colspan="1">KF251296</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cer. zebrina</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=137.56&link_type=cbs">CBS 137.56</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Hedysarum coronarium</italic>
</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">M. Ribaldi</td>
<td rowspan="1" colspan="1">KF253245</td>
<td rowspan="1" colspan="1">KF252779</td>
<td rowspan="1" colspan="1">KF252303</td>
<td rowspan="1" colspan="1">KF251801</td>
<td rowspan="1" colspan="1">KF251297</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=118790&link_type=cbs">CBS 118790</ext-link>
; IMI 262766</td>
<td rowspan="1" colspan="1">
<italic>Trifolium subterraneum</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">M.J. Barbetti</td>
<td rowspan="1" colspan="1">KF253107</td>
<td rowspan="1" colspan="1">KF252646</td>
<td rowspan="1" colspan="1">KF252156</td>
<td rowspan="1" colspan="1">KF251651</td>
<td rowspan="1" colspan="1">KF251147</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Chaetosphaeronema hispidulum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=216.75&link_type=cbs">CBS 216.75</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Anthyllis vulneraria</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253108</td>
<td rowspan="1" colspan="1">KF252647</td>
<td rowspan="1" colspan="1">KF252157</td>
<td rowspan="1" colspan="1">KF251652</td>
<td rowspan="1" colspan="1">KF251148</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Coniothyrium carteri</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=105.91&link_type=cbs">CBS 105.91</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Quercus robur</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">H. Schill</td>
<td rowspan="1" colspan="1">KF253165</td>
<td rowspan="1" colspan="1">KF252700</td>
<td rowspan="1" colspan="1">KF252214</td>
<td rowspan="1" colspan="1">KF251712</td>
<td rowspan="1" colspan="1">KF251209</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=101633&link_type=cbs">CBS 101633</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Quercus</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253166</td>
<td rowspan="1" colspan="1">KF252701</td>
<td rowspan="1" colspan="1">KF252215</td>
<td rowspan="1" colspan="1">KF251713</td>
<td rowspan="1" colspan="1">KF251210</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Con. glycinicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=124141&link_type=cbs">CBS 124141</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Glycine max</italic>
</td>
<td rowspan="1" colspan="1">Zimbabwe</td>
<td rowspan="1" colspan="1">C. Lavy</td>
<td rowspan="1" colspan="1">KF253167</td>
<td rowspan="1" colspan="1">KF252702</td>
<td rowspan="1" colspan="1">KF252216</td>
<td rowspan="1" colspan="1">KF251714</td>
<td rowspan="1" colspan="1">KF251211</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Con. sidae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135108&link_type=cbs">CBS 135108</ext-link>
; CPC 19602</td>
<td rowspan="1" colspan="1">
<italic>Sida</italic>
sp.</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">R.W. Barreto</td>
<td rowspan="1" colspan="1">KF253109</td>
<td rowspan="1" colspan="1">KF252648</td>
<td rowspan="1" colspan="1">KF252158</td>
<td rowspan="1" colspan="1">KF251653</td>
<td rowspan="1" colspan="1">KF251149</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Corynespora leucadendri</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135133&link_type=cbs">CBS 135133</ext-link>
; CPC 19345</td>
<td rowspan="1" colspan="1">
<italic>Leucadendron</italic>
sp.</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">S. Lee</td>
<td rowspan="1" colspan="1">KF253110</td>
<td rowspan="1" colspan="1">KF252639</td>
<td rowspan="1" colspan="1">KF252159</td>
<td rowspan="1" colspan="1">KF251654</td>
<td rowspan="1" colspan="1">KF251150</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cylindroseptoria ceratoniae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=477.69&link_type=cbs">CBS 477.69</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Ceratonia siliqua</italic>
</td>
<td rowspan="1" colspan="1">Spain</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253111</td>
<td rowspan="1" colspan="1">KF252649</td>
<td rowspan="1" colspan="1">KF252160</td>
<td rowspan="1" colspan="1">KF251655</td>
<td rowspan="1" colspan="1">KF251151</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cyl. pistaciae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=471.69&link_type=cbs">CBS 471.69</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pistacia lentiscus</italic>
</td>
<td rowspan="1" colspan="1">Spain</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253112</td>
<td rowspan="1" colspan="1">KF252650</td>
<td rowspan="1" colspan="1">KF252161</td>
<td rowspan="1" colspan="1">KF251656</td>
<td rowspan="1" colspan="1">KF251152</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Cytostagonospora martiniana</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135102&link_type=cbs">CBS 135102</ext-link>
; CPC 17727</td>
<td rowspan="1" colspan="1">
<italic>Acacia pycnantha</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253113</td>
<td rowspan="1" colspan="1">KF252651</td>
<td rowspan="1" colspan="1">KF252162</td>
<td rowspan="1" colspan="1">KF251657</td>
<td rowspan="1" colspan="1">KF251153</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Dissoconium commune</italic>
</td>
<td rowspan="1" colspan="1">CPC 12397</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus globulus</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">I. Smith</td>
<td rowspan="1" colspan="1">KF253190</td>
<td rowspan="1" colspan="1">KF252724</td>
<td rowspan="1" colspan="1">KF252242</td>
<td rowspan="1" colspan="1">KF251740</td>
<td rowspan="1" colspan="1">KF251237</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Dothistroma pini</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=116484&link_type=cbs">CBS 116484</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus nigra</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">G. Adams</td>
<td rowspan="1" colspan="1">JX901622</td>
<td rowspan="1" colspan="1">JX902193</td>
<td rowspan="1" colspan="1">JX901948</td>
<td rowspan="1" colspan="1">JX901824</td>
<td rowspan="1" colspan="1">JX901736</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=116485&link_type=cbs">CBS 116485</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus nigra</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">G. Adams</td>
<td rowspan="1" colspan="1">JX901625</td>
<td rowspan="1" colspan="1">JX902196</td>
<td rowspan="1" colspan="1">JX901951</td>
<td rowspan="1" colspan="1">JX901827</td>
<td rowspan="1" colspan="1">JX901739</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=116487&link_type=cbs">CBS 116487</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus nigra</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">G. Adams</td>
<td rowspan="1" colspan="1">JX901620</td>
<td rowspan="1" colspan="1">JX902191</td>
<td rowspan="1" colspan="1">JX901946</td>
<td rowspan="1" colspan="1">JX901822</td>
<td rowspan="1" colspan="1">GU214532</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=121005&link_type=cbs">CBS 121005</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus pallasiana</italic>
</td>
<td rowspan="1" colspan="1">Russia</td>
<td rowspan="1" colspan="1">T. S. Bulgakov</td>
<td rowspan="1" colspan="1">KF253115</td>
<td rowspan="1" colspan="1">KF252653</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF251659</td>
<td rowspan="1" colspan="1">KF251155</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=121011&link_type=cbs">CBS 121011</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus pallasiana</italic>
</td>
<td rowspan="1" colspan="1">Russia</td>
<td rowspan="1" colspan="1">A.C. Usichenko</td>
<td rowspan="1" colspan="1">KF253250</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252307</td>
<td rowspan="1" colspan="1">KF251806</td>
<td rowspan="1" colspan="1">KF251302</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Dot. septosporum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=383.74&link_type=cbs">CBS 383.74</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus coulteri</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">M. Morelet</td>
<td rowspan="1" colspan="1">KF253251</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252308</td>
<td rowspan="1" colspan="1">KF251807</td>
<td rowspan="1" colspan="1">KF251303</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 16798</td>
<td rowspan="1" colspan="1">
<italic>Pinus mugo ‘Rostrata’</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">JX901627</td>
<td rowspan="1" colspan="1">JX902198</td>
<td rowspan="1" colspan="1">JX901953</td>
<td rowspan="1" colspan="1">JX901829</td>
<td rowspan="1" colspan="1">JX901741</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 16799</td>
<td rowspan="1" colspan="1">
<italic>Pinus mugo</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">JX901628</td>
<td rowspan="1" colspan="1">JX902199</td>
<td rowspan="1" colspan="1">JX901954</td>
<td rowspan="1" colspan="1">JX901830</td>
<td rowspan="1" colspan="1">JX901742</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Kirstenboschia diospyri</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=134911&link_type=cbs">CBS 134911</ext-link>
; CPC 19869</td>
<td rowspan="1" colspan="1">
<italic>Diospyros whyteana</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253116</td>
<td rowspan="1" colspan="1">KF252640</td>
<td rowspan="1" colspan="1">KF252164</td>
<td rowspan="1" colspan="1">KF251660</td>
<td rowspan="1" colspan="1">KF251156</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 19870</td>
<td rowspan="1" colspan="1">
<italic>Diospyros whyteana</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253117</td>
<td rowspan="1" colspan="1">KF252641</td>
<td rowspan="1" colspan="1">KF252165</td>
<td rowspan="1" colspan="1">KF251661</td>
<td rowspan="1" colspan="1">KF251157</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Lecanosticta acicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=322.33&link_type=cbs">CBS 322.33</ext-link>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">P.V. Siggers</td>
<td rowspan="1" colspan="1">JX901639</td>
<td rowspan="1" colspan="1">JX902213</td>
<td rowspan="1" colspan="1">JX901968</td>
<td rowspan="1" colspan="1">JX901844</td>
<td rowspan="1" colspan="1">JX901755</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=133791&link_type=cbs">CBS 133791</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus strobus</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">B. Ostrofsky</td>
<td rowspan="1" colspan="1">KC013002</td>
<td rowspan="1" colspan="1">KC013008</td>
<td rowspan="1" colspan="1">KC013014</td>
<td rowspan="1" colspan="1">KC013017</td>
<td rowspan="1" colspan="1">KC012999</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Lec. brevispora</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=133601&link_type=cbs">CBS 133601</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus</italic>
sp.</td>
<td rowspan="1" colspan="1">Mexico</td>
<td rowspan="1" colspan="1">J.Y. Morales</td>
<td rowspan="1" colspan="1">JX901649</td>
<td rowspan="1" colspan="1">JX902224</td>
<td rowspan="1" colspan="1">JX901979</td>
<td rowspan="1" colspan="1">JX901855</td>
<td rowspan="1" colspan="1">JX901763</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Lec. guatamalensis</italic>
</td>
<td rowspan="1" colspan="1">IMI 281598</td>
<td rowspan="1" colspan="1">
<italic>Pinus oocarpa</italic>
</td>
<td rowspan="1" colspan="1">Guatemala</td>
<td rowspan="1" colspan="1">H.C. Evans</td>
<td rowspan="1" colspan="1">JX901650</td>
<td rowspan="1" colspan="1">JX902225</td>
<td rowspan="1" colspan="1">JX901980</td>
<td rowspan="1" colspan="1">JX901856</td>
<td rowspan="1" colspan="1">JX901764</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Lec. longispora</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=133602&link_type=cbs">CBS 133602</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus</italic>
sp.</td>
<td rowspan="1" colspan="1">Mexico</td>
<td rowspan="1" colspan="1">J.Y. Morales</td>
<td rowspan="1" colspan="1">JX901651</td>
<td rowspan="1" colspan="1">JX902227</td>
<td rowspan="1" colspan="1">JX901982</td>
<td rowspan="1" colspan="1">JX901858</td>
<td rowspan="1" colspan="1">JX901766</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Leptosphaeria albopunctata</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=254.64&link_type=cbs">CBS 254.64</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Spartina alterniflora</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">J. Kohlmeyer</td>
<td rowspan="1" colspan="1">KF253118</td>
<td rowspan="1" colspan="1">KF252654</td>
<td rowspan="1" colspan="1">KF252166</td>
<td rowspan="1" colspan="1">KF251662</td>
<td rowspan="1" colspan="1">KF251158</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Mycosphaerella brassicicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=228.32&link_type=cbs">CBS 228.32</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Brassica oleracea</italic>
</td>
<td rowspan="1" colspan="1">Denmark</td>
<td rowspan="1" colspan="1">C.A. Jörgensen</td>
<td rowspan="1" colspan="1">KF253252</td>
<td rowspan="1" colspan="1">KF252783</td>
<td rowspan="1" colspan="1">KF252309</td>
<td rowspan="1" colspan="1">KF251808</td>
<td rowspan="1" colspan="1">KF251304</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=267.53&link_type=cbs">CBS 267.53</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Brassica oleracea</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">F. Quak</td>
<td rowspan="1" colspan="1">KF253253</td>
<td rowspan="1" colspan="1">KF252784</td>
<td rowspan="1" colspan="1">KF252310</td>
<td rowspan="1" colspan="1">KF251809</td>
<td rowspan="1" colspan="1">KF251305</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Mycosphaerella</italic>
sp.</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135464&link_type=cbs">CBS 135464</ext-link>
; CPC 11677</td>
<td rowspan="1" colspan="1">
<italic>Draba nemorosa</italic>
var.
<italic>hebecarpa</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252786</td>
<td rowspan="1" colspan="1">KF252312</td>
<td rowspan="1" colspan="1">KF251811</td>
<td rowspan="1" colspan="1">KF251307</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Neoseptoria caricis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135097&link_type=cbs">CBS 135097</ext-link>
; S653</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252167</td>
<td rowspan="1" colspan="1">KF251663</td>
<td rowspan="1" colspan="1">KF251159</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Neosetophoma samarorum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=138.96&link_type=cbs">CBS 138.96</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phlox paniculata</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253119</td>
<td rowspan="1" colspan="1">KF252655</td>
<td rowspan="1" colspan="1">KF252168</td>
<td rowspan="1" colspan="1">KF251664</td>
<td rowspan="1" colspan="1">KF251160</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=139.96&link_type=cbs">CBS 139.96</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Poa</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253120</td>
<td rowspan="1" colspan="1">KF252656</td>
<td rowspan="1" colspan="1">KF252169</td>
<td rowspan="1" colspan="1">KF251665</td>
<td rowspan="1" colspan="1">KF251161</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=568.94&link_type=cbs">CBS 568.94</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Urtica dioica</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253121</td>
<td rowspan="1" colspan="1">KF252657</td>
<td rowspan="1" colspan="1">KF252170</td>
<td rowspan="1" colspan="1">KF251666</td>
<td rowspan="1" colspan="1">KF251162</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Neostagonospora caricis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135092&link_type=cbs">CBS 135092</ext-link>
; S616</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252658</td>
<td rowspan="1" colspan="1">KF252171</td>
<td rowspan="1" colspan="1">KF251667</td>
<td rowspan="1" colspan="1">KF251163</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Neost. elegiae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135101&link_type=cbs">CBS 135101</ext-link>
; CPC 16977</td>
<td rowspan="1" colspan="1">
<italic>Elegia cuspidata</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">S. Lee</td>
<td rowspan="1" colspan="1">KF253122</td>
<td rowspan="1" colspan="1">KF252659</td>
<td rowspan="1" colspan="1">KF252172</td>
<td rowspan="1" colspan="1">KF251668</td>
<td rowspan="1" colspan="1">KF251164</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Paraphoma chrysanthemicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=172.70&link_type=cbs">CBS 172.70</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chrysanthemum morifolium</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253123</td>
<td rowspan="1" colspan="1">KF252660</td>
<td rowspan="1" colspan="1">KF252173</td>
<td rowspan="1" colspan="1">KF251669</td>
<td rowspan="1" colspan="1">KF251165</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=522.66&link_type=cbs">CBS 522.66</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chrysanthemum morifolium</italic>
</td>
<td rowspan="1" colspan="1">UK</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253124</td>
<td rowspan="1" colspan="1">KF252661</td>
<td rowspan="1" colspan="1">KF252174</td>
<td rowspan="1" colspan="1">KF251670</td>
<td rowspan="1" colspan="1">KF251166</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Parap. dioscoreae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135100&link_type=cbs">CBS 135100</ext-link>
; CPC 11357</td>
<td rowspan="1" colspan="1">
<italic>Dioscorea tokoro</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253125</td>
<td rowspan="1" colspan="1">KF252662</td>
<td rowspan="1" colspan="1">KF252175</td>
<td rowspan="1" colspan="1">KF251671</td>
<td rowspan="1" colspan="1">KF251167</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 11355</td>
<td rowspan="1" colspan="1">
<italic>Dioscorea tokoro</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253126</td>
<td rowspan="1" colspan="1">KF252663</td>
<td rowspan="1" colspan="1">KF252176</td>
<td rowspan="1" colspan="1">KF251672</td>
<td rowspan="1" colspan="1">KF251168</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 11361</td>
<td rowspan="1" colspan="1">
<italic>Dioscorea tokoro</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253127</td>
<td rowspan="1" colspan="1">KF252664</td>
<td rowspan="1" colspan="1">KF252177</td>
<td rowspan="1" colspan="1">KF251673</td>
<td rowspan="1" colspan="1">KF251169</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Parap. fimeti</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=170.70&link_type=cbs">CBS 170.70</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Apium graveolens</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">M.A. de Waard</td>
<td rowspan="1" colspan="1">KF253128</td>
<td rowspan="1" colspan="1">KF252665</td>
<td rowspan="1" colspan="1">KF252178</td>
<td rowspan="1" colspan="1">KF251674</td>
<td rowspan="1" colspan="1">KF251170</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=368.91&link_type=cbs">CBS 368.91</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Juniperus communis</italic>
</td>
<td rowspan="1" colspan="1">Switzerland</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253129</td>
<td rowspan="1" colspan="1">KF252666</td>
<td rowspan="1" colspan="1">KF252179</td>
<td rowspan="1" colspan="1">KF251675</td>
<td rowspan="1" colspan="1">KF251171</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Parap. radicina</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111.79&link_type=cbs">CBS 111.79</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Malus sylvestris</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.H. Boerema</td>
<td rowspan="1" colspan="1">KF253130</td>
<td rowspan="1" colspan="1">KF252667</td>
<td rowspan="1" colspan="1">KF252180</td>
<td rowspan="1" colspan="1">KF251676</td>
<td rowspan="1" colspan="1">KF251172</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102875&link_type=cbs">CBS 102875</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lycopersicon esculentum</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253131</td>
<td rowspan="1" colspan="1">KF252668</td>
<td rowspan="1" colspan="1">KF252181</td>
<td rowspan="1" colspan="1">KF251677</td>
<td rowspan="1" colspan="1">KF251173</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Parastagonospora avenae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=289.69&link_type=cbs">CBS 289.69</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lolium perenne</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">U.G. Schlösser</td>
<td rowspan="1" colspan="1">KF253132</td>
<td rowspan="1" colspan="1">KF252669</td>
<td rowspan="1" colspan="1">KF252182</td>
<td rowspan="1" colspan="1">KF251678</td>
<td rowspan="1" colspan="1">KF251174</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=290.69&link_type=cbs">CBS 290.69</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lolium perenne</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">U.G. Schlösser</td>
<td rowspan="1" colspan="1">KF253133</td>
<td rowspan="1" colspan="1">KF252670</td>
<td rowspan="1" colspan="1">KF252183</td>
<td rowspan="1" colspan="1">KF251679</td>
<td rowspan="1" colspan="1">KF251175</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Paras. caricis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135671&link_type=cbs">CBS 135671</ext-link>
; S615</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253134</td>
<td rowspan="1" colspan="1">KF252671</td>
<td rowspan="1" colspan="1">KF252184</td>
<td rowspan="1" colspan="1">KF251680</td>
<td rowspan="1" colspan="1">KF251176</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Paras. nodorum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=110109&link_type=cbs">CBS 110109</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lolium perenne</italic>
</td>
<td rowspan="1" colspan="1">Denmark</td>
<td rowspan="1" colspan="1">M.P.S. Câmara</td>
<td rowspan="1" colspan="1">KF253135</td>
<td rowspan="1" colspan="1">KF252672</td>
<td rowspan="1" colspan="1">KF252185</td>
<td rowspan="1" colspan="1">KF251681</td>
<td rowspan="1" colspan="1">KF251177</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Paras. “nodorum”</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=259.49&link_type=cbs">CBS 259.49</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Triticum</italic>
sp.</td>
<td rowspan="1" colspan="1">Canada</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253143</td>
<td rowspan="1" colspan="1">KF252679</td>
<td rowspan="1" colspan="1">KF252192</td>
<td rowspan="1" colspan="1">KF251688</td>
<td rowspan="1" colspan="1">KF251185</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Paras. poae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135089&link_type=cbs">CBS 135089</ext-link>
; S606</td>
<td rowspan="1" colspan="1">
<italic>Poa</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S.I.R. Videira</td>
<td rowspan="1" colspan="1">KF253136</td>
<td rowspan="1" colspan="1">KF252673</td>
<td rowspan="1" colspan="1">KF252186</td>
<td rowspan="1" colspan="1">KF251682</td>
<td rowspan="1" colspan="1">KF251178</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135091&link_type=cbs">CBS 135091</ext-link>
; S613</td>
<td rowspan="1" colspan="1">
<italic>Poa</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S.I.R. Videira</td>
<td rowspan="1" colspan="1">KF253137</td>
<td rowspan="1" colspan="1">KF252674</td>
<td rowspan="1" colspan="1">KF252187</td>
<td rowspan="1" colspan="1">KF251683</td>
<td rowspan="1" colspan="1">KF251179</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Passalora depressa</italic>
</td>
<td rowspan="1" colspan="1">CPC 14915</td>
<td rowspan="1" colspan="1">
<italic>Angelica gigas</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253256</td>
<td rowspan="1" colspan="1">KF252788</td>
<td rowspan="1" colspan="1">KF252314</td>
<td rowspan="1" colspan="1">KF251813</td>
<td rowspan="1" colspan="1">KF251309</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pas. dioscoreae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135460&link_type=cbs">CBS 135460</ext-link>
; CPC 10855</td>
<td rowspan="1" colspan="1">
<italic>Dioscorea tokoro</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253257</td>
<td rowspan="1" colspan="1">KF252789</td>
<td rowspan="1" colspan="1">KF252315</td>
<td rowspan="1" colspan="1">KF251814</td>
<td rowspan="1" colspan="1">KF251310</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135463&link_type=cbs">CBS 135463</ext-link>
; CPC 11513</td>
<td rowspan="1" colspan="1">
<italic>Dioscorea tenuipes</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253258</td>
<td rowspan="1" colspan="1">KF252790</td>
<td rowspan="1" colspan="1">KF252316</td>
<td rowspan="1" colspan="1">KF251815</td>
<td rowspan="1" colspan="1">KF251311</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phaeophleospora eugeniae</italic>
</td>
<td rowspan="1" colspan="1">CPC 15143</td>
<td rowspan="1" colspan="1">
<italic>Eugenia uniflora</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">A.C. Alfenas</td>
<td rowspan="1" colspan="1">KF253138</td>
<td rowspan="1" colspan="1">KF252642</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">JX901875</td>
<td rowspan="1" colspan="1">KF251180</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 15159</td>
<td rowspan="1" colspan="1">
<italic>Eugenia uniflora</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">A.C. Alfenas</td>
<td rowspan="1" colspan="1">JX901667</td>
<td rowspan="1" colspan="1">JX902245</td>
<td rowspan="1" colspan="1">JX901999</td>
<td rowspan="1" colspan="1">JX901876</td>
<td rowspan="1" colspan="1">FJ493189</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Phaeosphaeria” alpina</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=456.84&link_type=cbs">CBS 456.84</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phleum alpinum</italic>
</td>
<td rowspan="1" colspan="1">Switzerland</td>
<td rowspan="1" colspan="1">A. Leuchtmann</td>
<td rowspan="1" colspan="1">KF253139</td>
<td rowspan="1" colspan="1">KF252675</td>
<td rowspan="1" colspan="1">KF252188</td>
<td rowspan="1" colspan="1">KF251684</td>
<td rowspan="1" colspan="1">KF251181</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phaeos. caricicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=603.86&link_type=cbs">CBS 603.86</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Carex pendula</italic>
</td>
<td rowspan="1" colspan="1">Switzerland</td>
<td rowspan="1" colspan="1">A. Leuchtmann</td>
<td rowspan="1" colspan="1">KF253140</td>
<td rowspan="1" colspan="1">KF252676</td>
<td rowspan="1" colspan="1">KF252189</td>
<td rowspan="1" colspan="1">KF251685</td>
<td rowspan="1" colspan="1">KF251182</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phaeos. juncicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=110108&link_type=cbs">CBS 110108</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phlox</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">M.P.S. Câmara</td>
<td rowspan="1" colspan="1">KF253141</td>
<td rowspan="1" colspan="1">KF252677</td>
<td rowspan="1" colspan="1">KF252190</td>
<td rowspan="1" colspan="1">KF251686</td>
<td rowspan="1" colspan="1">KF251183</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phaeos. nigrans</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=307.79&link_type=cbs">CBS 307.79</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Zea mays</italic>
</td>
<td rowspan="1" colspan="1">Switzerland</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253142</td>
<td rowspan="1" colspan="1">KF252678</td>
<td rowspan="1" colspan="1">KF252191</td>
<td rowspan="1" colspan="1">KF251687</td>
<td rowspan="1" colspan="1">KF251184</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phaeos. oryzae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=110110&link_type=cbs">CBS 110110</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Oryza sativa</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">L. Hausch</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252680</td>
<td rowspan="1" colspan="1">KF252193</td>
<td rowspan="1" colspan="1">KF251689</td>
<td rowspan="1" colspan="1">KF251186</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phaeos. papayae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135416&link_type=cbs">CBS 135416</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Carica papaya</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">A.C. Alfenas</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252681</td>
<td rowspan="1" colspan="1">KF252194</td>
<td rowspan="1" colspan="1">KF251690</td>
<td rowspan="1" colspan="1">KF251187</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Phaeos.” phragmiticola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=459.84&link_type=cbs">CBS 459.84</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phragmites australis</italic>
</td>
<td rowspan="1" colspan="1">Switzerland</td>
<td rowspan="1" colspan="1">A. Leuchtmann</td>
<td rowspan="1" colspan="1">KF253144</td>
<td rowspan="1" colspan="1">KF252682</td>
<td rowspan="1" colspan="1">KF252195</td>
<td rowspan="1" colspan="1">KF251691</td>
<td rowspan="1" colspan="1">KF251188</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Phaeos.” pontiformis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=117487&link_type=cbs">CBS 117487</ext-link>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">J. Harrak</td>
<td rowspan="1" colspan="1">KF253145</td>
<td rowspan="1" colspan="1">KF252683</td>
<td rowspan="1" colspan="1">KF252196</td>
<td rowspan="1" colspan="1">KF251692</td>
<td rowspan="1" colspan="1">KF251189</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phaeosphaeria</italic>
sp.</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=206.87&link_type=cbs">CBS 206.87</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Zea mays</italic>
</td>
<td rowspan="1" colspan="1">Gabon</td>
<td rowspan="1" colspan="1">J.L. Notteghem</td>
<td rowspan="1" colspan="1">KF253146</td>
<td rowspan="1" colspan="1">KF252684</td>
<td rowspan="1" colspan="1">KF252197</td>
<td rowspan="1" colspan="1">KF251693</td>
<td rowspan="1" colspan="1">KF251190</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135465&link_type=cbs">CBS 135465</ext-link>
; CPC 11894</td>
<td rowspan="1" colspan="1">
<italic>Zea mays</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253147</td>
<td rowspan="1" colspan="1">KF252685</td>
<td rowspan="1" colspan="1">KF252198</td>
<td rowspan="1" colspan="1">KF251694</td>
<td rowspan="1" colspan="1">KF251191</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Phaeos.” typharum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=296.54&link_type=cbs">CBS 296.54</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Nardus stricta</italic>
</td>
<td rowspan="1" colspan="1">Switzerland</td>
<td rowspan="1" colspan="1">L.E. Wehmeyer</td>
<td rowspan="1" colspan="1">KF253148</td>
<td rowspan="1" colspan="1">KF252686</td>
<td rowspan="1" colspan="1">KF252199</td>
<td rowspan="1" colspan="1">KF251695</td>
<td rowspan="1" colspan="1">KF251192</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Phaeos.” vagans</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=604.86&link_type=cbs">CBS 604.86</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Calamagrostis arundinacea</italic>
</td>
<td rowspan="1" colspan="1">Sweden</td>
<td rowspan="1" colspan="1">A. Leuchtmann</td>
<td rowspan="1" colspan="1">KF253149</td>
<td rowspan="1" colspan="1">KF252687</td>
<td rowspan="1" colspan="1">KF252200</td>
<td rowspan="1" colspan="1">KF251696</td>
<td rowspan="1" colspan="1">KF251193</td>
</tr>
<tr>
<td rowspan="1" colspan="1">phaeosphaeria-like sp.</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123.76&link_type=cbs">CBS 123.76</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Prunus domestica</italic>
</td>
<td rowspan="1" colspan="1">Serbia</td>
<td rowspan="1" colspan="1">M. Arseijevic</td>
<td rowspan="1" colspan="1">KF253150</td>
<td rowspan="1" colspan="1">KF252688</td>
<td rowspan="1" colspan="1">KF252201</td>
<td rowspan="1" colspan="1">KF251697</td>
<td rowspan="1" colspan="1">KF251194</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135461&link_type=cbs">CBS 135461</ext-link>
; CPC 11231</td>
<td rowspan="1" colspan="1">
<italic>Musa</italic>
sp.</td>
<td rowspan="1" colspan="1">Mauritius</td>
<td rowspan="1" colspan="1">Y. Jaufeerally-Fakim</td>
<td rowspan="1" colspan="1">KF253151</td>
<td rowspan="1" colspan="1">KF252689</td>
<td rowspan="1" colspan="1">KF252202</td>
<td rowspan="1" colspan="1">KF251698</td>
<td rowspan="1" colspan="1">KF251195</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135466&link_type=cbs">CBS 135466</ext-link>
; CPC 12131</td>
<td rowspan="1" colspan="1">
<italic>Acacia crassicarpa</italic>
</td>
<td rowspan="1" colspan="1">Thailand</td>
<td rowspan="1" colspan="1">W. Himaman</td>
<td rowspan="1" colspan="1">KF253153</td>
<td rowspan="1" colspan="1">KF252691</td>
<td rowspan="1" colspan="1">KF252204</td>
<td rowspan="1" colspan="1">KF251700</td>
<td rowspan="1" colspan="1">KF251197</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135469&link_type=cbs">CBS 135469</ext-link>
; CPC 12881</td>
<td rowspan="1" colspan="1">
<italic>Pinus monticola</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">G. Newcombe & R.G. Ganley</td>
<td rowspan="1" colspan="1">KF253154</td>
<td rowspan="1" colspan="1">KF252692</td>
<td rowspan="1" colspan="1">KF252205</td>
<td rowspan="1" colspan="1">KF251701</td>
<td rowspan="1" colspan="1">KF251198</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 12130</td>
<td rowspan="1" colspan="1">
<italic>Acacia crassicarpa</italic>
</td>
<td rowspan="1" colspan="1">Thailand</td>
<td rowspan="1" colspan="1">W. Himaman</td>
<td rowspan="1" colspan="1">KF253152</td>
<td rowspan="1" colspan="1">KF252690</td>
<td rowspan="1" colspan="1">KF252203</td>
<td rowspan="1" colspan="1">KF251699</td>
<td rowspan="1" colspan="1">KF251196</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phaeosphaeriopsis glaucopunctata</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=653.86&link_type=cbs">CBS 653.86</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Ruscus aculeatus</italic>
</td>
<td rowspan="1" colspan="1">Switzerland</td>
<td rowspan="1" colspan="1">A. Leuchtmann</td>
<td rowspan="1" colspan="1">KF253155</td>
<td rowspan="1" colspan="1">KF252693</td>
<td rowspan="1" colspan="1">KF252206</td>
<td rowspan="1" colspan="1">KF251702</td>
<td rowspan="1" colspan="1">KF251199</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phloeospora ulmi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=344.97&link_type=cbs">CBS 344.97</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Ulmus glabra</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">W. Gams</td>
<td rowspan="1" colspan="1">KF253158</td>
<td rowspan="1" colspan="1">KF252696</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF251705</td>
<td rowspan="1" colspan="1">KF251202</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=613.81&link_type=cbs">CBS 613.81</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Ulmus</italic>
sp.</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253159</td>
<td rowspan="1" colspan="1">KF252697</td>
<td rowspan="1" colspan="1">KF252208</td>
<td rowspan="1" colspan="1">KF251706</td>
<td rowspan="1" colspan="1">KF251203</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=101564&link_type=cbs">CBS 101564</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Ulmus</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253156</td>
<td rowspan="1" colspan="1">KF252694</td>
<td rowspan="1" colspan="1">KF252207</td>
<td rowspan="1" colspan="1">KF251703</td>
<td rowspan="1" colspan="1">KF251200</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109835&link_type=cbs">CBS 109835</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Ulmus</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253157</td>
<td rowspan="1" colspan="1">KF252695</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF251704</td>
<td rowspan="1" colspan="1">KF251201</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phlogicylindrium eucalyptorum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111680&link_type=cbs">CBS 111680</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus nitens</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253160</td>
<td rowspan="1" colspan="1">KF252698</td>
<td rowspan="1" colspan="1">KF252209</td>
<td rowspan="1" colspan="1">KF251707</td>
<td rowspan="1" colspan="1">KF251204</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111689&link_type=cbs">CBS 111689</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus nitens</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253161</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252210</td>
<td rowspan="1" colspan="1">KF251708</td>
<td rowspan="1" colspan="1">KF251205</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phlyctema vincetoxici</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123726&link_type=cbs">CBS 123726</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Vincetoxicum officinale</italic>
</td>
<td rowspan="1" colspan="1">Czech Republic</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253162</td>
<td rowspan="1" colspan="1">KF252699</td>
<td rowspan="1" colspan="1">KF252211</td>
<td rowspan="1" colspan="1">KF251709</td>
<td rowspan="1" colspan="1">KF251206</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123727&link_type=cbs">CBS 123727</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Vincetoxicum officinale</italic>
</td>
<td rowspan="1" colspan="1">Czech Republic</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253163</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252212</td>
<td rowspan="1" colspan="1">KF251710</td>
<td rowspan="1" colspan="1">KF251207</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123743&link_type=cbs">CBS 123743</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Vincetoxicum officinale</italic>
</td>
<td rowspan="1" colspan="1">Czech Republic</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253164</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252213</td>
<td rowspan="1" colspan="1">KF251711</td>
<td rowspan="1" colspan="1">KF251208</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Phoma herbarum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=615.75&link_type=cbs">CBS 615.75</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rosa multiflora</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.H. Boerema</td>
<td rowspan="1" colspan="1">KF253168</td>
<td rowspan="1" colspan="1">KF252703</td>
<td rowspan="1" colspan="1">KF252217</td>
<td rowspan="1" colspan="1">KF251715</td>
<td rowspan="1" colspan="1">KF251212</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Polyphialoseptoria tabebuiae-serratifoliae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=112650&link_type=cbs">CBS 112650</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Tabebuia serratifolia</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">A.C. Alfenas</td>
<td rowspan="1" colspan="1">KF253169</td>
<td rowspan="1" colspan="1">KF252704</td>
<td rowspan="1" colspan="1">KF252218</td>
<td rowspan="1" colspan="1">KF251716</td>
<td rowspan="1" colspan="1">KF251213</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pol. terminaliae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135106&link_type=cbs">CBS 135106</ext-link>
; CPC 19611</td>
<td rowspan="1" colspan="1">
<italic>Terminalia catappa</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">R.W. Barreto</td>
<td rowspan="1" colspan="1">KF253170</td>
<td rowspan="1" colspan="1">KF252705</td>
<td rowspan="1" colspan="1">KF252219</td>
<td rowspan="1" colspan="1">KF251717</td>
<td rowspan="1" colspan="1">KF251214</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135475&link_type=cbs">CBS 135475</ext-link>
; CPC 19487</td>
<td rowspan="1" colspan="1">
<italic>Terminalia catappa</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">R.W. Barreto</td>
<td rowspan="1" colspan="1">KF253171</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252220</td>
<td rowspan="1" colspan="1">KF251718</td>
<td rowspan="1" colspan="1">KF251215</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pseudocercospora chiangmaiensis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123244&link_type=cbs">CBS 123244</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus camaldurensis</italic>
</td>
<td rowspan="1" colspan="1">Thailand</td>
<td rowspan="1" colspan="1">R. Cheewangkoon</td>
<td rowspan="1" colspan="1">JX901676</td>
<td rowspan="1" colspan="1">JX902254</td>
<td rowspan="1" colspan="1">JX902008</td>
<td rowspan="1" colspan="1">JX901885</td>
<td rowspan="1" colspan="1">JX901781</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pse. eucalyptorum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=116303&link_type=cbs">CBS 116303</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus nitens</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253172</td>
<td rowspan="1" colspan="1">KF252706</td>
<td rowspan="1" colspan="1">KF252221</td>
<td rowspan="1" colspan="1">KF251719</td>
<td rowspan="1" colspan="1">KF251216</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 13816</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus glaucescens</italic>
</td>
<td rowspan="1" colspan="1">UK</td>
<td rowspan="1" colspan="1">S. Denman</td>
<td rowspan="1" colspan="1">KF253230</td>
<td rowspan="1" colspan="1">KF252764</td>
<td rowspan="1" colspan="1">KF252288</td>
<td rowspan="1" colspan="1">KF251786</td>
<td rowspan="1" colspan="1">KF251282</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pse. madagascariensis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=124155&link_type=cbs">CBS 124155</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus camaldulensis</italic>
</td>
<td rowspan="1" colspan="1">Madagascar</td>
<td rowspan="1" colspan="1">M.J. Wingfield</td>
<td rowspan="1" colspan="1">KF253265</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252322</td>
<td rowspan="1" colspan="1">KF251822</td>
<td rowspan="1" colspan="1">KF251318</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pse. natalensis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111069&link_type=cbs">CBS 111069</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus nitens</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">T. Coutinho</td>
<td rowspan="1" colspan="1">KF302389</td>
<td rowspan="1" colspan="1">KF302384</td>
<td rowspan="1" colspan="1">KF302393</td>
<td rowspan="1" colspan="1">KF302405</td>
<td rowspan="1" colspan="1">KF302399</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pse. norchiensis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=120738&link_type=cbs">CBS 120738</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus</italic>
sp.</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">W. Gams</td>
<td rowspan="1" colspan="1">JX901684</td>
<td rowspan="1" colspan="1">JX902263</td>
<td rowspan="1" colspan="1">JX902017</td>
<td rowspan="1" colspan="1">JX901894</td>
<td rowspan="1" colspan="1">JX901785</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pse. robusta</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111175&link_type=cbs">CBS 111175</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus robur</italic>
</td>
<td rowspan="1" colspan="1">Malaysia</td>
<td rowspan="1" colspan="1">M.J. Wingfield</td>
<td rowspan="1" colspan="1">JX901694</td>
<td rowspan="1" colspan="1">JX902273</td>
<td rowspan="1" colspan="1">JX902027</td>
<td rowspan="1" colspan="1">JX901904</td>
<td rowspan="1" colspan="1">DQ303081</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pse. schizolobii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=120029&link_type=cbs">CBS 120029</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Schizolobium parahybum</italic>
</td>
<td rowspan="1" colspan="1">Ecuador</td>
<td rowspan="1" colspan="1">M.J. Wingfield</td>
<td rowspan="1" colspan="1">KF253269</td>
<td rowspan="1" colspan="1">KF252798</td>
<td rowspan="1" colspan="1">KF252326</td>
<td rowspan="1" colspan="1">KF251826</td>
<td rowspan="1" colspan="1">KF251322</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pse. tereticornis</italic>
</td>
<td rowspan="1" colspan="1">CPC 13299</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus tereticornis</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">JX901701</td>
<td rowspan="1" colspan="1">JX902280</td>
<td rowspan="1" colspan="1">JX902034</td>
<td rowspan="1" colspan="1">JX901911</td>
<td rowspan="1" colspan="1">GQ852770</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pseudocercosporella capsellae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=127.29&link_type=cbs">CBS 127.29</ext-link>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">K. Togashi</td>
<td rowspan="1" colspan="1">KF253273</td>
<td rowspan="1" colspan="1">KF252801</td>
<td rowspan="1" colspan="1">KF252330</td>
<td rowspan="1" colspan="1">KF251830</td>
<td rowspan="1" colspan="1">KF251326</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=112032&link_type=cbs">CBS 112032</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Brassica</italic>
sp.</td>
<td rowspan="1" colspan="1">UK</td>
<td rowspan="1" colspan="1">R. Evans</td>
<td rowspan="1" colspan="1">KF253267</td>
<td rowspan="1" colspan="1">KF252797</td>
<td rowspan="1" colspan="1">KF252324</td>
<td rowspan="1" colspan="1">KF251824</td>
<td rowspan="1" colspan="1">KF251320</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=112033&link_type=cbs">CBS 112033</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Brassica</italic>
sp.</td>
<td rowspan="1" colspan="1">UK</td>
<td rowspan="1" colspan="1">R. Evans</td>
<td rowspan="1" colspan="1">KF253254</td>
<td rowspan="1" colspan="1">KF252785</td>
<td rowspan="1" colspan="1">KF252311</td>
<td rowspan="1" colspan="1">KF251810</td>
<td rowspan="1" colspan="1">KF251306</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=118412&link_type=cbs">CBS 118412</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Brassica</italic>
sp.</td>
<td rowspan="1" colspan="1">New Zealand</td>
<td rowspan="1" colspan="1">C.F. Hill</td>
<td rowspan="1" colspan="1">KF253272</td>
<td rowspan="1" colspan="1">KF252800</td>
<td rowspan="1" colspan="1">KF252329</td>
<td rowspan="1" colspan="1">KF251829</td>
<td rowspan="1" colspan="1">KF251325</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Pella.” magnusiana</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=114735&link_type=cbs">CBS 114735</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Geranium silvaticum</italic>
</td>
<td rowspan="1" colspan="1">Sweden</td>
<td rowspan="1" colspan="1">E. Gunnerbeck</td>
<td rowspan="1" colspan="1">KF253274</td>
<td rowspan="1" colspan="1">KF252802</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF251831</td>
<td rowspan="1" colspan="1">KF251327</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pella. pastinacae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=114116&link_type=cbs">CBS 114116</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Laserpitium latifolium</italic>
</td>
<td rowspan="1" colspan="1">Sweden</td>
<td rowspan="1" colspan="1">L. Holm</td>
<td rowspan="1" colspan="1">KF253275</td>
<td rowspan="1" colspan="1">KF252803</td>
<td rowspan="1" colspan="1">KF252331</td>
<td rowspan="1" colspan="1">KF251832</td>
<td rowspan="1" colspan="1">KF251328</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pseudoseptoria collariana</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135104&link_type=cbs">CBS 135104</ext-link>
; CPC 18119</td>
<td rowspan="1" colspan="1">
<italic>Bambusoideae</italic>
sp.</td>
<td rowspan="1" colspan="1">Iran</td>
<td rowspan="1" colspan="1">A. Mirzadi Gohari</td>
<td rowspan="1" colspan="1">KF253174</td>
<td rowspan="1" colspan="1">KF252707</td>
<td rowspan="1" colspan="1">KF252223</td>
<td rowspan="1" colspan="1">KF251721</td>
<td rowspan="1" colspan="1">KF251218</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Pseudos. obscura</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135103&link_type=cbs">CBS 135103</ext-link>
; CPC 18118</td>
<td rowspan="1" colspan="1">
<italic>Bambusoideae</italic>
sp.</td>
<td rowspan="1" colspan="1">Iran</td>
<td rowspan="1" colspan="1">A. Mirzadi Gohari</td>
<td rowspan="1" colspan="1">KF253175</td>
<td rowspan="1" colspan="1">KF252708</td>
<td rowspan="1" colspan="1">KF252224</td>
<td rowspan="1" colspan="1">KF251722</td>
<td rowspan="1" colspan="1">KF251219</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ramularia endophylla</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=113265&link_type=cbs">CBS 113265</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Quercus robur</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253176</td>
<td rowspan="1" colspan="1">KF252709</td>
<td rowspan="1" colspan="1">KF252225</td>
<td rowspan="1" colspan="1">KF251723</td>
<td rowspan="1" colspan="1">KF251220</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ram. eucalypti</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=120726&link_type=cbs">CBS 120726</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus grandis</italic>
var.
<italic>grandiflora Maiden</italic>
</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">W. Gams</td>
<td rowspan="1" colspan="1">KF253177</td>
<td rowspan="1" colspan="1">KF252710</td>
<td rowspan="1" colspan="1">KF252226</td>
<td rowspan="1" colspan="1">KF251724</td>
<td rowspan="1" colspan="1">KF251221</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ram. lamii</italic>
</td>
<td rowspan="1" colspan="1">CPC 11312</td>
<td rowspan="1" colspan="1">
<italic>Leonurus sibiricus</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253178</td>
<td rowspan="1" colspan="1">KF252711</td>
<td rowspan="1" colspan="1">KF252227</td>
<td rowspan="1" colspan="1">KF251725</td>
<td rowspan="1" colspan="1">KF251222</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ram. pratensis</italic>
</td>
<td rowspan="1" colspan="1">CPC 11294</td>
<td rowspan="1" colspan="1">
<italic>Rumex crispus</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253179</td>
<td rowspan="1" colspan="1">KF252712</td>
<td rowspan="1" colspan="1">KF252228</td>
<td rowspan="1" colspan="1">KF251726</td>
<td rowspan="1" colspan="1">KF251223</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ramularia</italic>
sp.</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=115913&link_type=cbs">CBS 115913</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cerastium semidecandrum</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">A. Aptroot</td>
<td rowspan="1" colspan="1">KF253180</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252229</td>
<td rowspan="1" colspan="1">KF251727</td>
<td rowspan="1" colspan="1">KF251224</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Readeriella angustia</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=124998&link_type=cbs">CBS 124998</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus delegatensis</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">B.A. Summerel</td>
<td rowspan="1" colspan="1">KF253181</td>
<td rowspan="1" colspan="1">KF252713</td>
<td rowspan="1" colspan="1">KF252230</td>
<td rowspan="1" colspan="1">KF251728</td>
<td rowspan="1" colspan="1">KF251225</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Rea. eucalypti</italic>
</td>
<td rowspan="1" colspan="1">CPC 13401</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus</italic>
sp.</td>
<td rowspan="1" colspan="1">Portugal</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253173</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252222</td>
<td rowspan="1" colspan="1">KF251720</td>
<td rowspan="1" colspan="1">KF251217</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Rea. readeriellophora</italic>
</td>
<td rowspan="1" colspan="1">CPC 12920</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus</italic>
sp.</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">A. Carnegie</td>
<td rowspan="1" colspan="1">KF253114</td>
<td rowspan="1" colspan="1">KF252652</td>
<td rowspan="1" colspan="1">KF252163</td>
<td rowspan="1" colspan="1">KF251658</td>
<td rowspan="1" colspan="1">KF251154</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ruptoseptoria unedonis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=355.86&link_type=cbs">CBS 355.86</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Arbutus unedo</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252715</td>
<td rowspan="1" colspan="1">KF252233</td>
<td rowspan="1" colspan="1">KF251731</td>
<td rowspan="1" colspan="1">KF251228</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=755.70&link_type=cbs">CBS 755.70</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Arbutus unedo</italic>
</td>
<td rowspan="1" colspan="1">Croatia</td>
<td rowspan="1" colspan="1">J.A. von Arx</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252716</td>
<td rowspan="1" colspan="1">KF252234</td>
<td rowspan="1" colspan="1">KF251732</td>
<td rowspan="1" colspan="1">KF251229</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sclerostagonospora phragmiticola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=338.86&link_type=cbs">CBS 338.86</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phragmites australis</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253184</td>
<td rowspan="1" colspan="1">KF252717</td>
<td rowspan="1" colspan="1">KF252235</td>
<td rowspan="1" colspan="1">KF251733</td>
<td rowspan="1" colspan="1">KF251230</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Septoria abei</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128598&link_type=cbs">CBS 128598</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Hibiscus syriacus</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253280</td>
<td rowspan="1" colspan="1">KF252805</td>
<td rowspan="1" colspan="1">KF252336</td>
<td rowspan="1" colspan="1">KF251837</td>
<td rowspan="1" colspan="1">KF251333</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. “agropyrina”</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=387.64&link_type=cbs">CBS 387.64</ext-link>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Japan</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF302392</td>
<td rowspan="1" colspan="1">KF302387</td>
<td rowspan="1" colspan="1">KF302398</td>
<td rowspan="1" colspan="1">KF302410</td>
<td rowspan="1" colspan="1">KF302404</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. anthrisci</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109020&link_type=cbs">CBS 109020</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Anthriscus</italic>
sp.</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253286</td>
<td rowspan="1" colspan="1">KF252811</td>
<td rowspan="1" colspan="1">KF252340</td>
<td rowspan="1" colspan="1">KF251843</td>
<td rowspan="1" colspan="1">KF251339</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. anthurii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=346.58&link_type=cbs">CBS 346.58</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Anthurium scherzerianum</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253288</td>
<td rowspan="1" colspan="1">KF252813</td>
<td rowspan="1" colspan="1">KF252342</td>
<td rowspan="1" colspan="1">KF251845</td>
<td rowspan="1" colspan="1">KF251341</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. apiicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=400.54&link_type=cbs">CBS 400.54</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Apium graveolens</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">J.A. von Arx</td>
<td rowspan="1" colspan="1">KF253292</td>
<td rowspan="1" colspan="1">KF252817</td>
<td rowspan="1" colspan="1">KF252346</td>
<td rowspan="1" colspan="1">KF251849</td>
<td rowspan="1" colspan="1">KF251345</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Sep.” arundinacea</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=133.68&link_type=cbs">CBS 133.68</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phragmites australis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253185</td>
<td rowspan="1" colspan="1">KF252718</td>
<td rowspan="1" colspan="1">KF252236</td>
<td rowspan="1" colspan="1">KF251734</td>
<td rowspan="1" colspan="1">KF251231</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=281.72&link_type=cbs">CBS 281.72</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phragmites australis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">J.W. Veenbaas-Rijks</td>
<td rowspan="1" colspan="1">KF253186</td>
<td rowspan="1" colspan="1">KF252719</td>
<td rowspan="1" colspan="1">KF252237</td>
<td rowspan="1" colspan="1">KF251735</td>
<td rowspan="1" colspan="1">KF251232</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. astericola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128593&link_type=cbs">CBS 128593</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Aster yomena</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253294</td>
<td rowspan="1" colspan="1">KF252819</td>
<td rowspan="1" colspan="1">KF252348</td>
<td rowspan="1" colspan="1">KF251851</td>
<td rowspan="1" colspan="1">KF251347</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. astragali</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109116&link_type=cbs">CBS 109116</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Astragalus</italic>
sp.</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253298</td>
<td rowspan="1" colspan="1">KF252823</td>
<td rowspan="1" colspan="1">KF252352</td>
<td rowspan="1" colspan="1">KF251855</td>
<td rowspan="1" colspan="1">KF251351</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123878&link_type=cbs">CBS 123878</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Astragalus glycyphyllos</italic>
</td>
<td rowspan="1" colspan="1">Czech Republic</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253297</td>
<td rowspan="1" colspan="1">KF252822</td>
<td rowspan="1" colspan="1">KF252351</td>
<td rowspan="1" colspan="1">KF251854</td>
<td rowspan="1" colspan="1">KF251350</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. atropurpurea</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=348.58&link_type=cbs">CBS 348.58</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Aster canus</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253299</td>
<td rowspan="1" colspan="1">KF252824</td>
<td rowspan="1" colspan="1">KF252353</td>
<td rowspan="1" colspan="1">KF251856</td>
<td rowspan="1" colspan="1">KF251352</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. bothriospermi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128599&link_type=cbs">CBS 128599</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Bothriospermum tenellum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253301</td>
<td rowspan="1" colspan="1">KF252826</td>
<td rowspan="1" colspan="1">KF252355</td>
<td rowspan="1" colspan="1">KF251858</td>
<td rowspan="1" colspan="1">KF251354</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. bupleuricola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128603&link_type=cbs">CBS 128603</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Bupleurum falcatum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253303</td>
<td rowspan="1" colspan="1">KF252828</td>
<td rowspan="1" colspan="1">KF252357</td>
<td rowspan="1" colspan="1">KF251860</td>
<td rowspan="1" colspan="1">KF251356</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. calendulae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=349.58&link_type=cbs">CBS 349.58</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Calendula arvensis</italic>
</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253304</td>
<td rowspan="1" colspan="1">KF252829</td>
<td rowspan="1" colspan="1">KF252358</td>
<td rowspan="1" colspan="1">KF251861</td>
<td rowspan="1" colspan="1">KF251357</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. callistephi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128590&link_type=cbs">CBS 128590</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Callistephus chinensis</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253305</td>
<td rowspan="1" colspan="1">KF252830</td>
<td rowspan="1" colspan="1">KF252359</td>
<td rowspan="1" colspan="1">KF251862</td>
<td rowspan="1" colspan="1">KF251358</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. campanulae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128604&link_type=cbs">CBS 128604</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Campanula takesimana</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253308</td>
<td rowspan="1" colspan="1">KF252833</td>
<td rowspan="1" colspan="1">KF252362</td>
<td rowspan="1" colspan="1">KF251865</td>
<td rowspan="1" colspan="1">KF251361</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. cerastii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128612&link_type=cbs">CBS 128612</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cerastium holosteoides</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253311</td>
<td rowspan="1" colspan="1">KF252836</td>
<td rowspan="1" colspan="1">KF252365</td>
<td rowspan="1" colspan="1">KF251868</td>
<td rowspan="1" colspan="1">KF251364</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep.</italic>
cf.
<italic>agrimoniicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128585&link_type=cbs">CBS 128585</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Agrimonia pilosa</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253283</td>
<td rowspan="1" colspan="1">KF252808</td>
<td rowspan="1" colspan="1">KF252337</td>
<td rowspan="1" colspan="1">KF251840</td>
<td rowspan="1" colspan="1">KF251336</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128602&link_type=cbs">CBS 128602</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Agrimonia pilosa</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253284</td>
<td rowspan="1" colspan="1">KF252809</td>
<td rowspan="1" colspan="1">KF252338</td>
<td rowspan="1" colspan="1">KF251841</td>
<td rowspan="1" colspan="1">KF251337</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep.</italic>
cf.
<italic>rubi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128646&link_type=cbs">CBS 128646</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rubus crataegifolius</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253314</td>
<td rowspan="1" colspan="1">KF252839</td>
<td rowspan="1" colspan="1">KF252368</td>
<td rowspan="1" colspan="1">KF251871</td>
<td rowspan="1" colspan="1">KF251367</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep.</italic>
cf.
<italic>stachydicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128668&link_type=cbs">CBS 128668</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Stachys riederi</italic>
var.
<italic>japonica</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253512</td>
<td rowspan="1" colspan="1">KF253033</td>
<td rowspan="1" colspan="1">KF252558</td>
<td rowspan="1" colspan="1">KF252070</td>
<td rowspan="1" colspan="1">KF251565</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. chelidonii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128607&link_type=cbs">CBS 128607</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chelidonium majus</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253319</td>
<td rowspan="1" colspan="1">KF252844</td>
<td rowspan="1" colspan="1">KF252373</td>
<td rowspan="1" colspan="1">KF251876</td>
<td rowspan="1" colspan="1">KF251372</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. chromolaenae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=113373&link_type=cbs">CBS 113373</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chromolaena odorata</italic>
</td>
<td rowspan="1" colspan="1">Cuba</td>
<td rowspan="1" colspan="1">S. Neser</td>
<td rowspan="1" colspan="1">KF253321</td>
<td rowspan="1" colspan="1">KF252846</td>
<td rowspan="1" colspan="1">KF252375</td>
<td rowspan="1" colspan="1">KF251878</td>
<td rowspan="1" colspan="1">KF251374</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. chrysanthemella</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128622&link_type=cbs">CBS 128622</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chrysanthemum boreale</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253323</td>
<td rowspan="1" colspan="1">KF252848</td>
<td rowspan="1" colspan="1">KF252377</td>
<td rowspan="1" colspan="1">KF251880</td>
<td rowspan="1" colspan="1">KF251376</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128716&link_type=cbs">CBS 128716</ext-link>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">E. Oh</td>
<td rowspan="1" colspan="1">KF253325</td>
<td rowspan="1" colspan="1">KF252850</td>
<td rowspan="1" colspan="1">KF252379</td>
<td rowspan="1" colspan="1">KF251882</td>
<td rowspan="1" colspan="1">KF251378</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. cirsii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128621&link_type=cbs">CBS 128621</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cirsium setidens</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253328</td>
<td rowspan="1" colspan="1">KF252853</td>
<td rowspan="1" colspan="1">KF252382</td>
<td rowspan="1" colspan="1">KF251885</td>
<td rowspan="1" colspan="1">KF251381</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. citricola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=356.36&link_type=cbs">CBS 356.36</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Citrus sinensis</italic>
</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">G. Ruggieri</td>
<td rowspan="1" colspan="1">KF253329</td>
<td rowspan="1" colspan="1">KF252854</td>
<td rowspan="1" colspan="1">KF252383</td>
<td rowspan="1" colspan="1">KF251886</td>
<td rowspan="1" colspan="1">KF251382</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. clematidis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=108983&link_type=cbs">CBS 108983</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Clematis vitalba</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253330</td>
<td rowspan="1" colspan="1">KF252855</td>
<td rowspan="1" colspan="1">KF252384</td>
<td rowspan="1" colspan="1">KF251887</td>
<td rowspan="1" colspan="1">KF251383</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. codonopsidis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128620&link_type=cbs">CBS 128620</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Codonopsis lanceolata</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253333</td>
<td rowspan="1" colspan="1">KF252858</td>
<td rowspan="1" colspan="1">KF252387</td>
<td rowspan="1" colspan="1">KF251890</td>
<td rowspan="1" colspan="1">KF251386</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. convolvuli</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128627&link_type=cbs">CBS 128627</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Calystegia soldanella</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253336</td>
<td rowspan="1" colspan="1">KF252861</td>
<td rowspan="1" colspan="1">KF252390</td>
<td rowspan="1" colspan="1">KF251893</td>
<td rowspan="1" colspan="1">KF251389</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. coprosma</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=113391&link_type=cbs">CBS 113391</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Coprosma robusta</italic>
</td>
<td rowspan="1" colspan="1">New Zealand</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253255</td>
<td rowspan="1" colspan="1">KF252787</td>
<td rowspan="1" colspan="1">KF252313</td>
<td rowspan="1" colspan="1">KF251812</td>
<td rowspan="1" colspan="1">KF251308</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. crepidis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128608&link_type=cbs">CBS 128608</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Youngia japonica</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253337</td>
<td rowspan="1" colspan="1">KF252862</td>
<td rowspan="1" colspan="1">KF252391</td>
<td rowspan="1" colspan="1">KF251894</td>
<td rowspan="1" colspan="1">KF251390</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128619&link_type=cbs">CBS 128619</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Youngia japonica</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253338</td>
<td rowspan="1" colspan="1">KF252863</td>
<td rowspan="1" colspan="1">KF252392</td>
<td rowspan="1" colspan="1">KF251895</td>
<td rowspan="1" colspan="1">KF251391</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. cretae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135095&link_type=cbs">CBS 135095</ext-link>
; CPC 651</td>
<td rowspan="1" colspan="1">
<italic>Nerium oleander</italic>
</td>
<td rowspan="1" colspan="1">Greece</td>
<td rowspan="1" colspan="1">U. Damm</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252720</td>
<td rowspan="1" colspan="1">KF252238</td>
<td rowspan="1" colspan="1">KF251736</td>
<td rowspan="1" colspan="1">KF251233</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. cruciatae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123747&link_type=cbs">CBS 123747</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Galium odoratum</italic>
</td>
<td rowspan="1" colspan="1">Czech Republic</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253340</td>
<td rowspan="1" colspan="1">KF252865</td>
<td rowspan="1" colspan="1">KF252394</td>
<td rowspan="1" colspan="1">KF251897</td>
<td rowspan="1" colspan="1">KF251393</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. cucubali</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102386&link_type=cbs">CBS 102386</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Saponaria officinalis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253344</td>
<td rowspan="1" colspan="1">KF252869</td>
<td rowspan="1" colspan="1">KF252398</td>
<td rowspan="1" colspan="1">KF251901</td>
<td rowspan="1" colspan="1">KF251397</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. cucurbitacearum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=178.77&link_type=cbs">CBS 178.77</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cucurbita maxima</italic>
</td>
<td rowspan="1" colspan="1">New Zealand</td>
<td rowspan="1" colspan="1">H.J. Boesewinkel</td>
<td rowspan="1" colspan="1">KF253346</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252400</td>
<td rowspan="1" colspan="1">KF251903</td>
<td rowspan="1" colspan="1">KF251399</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. dearnessii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128624&link_type=cbs">CBS 128624</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Angelica dahurica</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253347</td>
<td rowspan="1" colspan="1">KF252871</td>
<td rowspan="1" colspan="1">KF252401</td>
<td rowspan="1" colspan="1">KF251904</td>
<td rowspan="1" colspan="1">KF251400</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. digitalis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=391.63&link_type=cbs">CBS 391.63</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Digitalis lanata</italic>
</td>
<td rowspan="1" colspan="1">Czech Republic</td>
<td rowspan="1" colspan="1">V. Holubová</td>
<td rowspan="1" colspan="1">KF253349</td>
<td rowspan="1" colspan="1">KF252873</td>
<td rowspan="1" colspan="1">KF252403</td>
<td rowspan="1" colspan="1">KF251906</td>
<td rowspan="1" colspan="1">KF251402</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. dysentericae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=131892&link_type=cbs">CBS 131892</ext-link>
; CPC 12328</td>
<td rowspan="1" colspan="1">
<italic>Inula britannica</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253353</td>
<td rowspan="1" colspan="1">KF252877</td>
<td rowspan="1" colspan="1">KF252406</td>
<td rowspan="1" colspan="1">KF251910</td>
<td rowspan="1" colspan="1">KF251406</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. epambrosiae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128629&link_type=cbs">CBS 128629</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Ambrosia trifida</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253356</td>
<td rowspan="1" colspan="1">KF252880</td>
<td rowspan="1" colspan="1">KF252407</td>
<td rowspan="1" colspan="1">KF251913</td>
<td rowspan="1" colspan="1">KF251409</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. epilobii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109084&link_type=cbs">CBS 109084</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Epilobium fleischeri</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253358</td>
<td rowspan="1" colspan="1">KF252882</td>
<td rowspan="1" colspan="1">KF252409</td>
<td rowspan="1" colspan="1">KF251915</td>
<td rowspan="1" colspan="1">KF251411</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109085&link_type=cbs">CBS 109085</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Epilobium fleischeri</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253359</td>
<td rowspan="1" colspan="1">KF252883</td>
<td rowspan="1" colspan="1">KF252410</td>
<td rowspan="1" colspan="1">KF251916</td>
<td rowspan="1" colspan="1">KF251412</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. erigerontis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=186.93&link_type=cbs">CBS 186.93</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Erigeron annuus</italic>
</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">M. Vurro</td>
<td rowspan="1" colspan="1">KF253364</td>
<td rowspan="1" colspan="1">KF252887</td>
<td rowspan="1" colspan="1">KF252537</td>
<td rowspan="1" colspan="1">KF252048</td>
<td rowspan="1" colspan="1">KF251543</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109094&link_type=cbs">CBS 109094</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Erigeron annuus</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253360</td>
<td rowspan="1" colspan="1">KF252884</td>
<td rowspan="1" colspan="1">KF252411</td>
<td rowspan="1" colspan="1">KF251917</td>
<td rowspan="1" colspan="1">KF251413</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=131893&link_type=cbs">CBS 131893</ext-link>
; CPC 12340</td>
<td rowspan="1" colspan="1">
<italic>Erigeron annuus</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253363</td>
<td rowspan="1" colspan="1">KF252888</td>
<td rowspan="1" colspan="1">KF252414</td>
<td rowspan="1" colspan="1">KF251920</td>
<td rowspan="1" colspan="1">KF251416</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. eucalyptorum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=118505&link_type=cbs">CBS 118505</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus</italic>
sp.</td>
<td rowspan="1" colspan="1">India</td>
<td rowspan="1" colspan="1">W. Gams</td>
<td rowspan="1" colspan="1">KF253365</td>
<td rowspan="1" colspan="1">KF252889</td>
<td rowspan="1" colspan="1">KF252415</td>
<td rowspan="1" colspan="1">KF251921</td>
<td rowspan="1" colspan="1">KF251417</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. exotica</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=163.78&link_type=cbs">CBS 163.78</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Hebe speciosa</italic>
</td>
<td rowspan="1" colspan="1">New Zealand</td>
<td rowspan="1" colspan="1">H.J. Boesewinkel</td>
<td rowspan="1" colspan="1">KF253366</td>
<td rowspan="1" colspan="1">KF252890</td>
<td rowspan="1" colspan="1">KF252416</td>
<td rowspan="1" colspan="1">KF251922</td>
<td rowspan="1" colspan="1">KF251418</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. galeopsidis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=191.26&link_type=cbs">CBS 191.26</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Galeopsis</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">C. Killian</td>
<td rowspan="1" colspan="1">KF253370</td>
<td rowspan="1" colspan="1">KF252894</td>
<td rowspan="1" colspan="1">KF252420</td>
<td rowspan="1" colspan="1">KF251926</td>
<td rowspan="1" colspan="1">KF251422</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102314&link_type=cbs">CBS 102314</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Galeopsis tetrahit</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253371</td>
<td rowspan="1" colspan="1">KF252895</td>
<td rowspan="1" colspan="1">KF252421</td>
<td rowspan="1" colspan="1">KF251927</td>
<td rowspan="1" colspan="1">KF251423</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102411&link_type=cbs">CBS 102411</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Galeopsis tetrahit</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253372</td>
<td rowspan="1" colspan="1">KF252896</td>
<td rowspan="1" colspan="1">KF252422</td>
<td rowspan="1" colspan="1">KF251928</td>
<td rowspan="1" colspan="1">KF251424</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. gentianae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128633&link_type=cbs">CBS 128633</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Gentiana scabra</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253374</td>
<td rowspan="1" colspan="1">KF252898</td>
<td rowspan="1" colspan="1">KF252424</td>
<td rowspan="1" colspan="1">KF251930</td>
<td rowspan="1" colspan="1">KF251426</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Sep.” gladioli</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=121.20&link_type=cbs">CBS 121.20</ext-link>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">W.J. Kaiser</td>
<td rowspan="1" colspan="1">KF253375</td>
<td rowspan="1" colspan="1">KF252899</td>
<td rowspan="1" colspan="1">KF252425</td>
<td rowspan="1" colspan="1">KF251931</td>
<td rowspan="1" colspan="1">KF251427</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=353.29&link_type=cbs">CBS 353.29</ext-link>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">J.C. Went</td>
<td rowspan="1" colspan="1">KF253376</td>
<td rowspan="1" colspan="1">KF252900</td>
<td rowspan="1" colspan="1">KF252426</td>
<td rowspan="1" colspan="1">KF251932</td>
<td rowspan="1" colspan="1">KF251428</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. glycinicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128618&link_type=cbs">CBS 128618</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Glycine max</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253378</td>
<td rowspan="1" colspan="1">KF252902</td>
<td rowspan="1" colspan="1">KF252427</td>
<td rowspan="1" colspan="1">KF251934</td>
<td rowspan="1" colspan="1">KF251430</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. helianthi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123.81&link_type=cbs">CBS 123.81</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Helianthus annuus</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">M. Muntañola</td>
<td rowspan="1" colspan="1">KF253379</td>
<td rowspan="1" colspan="1">KF252903</td>
<td rowspan="1" colspan="1">KF252428</td>
<td rowspan="1" colspan="1">KF251935</td>
<td rowspan="1" colspan="1">KF251431</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. hibiscicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128615&link_type=cbs">CBS 128615</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Hibiscus syriacus</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253382</td>
<td rowspan="1" colspan="1">KF252906</td>
<td rowspan="1" colspan="1">KF252431</td>
<td rowspan="1" colspan="1">KF251938</td>
<td rowspan="1" colspan="1">KF251434</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. hippocastani</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=411.61&link_type=cbs">CBS 411.61</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Aesculus hippocastanum</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">W. Gerlach</td>
<td rowspan="1" colspan="1">KF253383</td>
<td rowspan="1" colspan="1">KF252907</td>
<td rowspan="1" colspan="1">KF252432</td>
<td rowspan="1" colspan="1">KF251939</td>
<td rowspan="1" colspan="1">KF251435</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 23103; MP11</td>
<td rowspan="1" colspan="1">
<italic>Aesculus</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S.I.R. Videira</td>
<td rowspan="1" colspan="1">KF253510</td>
<td rowspan="1" colspan="1">KF253031</td>
<td rowspan="1" colspan="1">KF252556</td>
<td rowspan="1" colspan="1">KF252068</td>
<td rowspan="1" colspan="1">KF251563</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. justiciae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128625&link_type=cbs">CBS 128625</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Justicia procumbens</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253385</td>
<td rowspan="1" colspan="1">KF252909</td>
<td rowspan="1" colspan="1">KF252434</td>
<td rowspan="1" colspan="1">KF251941</td>
<td rowspan="1" colspan="1">KF251437</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. lactucae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=352.58&link_type=cbs">CBS 352.58</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lactuca sativa</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">G. Sörgel</td>
<td rowspan="1" colspan="1">KF253388</td>
<td rowspan="1" colspan="1">KF252912</td>
<td rowspan="1" colspan="1">KF252437</td>
<td rowspan="1" colspan="1">KF251944</td>
<td rowspan="1" colspan="1">KF251440</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=108943&link_type=cbs">CBS 108943</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lactuca sativa</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">P. Grooteman</td>
<td rowspan="1" colspan="1">KF253387</td>
<td rowspan="1" colspan="1">KF252911</td>
<td rowspan="1" colspan="1">KF252436</td>
<td rowspan="1" colspan="1">KF251943</td>
<td rowspan="1" colspan="1">KF251439</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. lamiicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123884&link_type=cbs">CBS 123884</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lamium</italic>
sp.</td>
<td rowspan="1" colspan="1">Czech Republic</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253397</td>
<td rowspan="1" colspan="1">KF252921</td>
<td rowspan="1" colspan="1">KF252446</td>
<td rowspan="1" colspan="1">KF251953</td>
<td rowspan="1" colspan="1">KF251449</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. lepidiicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128635&link_type=cbs">CBS 128635</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lepidium virginicum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253398</td>
<td rowspan="1" colspan="1">KF252922</td>
<td rowspan="1" colspan="1">KF252447</td>
<td rowspan="1" colspan="1">KF251954</td>
<td rowspan="1" colspan="1">KF251450</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. leptostachyae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128613&link_type=cbs">CBS 128613</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phryma leptostachya</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253399</td>
<td rowspan="1" colspan="1">KF252923</td>
<td rowspan="1" colspan="1">KF252448</td>
<td rowspan="1" colspan="1">KF251955</td>
<td rowspan="1" colspan="1">KF251451</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128628&link_type=cbs">CBS 128628</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phryma leptostachya</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253400</td>
<td rowspan="1" colspan="1">KF252924</td>
<td rowspan="1" colspan="1">KF252449</td>
<td rowspan="1" colspan="1">KF251956</td>
<td rowspan="1" colspan="1">KF251452</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. leucanthemi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109090&link_type=cbs">CBS 109090</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chrysanthemum leucanthemum</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253403</td>
<td rowspan="1" colspan="1">KF252927</td>
<td rowspan="1" colspan="1">KF252452</td>
<td rowspan="1" colspan="1">KF251959</td>
<td rowspan="1" colspan="1">KF251455</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. limonum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=419.51&link_type=cbs">CBS 419.51</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Citrus limonum</italic>
</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">G. Goidánich</td>
<td rowspan="1" colspan="1">KF253407</td>
<td rowspan="1" colspan="1">KF252931</td>
<td rowspan="1" colspan="1">KF252456</td>
<td rowspan="1" colspan="1">KF251963</td>
<td rowspan="1" colspan="1">KF251459</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. linicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=316.37&link_type=cbs">CBS 316.37</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Linum usitatissimum</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">H.W. Hollenweber</td>
<td rowspan="1" colspan="1">KF253408</td>
<td rowspan="1" colspan="1">KF252932</td>
<td rowspan="1" colspan="1">KF252457</td>
<td rowspan="1" colspan="1">KF251964</td>
<td rowspan="1" colspan="1">KF251460</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. lycoctoni</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109089&link_type=cbs">CBS 109089</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Aconitum vulparia</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253409</td>
<td rowspan="1" colspan="1">KF252933</td>
<td rowspan="1" colspan="1">KF252458</td>
<td rowspan="1" colspan="1">KF251965</td>
<td rowspan="1" colspan="1">KF251461</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. lycopersici</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128654&link_type=cbs">CBS 128654</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lycopersicon esculentum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253410</td>
<td rowspan="1" colspan="1">KF252934</td>
<td rowspan="1" colspan="1">KF252459</td>
<td rowspan="1" colspan="1">KF251966</td>
<td rowspan="1" colspan="1">KF251462</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. lycopicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128651&link_type=cbs">CBS 128651</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lycopus ramosissimus</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253412</td>
<td rowspan="1" colspan="1">KF252936</td>
<td rowspan="1" colspan="1">KF252461</td>
<td rowspan="1" colspan="1">KF251968</td>
<td rowspan="1" colspan="1">KF251464</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. lysimachiae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102315&link_type=cbs">CBS 102315</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lysimachia vulgaris</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253413</td>
<td rowspan="1" colspan="1">KF252937</td>
<td rowspan="1" colspan="1">KF252462</td>
<td rowspan="1" colspan="1">KF251969</td>
<td rowspan="1" colspan="1">KF251465</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123795&link_type=cbs">CBS 123795</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lysimachia</italic>
sp.</td>
<td rowspan="1" colspan="1">Czech Republic</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253417</td>
<td rowspan="1" colspan="1">KF252941</td>
<td rowspan="1" colspan="1">KF252466</td>
<td rowspan="1" colspan="1">KF251973</td>
<td rowspan="1" colspan="1">KF251469</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. malagutii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=106.80&link_type=cbs">CBS 106.80</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Solanum</italic>
sp.</td>
<td rowspan="1" colspan="1">Peru</td>
<td rowspan="1" colspan="1">G.H. Boerema</td>
<td rowspan="1" colspan="1">KF253418</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252467</td>
<td rowspan="1" colspan="1">KF251974</td>
<td rowspan="1" colspan="1">KF251470</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. matricariae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109001&link_type=cbs">CBS 109001</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Matricaria discoidea</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253420</td>
<td rowspan="1" colspan="1">KF252943</td>
<td rowspan="1" colspan="1">KF252469</td>
<td rowspan="1" colspan="1">KF251976</td>
<td rowspan="1" colspan="1">KF251472</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. mazi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128755&link_type=cbs">CBS 128755</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Mazus japonicus</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253422</td>
<td rowspan="1" colspan="1">KF252945</td>
<td rowspan="1" colspan="1">KF252471</td>
<td rowspan="1" colspan="1">KF251978</td>
<td rowspan="1" colspan="1">KF251474</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. melissae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109097&link_type=cbs">CBS 109097</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Melissa officinalis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253423</td>
<td rowspan="1" colspan="1">KF252946</td>
<td rowspan="1" colspan="1">KF252472</td>
<td rowspan="1" colspan="1">KF251979</td>
<td rowspan="1" colspan="1">KF251475</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. napelli</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109105&link_type=cbs">CBS 109105</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Aconitum napellus</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253426</td>
<td rowspan="1" colspan="1">KF252949</td>
<td rowspan="1" colspan="1">KF252474</td>
<td rowspan="1" colspan="1">KF251982</td>
<td rowspan="1" colspan="1">KF251478</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. obesa</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=354.58&link_type=cbs">CBS 354.58</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chrysanthemum indicum</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253431</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252479</td>
<td rowspan="1" colspan="1">KF251987</td>
<td rowspan="1" colspan="1">KF251483</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128588&link_type=cbs">CBS 128588</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Artemisia lavandulaefolia</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253428</td>
<td rowspan="1" colspan="1">KF252951</td>
<td rowspan="1" colspan="1">KF252476</td>
<td rowspan="1" colspan="1">KF251984</td>
<td rowspan="1" colspan="1">KF251480</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128623&link_type=cbs">CBS 128623</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chrysanthemum indicum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253429</td>
<td rowspan="1" colspan="1">KF252952</td>
<td rowspan="1" colspan="1">KF252477</td>
<td rowspan="1" colspan="1">KF251985</td>
<td rowspan="1" colspan="1">KF251481</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. oenanthicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128649&link_type=cbs">CBS 128649</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Oenanthe javanica</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253187</td>
<td rowspan="1" colspan="1">KF252721</td>
<td rowspan="1" colspan="1">KF252239</td>
<td rowspan="1" colspan="1">KF251737</td>
<td rowspan="1" colspan="1">KF251234</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. oenanthis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128667&link_type=cbs">CBS 128667</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cicuta virosa</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253432</td>
<td rowspan="1" colspan="1">KF252953</td>
<td rowspan="1" colspan="1">KF252481</td>
<td rowspan="1" colspan="1">KF251989</td>
<td rowspan="1" colspan="1">KF251485</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. orchidearum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=457.78&link_type=cbs">CBS 457.78</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Listera ovata</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253435</td>
<td rowspan="1" colspan="1">KF252956</td>
<td rowspan="1" colspan="1">KF252483</td>
<td rowspan="1" colspan="1">KF251991</td>
<td rowspan="1" colspan="1">KF251487</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128631&link_type=cbs">CBS 128631</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cyclamen fatrense</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253434</td>
<td rowspan="1" colspan="1">KF252955</td>
<td rowspan="1" colspan="1">KF252482</td>
<td rowspan="1" colspan="1">KF251990</td>
<td rowspan="1" colspan="1">KF251486</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. pachyspora</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128652&link_type=cbs">CBS 128652</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Zyathoxylum schinifolium</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253437</td>
<td rowspan="1" colspan="1">KF252958</td>
<td rowspan="1" colspan="1">KF252485</td>
<td rowspan="1" colspan="1">KF251993</td>
<td rowspan="1" colspan="1">KF251488</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. paridis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109108&link_type=cbs">CBS 109108</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Viola</italic>
sp.</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253440</td>
<td rowspan="1" colspan="1">KF252961</td>
<td rowspan="1" colspan="1">KF252488</td>
<td rowspan="1" colspan="1">KF251996</td>
<td rowspan="1" colspan="1">KF251491</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109111&link_type=cbs">CBS 109111</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Paris quadrifolia</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253438</td>
<td rowspan="1" colspan="1">KF252959</td>
<td rowspan="1" colspan="1">KF252486</td>
<td rowspan="1" colspan="1">KF251994</td>
<td rowspan="1" colspan="1">KF251489</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. passiflorae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102701&link_type=cbs">CBS 102701</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Passiflora edulis</italic>
</td>
<td rowspan="1" colspan="1">New Zealand</td>
<td rowspan="1" colspan="1">C.F. Hill</td>
<td rowspan="1" colspan="1">KF253442</td>
<td rowspan="1" colspan="1">KF252963</td>
<td rowspan="1" colspan="1">KF252490</td>
<td rowspan="1" colspan="1">KF251998</td>
<td rowspan="1" colspan="1">KF251493</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. perillae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128655&link_type=cbs">CBS 128655</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Perilla frutescens</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253444</td>
<td rowspan="1" colspan="1">KF252965</td>
<td rowspan="1" colspan="1">KF252491</td>
<td rowspan="1" colspan="1">KF252000</td>
<td rowspan="1" colspan="1">KF251495</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. petroselini</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=182.44&link_type=cbs">CBS 182.44</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Petroselinum sativum</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S.D. de Wit</td>
<td rowspan="1" colspan="1">KF253446</td>
<td rowspan="1" colspan="1">KF252967</td>
<td rowspan="1" colspan="1">KF252493</td>
<td rowspan="1" colspan="1">KF252002</td>
<td rowspan="1" colspan="1">KF251497</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. phlogis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128663&link_type=cbs">CBS 128663</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phlox paniculata</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253448</td>
<td rowspan="1" colspan="1">KF252969</td>
<td rowspan="1" colspan="1">KF252495</td>
<td rowspan="1" colspan="1">KF252004</td>
<td rowspan="1" colspan="1">KF251499</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. polygonorum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=347.67&link_type=cbs">CBS 347.67</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Polygonum persicaria</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253455</td>
<td rowspan="1" colspan="1">KF252976</td>
<td rowspan="1" colspan="1">KF252502</td>
<td rowspan="1" colspan="1">KF252011</td>
<td rowspan="1" colspan="1">KF251506</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109834&link_type=cbs">CBS 109834</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Polygonum persicaria</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253453</td>
<td rowspan="1" colspan="1">KF252974</td>
<td rowspan="1" colspan="1">KF252500</td>
<td rowspan="1" colspan="1">KF252009</td>
<td rowspan="1" colspan="1">KF251504</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. posoniensis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128645&link_type=cbs">CBS 128645</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chrysosplenium japonicum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253456</td>
<td rowspan="1" colspan="1">KF252977</td>
<td rowspan="1" colspan="1">KF252503</td>
<td rowspan="1" colspan="1">KF252012</td>
<td rowspan="1" colspan="1">KF251507</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. protearum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=177.77&link_type=cbs">CBS 177.77</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Fragaria</italic>
sp.</td>
<td rowspan="1" colspan="1">New Zealand</td>
<td rowspan="1" colspan="1">H.J. Boesewinkel</td>
<td rowspan="1" colspan="1">KF253463</td>
<td rowspan="1" colspan="1">KF252984</td>
<td rowspan="1" colspan="1">KF252509</td>
<td rowspan="1" colspan="1">KF252019</td>
<td rowspan="1" colspan="1">KF251514</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=390.59&link_type=cbs">CBS 390.59</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Ligustrum vulgare</italic>
</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">M. Ribaldi</td>
<td rowspan="1" colspan="1">KF253467</td>
<td rowspan="1" colspan="1">KF252987</td>
<td rowspan="1" colspan="1">KF252513</td>
<td rowspan="1" colspan="1">KF252023</td>
<td rowspan="1" colspan="1">KF251518</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=566.88&link_type=cbs">CBS 566.88</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Hedera helix</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253470</td>
<td rowspan="1" colspan="1">KF252990</td>
<td rowspan="1" colspan="1">KF252515</td>
<td rowspan="1" colspan="1">KF252026</td>
<td rowspan="1" colspan="1">KF251521</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=778.97&link_type=cbs">CBS 778.97</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Protea cynaroides</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">L. Viljoen</td>
<td rowspan="1" colspan="1">KF253472</td>
<td rowspan="1" colspan="1">KF252992</td>
<td rowspan="1" colspan="1">KF252517</td>
<td rowspan="1" colspan="1">KF252028</td>
<td rowspan="1" colspan="1">KF251523</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135477&link_type=cbs">CBS 135477</ext-link>
; CPC 19675</td>
<td rowspan="1" colspan="1">
<italic>Zantedeschia aethiopica</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253473</td>
<td rowspan="1" colspan="1">KF252993</td>
<td rowspan="1" colspan="1">KF252518</td>
<td rowspan="1" colspan="1">KF252029</td>
<td rowspan="1" colspan="1">KF251524</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. pseudonapelli</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128664&link_type=cbs">CBS 128664</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Aconitum pseudolaeve</italic>
var.
<italic>erectum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253475</td>
<td rowspan="1" colspan="1">KF252995</td>
<td rowspan="1" colspan="1">KF252520</td>
<td rowspan="1" colspan="1">KF252031</td>
<td rowspan="1" colspan="1">KF251526</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. putrida</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109088&link_type=cbs">CBS 109088</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Senecio nemorensis</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253477</td>
<td rowspan="1" colspan="1">KF252997</td>
<td rowspan="1" colspan="1">KF252522</td>
<td rowspan="1" colspan="1">KF252033</td>
<td rowspan="1" colspan="1">KF251528</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. rumicum</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=503.76&link_type=cbs">CBS 503.76</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rumex acetosa</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253478</td>
<td rowspan="1" colspan="1">KF252998</td>
<td rowspan="1" colspan="1">KF252523</td>
<td rowspan="1" colspan="1">KF252034</td>
<td rowspan="1" colspan="1">KF251529</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. saccardoi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128756&link_type=cbs">CBS 128756</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lysimachia vulgaris</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253479</td>
<td rowspan="1" colspan="1">KF252999</td>
<td rowspan="1" colspan="1">KF252524</td>
<td rowspan="1" colspan="1">KF252035</td>
<td rowspan="1" colspan="1">KF251530</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. scabiosicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102334&link_type=cbs">CBS 102334</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Knautia arvensis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253481</td>
<td rowspan="1" colspan="1">KF253001</td>
<td rowspan="1" colspan="1">KF252526</td>
<td rowspan="1" colspan="1">KF252037</td>
<td rowspan="1" colspan="1">KF251532</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102336&link_type=cbs">CBS 102336</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Knautia arvensis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253483</td>
<td rowspan="1" colspan="1">KF253003</td>
<td rowspan="1" colspan="1">KF252528</td>
<td rowspan="1" colspan="1">KF252039</td>
<td rowspan="1" colspan="1">KF251534</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=108981&link_type=cbs">CBS 108981</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Knautia arvensis</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253484</td>
<td rowspan="1" colspan="1">KF253004</td>
<td rowspan="1" colspan="1">KF252529</td>
<td rowspan="1" colspan="1">KF252040</td>
<td rowspan="1" colspan="1">KF251535</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109093&link_type=cbs">CBS 109093</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Knautia dipsacifolia</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253487</td>
<td rowspan="1" colspan="1">KF253007</td>
<td rowspan="1" colspan="1">KF252532</td>
<td rowspan="1" colspan="1">KF252043</td>
<td rowspan="1" colspan="1">KF251538</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. senecionis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102366&link_type=cbs">CBS 102366</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Senecio fluviatilis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253492</td>
<td rowspan="1" colspan="1">KF253012</td>
<td rowspan="1" colspan="1">KF252538</td>
<td rowspan="1" colspan="1">KF252049</td>
<td rowspan="1" colspan="1">KF251544</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102381&link_type=cbs">CBS 102381</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Senecio fluviatilis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253493</td>
<td rowspan="1" colspan="1">KF253013</td>
<td rowspan="1" colspan="1">KF252539</td>
<td rowspan="1" colspan="1">KF252050</td>
<td rowspan="1" colspan="1">KF251545</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. siegesbeckiae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128659&link_type=cbs">CBS 128659</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Siegesbeckia glabrescens</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253494</td>
<td rowspan="1" colspan="1">KF253014</td>
<td rowspan="1" colspan="1">KF252540</td>
<td rowspan="1" colspan="1">KF252051</td>
<td rowspan="1" colspan="1">KF251546</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128661&link_type=cbs">CBS 128661</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Siegesbeckia pubescens</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253495</td>
<td rowspan="1" colspan="1">KF253015</td>
<td rowspan="1" colspan="1">KF252541</td>
<td rowspan="1" colspan="1">KF252052</td>
<td rowspan="1" colspan="1">KF251547</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. sii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102370&link_type=cbs">CBS 102370</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Berula erecta</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253497</td>
<td rowspan="1" colspan="1">KF253017</td>
<td rowspan="1" colspan="1">KF252543</td>
<td rowspan="1" colspan="1">KF252054</td>
<td rowspan="1" colspan="1">KF251549</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. sisyrinchii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=112096&link_type=cbs">CBS 112096</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Sysirinchium</italic>
sp.</td>
<td rowspan="1" colspan="1">New Zealand</td>
<td rowspan="1" colspan="1">C.F. Hill</td>
<td rowspan="1" colspan="1">KF253499</td>
<td rowspan="1" colspan="1">KF253019</td>
<td rowspan="1" colspan="1">KF252545</td>
<td rowspan="1" colspan="1">KF252056</td>
<td rowspan="1" colspan="1">KF251551</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Septoria</italic>
sp.</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128650&link_type=cbs">CBS 128650</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Taraxacum officinale</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253504</td>
<td rowspan="1" colspan="1">KF253024</td>
<td rowspan="1" colspan="1">KF252550</td>
<td rowspan="1" colspan="1">KF252061</td>
<td rowspan="1" colspan="1">KF251556</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128658&link_type=cbs">CBS 128658</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chrysosplenium japonicum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253505</td>
<td rowspan="1" colspan="1">KF253025</td>
<td rowspan="1" colspan="1">KF252551</td>
<td rowspan="1" colspan="1">KF252062</td>
<td rowspan="1" colspan="1">KF251557</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128757&link_type=cbs">CBS 128757</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Sonchus asper</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253500</td>
<td rowspan="1" colspan="1">KF253020</td>
<td rowspan="1" colspan="1">KF252546</td>
<td rowspan="1" colspan="1">KF252057</td>
<td rowspan="1" colspan="1">KF251552</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135472&link_type=cbs">CBS 135472</ext-link>
; CPC 19304</td>
<td rowspan="1" colspan="1">
<italic>Vigna unguiculata</italic>
ssp.
<italic>sesquipedalis</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253506</td>
<td rowspan="1" colspan="1">KF253026</td>
<td rowspan="1" colspan="1">KF252552</td>
<td rowspan="1" colspan="1">KF252063</td>
<td rowspan="1" colspan="1">KF251558</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135474&link_type=cbs">CBS 135474</ext-link>
; CPC 19485</td>
<td rowspan="1" colspan="1">
<italic>Conyza canadensis</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">R.W. Barreto</td>
<td rowspan="1" colspan="1">KF253507</td>
<td rowspan="1" colspan="1">KF253027</td>
<td rowspan="1" colspan="1">KF252553</td>
<td rowspan="1" colspan="1">KF252064</td>
<td rowspan="1" colspan="1">KF251559</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135478&link_type=cbs">CBS 135478</ext-link>
; CPC 19716</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus</italic>
sp.</td>
<td rowspan="1" colspan="1">India</td>
<td rowspan="1" colspan="1">W. Gams</td>
<td rowspan="1" colspan="1">KF253188</td>
<td rowspan="1" colspan="1">KF252722</td>
<td rowspan="1" colspan="1">KF252240</td>
<td rowspan="1" colspan="1">KF251738</td>
<td rowspan="1" colspan="1">KF251235</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135479&link_type=cbs">CBS 135479</ext-link>
; CPC 19793</td>
<td rowspan="1" colspan="1">
<italic>Syzygium cordatum</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253029</td>
<td rowspan="1" colspan="1">KF252555</td>
<td rowspan="1" colspan="1">KF252066</td>
<td rowspan="1" colspan="1">KF251561</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 19976</td>
<td rowspan="1" colspan="1">
<italic>Feijoa sellowiana</italic>
</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">G. Polizzi</td>
<td rowspan="1" colspan="1">KF253509</td>
<td rowspan="1" colspan="1">KF253030</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252067</td>
<td rowspan="1" colspan="1">KF251562</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 21105</td>
<td rowspan="1" colspan="1">
<italic>Cluvia</italic>
sp.</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF302396</td>
<td rowspan="1" colspan="1">KF302408</td>
<td rowspan="1" colspan="1">KF302402</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 23104</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">E. van Agtmaal</td>
<td rowspan="1" colspan="1">KF253511</td>
<td rowspan="1" colspan="1">KF253032</td>
<td rowspan="1" colspan="1">KF252557</td>
<td rowspan="1" colspan="1">KF252069</td>
<td rowspan="1" colspan="1">KF251564</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. stachydis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=347.58&link_type=cbs">CBS 347.58</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Aster canus</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253295</td>
<td rowspan="1" colspan="1">KF252820</td>
<td rowspan="1" colspan="1">KF252349</td>
<td rowspan="1" colspan="1">KF251852</td>
<td rowspan="1" colspan="1">KF251348</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102326&link_type=cbs">CBS 102326</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Stachys sylvatica</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253514</td>
<td rowspan="1" colspan="1">KF253035</td>
<td rowspan="1" colspan="1">KF252560</td>
<td rowspan="1" colspan="1">KF252072</td>
<td rowspan="1" colspan="1">KF251567</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109115&link_type=cbs">CBS 109115</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Campanula glomerata</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253502</td>
<td rowspan="1" colspan="1">KF253022</td>
<td rowspan="1" colspan="1">KF252548</td>
<td rowspan="1" colspan="1">KF252059</td>
<td rowspan="1" colspan="1">KF251554</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109127&link_type=cbs">CBS 109127</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Stachys sylvatica</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253517</td>
<td rowspan="1" colspan="1">KF253038</td>
<td rowspan="1" colspan="1">KF252563</td>
<td rowspan="1" colspan="1">KF252075</td>
<td rowspan="1" colspan="1">KF251570</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. stellariae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102376&link_type=cbs">CBS 102376</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Stellaria media</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253521</td>
<td rowspan="1" colspan="1">KF253042</td>
<td rowspan="1" colspan="1">KF252567</td>
<td rowspan="1" colspan="1">KF252079</td>
<td rowspan="1" colspan="1">KF251574</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Sep.” steviae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=120132&link_type=cbs">CBS 120132</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Stevia rebaudiana</italic>
</td>
<td rowspan="1" colspan="1">Japan</td>
<td rowspan="1" colspan="1">J. Ishiba</td>
<td rowspan="1" colspan="1">KF253191</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252243</td>
<td rowspan="1" colspan="1">KF251741</td>
<td rowspan="1" colspan="1">KF251238</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Sep.” tanaceti</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=358.58&link_type=cbs">CBS 358.58</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Tanacetum vulgare</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253192</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252244</td>
<td rowspan="1" colspan="1">KF251742</td>
<td rowspan="1" colspan="1">KF251239</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. taraxaci</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=567.75&link_type=cbs">CBS 567.75</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Taraxacum</italic>
sp.</td>
<td rowspan="1" colspan="1">Armenia</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253524</td>
<td rowspan="1" colspan="1">KF253045</td>
<td rowspan="1" colspan="1">KF252570</td>
<td rowspan="1" colspan="1">KF252082</td>
<td rowspan="1" colspan="1">KF251577</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. tinctoriae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=129154&link_type=cbs">CBS 129154</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Serratula coronata</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253525</td>
<td rowspan="1" colspan="1">KF253046</td>
<td rowspan="1" colspan="1">KF252571</td>
<td rowspan="1" colspan="1">KF252083</td>
<td rowspan="1" colspan="1">KF251578</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. tormentillae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128643&link_type=cbs">CBS 128643</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Potentilla fragarioides</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253526</td>
<td rowspan="1" colspan="1">KF253047</td>
<td rowspan="1" colspan="1">KF252572</td>
<td rowspan="1" colspan="1">KF252084</td>
<td rowspan="1" colspan="1">KF251579</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128647&link_type=cbs">CBS 128647</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Potentilla fragarioides</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253527</td>
<td rowspan="1" colspan="1">KF253048</td>
<td rowspan="1" colspan="1">KF252573</td>
<td rowspan="1" colspan="1">KF252085</td>
<td rowspan="1" colspan="1">KF251580</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. urticae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102316&link_type=cbs">CBS 102316</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Glechoma hederacea</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253528</td>
<td rowspan="1" colspan="1">KF253049</td>
<td rowspan="1" colspan="1">KF252574</td>
<td rowspan="1" colspan="1">KF252086</td>
<td rowspan="1" colspan="1">KF251581</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102375&link_type=cbs">CBS 102375</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Urtica dioica</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253530</td>
<td rowspan="1" colspan="1">KF253051</td>
<td rowspan="1" colspan="1">KF252576</td>
<td rowspan="1" colspan="1">KF252088</td>
<td rowspan="1" colspan="1">KF251583</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. verbascicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102401&link_type=cbs">CBS 102401</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Verbascum nigrum</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253531</td>
<td rowspan="1" colspan="1">KF253052</td>
<td rowspan="1" colspan="1">KF252577</td>
<td rowspan="1" colspan="1">KF252089</td>
<td rowspan="1" colspan="1">KF251584</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. verbenae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=113438&link_type=cbs">CBS 113438</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Verbena officinalis</italic>
</td>
<td rowspan="1" colspan="1">New Zealand</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253532</td>
<td rowspan="1" colspan="1">KF253053</td>
<td rowspan="1" colspan="1">KF252578</td>
<td rowspan="1" colspan="1">KF252090</td>
<td rowspan="1" colspan="1">KF251585</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. villarsiae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=514.78&link_type=cbs">CBS 514.78</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Nymphoides peltata</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253534</td>
<td rowspan="1" colspan="1">KF253055</td>
<td rowspan="1" colspan="1">KF252580</td>
<td rowspan="1" colspan="1">KF252092</td>
<td rowspan="1" colspan="1">KF251587</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sep. violae-palustris</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128644&link_type=cbs">CBS 128644</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Viola selkirkii</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253537</td>
<td rowspan="1" colspan="1">KF253058</td>
<td rowspan="1" colspan="1">KF252583</td>
<td rowspan="1" colspan="1">KF252095</td>
<td rowspan="1" colspan="1">KF251590</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128660&link_type=cbs">CBS 128660</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Viola yedoensis</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253538</td>
<td rowspan="1" colspan="1">KF253059</td>
<td rowspan="1" colspan="1">KF252584</td>
<td rowspan="1" colspan="1">KF252096</td>
<td rowspan="1" colspan="1">KF251591</td>
</tr>
<tr>
<td rowspan="1" colspan="1">septoria-like sp.</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=134910&link_type=cbs">CBS 134910</ext-link>
; CPC 19500</td>
<td rowspan="1" colspan="1">
<italic>Tibouchina herbacea</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">D.F. Parreira</td>
<td rowspan="1" colspan="1">KF302391</td>
<td rowspan="1" colspan="1">KF302386</td>
<td rowspan="1" colspan="1">KF302397</td>
<td rowspan="1" colspan="1">KF302409</td>
<td rowspan="1" colspan="1">KF302403</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135471&link_type=cbs">CBS 135471</ext-link>
; CPC 19294</td>
<td rowspan="1" colspan="1">
<italic>Corymbia gummifera</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253193</td>
<td rowspan="1" colspan="1">KF252725</td>
<td rowspan="1" colspan="1">KF252245</td>
<td rowspan="1" colspan="1">KF251743</td>
<td rowspan="1" colspan="1">KF251240</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135473&link_type=cbs">CBS 135473</ext-link>
; CPC 19311</td>
<td rowspan="1" colspan="1">
<italic>Phragmites</italic>
sp.</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253194</td>
<td rowspan="1" colspan="1">KF252726</td>
<td rowspan="1" colspan="1">KF252246</td>
<td rowspan="1" colspan="1">KF251744</td>
<td rowspan="1" colspan="1">KF251241</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135481&link_type=cbs">CBS 135481</ext-link>
; CPC 22154; S672</td>
<td rowspan="1" colspan="1">
<italic>Polygonatum</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">U. Damm</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252247</td>
<td rowspan="1" colspan="1">KF251745</td>
<td rowspan="1" colspan="1">KF251242</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Septorioides pini-thunbergii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=473.91&link_type=cbs">CBS 473.91</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Pinus thunbergii</italic>
</td>
<td rowspan="1" colspan="1">Japan</td>
<td rowspan="1" colspan="1">S. Kaneko & Y. Zinno</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252727</td>
<td rowspan="1" colspan="1">KF252248</td>
<td rowspan="1" colspan="1">KF251746</td>
<td rowspan="1" colspan="1">KF251243</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Setophoma chromolaenae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135105&link_type=cbs">CBS 135105</ext-link>
; CPC 18553</td>
<td rowspan="1" colspan="1">
<italic>Chromolaena odorata</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">R.W. Barreto</td>
<td rowspan="1" colspan="1">KF253195</td>
<td rowspan="1" colspan="1">KF252728</td>
<td rowspan="1" colspan="1">KF252249</td>
<td rowspan="1" colspan="1">KF251747</td>
<td rowspan="1" colspan="1">KF251244</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Setop. sacchari</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=333.39&link_type=cbs">CBS 333.39</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Saccharum officinarum</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">A.A. Bitancourt</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252250</td>
<td rowspan="1" colspan="1">KF251748</td>
<td rowspan="1" colspan="1">KF251245</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Setop. terrestris</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=335.29&link_type=cbs">CBS 335.29</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Allium sativum</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">H.N. Hansen</td>
<td rowspan="1" colspan="1">KF253196</td>
<td rowspan="1" colspan="1">KF252729</td>
<td rowspan="1" colspan="1">KF252251</td>
<td rowspan="1" colspan="1">KF251749</td>
<td rowspan="1" colspan="1">KF251246</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=335.87&link_type=cbs">CBS 335.87</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Allium cepa</italic>
</td>
<td rowspan="1" colspan="1">Senegal</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253197</td>
<td rowspan="1" colspan="1">KF252730</td>
<td rowspan="1" colspan="1">KF252252</td>
<td rowspan="1" colspan="1">KF251750</td>
<td rowspan="1" colspan="1">KF251247</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=377.52&link_type=cbs">CBS 377.52</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Allium cepa</italic>
</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">R.H. Larson</td>
<td rowspan="1" colspan="1">KF253198</td>
<td rowspan="1" colspan="1">KF252731</td>
<td rowspan="1" colspan="1">KF252253</td>
<td rowspan="1" colspan="1">KF251751</td>
<td rowspan="1" colspan="1">KF251248</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135470&link_type=cbs">CBS 135470</ext-link>
; CPC 18417</td>
<td rowspan="1" colspan="1">
<italic>Zea mays</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">S. Lamprecht</td>
<td rowspan="1" colspan="1">KF253189</td>
<td rowspan="1" colspan="1">KF252723</td>
<td rowspan="1" colspan="1">KF252241</td>
<td rowspan="1" colspan="1">KF251739</td>
<td rowspan="1" colspan="1">KF251236</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Setoseptoria phragmitis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=114802&link_type=cbs">CBS 114802</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phragmites australis</italic>
</td>
<td rowspan="1" colspan="1">Hong Kong</td>
<td rowspan="1" colspan="1">K.D. Hyde</td>
<td rowspan="1" colspan="1">KF253199</td>
<td rowspan="1" colspan="1">KF252732</td>
<td rowspan="1" colspan="1">KF252254</td>
<td rowspan="1" colspan="1">KF251752</td>
<td rowspan="1" colspan="1">KF251249</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=114966&link_type=cbs">CBS 114966</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phragmites australis</italic>
</td>
<td rowspan="1" colspan="1">Hong Kong</td>
<td rowspan="1" colspan="1">K.D. Hyde</td>
<td rowspan="1" colspan="1">KF253200</td>
<td rowspan="1" colspan="1">KF252733</td>
<td rowspan="1" colspan="1">KF252255</td>
<td rowspan="1" colspan="1">KF251753</td>
<td rowspan="1" colspan="1">KF251250</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sphaerulina abeliceae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128591&link_type=cbs">CBS 128591</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Zelkova serrata</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253539</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252585</td>
<td rowspan="1" colspan="1">KF252097</td>
<td rowspan="1" colspan="1">KF251592</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. aceris</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=687.94&link_type=cbs">CBS 687.94</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Acer pseudoplatanus</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253542</td>
<td rowspan="1" colspan="1">KF253061</td>
<td rowspan="1" colspan="1">KF252588</td>
<td rowspan="1" colspan="1">KF252100</td>
<td rowspan="1" colspan="1">KF251595</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. amelanchier</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102063&link_type=cbs">CBS 102063</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Actinidia deliciosa</italic>
</td>
<td rowspan="1" colspan="1">New Zealand</td>
<td rowspan="1" colspan="1">C.F. Hill</td>
<td rowspan="1" colspan="1">KF253581</td>
<td rowspan="1" colspan="1">KF253096</td>
<td rowspan="1" colspan="1">KF252627</td>
<td rowspan="1" colspan="1">KF252140</td>
<td rowspan="1" colspan="1">KF251635</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135110&link_type=cbs">CBS 135110</ext-link>
; MP8</td>
<td rowspan="1" colspan="1">
<italic>Amelanchier</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S.I.R. Videira</td>
<td rowspan="1" colspan="1">KF253543</td>
<td rowspan="1" colspan="1">KF253062</td>
<td rowspan="1" colspan="1">KF252589</td>
<td rowspan="1" colspan="1">KF252101</td>
<td rowspan="1" colspan="1">KF251596</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 23105; MP22</td>
<td rowspan="1" colspan="1">
<italic>Quercus</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S.I.R. Videira</td>
<td rowspan="1" colspan="1">KF253544</td>
<td rowspan="1" colspan="1">KF253063</td>
<td rowspan="1" colspan="1">KF252590</td>
<td rowspan="1" colspan="1">KF252102</td>
<td rowspan="1" colspan="1">KF251597</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 23106; MP7</td>
<td rowspan="1" colspan="1">
<italic>Castanea</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S.I.R. Videira</td>
<td rowspan="1" colspan="1">KF253545</td>
<td rowspan="1" colspan="1">KF253064</td>
<td rowspan="1" colspan="1">KF252591</td>
<td rowspan="1" colspan="1">KF252103</td>
<td rowspan="1" colspan="1">KF251598</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 23107; MP9</td>
<td rowspan="1" colspan="1">
<italic>Betula</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S.I.R. Videira</td>
<td rowspan="1" colspan="1">KF253583</td>
<td rowspan="1" colspan="1">KF253098</td>
<td rowspan="1" colspan="1">KF252626</td>
<td rowspan="1" colspan="1">KF252139</td>
<td rowspan="1" colspan="1">KF251634</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. azaleae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=352.49&link_type=cbs">CBS 352.49</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rhododendron</italic>
sp.</td>
<td rowspan="1" colspan="1">Belgium</td>
<td rowspan="1" colspan="1">J. van Holder</td>
<td rowspan="1" colspan="1">KF253547</td>
<td rowspan="1" colspan="1">KF253066</td>
<td rowspan="1" colspan="1">KF252593</td>
<td rowspan="1" colspan="1">KF252105</td>
<td rowspan="1" colspan="1">KF251600</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128605&link_type=cbs">CBS 128605</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rhododendron</italic>
sp.</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253546</td>
<td rowspan="1" colspan="1">KF253065</td>
<td rowspan="1" colspan="1">KF252592</td>
<td rowspan="1" colspan="1">KF252104</td>
<td rowspan="1" colspan="1">KF251599</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. berberidis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=324.52&link_type=cbs">CBS 324.52</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Berberis vulgaris</italic>
</td>
<td rowspan="1" colspan="1">Switzerland</td>
<td rowspan="1" colspan="1">E. Müller</td>
<td rowspan="1" colspan="1">KF253548</td>
<td rowspan="1" colspan="1">KF253067</td>
<td rowspan="1" colspan="1">KF252594</td>
<td rowspan="1" colspan="1">KF252106</td>
<td rowspan="1" colspan="1">KF251601</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. betulae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=116724&link_type=cbs">CBS 116724</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Betula pubescens</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S. Green</td>
<td rowspan="1" colspan="1">KF253549</td>
<td rowspan="1" colspan="1">KF253068</td>
<td rowspan="1" colspan="1">KF252595</td>
<td rowspan="1" colspan="1">KF252107</td>
<td rowspan="1" colspan="1">KF251602</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128600&link_type=cbs">CBS 128600</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Betula platyphylla</italic>
var.
<italic>japonica</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253552</td>
<td rowspan="1" colspan="1">KF253071</td>
<td rowspan="1" colspan="1">KF252598</td>
<td rowspan="1" colspan="1">KF252110</td>
<td rowspan="1" colspan="1">KF251605</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. cercidis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=501.50&link_type=cbs">CBS 501.50</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cercis siliquastrum</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G. van den Ende</td>
<td rowspan="1" colspan="1">KF253556</td>
<td rowspan="1" colspan="1">KF253075</td>
<td rowspan="1" colspan="1">KF252601</td>
<td rowspan="1" colspan="1">KF252113</td>
<td rowspan="1" colspan="1">KF251608</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=118910&link_type=cbs">CBS 118910</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus</italic>
sp.</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253553</td>
<td rowspan="1" colspan="1">KF253072</td>
<td rowspan="1" colspan="1">KF252602</td>
<td rowspan="1" colspan="1">KF252114</td>
<td rowspan="1" colspan="1">KF251609</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128634&link_type=cbs">CBS 128634</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cercis siliquastrum</italic>
</td>
<td rowspan="1" colspan="1">Argentina</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253554</td>
<td rowspan="1" colspan="1">KF253073</td>
<td rowspan="1" colspan="1">KF252599</td>
<td rowspan="1" colspan="1">KF252111</td>
<td rowspan="1" colspan="1">KF251606</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=129151&link_type=cbs">CBS 129151</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cercis siliquastrum</italic>
</td>
<td rowspan="1" colspan="1">Argentina</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253555</td>
<td rowspan="1" colspan="1">KF253074</td>
<td rowspan="1" colspan="1">KF252600</td>
<td rowspan="1" colspan="1">KF252112</td>
<td rowspan="1" colspan="1">KF251607</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. cornicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102324&link_type=cbs">CBS 102324</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cornus</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">A. van Iperen</td>
<td rowspan="1" colspan="1">KF253557</td>
<td rowspan="1" colspan="1">KF253076</td>
<td rowspan="1" colspan="1">KF252603</td>
<td rowspan="1" colspan="1">KF252115</td>
<td rowspan="1" colspan="1">KF251610</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102332&link_type=cbs">CBS 102332</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cornus</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">A. van Iperen</td>
<td rowspan="1" colspan="1">KF253558</td>
<td rowspan="1" colspan="1">KF253077</td>
<td rowspan="1" colspan="1">KF252604</td>
<td rowspan="1" colspan="1">KF252116</td>
<td rowspan="1" colspan="1">KF251611</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. frondicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=391.59&link_type=cbs">CBS 391.59</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Populus pyramidalis</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253572</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252617</td>
<td rowspan="1" colspan="1">KF252130</td>
<td rowspan="1" colspan="1">KF251625</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. gei</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102318&link_type=cbs">CBS 102318</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Geum urbanum</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253560</td>
<td rowspan="1" colspan="1">KF253079</td>
<td rowspan="1" colspan="1">KF252605</td>
<td rowspan="1" colspan="1">KF252118</td>
<td rowspan="1" colspan="1">KF251613</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128632&link_type=cbs">CBS 128632</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Geum japonicum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253562</td>
<td rowspan="1" colspan="1">KF253081</td>
<td rowspan="1" colspan="1">KF252607</td>
<td rowspan="1" colspan="1">KF252120</td>
<td rowspan="1" colspan="1">KF251615</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. hyperici</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102313&link_type=cbs">CBS 102313</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Hypericum</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253563</td>
<td rowspan="1" colspan="1">KF253082</td>
<td rowspan="1" colspan="1">KF252608</td>
<td rowspan="1" colspan="1">KF252121</td>
<td rowspan="1" colspan="1">KF251616</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. menispermi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128666&link_type=cbs">CBS 128666</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Menispermum dauricum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253564</td>
<td rowspan="1" colspan="1">KF253083</td>
<td rowspan="1" colspan="1">KF252609</td>
<td rowspan="1" colspan="1">KF252122</td>
<td rowspan="1" colspan="1">KF251617</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128761&link_type=cbs">CBS 128761</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Menispermum dauricum</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253565</td>
<td rowspan="1" colspan="1">KF253084</td>
<td rowspan="1" colspan="1">KF252610</td>
<td rowspan="1" colspan="1">KF252123</td>
<td rowspan="1" colspan="1">KF251618</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. musiva</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=130570&link_type=cbs">CBS 130570</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Populus deltoides</italic>
</td>
<td rowspan="1" colspan="1">Canada</td>
<td rowspan="1" colspan="1">J. LeBoldus</td>
<td rowspan="1" colspan="1">JX901725</td>
<td rowspan="1" colspan="1">JX902304</td>
<td rowspan="1" colspan="1">JX902058</td>
<td rowspan="1" colspan="1">JX901935</td>
<td rowspan="1" colspan="1">JX901812</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. myriadea</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=124646&link_type=cbs">CBS 124646</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Quercus dentata</italic>
</td>
<td rowspan="1" colspan="1">Japan</td>
<td rowspan="1" colspan="1">K. Tanaka</td>
<td rowspan="1" colspan="1">KF253201</td>
<td rowspan="1" colspan="1">KF252734</td>
<td rowspan="1" colspan="1">KF252256</td>
<td rowspan="1" colspan="1">KF251754</td>
<td rowspan="1" colspan="1">KF251251</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. oxyacanthae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135098&link_type=cbs">CBS 135098</ext-link>
; S654</td>
<td rowspan="1" colspan="1">
<italic>Crataegus</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253202</td>
<td rowspan="1" colspan="1">KF252735</td>
<td rowspan="1" colspan="1">KF252257</td>
<td rowspan="1" colspan="1">KF251755</td>
<td rowspan="1" colspan="1">KF251252</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. patriniae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128653&link_type=cbs">CBS 128653</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Patrinia scabiosaefolia</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253570</td>
<td rowspan="1" colspan="1">KF253087</td>
<td rowspan="1" colspan="1">KF252615</td>
<td rowspan="1" colspan="1">KF252128</td>
<td rowspan="1" colspan="1">KF251623</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. populicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=100042&link_type=cbs">CBS 100042</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Populus trichocarpa</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">G. Newcombe</td>
<td rowspan="1" colspan="1">KF253573</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252618</td>
<td rowspan="1" colspan="1">KF252131</td>
<td rowspan="1" colspan="1">KF251626</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. pseudovirgaureae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135109&link_type=cbs">CBS 135109</ext-link>
; S669</td>
<td rowspan="1" colspan="1">
<italic>Solidago gigantea</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">S.I.R. Videira</td>
<td rowspan="1" colspan="1">KF253203</td>
<td rowspan="1" colspan="1">KF252736</td>
<td rowspan="1" colspan="1">KF252258</td>
<td rowspan="1" colspan="1">KF251756</td>
<td rowspan="1" colspan="1">KF251253</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. quercicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=663.94&link_type=cbs">CBS 663.94</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Quercus robur</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">H.A. van der Aa</td>
<td rowspan="1" colspan="1">KF253577</td>
<td rowspan="1" colspan="1">KF253092</td>
<td rowspan="1" colspan="1">KF252622</td>
<td rowspan="1" colspan="1">KF252135</td>
<td rowspan="1" colspan="1">KF251630</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109009&link_type=cbs">CBS 109009</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Quercus rubra</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253574</td>
<td rowspan="1" colspan="1">KF253089</td>
<td rowspan="1" colspan="1">KF252619</td>
<td rowspan="1" colspan="1">KF252132</td>
<td rowspan="1" colspan="1">KF251627</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=115016&link_type=cbs">CBS 115016</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Quercus robur</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253575</td>
<td rowspan="1" colspan="1">KF253090</td>
<td rowspan="1" colspan="1">KF252620</td>
<td rowspan="1" colspan="1">KF252133</td>
<td rowspan="1" colspan="1">KF251628</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=115136&link_type=cbs">CBS 115136</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Quercus robur</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253576</td>
<td rowspan="1" colspan="1">KF253091</td>
<td rowspan="1" colspan="1">KF252621</td>
<td rowspan="1" colspan="1">KF252134</td>
<td rowspan="1" colspan="1">KF251629</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=115137&link_type=cbs">CBS 115137</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Quercus robur</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF302390</td>
<td rowspan="1" colspan="1">KF302385</td>
<td rowspan="1" colspan="1">KF302394</td>
<td rowspan="1" colspan="1">KF302406</td>
<td rowspan="1" colspan="1">KF302400</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. socia</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=355.58&link_type=cbs">CBS 355.58</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rosa</italic>
sp.</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253579</td>
<td rowspan="1" colspan="1">KF253094</td>
<td rowspan="1" colspan="1">KF252624</td>
<td rowspan="1" colspan="1">KF252137</td>
<td rowspan="1" colspan="1">KF251632</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=357.58&link_type=cbs">CBS 357.58</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Chrysanthemum leucanthemum</italic>
</td>
<td rowspan="1" colspan="1">Germany</td>
<td rowspan="1" colspan="1">R. Schneider</td>
<td rowspan="1" colspan="1">KF253580</td>
<td rowspan="1" colspan="1">KF253095</td>
<td rowspan="1" colspan="1">KF252625</td>
<td rowspan="1" colspan="1">KF252138</td>
<td rowspan="1" colspan="1">KF251633</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. tirolensis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109017&link_type=cbs">CBS 109017</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rubus idaeus</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253584</td>
<td rowspan="1" colspan="1">KF253099</td>
<td rowspan="1" colspan="1">KF252629</td>
<td rowspan="1" colspan="1">KF252142</td>
<td rowspan="1" colspan="1">KF251637</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109018&link_type=cbs">CBS 109018</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rubus idaeus</italic>
</td>
<td rowspan="1" colspan="1">Austria</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253585</td>
<td rowspan="1" colspan="1">KF253100</td>
<td rowspan="1" colspan="1">KF252630</td>
<td rowspan="1" colspan="1">KF252143</td>
<td rowspan="1" colspan="1">KF251638</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. viciae</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=131898&link_type=cbs">CBS 131898</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Vicia amurense</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253586</td>
<td rowspan="1" colspan="1">KF253101</td>
<td rowspan="1" colspan="1">KF252631</td>
<td rowspan="1" colspan="1">KF252144</td>
<td rowspan="1" colspan="1">KF251639</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sph. westendorpii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=117478&link_type=cbs">CBS 117478</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Rubus fruticosus</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253589</td>
<td rowspan="1" colspan="1">KF253104</td>
<td rowspan="1" colspan="1">KF252634</td>
<td rowspan="1" colspan="1">KF252147</td>
<td rowspan="1" colspan="1">KF251642</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Stagonospora</italic>
cf.
<italic>paludosa</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=130005&link_type=cbs">CBS 130005</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Carex</italic>
sp.</td>
<td rowspan="1" colspan="1">Russia</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF253204</td>
<td rowspan="1" colspan="1">KF252737</td>
<td rowspan="1" colspan="1">KF252259</td>
<td rowspan="1" colspan="1">KF251757</td>
<td rowspan="1" colspan="1">KF251254</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sta. duoseptata</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135093&link_type=cbs">CBS 135093</ext-link>
; S618</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253205</td>
<td rowspan="1" colspan="1">KF252738</td>
<td rowspan="1" colspan="1">KF252260</td>
<td rowspan="1" colspan="1">KF251758</td>
<td rowspan="1" colspan="1">KF251255</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>“Sta.” foliicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=110111&link_type=cbs">CBS 110111</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phalaris arundinacea</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">N. O’Neil</td>
<td rowspan="1" colspan="1">KF253206</td>
<td rowspan="1" colspan="1">KF252739</td>
<td rowspan="1" colspan="1">KF252261</td>
<td rowspan="1" colspan="1">KF251759</td>
<td rowspan="1" colspan="1">KF251256</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sta. paludosa</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135088&link_type=cbs">CBS 135088</ext-link>
; S601</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253207</td>
<td rowspan="1" colspan="1">KF252740</td>
<td rowspan="1" colspan="1">KF252262</td>
<td rowspan="1" colspan="1">KF251760</td>
<td rowspan="1" colspan="1">KF251257</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sta. perfecta</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135099&link_type=cbs">CBS 135099</ext-link>
; S656</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253208</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252263</td>
<td rowspan="1" colspan="1">KF251761</td>
<td rowspan="1" colspan="1">KF251258</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sta. pseudocaricis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135132&link_type=cbs">CBS 135132</ext-link>
; S610</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">A. Gardiennet</td>
<td rowspan="1" colspan="1">KF253210</td>
<td rowspan="1" colspan="1">KF252742</td>
<td rowspan="1" colspan="1">KF252265</td>
<td rowspan="1" colspan="1">KF251763</td>
<td rowspan="1" colspan="1">KF251260</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135414&link_type=cbs">CBS 135414</ext-link>
; S609</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">A. Gardiennet</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF302383</td>
<td rowspan="1" colspan="1">KF302395</td>
<td rowspan="1" colspan="1">KF302407</td>
<td rowspan="1" colspan="1">KF302401</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sta. pseudovitensis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135094&link_type=cbs">CBS 135094</ext-link>
; S620</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253211</td>
<td rowspan="1" colspan="1">KF252743</td>
<td rowspan="1" colspan="1">KF252266</td>
<td rowspan="1" colspan="1">KF251764</td>
<td rowspan="1" colspan="1">KF251261</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">S602</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253212</td>
<td rowspan="1" colspan="1">KF252744</td>
<td rowspan="1" colspan="1">KF252267</td>
<td rowspan="1" colspan="1">KF251765</td>
<td rowspan="1" colspan="1">KF251262</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Stagonospora</italic>
sp.</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135096&link_type=cbs">CBS 135096</ext-link>
; 652</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">France</td>
<td rowspan="1" colspan="1">A. Gardiennet</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252268</td>
<td rowspan="1" colspan="1">KF251766</td>
<td rowspan="1" colspan="1">KF251263</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Sta. uniseptata</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135090&link_type=cbs">CBS 135090</ext-link>
; S611</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252745</td>
<td rowspan="1" colspan="1">KF252269</td>
<td rowspan="1" colspan="1">KF251767</td>
<td rowspan="1" colspan="1">KF251264</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 22150; S608</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253214</td>
<td rowspan="1" colspan="1">KF252747</td>
<td rowspan="1" colspan="1">KF252271</td>
<td rowspan="1" colspan="1">KF251769</td>
<td rowspan="1" colspan="1">KF251266</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 22151; S607</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253213</td>
<td rowspan="1" colspan="1">KF252746</td>
<td rowspan="1" colspan="1">KF252270</td>
<td rowspan="1" colspan="1">KF251768</td>
<td rowspan="1" colspan="1">KF251265</td>
</tr>
<tr>
<td rowspan="1" colspan="1">stagonospora-like sp.</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=516.74&link_type=cbs">CBS 516.74</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Triticum aestivum</italic>
</td>
<td rowspan="1" colspan="1">Brazil</td>
<td rowspan="1" colspan="1">Y.R. Mehta</td>
<td rowspan="1" colspan="1">KF253215</td>
<td rowspan="1" colspan="1">KF252748</td>
<td rowspan="1" colspan="1">KF252272</td>
<td rowspan="1" colspan="1">KF251770</td>
<td rowspan="1" colspan="1">KF251267</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135482&link_type=cbs">CBS 135482</ext-link>
; CPC 22155; S526</td>
<td rowspan="1" colspan="1">
<italic>Poa</italic>
sp.</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253216</td>
<td rowspan="1" colspan="1">KF252749</td>
<td rowspan="1" colspan="1">KF252273</td>
<td rowspan="1" colspan="1">KF251771</td>
<td rowspan="1" colspan="1">KF251268</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135483&link_type=cbs">CBS 135483</ext-link>
; CPC 22157; S617</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253217</td>
<td rowspan="1" colspan="1">KF252750</td>
<td rowspan="1" colspan="1">KF252274</td>
<td rowspan="1" colspan="1">KF251772</td>
<td rowspan="1" colspan="1">KF251269</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">S619</td>
<td rowspan="1" colspan="1">
<italic>Carex acutiformis</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">W. Quaedvlieg</td>
<td rowspan="1" colspan="1">KF253218</td>
<td rowspan="1" colspan="1">KF252751</td>
<td rowspan="1" colspan="1">KF252275</td>
<td rowspan="1" colspan="1">KF251773</td>
<td rowspan="1" colspan="1">KF251270</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Stromatoseptoria castaneicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102322&link_type=cbs">CBS 102322</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Castanea sativa</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253219</td>
<td rowspan="1" colspan="1">KF252752</td>
<td rowspan="1" colspan="1">KF252276</td>
<td rowspan="1" colspan="1">KF251774</td>
<td rowspan="1" colspan="1">KF251271</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102377&link_type=cbs">CBS 102377</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Castanea sativa</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">G.J.M. Verkley</td>
<td rowspan="1" colspan="1">KF253220</td>
<td rowspan="1" colspan="1">KF252753</td>
<td rowspan="1" colspan="1">KF252277</td>
<td rowspan="1" colspan="1">KF251775</td>
<td rowspan="1" colspan="1">KF251272</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Teratosphaeria juvenalis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111149&link_type=cbs">CBS 111149</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus cladocalyx</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253221</td>
<td rowspan="1" colspan="1">KF252754</td>
<td rowspan="1" colspan="1">KF252278</td>
<td rowspan="1" colspan="1">KF251776</td>
<td rowspan="1" colspan="1">KF251273</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ter. molleriana</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111164&link_type=cbs">CBS 111164</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus globulus</italic>
</td>
<td rowspan="1" colspan="1">Portugal</td>
<td rowspan="1" colspan="1">M.J. Wingfield</td>
<td rowspan="1" colspan="1">KF253222</td>
<td rowspan="1" colspan="1">KF252755</td>
<td rowspan="1" colspan="1">KF252279</td>
<td rowspan="1" colspan="1">KF251777</td>
<td rowspan="1" colspan="1">KF251274</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ter. parva</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=119901&link_type=cbs">CBS 119901</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus globulus</italic>
</td>
<td rowspan="1" colspan="1">Ethiopia</td>
<td rowspan="1" colspan="1">A. Gezahgne</td>
<td rowspan="1" colspan="1">KF253223</td>
<td rowspan="1" colspan="1">KF252756</td>
<td rowspan="1" colspan="1">KF252280</td>
<td rowspan="1" colspan="1">KF251778</td>
<td rowspan="1" colspan="1">KF251275</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ter. pseudoeucalypti</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=124577&link_type=cbs">CBS 124577</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus grandis</italic>
×
<italic>E. camaldulensis</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">V. Andjic</td>
<td rowspan="1" colspan="1">KF253224</td>
<td rowspan="1" colspan="1">KF252757</td>
<td rowspan="1" colspan="1">KF252281</td>
<td rowspan="1" colspan="1">KF251779</td>
<td rowspan="1" colspan="1">KF251276</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ter. suberosa</italic>
</td>
<td rowspan="1" colspan="1">CPC 13106</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus dunnii</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">A.J. Carnegie</td>
<td rowspan="1" colspan="1">KF253183</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252232</td>
<td rowspan="1" colspan="1">KF251730</td>
<td rowspan="1" colspan="1">KF251227</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Ter. toledana</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=113313&link_type=cbs">CBS 113313</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus</italic>
sp.</td>
<td rowspan="1" colspan="1">Spain</td>
<td rowspan="1" colspan="1">P.W. Crous & G. Bills</td>
<td rowspan="1" colspan="1">KF253225</td>
<td rowspan="1" colspan="1">KF252758</td>
<td rowspan="1" colspan="1">KF252282</td>
<td rowspan="1" colspan="1">KF251780</td>
<td rowspan="1" colspan="1">KF251277</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Vrystaatia aloeicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135107&link_type=cbs">CBS 135107</ext-link>
; CPC 20617</td>
<td rowspan="1" colspan="1">
<italic>Aloe maculata</italic>
</td>
<td rowspan="1" colspan="1">South Africa</td>
<td rowspan="1" colspan="1">P.W. Crous & W.J. Swart</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">KF252759</td>
<td rowspan="1" colspan="1">KF252283</td>
<td rowspan="1" colspan="1">KF251781</td>
<td rowspan="1" colspan="1">KF251278</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Xenobotryosphaeria calamagrostidis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=303.71&link_type=cbs">CBS 303.71</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Calamagrostis</italic>
sp.</td>
<td rowspan="1" colspan="1">Italy</td>
<td rowspan="1" colspan="1">G.A. Hedjaroude</td>
<td rowspan="1" colspan="1">KF253226</td>
<td rowspan="1" colspan="1">KF252760</td>
<td rowspan="1" colspan="1">KF252284</td>
<td rowspan="1" colspan="1">KF251782</td>
<td rowspan="1" colspan="1">KF251279</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Xenoseptoria neosaccardoi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=120.43&link_type=cbs">CBS 120.43</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Cyclamen persicum</italic>
</td>
<td rowspan="1" colspan="1">Netherlands</td>
<td rowspan="1" colspan="1">Roodenburg</td>
<td rowspan="1" colspan="1">KF253227</td>
<td rowspan="1" colspan="1">KF252761</td>
<td rowspan="1" colspan="1">KF252285</td>
<td rowspan="1" colspan="1">KF251783</td>
<td rowspan="1" colspan="1">KF251280</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128665&link_type=cbs">CBS 128665</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lysimachia vulgaris</italic>
var.
<italic>davurica</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253228</td>
<td rowspan="1" colspan="1">KF252762</td>
<td rowspan="1" colspan="1">KF252286</td>
<td rowspan="1" colspan="1">KF251784</td>
<td rowspan="1" colspan="1">KF251281</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zasmidium anthuriicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=118742&link_type=cbs">CBS 118742</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Anthurium</italic>
sp.</td>
<td rowspan="1" colspan="1">Thailand</td>
<td rowspan="1" colspan="1">C.F. Hill</td>
<td rowspan="1" colspan="1">KF253229</td>
<td rowspan="1" colspan="1">KF252763</td>
<td rowspan="1" colspan="1">KF252287</td>
<td rowspan="1" colspan="1">KF251785</td>
<td rowspan="1" colspan="1">FJ839626</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zas. citri</italic>
</td>
<td rowspan="1" colspan="1">CPC 13467</td>
<td rowspan="1" colspan="1">
<italic>Eucalyptus</italic>
sp.</td>
<td rowspan="1" colspan="1">Thailand</td>
<td rowspan="1" colspan="1">W. Himaman</td>
<td rowspan="1" colspan="1">KF253182</td>
<td rowspan="1" colspan="1">KF252714</td>
<td rowspan="1" colspan="1">KF252231</td>
<td rowspan="1" colspan="1">KF251729</td>
<td rowspan="1" colspan="1">KF251226</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zas. lonicericola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=125008&link_type=cbs">CBS 125008</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Lonicera japonica</italic>
</td>
<td rowspan="1" colspan="1">South Korea</td>
<td rowspan="1" colspan="1">H.D. Shin</td>
<td rowspan="1" colspan="1">KF253231</td>
<td rowspan="1" colspan="1">KF252765</td>
<td rowspan="1" colspan="1">KF252289</td>
<td rowspan="1" colspan="1">KF251787</td>
<td rowspan="1" colspan="1">KF251283</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zas. nocoxi</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=125009&link_type=cbs">CBS 125009</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Twig debris</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">P.W. Crous</td>
<td rowspan="1" colspan="1">KF253232</td>
<td rowspan="1" colspan="1">KF252766</td>
<td rowspan="1" colspan="1">KF252290</td>
<td rowspan="1" colspan="1">KF251788</td>
<td rowspan="1" colspan="1">KF251284</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zas. scaevolicola</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=127009&link_type=cbs">CBS 127009</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Scaevola taccada</italic>
</td>
<td rowspan="1" colspan="1">Australia</td>
<td rowspan="1" colspan="1">R.G. Shivas & P.W Crous</td>
<td rowspan="1" colspan="1">KF253233</td>
<td rowspan="1" colspan="1">KF252767</td>
<td rowspan="1" colspan="1">KF252291</td>
<td rowspan="1" colspan="1">KF251789</td>
<td rowspan="1" colspan="1">KF251285</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zymoseptoria brevis</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128853&link_type=cbs">CBS 128853</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Phalaris minor</italic>
</td>
<td rowspan="1" colspan="1">Iran</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">JQ739777</td>
<td rowspan="1" colspan="1">JF700968</td>
<td rowspan="1" colspan="1">JF700799</td>
<td rowspan="1" colspan="1">JQ739833</td>
<td rowspan="1" colspan="1">JF700867</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 18109</td>
<td rowspan="1" colspan="1">
<italic>Phalaris paradoxa</italic>
</td>
<td rowspan="1" colspan="1">Iran</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">JQ739779</td>
<td rowspan="1" colspan="1">JF700970</td>
<td rowspan="1" colspan="1">JF700801</td>
<td rowspan="1" colspan="1">JQ739835</td>
<td rowspan="1" colspan="1">JF700869</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">CPC 18112</td>
<td rowspan="1" colspan="1">
<italic>Phalaris paradoxa</italic>
</td>
<td rowspan="1" colspan="1">Iran</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">JQ739782</td>
<td rowspan="1" colspan="1">JF700973</td>
<td rowspan="1" colspan="1">JF700804</td>
<td rowspan="1" colspan="1">JQ739838</td>
<td rowspan="1" colspan="1">JF700872</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zym. halophila</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128854&link_type=cbs">CBS 128854</ext-link>
; CPC 18105</td>
<td rowspan="1" colspan="1">
<italic>Hordeum glaucum</italic>
</td>
<td rowspan="1" colspan="1">Iran</td>
<td rowspan="1" colspan="1">M. Razavi</td>
<td rowspan="1" colspan="1">KF253592</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">JF700808</td>
<td rowspan="1" colspan="1">KF252150</td>
<td rowspan="1" colspan="1">KF251645</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zym. passerinii</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=120384&link_type=cbs">CBS 120384</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Hordeum vulgare</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">S. Ware</td>
<td rowspan="1" colspan="1">JQ739788</td>
<td rowspan="1" colspan="1">JF700878</td>
<td rowspan="1" colspan="1">JF700979</td>
<td rowspan="1" colspan="1">JQ739844</td>
<td rowspan="1" colspan="1">JF700810</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=120385&link_type=cbs">CBS 120385</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Hordeum vulgare</italic>
</td>
<td rowspan="1" colspan="1">USA</td>
<td rowspan="1" colspan="1">S. Ware</td>
<td rowspan="1" colspan="1">JQ739789</td>
<td rowspan="1" colspan="1">JF700980</td>
<td rowspan="1" colspan="1">JF700811</td>
<td rowspan="1" colspan="1">JQ739845</td>
<td rowspan="1" colspan="1">JF700879</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zym. pseudotritici</italic>
</td>
<td rowspan="1" colspan="1">
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=130976&link_type=cbs">CBS 130976</ext-link>
</td>
<td rowspan="1" colspan="1">
<italic>Dactylis glomerata</italic>
</td>
<td rowspan="1" colspan="1">Iran</td>
<td rowspan="1" colspan="1">M. Javan-Nikkhah</td>
<td rowspan="1" colspan="1">JQ739772</td>
<td rowspan="1" colspan="1">JN982484</td>
<td rowspan="1" colspan="1">JN982482</td>
<td rowspan="1" colspan="1">JQ739828</td>
<td rowspan="1" colspan="1">JN982480</td>
</tr>
<tr>
<td rowspan="1" colspan="1">
<italic>Zym. tritici</italic>
</td>
<td rowspan="1" colspan="1">CPC 18117</td>
<td rowspan="1" colspan="1">
<italic>Avena</italic>
sp.</td>
<td rowspan="1" colspan="1">Iran</td>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">JQ739801</td>
<td rowspan="1" colspan="1">JF700986</td>
<td rowspan="1" colspan="1">JF700817</td>
<td rowspan="1" colspan="1">JQ739857</td>
<td rowspan="1" colspan="1">JF700885</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TFN1">
<label>
<sup>1</sup>
</label>
<p>CBS: CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands; CPC: Culture collection of Pedro Crous, housed at CBS; IMI: International Mycological Institute, CABI-Bioscience, Egham, Bakeham Lane, U.K.; MP: Working collection of Sandra Videira; S: Working collection of William Quaedvlieg.</p>
</fn>
<fn id="TFN2">
<label>
<sup>2</sup>
</label>
<p>Btub: β-tubulin; EF-1α: Translation elongation factor 1-alpha; ITS: internal transcribed spacers and intervening 5.8S nrDNA; LSU: 28S large subunit of the nrRNA gene; RPB2: RNA polymerase II second largest subunit.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="T2" position="float">
<label>Table 2.</label>
<caption>
<p>Primer combinations used during this study for generic amplification and sequencing.</p>
</caption>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
</colgroup>
<thead>
<tr>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>locus</bold>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Primer</bold>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Primer sequence 5’ to 3’</bold>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Annealing</bold>
<break></break>
<bold>temperature (°C)</bold>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Orientation</bold>
</th>
<th align="left" valign="top" rowspan="1" colspan="1">
<bold>Reference</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="1" colspan="1">Translation elongation factor-1α</td>
<td rowspan="1" colspan="1">EF1-728F</td>
<td rowspan="1" colspan="1">CATCGAGAAGTTCGAGAAGG</td>
<td rowspan="1" colspan="1">52</td>
<td rowspan="1" colspan="1">Forward</td>
<td rowspan="1" colspan="1">Carbone & Kohn (
<xref ref-type="bibr" rid="R13">1999</xref>
)</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">EF-2</td>
<td rowspan="1" colspan="1">GGARGTACCAGTSATCATGTT</td>
<td rowspan="1" colspan="1">52</td>
<td rowspan="1" colspan="1">Reverse</td>
<td rowspan="1" colspan="1">O’Donnell
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R82">1998</xref>
)</td>
</tr>
<tr>
<td rowspan="1" colspan="1">β-tubulin</td>
<td rowspan="1" colspan="1">T1</td>
<td rowspan="1" colspan="1">AACATGCGTGAGATTGTAAGT</td>
<td rowspan="1" colspan="1">52</td>
<td rowspan="1" colspan="1">Forward</td>
<td rowspan="1" colspan="1">O’Donnell & Cigelnik (1997)</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">β-Sandy-R</td>
<td rowspan="1" colspan="1">GCRCGNGGVACRTACTTGTT</td>
<td rowspan="1" colspan="1">52</td>
<td rowspan="1" colspan="1">Reverse</td>
<td rowspan="1" colspan="1">Stukenbrock
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R102">2012</xref>
)</td>
</tr>
<tr>
<td rowspan="1" colspan="1">RNA polymerase II second largest subunit</td>
<td rowspan="1" colspan="1">fRPB2-5F</td>
<td rowspan="1" colspan="1">GAYGAYMGWGATCAYTTYGG</td>
<td rowspan="1" colspan="1">49</td>
<td rowspan="1" colspan="1">Forward</td>
<td rowspan="1" colspan="1">Liu
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R72">1999</xref>
)</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">fRPB2-414R</td>
<td rowspan="1" colspan="1">ACMANNCCCCARTGNGWRTTRTG</td>
<td rowspan="1" colspan="1">49</td>
<td rowspan="1" colspan="1">Reverse</td>
<td rowspan="1" colspan="1">Quaedvlieg
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R89">2011</xref>
)</td>
</tr>
<tr>
<td rowspan="1" colspan="1">LSU</td>
<td rowspan="1" colspan="1">LSU1Fd</td>
<td rowspan="1" colspan="1">GRATCAGGTAGGRATACCCG</td>
<td rowspan="1" colspan="1">52</td>
<td rowspan="1" colspan="1">Forward</td>
<td rowspan="1" colspan="1">Crous
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R25">2009a</xref>
)</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">LR5</td>
<td rowspan="1" colspan="1">TCCTGAGGGAAACTTCG</td>
<td rowspan="1" colspan="1">52</td>
<td rowspan="1" colspan="1">Reverse</td>
<td rowspan="1" colspan="1">Vilgalys & Hester (
<xref ref-type="bibr" rid="R118">1990</xref>
)</td>
</tr>
<tr>
<td rowspan="1" colspan="1">ITS</td>
<td rowspan="1" colspan="1">ITS5</td>
<td rowspan="1" colspan="1">GGAAGTAAAAGTCGTAACAAGG</td>
<td rowspan="1" colspan="1">52</td>
<td rowspan="1" colspan="1">Forward</td>
<td rowspan="1" colspan="1">White
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R121">1990</xref>
)</td>
</tr>
<tr>
<td rowspan="1" colspan="1"></td>
<td rowspan="1" colspan="1">ITS4</td>
<td rowspan="1" colspan="1">TCCTCCGCTTATTGATATGC</td>
<td rowspan="1" colspan="1">52</td>
<td rowspan="1" colspan="1">Reverse</td>
<td rowspan="1" colspan="1">White
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R121">1990</xref>
)</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T3" position="float">
<label>Table 3.</label>
<caption>
<p>Amplification success, phylogenetic data and the substitution models used in the phylogenetic analysis, per locus.</p>
</caption>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
<col align="left" valign="middle" span="1"></col>
</colgroup>
<thead>
<tr>
<th align="left" rowspan="1" colspan="1">
<bold>Locus</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>RPB2</bold>
</th>
<th align="left" rowspan="1" colspan="1">
<bold>LSU</bold>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="1" colspan="1">Amplification succes (%)</td>
<td rowspan="1" colspan="1">99.20 %</td>
<td rowspan="1" colspan="1">100 %</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Number of characters</td>
<td rowspan="1" colspan="1">327</td>
<td rowspan="1" colspan="1">792</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Unique site patterns</td>
<td rowspan="1" colspan="1">197</td>
<td rowspan="1" colspan="1">216</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">Substitution model used</td>
<td rowspan="1" colspan="1">GTR-I-gamma
<hr></hr>
</td>
<td rowspan="1" colspan="1">GTR-I-gamma
<hr></hr>
</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Number of generations (1000×)</td>
<td colspan="2" align="center" rowspan="1">2575</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Total number of trees (n)</td>
<td colspan="2" align="center" rowspan="1">5152</td>
</tr>
<tr>
<td rowspan="1" colspan="1">Sampled trees (n)</td>
<td colspan="2" align="center" rowspan="1">3864</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="S13">
<title>
<italic>Septoria</italic>
and septoria-like genera</title>
<p id="P24">In addition to
<italic>Septoria s. str.</italic>
, numerous septoria-like genera (pycnidial/acervular/stromatic conidioma with filiform conidia) have since been described. Although the majority of these have no ex-type culture available for DNA analysis, many have type material deposited in herbaria, which were available for morphological examination. A summary of these genera is provided below.</p>
</sec>
<sec id="S14">
<title>Pycnidial forms</title>
<p id="P25">
<bold>
<italic>Cytostagonospora</italic>
</bold>
Bubák, Ann. Mycol. 14: 150. 1916.
<xref ref-type="fig" rid="F3">Fig. 3</xref>
.</p>
<fig id="F3" position="float">
<label>Fig. 3.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Cytostagonospora photiniicola</italic>
(redrawn from
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig3"></graphic>
</fig>
<p id="P26">
<italic>Mycelium</italic>
immersed, dark brown, branched, septate.
<italic>Conidiomata</italic>
pycnidial, amphigenous, separate, globose, dark brown to black, immersed, unilocular, thick-walled, clypeate; walls of dark brown, thick-walled
<italic>textura angularis</italic>
to
<italic>textura globulosa</italic>
, becoming hyaline towards the conidiogenous region, extending in the upper part to become a circular clypeus of similar thickness to the wall.
<italic>Ostiole</italic>
central, circular, papillate to shortly rostrate, depressed, situated immersed within the clypeus.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
holoblastic, determinate, discrete, lageniform, hyaline, smooth, formed from the inner cells of the pycnidial wall.
<italic>Conidia</italic>
hyaline, 0-2-euseptate, not constricted at septa, base truncate, apex obtuse, thin-walled, eguttulate, smooth, filiform, often curved (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P27">
<italic>Type species</italic>
:
<italic>C. photiniicola</italic>
Bubák, Ann. Mycol. 14(3-4): 150. 1916.</p>
<p id="P28">
<italic>Notes</italic>
: Von Arx (
<xref ref-type="bibr" rid="R2">1983</xref>
) and Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
) disagreed about the link of
<italic>Cytostagonospora</italic>
to
<italic>Septoria</italic>
. Von Arx treated it as a synonym of
<italic>Septoria,</italic>
while Sutton retained it as a separate genus.</p>
<p id="P29">
<bold>
<italic>Dearnessia</italic>
</bold>
Bubák, Hedwigia 58: 25. 1916.</p>
<p id="P30">
<italic>Mycelium</italic>
hyaline to brown, branched, septate.
<italic>Conidiomata</italic>
pycnidial, amphigenous, separate, globose, immersed, brown; wall of thin-walled
<italic>textura angularis. Ostiole</italic>
central, circular, papillate.
<italic>Setae</italic>
ostiolar, approximately straight, unbranched, tapered towards apex, dark brown, smooth, thin-walled, septate.
<italic>Conidiogenous cells</italic>
holoblastic, determinate, discrete, doliiform to ampulliform, hyaline, smooth and formed from the inner layer of the pycnidial wall.
<italic>Conidia</italic>
cylindrical to irregular, hyaline, 1-multi-transversely euseptate, rarely with 1-2 longitudinal eusepta, continuous or constricted, often tapered at the apex, base truncate, thin-walled, smooth, guttulate or not (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P31">
<italic>Type species</italic>
:
<italic>D. apocyni</italic>
Bubák, Hedwigia 58: 25. 1916.</p>
<p id="P32">
<bold>
<italic>Dearnessia apocyni</italic>
</bold>
Bubák, Hedwigia 58: 25. 1916. Figs
<xref ref-type="fig" rid="F4">4</xref>
,
<xref ref-type="fig" rid="F5">5</xref>
.</p>
<fig id="F4" position="float">
<label>Fig. 4.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Dearnessia apocyni</italic>
(F43227). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig4"></graphic>
</fig>
<fig id="F5" position="float">
<label>Fig. 5.</label>
<caption>
<p>
<italic>Dearnessia apocyni</italic>
(F43227). A. Leaf spot. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig5"></graphic>
</fig>
<p id="P33">
<italic>Leaf spots</italic>
amphigenous, irregular, feathery to angular, dark brown, 3-6 mm diam, surrounded by a wide chlorotic zone up to 3 mm diam.
<italic>Conidiomata</italic>
epiphyllous, pycnidial, erumpent, up to 150 μm diam, with central ostiole; wall of 3-6 layers of brown
<italic>textura angularis. Conidiogenous cells</italic>
doliiform, globose to subcylindrical, hyaline, smooth, thin-walled, mode of proliferation obscure, 5-10 × 4-6 μm.
<italic>Conidia</italic>
hyaline, smooth, subcylindrical to obclavate, apex obtuse, base truncate to subobtuse, straight to irregular (lateral swellings?), 1-4-septate, 16-33 × 5-8 μm.</p>
<p id="P34">
<italic>Specimen examined</italic>
:
<bold>Canada</bold>
, Ontario, London, on leaves of
<italic>Apocynum androsaemifolium</italic>
(
<italic>Apocynaceae</italic>
), 11 Aug. 1910, J. Dearness,
<bold>holotype</bold>
F43227.</p>
<p id="P35">
<italic>Notes</italic>
: Because the specimen is in poor condition, no definite conclusion could be reached about its potential relationships. However,
<italic>D. apocyni</italic>
does appear septoria-like in general morphology.</p>
<p id="P36">
<bold>
<italic>Jahniella</italic>
</bold>
Petr., Ann. Mycol. 18: 123. 1921. [1920]. Figs
<xref ref-type="fig" rid="F6">6</xref>
,
<xref ref-type="fig" rid="F7">7</xref>
.</p>
<fig id="F6" position="float">
<label>Fig. 6.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Jahniella bohemica</italic>
(redrawn from
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig6"></graphic>
</fig>
<fig id="F7" position="float">
<label>Fig. 7.</label>
<caption>
<p>
<italic>Jahniella bohemica</italic>
[K(M) 180917]. A. Vertical section through conidioma. B. Ostiolar region with loose cells. C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig7"></graphic>
</fig>
<p id="P37">
<italic>Mycelium</italic>
branched, immersed, septate, brown.
<italic>Conidiomata</italic>
pycnidial, superficial on epidermis, immersed, separate, globose, papillate, dark brown, thick-walled, sclerenchymatic; wall consisting of an outer layer of dark brown, thick-walled
<italic>textura angularis</italic>
, a middle layer of 8 cells thick, of hyaline to pale brown, thick-walled cells, and an inner layer of thin-walled, hyaline, irregular cells.
<italic>Ostiole</italic>
single, circular, with a distinct channel and hyaline periphysoid cells.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
holoblastic, determinate, discrete, hyaline, ampulliform, lining the wall of the pycnidium.
<italic>Conidia</italic>
straight or slightly curved, hyaline, thin-walled, smooth, 3-4-euseptate, eguttulate, truncate at the base, slightly tapered to the apex (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P38">
<italic>Type species</italic>
:
<italic>J. bohemica</italic>
Petr., Ann. Mycol. 18(4-6): 123. 1921. [1920]</p>
<p id="P39">
<italic>Specimen examined</italic>
:
<bold>Czech Republic</bold>
, Bohemia, on stems of
<italic>Scrophularia nodosa</italic>
(
<italic>Scrophulariaceae</italic>
), 18 Mar. 1916, J. Jahn,
<bold>holotype</bold>
K(M) 180917, slides ex BPI.</p>
<p id="P40">
<italic>Note</italic>
: The specimen correlates closely with the description provided by Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
), except that the conidiomata are superficial, not immersed in the epidermis.</p>
<p id="P41">
<bold>
<italic>Megaloseptoria</italic>
</bold>
Naumov, Morbi Plantarum 14: 144. 1925. Figs
<xref ref-type="fig" rid="F8">8</xref>
,
<xref ref-type="fig" rid="F9">9</xref>
.</p>
<fig id="F8" position="float">
<label>Fig. 8.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Megaloseptoria mirabilis</italic>
(MA-Fungi 6978-1). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig8"></graphic>
</fig>
<fig id="F9" position="float">
<label>Fig. 9.</label>
<caption>
<p>
<italic>Megaloseptoria mirabilis</italic>
(MA-Fungi 6978-1). A. Conidiomata on host tissue. B. Conidiogenous cells. C. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig9"></graphic>
</fig>
<p id="P42">
<italic>Mycelium</italic>
immersed, branched, septate, brown.
<italic>Conidiomata</italic>
pycnidial, separate, globose, slightly papillate, dark brown to black, superficial, sessile, often aggregated in groups, unilocular, thick-walled; wall of several cell layers of brown
<italic>textura angularis</italic>
, more darkly pigmented on the outside.
<italic>Ostiole</italic>
single, circular.
<italic>Conidiophores</italic>
hyaline, branched, septate (mainly at the base), smooth, straight or irregular, formed from the inner cells of the pycnidial wall.
<italic>Conidiogenous cells</italic>
enteroblastic, determinate, discrete or integrated, doliiform, ampulliform or irregularly cylindrical, hyaline, smooth, collarette evident, channel wide, periclinal thickening present.
<italic>Conidia</italic>
hyaline to pale brown with several transverse eusepta, continuous, tapered near the obtuse apex and truncate base, thin-walled, smooth, cylindrical, straight or slightly curved, often with 2 guttules in each cell (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P43">
<italic>Type species</italic>
:
<italic>M. mirabilis</italic>
Naumov, Morbi Plant. Script. Sect. Phytopath. Hort. Bot. Prince. USSR 14: 144. 1925.</p>
<p id="P44">
<bold>
<italic>Megaloseptoria mirabilis</italic>
</bold>
Naumov, Morbi Plantarum 14: 144. 1925.</p>
<p id="P45">
<italic>Conidiomata</italic>
aggregated in a black stroma at the ends of branchlets, globose, black, smooth, with central ostiole, up to 600 μm diam, papillate; wall of 3-8 layers of dark brown
<italic>textura angularis. Conidiogenous cells</italic>
lining the cavity, subcylindrical to ampulliform, hyaline, smooth, 7-15 × 4-8 μm; proliferating percurrently near apex.
<italic>Conidia</italic>
solitary, scolecosporous, variously curved, subcylindrical, tapering in upper third to obtuse apex, base truncate, 3-4 μm diam, transversely 30-40-septate, (170-)200-250 × (5-)6(-7) μm.</p>
<p id="P46">
<italic>Specimen examined</italic>
:
<bold>Switzerland</bold>
, Zürich, St. Schnach., on branchlets of
<italic>Pinus pungens</italic>
var.
<italic>glauba</italic>
(
<italic>Pinaceae</italic>
), 10 July 1951, E. Müller,
<bold>holotype</bold>
MA-Fungi 6978-1.</p>
<p id="P47">
<italic>Note</italic>
:
<italic>Megaloseptoria</italic>
differs from
<italic>Septoria</italic>
in that the conidiomata are aggregated in a black stroma, which is not the case in
<italic>Septoria s. str</italic>
.</p>
<p id="P48">
<bold>
<italic>Phaeoseptoria</italic>
</bold>
Speg., Revista Mus. La Plata 15(2): 39. 1908.</p>
<p id="P49">
<italic>Leaf spots</italic>
angular-subcircular, 0.5-3 mm diam, becoming confluent.
<italic>Conidiomata</italic>
pycnidial, epiphyllous, subepidermal, black, 60-90 μm diam.
<italic>Conidiogenesis cells</italic>
hyaline, smooth, holoblastic (?).
<italic>Conidia</italic>
filiform, obclavate, smooth, 1-3-euseptate, medium brown, 30 × 3 μm (
<xref ref-type="bibr" rid="R95">Saccardo & Trotter 1913</xref>
,
<xref ref-type="bibr" rid="R120">Walker
<italic>et al.</italic>
1992</xref>
,
<xref ref-type="bibr" rid="R21">Crous
<italic>et al.</italic>
1997</xref>
).</p>
<p id="P50">
<italic>Type species</italic>
:
<italic>P. papayae</italic>
Speg., Revista Mus. La Plata 15(2): 39. 1908.</p>
<p id="P51">
<italic>Notes</italic>
:
<italic>Phaeoseptoria papayae</italic>
was originally described from leaf spots on
<italic>Carica papaya</italic>
collected in the São Paulo Botanical Garden, Brazil. Presently there are numerous clades that contain isolates conforming to this morphology, and this matter can only be resolved once fresh material of
<italic>P. papayae</italic>
has been recollected to clarify its phylogeny (see below).</p>
<p id="P52">
<bold>
<italic>Pseudoseptoria</italic>
</bold>
Speg., Ann. Mus. Nac. B. Aires, Ser. 3 13: 388. 1910.</p>
<p id="P53">
<italic>Mycelium</italic>
immersed, branched, septate, pale brown.
<italic>Conidiomata</italic>
pycnidial, solitary or linearly aggregated, immersed, brown, globose, unilocular; walls thin, of pale brown
<italic>textura angularis. Ostiole</italic>
distinct, central, circular.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
discrete, determinate or indeterminate, hyaline, smooth, ampulliform with a prominent cylindrical papilla with several percurrent proliferations at the apex.
<italic>Conidia</italic>
falcate, fusoid, acutely rounded at each end, hyaline, aseptate, guttulate, smooth, thin-walled (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P54">
<italic>Type species</italic>
:
<italic>P. donacicola</italic>
Speg., Ann. Mus. Nac. B. Aires, Ser. 3 13: 388. 1910.</p>
<p id="P55">
<italic>Note</italic>
: Species of
<italic>Pseudoseptoria</italic>
are plant pathogenic to members of
<italic>Poaceae</italic>
.</p>
<p id="P56">
<bold>
<italic>Rhabdospora</italic>
</bold>
(Durieu & Mont. ex Sacc.) Sacc., Syll. Fung. (Abellini) 3: 578. 1884. nom. cons.</p>
<p id="P57">
<italic>Basionym</italic>
:
<italic>Septoria</italic>
sect.
<italic>Rhabdospora</italic>
Durieu & Mont., in Durieu, Expl. Sci. Alg. 1 (livr. 15): 592. 1849. [1846-1849].</p>
<p id="P58">
<italic>Type species</italic>
:
<italic>R. oleandri</italic>
Durieu & Mont., in Durieu, Expl. Sci. Alg. 1 (livr. 15): 593. 1849 [1846-1849].</p>
<p id="P59">
<italic>Notes</italic>
:
<italic>Rhabdospora</italic>
is a poorly defined genus, originally established to accommodate septoria-like species occurring on stems (
<xref ref-type="bibr" rid="R86">Priest 2006</xref>
). Of the 11 species treated by Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
), most are currently placed in
<italic>Septoria</italic>
. This genus is in need of revision pending the recollection of fresh material (on
<italic>Nerium oleander</italic>
from Algeria).</p>
<p id="P60">
<bold>
<italic>Sclerostagonospora</italic>
</bold>
Höhn., Hedwigia 59: 252. 1917.</p>
<p id="P61">
<italic>Conidiomata</italic>
pycnidial, immersed, separate, dark brown to black, globose, unilocular; walls thin, composed of thick-walled, dark brown
<italic>textura angularis</italic>
; ostiole single, circular, central, papillate.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
holoblastic, determinate, discrete, hyaline, smooth, ampulliform to irregular, formed from the inner cells of the pycnidial wall.
<italic>Conidia</italic>
subcylindrical, pale brown, thin-walled, minutely verruculose, 3-euseptate, sometimes slightly constricted at the septa (from
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P62">
<italic>Type species</italic>
:
<italic>S. heraclei</italic>
(Sacc.) Höhn., Hedwigia 59: 252. 1917.</p>
<p id="P63">
<italic>Note</italic>
:
<italic>Sclerostagonospora</italic>
differs from
<italic>Stagonospora</italic>
in having pigmented conidia.</p>
<p id="P64">
<bold>
<italic>Septoria</italic>
</bold>
(Sacc.) Sacc., Syll. Fung 3: 474. 1884. nom. cons. Figs
<xref ref-type="fig" rid="F10">10</xref>
,
<xref ref-type="fig" rid="F11">11</xref>
.</p>
<fig id="F10" position="float">
<label>Fig. 10.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Septoria cytisi</italic>
(BPI USO 378994). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig10"></graphic>
</fig>
<fig id="F11" position="float">
<label>Fig. 11.</label>
<caption>
<p>
<italic>Septoria cytisi</italic>
(BPI USO 378994). A. Leaf with symptoms. B. Close-up of leaf spot with conidiomata. C, D. Conidiogenous cells giving rise to conidia. E. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig11"></graphic>
</fig>
<list list-type="simple">
<list-item>
<p>=
<italic>Septaria</italic>
Fr., Novit. Fl. Svec. 5: 78. 1819. nom. rejic.</p>
</list-item>
</list>
<p id="P65">
<italic>Mycelium</italic>
slow-growing, pale brown, septate, immersed.
<italic>Conidiomata</italic>
pycnidial, immersed, separate or aggregated (but not confluent), globose, papillate (or not), brown, wall of thin, pale brown
<italic>textura angularis</italic>
, inner layer of flattened, hyaline
<italic>textura angularis</italic>
, frequently somewhat darker and more thick-walled around the ostiole.
<italic>Ostiole</italic>
single, circular, central.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
holoblastic, either determinate or indeterminate, proliferating sympodially and/or percurrently, hyaline, smooth, ampulliform, dolliform or lageniform to short cylindrical; scars unthickened.
<italic>Conidia</italic>
hyaline, multiseptate, filiform, smooth, continuous or constricted at septa. Sexual states are mycosphaerella-like.</p>
<p id="P66">
<italic>Type species</italic>
:
<italic>S. cytisi</italic>
Desm., Ann. Sci. Nat. Bot. 8: 24. 1847.</p>
<p id="P67">
<italic>Specimen examined</italic>
:
<bold>Slovakia</bold>
, Muehlthal near Bratislava (Pressburg), on leaves of
<italic>Laburnum anagyroides</italic>
(
<italic>Leguminosae</italic>
), 1884, J.A. Baeumler, BPI USO 378994.</p>
<p id="P68">
<italic>Note</italic>
: The ITS and LSU sequences of this specimen were published respectively under GenBank accession numbers JF700932 and JF700954.</p>
<p id="P69">
<bold>
<italic>Stagonospora</italic>
</bold>
(Sacc.) Sacc., Syll. Fung. (Abellini) 3: 445. 1884. nom. cons.</p>
<p id="P70">
<italic>Basionym</italic>
:
<italic>Hendersonia</italic>
subgen.
<italic>Stagonospora</italic>
Sacc., Michelia 2 (no. 6): 8. 1880.</p>
<p id="P71">
<italic>Conidiomata</italic>
pycnidial, immersed, unilocular, globose, separate, ostiolate; walls of dark brown, thick-walled
<italic>textura angularis</italic>
, and on the inside of hyaline, thin-walled, flattened cells.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
doliiform, hyaline, with several percurrent proliferations at the apex, formed from the inner cells of the pycnidial wall.
<italic>Conidia</italic>
hyaline, smooth to finely verruculose, 1-multiseptate, cylindrical or fusoid-ellipsoidal, straight or slightly curved, often guttulate, constricted or not at septa.</p>
<p id="P72">
<italic>Type species</italic>
:
<italic>S. paludosa</italic>
(Sacc. & Speg.) Sacc., Syll. Fung. (Abellini) 3: 453. 1884.</p>
<p id="P73">
<bold>
<italic>Stenocarpella</italic>
</bold>
Syd. & P. Syd., Ann. Mycol. 15(3-4): 258. 1917.
<xref ref-type="fig" rid="F12">Fig. 12</xref>
.</p>
<fig id="F12" position="float">
<label>Fig. 12.</label>
<caption>
<p>
<italic>Stenocarpella maydis</italic>
(top) and
<italic>S. macrospora</italic>
(bottom) (redrawn from
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig12"></graphic>
</fig>
<p id="P74">
<italic>Mycelium</italic>
immersed, brown, branched, septate.
<italic>Conidiomata</italic>
pycnidial, separate or sometimes confluent, globose or elongated, dark brown, subepidermal, unilocular, thick-walled; walls composed of dark brown, thick-walled
<italic>textura angularis</italic>
. Ostiole single, circular, papillate, protruding.
<italic>Conidiophores</italic>
usually absent.
<italic>Conidiogenous cells</italic>
cylindrical, hyaline, determinate, discrete, phialidic, with collarette and minute periclinal thickening, lining the inner layer of the pycnidial wall.
<italic>Conidia</italic>
subcylindrical, straight or curved, fusiform, apex obtuse, base tapered, truncate, thick-walled, smooth-walled, granular, pale to medium brown, 0-3-euseptate. Beta conidia hyaline, scolecosporous, curved (
<xref ref-type="bibr" rid="R27">Crous
<italic>et al.</italic>
2006</xref>
,
<xref ref-type="bibr" rid="R68">Lamprecht
<italic>et al.</italic>
2011</xref>
).</p>
<p id="P75">
<italic>Type species</italic>
:
<italic>S. zeae</italic>
Syd. & P. Syd., Ann. Mycol. 15(3-4): 258. 1917. [=
<italic>S. macrospora</italic>
(Earle) B. Sutton]</p>
<p id="P76">
<italic>Specimens examined</italic>
:
<bold>South Africa</bold>
, KwaZulu-Natal, Hlabisa, rain-damaged Bt
<italic>Zea mays</italic>
hybrid (
<italic>Poaceae</italic>
), 2003-04 season, J. Rheeder (
<bold>ex-epitype</bold>
,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=117560&link_type=cbs">CBS 117560</ext-link>
=MRC 8615, designated in
<xref ref-type="bibr" rid="R27">Crous
<italic>et al.</italic>
2006</xref>
); KwaZulu-Natal,
<italic>Zea mays</italic>
kernels, 2005, P. Caldwell, CPC 11863 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128560&link_type=cbs">CBS 128560</ext-link>
.</p>
<p id="P77">
<italic>Notes</italic>
:
<italic>Stenocarpella</italic>
presently contains two species,
<italic>S. macrospora</italic>
and
<italic>S. maydis</italic>
, both causing “Diplodia ear rot of maize”. These two taxa were previously assigned to
<italic>Diplodia</italic>
and
<italic>Macrodiplodia</italic>
, respectively (
<xref ref-type="bibr" rid="R84">Petrak & Sydow 1927</xref>
,
<xref ref-type="bibr" rid="R108">Sutton 1964</xref>
). Several years later, Sutton re-examining these taxa and placed them in their own genus,
<italic>Stenocarpella</italic>
(Sutton
<xref ref-type="bibr" rid="R109">1977</xref>
,
<xref ref-type="bibr" rid="R110">1980</xref>
). Recent phylogenetic studies confirmed that these taxa indeed cluster by themselves within the
<italic>Diaporthales</italic>
(
<xref ref-type="bibr" rid="R27">Crous
<italic>et al</italic>
. 2006</xref>
,
<xref ref-type="bibr" rid="R68">Lamprecht
<italic>et al.</italic>
2011</xref>
), supporting the decision of Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
).</p>
<p id="P78">
<bold>
<italic>Trichoseptoria</italic>
</bold>
Cavara, Atti Ist. Bot. Univ. Lab. Crittog. Pavia 2: 40. 1892.</p>
<p id="P79">
<italic>Type species</italic>
:
<italic>T. alpei</italic>
Cavara, Atti Ist. Bot. Univ. Lab. Crittog. Pavia 2: 40. 1892.</p>
<p id="P80">
<italic>Notes</italic>
: Not much is known about this septoria-like genus, except that it is distinguished from
<italic>Septoria</italic>
by having setae on its pycnidia with 1-2-septate, hyaline conidia. This genus is in further need of revision once fresh material has been recollected (
<italic>Citrus vulgaris</italic>
, Belgiojoso, Alps).</p>
<p id="P81">
<bold>
<italic>Zymoseptoria</italic>
</bold>
Quaedvlieg & Crous, Persoonia 26: 64. 2011.</p>
<p id="P82">
<italic>Conidiomata</italic>
pycnidial, semi-immersed to erumpent, dark brown to black, subglobose, with central ostiole; wall of 3-4 layers of brown
<italic>textura angularis. Conidiophores</italic>
hyaline and smooth, 1-2-septate, or reduced to conidiogenous cells, lining the inner cavity.
<italic>Conidiogenous cells</italic>
are tightly aggregated and ampulliform to doliiform or subcylindrical, phialidic with periclinal thickening, or with 2-3 inconspicuous, percurrent proliferations at the apex.
<italic>Conidia</italic>
(Type I) solitary, hyaline, smooth, guttulate, narrowly cylindrical to subulate, tapering towards acutely rounded apex, with bluntly rounded to truncate base, transversely euseptate; hila not thickened nor darkened. On OA and PDA media plates the aerial hyphae disarticulate into phragmospores (Type II conidia) that again give rise to Type I conidia via microcyclic conidiation; yeast-like growth and microcyclic conidiation (Type III conidia) common on agar media (
<xref ref-type="bibr" rid="R89">Quaedvlieg
<italic>et al</italic>
. 2011</xref>
).</p>
<p id="P83">
<italic>Type species</italic>
:
<italic>Z. tritici</italic>
(Desm.) Quaedvlieg & Crous, Persoonia 26: 67. 2011.</p>
<p id="P84">
<italic>Notes</italic>
:
<italic>Zymoseptoria</italic>
was split off from
<italic>Septoria s. str.</italic>
and redescribed by Quaedvlieg
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R89">2011</xref>
) based on LSU sequence data when said authors delimitated
<italic>Septoria s. str</italic>
. by sequencing the ITS and LSU sequences out of
<italic>S. cytisi</italic>
herbarium material. Phylogenetic analysis showed that
<italic>Zymoseptoria</italic>
species cluster within a distinct clade inside the
<italic>Mycosphaerellaceae</italic>
that is closely related to
<italic>Ramularia</italic>
, but located distant from
<italic>Septoria s. str</italic>
.</p>
</sec>
<sec id="S15">
<title>Acervular forms</title>
<p id="P85">
<bold>
<italic>Asteromidium</italic>
</bold>
Speg., Ann. Soc. cient. argent. 26(1): 66. 1888. Figs
<xref ref-type="fig" rid="F13">13</xref>
,
<xref ref-type="fig" rid="F14">14</xref>
.</p>
<fig id="F13" position="float">
<label>Fig. 13.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Asteromidium imperspicuum</italic>
(redrawn from
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig13"></graphic>
</fig>
<fig id="F14" position="float">
<label>Fig. 14.</label>
<caption>
<p>
<italic>Asteromidium imperspicuum</italic>
[K(M) 180228]. A. Conidiomata on host surface. B. Section through conidioma. C, D. Conidiogenous cells and conidia. Scale bars: B = 75 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig14"></graphic>
</fig>
<p id="P86">
<italic>Mycelium</italic>
immersed, branched, septate, hyaline.
<italic>Conidiomata</italic>
acervular, subcuticular, separate or confluent, pulvinate to doliiform, at the base, composed of hyaline to pale brown, thin-walled
<italic>textura angularis</italic>
which extends laterally, finally with separate cells dispersed in a mucilaginous matrix to form the overlying wall; cuticle discoloured and occasionally pseudoparenchymatous, walls adjacent to the upper epidermal wall also discoloured; dehiscence irregular.
<italic>Conidiogenous cells</italic>
holoblastic, discrete, indeterminate, ± cylindrical, hyaline, smooth, with 1-2 sympodial proliferations, scars unthickened, flat, formed from the basal and lateral walls.
<italic>Conidia</italic>
cylindrical to fusoid, gently tapered at each end, apex obtuse, base truncate, thin-walled, guttulate to granular, hyaline, 3-septate (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P87">
<italic>Type species</italic>
:
<italic>A. imperspicuum</italic>
Speg., Ann. Soc. cient. argent. 26(1): 66. 1888.</p>
<p id="P88">
<italic>Specimen examined</italic>
:
<bold>Paraguay</bold>
, on leaves of
<italic>Sapindaceae</italic>
, 1883,
<bold>isotype</bold>
K(M) 180228, ex B. Balansa Pl. du Paraguay No. 4085.</p>
<p id="P89">
<italic>Notes</italic>
: This genus has to be recollected (
<italic>Sapindaceae</italic>
, Paraguay) to allow for a molecular comparison to other existing genera in this complex. The morphology of the specimen examined correlates well with the description provided by Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
).</p>
<p id="P90">
<bold>
<italic>Ciferriella</italic>
</bold>
Petr., Ann. Mycol. 28(5/6): 409. 1930.</p>
<p id="P91">
<italic>Type species</italic>
:
<italic>C. domingensis</italic>
Petr. & Cif., Ann. Mycol. 28(5/6): 409. 1930.</p>
<list list-type="simple">
<list-item>
<p>=
<bold>
<italic>Pseudocercospora</italic>
</bold>
Speg., Anales Mus. Nac. Hist. Nat. B. Aires, Ser. 3, 20: 437. 1910.</p>
</list-item>
</list>
<p id="P92">
<bold>
<italic>Pseudocercospora domingensis</italic>
</bold>
(Petr. & Cif.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804401&link_type=mb">MB804401</ext-link>
. Figs
<xref ref-type="fig" rid="F15">15</xref>
,
<xref ref-type="fig" rid="F16">16</xref>
.</p>
<fig id="F15" position="float">
<label>Fig. 15.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Pseudocercospora domingensis</italic>
(NY No 01048475). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig15"></graphic>
</fig>
<fig id="F16" position="float">
<label>Fig. 16.</label>
<caption>
<p>
<italic>Pseudocercospora domingensis</italic>
(NY No 01048475). A. Leaf spot. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig16"></graphic>
</fig>
<p id="P93">
<italic>Basionym</italic>
:
<italic>Ciferriella domingensis</italic>
Petr. & Cif., Ann. Mycol. 28(5/6): 409. 1930.</p>
<p id="P94">
<italic>Leaf spots</italic>
amphigenous, subcircular, medium brown with dark purple margin, 1.5-6 mm diam. Sporulation hypophyllous, fasciculate to sporodochial, brown, arising from a brown stroma, up to 50 μm diam.
<italic>Conidiophores</italic>
medium brown, smooth, subcylindrical, 0-2-septate, straight to once geniculate, 15-20 × 3-5 μm.
<italic>Conidiogenous cells</italic>
terminal, brown, smooth to finely verruculose, ampulliform to subcylindrical, proliferating sympodially or percurrently, tapering to a truncate apex, 2 μm diam, 10-15 × 3-4 μm.
<italic>Conidia</italic>
brown, smooth, straight to slightly curved, obclavate, apex subobtuse, base obconically truncate, 0-3-septate, 35-60 × 3-4 μm.</p>
<p id="P95">
<italic>Specimen examined</italic>
:
<bold>Dominican Republic</bold>
, on
<italic>Vitex umbrosa</italic>
(
<italic>Lamiaceae</italic>
), 26 May 1929, coll. R. Ciferri, det. F. Petrak,
<bold>holotype</bold>
ex N.Y. Bot. Gard. No 01048475.</p>
<p id="P96">
<italic>Notes</italic>
: The dimensions of the conidia and conidiophores correlate with the observations of Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
). However, the conidiomata are sporodochial to fasciculate, and not acervular.
<italic>Ciferriella domingensis</italic>
is a typical
<italic>Pseudocercospora sensu</italic>
Crous
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R19">2013</xref>
). Based on the species presently known from
<italic>Vitex</italic>
(
<xref ref-type="bibr" rid="R17">Crous & Braun 2003</xref>
), it appears to represent a distinct taxon, for which a new combination in
<italic>Pseudocercospora</italic>
is proposed.</p>
<p id="P97">
<bold>
<italic>Colletogloeum</italic>
</bold>
Petr., Sydowia 7: 368. 1953.</p>
<p id="P98">
<italic>Mycelium</italic>
immersed, branched, septate, hyaline to pale brown.
<italic>Conidiomata</italic>
acervular, epidermal to subepidermal, separate, occasionally confluent, composed of hyaline to pale brown, thin-walled
<italic>textura angularis. Conidiophores</italic>
hyaline to pale brown, sparsely branched, septate, smooth, cylindrical or slightly irregular, formed from the upper cells of the acervulus.
<italic>Conidiogenous cells</italic>
integrated or discrete, indeterminate, cylindrical or doliiform, with several percurrent proliferations at apex.
<italic>Conidia</italic>
hyaline to pale brown, 0-multiseptate, straight, curved or irregular, truncate at the base, obtuse at the apex, usually thin-walled, smooth, guttulate or not.</p>
<p id="P99">
<italic>Type species</italic>
:
<italic>C. dalbergiae</italic>
(S. Ahmad) Petr., Sydowia 7: 369. 1953. [=
<italic>C. sissoo</italic>
(Syd.) B. Sutton, Mycol. Pap. 97: 14. 1964.]</p>
<p id="P100">
<italic>Notes</italic>
: The exact taxonomic position of
<italic>Colletogloeum</italic>
was unclear for a long time as it included many species that appear to represent asexual morphs of
<italic>Teratosphaeria.</italic>
Crous
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R25">2009a</xref>
,
<xref ref-type="bibr" rid="R28">b</xref>
,
<xref ref-type="bibr" rid="R29">c</xref>
) used ITS sequence data from a specimen representative of
<italic>C. sissoo</italic>
(IMI 119162) to demonstate that the type of
<italic>Colletogloeum</italic>
clustered near the
<italic>Pseudocercospora</italic>
complex within the
<italic>Mycosphaerellaceae</italic>
.</p>
<p id="P101">
<bold>
<italic>Cylindrosporium</italic>
</bold>
Grev., Scott. crypt. fl. (Edinburgh) 1: pl. 27. 1822.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Cylindrodochium</italic>
Bonord., Handb. Allgem. mykol. (Stuttgart): 132. 1851.</p>
</list-item>
</list>
<p id="P102">
<italic>Mycelium</italic>
immersed, branched, septate, hyaline.
<italic>Conidiomata</italic>
acervular, white, slimy, subcuticular, separate or confluent, formed of pale brown to hyaline, thin-walled
<italic>textura angularis</italic>
; dehiscence irregular.
<italic>Conidiophores</italic>
hyaline, parallel, branched only at the base, 1-2-septate, smooth, formed from the upper pseudoparenchyma.
<italic>Conidiogenous cells</italic>
enteroblastic, phialidic, integrated, cylindrical, hyaline, smooth.
<italic>Conidia</italic>
straight or slightly curved, aseptate, cylindrical, thin-walled, smooth, hyaline, eguttulate (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P103">
<italic>Type species</italic>
:
<italic>C. concentricum</italic>
Unger, Exanth. Pflanzen (Wien) 2: 9. 1833.</p>
<p id="P104">
<italic>Notes</italic>
: Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
), Von Arx (
<xref ref-type="bibr" rid="R2">1983</xref>
), Deighton (
<xref ref-type="bibr" rid="R36">1987</xref>
) and Braun (
<xref ref-type="bibr" rid="R9">1990</xref>
) could not agree on the taxonomic status of this genus, which is associated with light leaf spot of oil seed rape (sexual morph
<italic>Pyrenopeziza brassicae</italic>
). This genus is in need of revision, awaiting the recollection of fresh material of
<italic>C. concentricum</italic>
(on
<italic>Pulmonaria officinalis</italic>
, Germany).</p>
<p id="P105">
<bold>
<italic>Phloeospora</italic>
</bold>
Wallr., Fl. Crypt. Germ. (Norimbergae) 2: 176. 1833.</p>
<p id="P106">
<italic>Mycelium</italic>
immersed, septate, hyaline.
<italic>Conidiomata</italic>
acervular, subepidermal, circular, discrete or confluent, composed of hyaline to pale brown, thin-walled
<italic>textura angularis</italic>
; dehiscence irregular.
<italic>Conidiophores</italic>
reduced to conidiogenous cells or with one or two supporting cells, branched at base or not.
<italic>Conidiogenous cells</italic>
holoblastic, annellidic, occasionally also sympodial, discrete, indeterminate hyaline, smooth, cylindrical, with several apical inconspicuous annellations, formed from the upper cells of the acervuli.
<italic>Conidia</italic>
hyaline, septate, smooth, guttulate or not, cylindrical, curved, attenuated towards the apices, apex obtuse to subobtuse, base truncate, with minute marginal frill.</p>
<p id="P107">
<italic>Type species</italic>
:
<italic>P. ulmi</italic>
(Fr.) Wallr., Fl. Crypt. Germ. (Norimbergae) 2: 177. 1833.</p>
<p id="P108">
<italic>Notes</italic>
: Sexual morphs of
<italic>Phloeospora</italic>
have been linked to genera that resemble the concepts of
<italic>Mycosphaerella, Didymella</italic>
and
<italic>Sphaerulina</italic>
. Verkley & Priest (
<xref ref-type="bibr" rid="R113">2000</xref>
) already noted that this genus is heterogeneous and in need of revision. The phylogenetic analysis performed in this study confirmed that
<italic>Phloeospora</italic>
(based on
<italic>P. ulmi</italic>
) clusters close to, but separate from
<italic>Septoria s. str</italic>
. (
<xref ref-type="fig" rid="F1">Fig. 1</xref>
).</p>
<p id="P109">
<bold>
<italic>Phloeosporella</italic>
</bold>
Höhn., Ann. Mycol. 22: 201. 1924.
<xref ref-type="fig" rid="F17">Fig. 17</xref>
.</p>
<fig id="F17" position="float">
<label>Fig. 17.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Phloeosporella ceanothi</italic>
(redrawn from
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig17"></graphic>
</fig>
<p id="P110">
<italic>Mycelium</italic>
immersed, branched, septate, hyaline.
<italic>Conidiomata</italic>
acervular, subepidermal, ± circular, discrete, composed of hyaline to pale brown, thin-walled
<italic>textura angularis. Conidiogenous cells</italic>
holoblastic, sympodial, discrete, indeterminate, hyaline, smooth, lageniform to cylindrical, with 1-2 broad, flat unthickened apical scars, formed from the upper pseudoparenchyma.
<italic>Conidia</italic>
hyaline, 2-euseptate, thin-walled, smooth, guttulate, straight, curved or irregular, tapered gradually to an obtuse apex and abruptly to a truncate base (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P111">
<italic>Type species</italic>
:
<italic>P. ceanothi</italic>
(Ellis & Everh.) Höhn., Ann. Mycol. 22(1-2): 201. 1924.</p>
<p id="P112">
<italic>Notes</italic>
: Not much is known of the sexual state of this genus, but
<italic>P. padi</italic>
has been linked to
<italic>Blumeriella jaapii</italic>
(
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). A phylogenetic analysis performed on available isolates (unpubl. data) indicated that
<italic>Phloeosporella</italic>
is polyphyletic. However, as the type is not known from culture (on
<italic>Ceanothus</italic>
, California, USA), this matter could not be resolved.</p>
<p id="P113">
<bold>
<italic>Septogloeum</italic>
</bold>
Sacc., Michelia 2(6): 11. 1880.</p>
<p id="P114">
<italic>Mycelium</italic>
immersed, branched, septate, hyaline.
<italic>Conidiomata</italic>
acervular, epidermal to subepidermal, separate or confluent, formed of pale brown thin-walled pseudoparenchyma.
<italic>Conidiophores</italic>
short, stout, 1-2-septate, hyaline, smooth, branched at the base, formed from the upper pseudoparenchyma.
<italic>Conidiogenous cells</italic>
phialidic, discrete or integrated, determinate, cylindrical, doliiform to obpyriform, hyaline, smooth, with minute collarette and prominent periclinal thickening.
<italic>Conidia</italic>
hyaline, 1-3-euseptate, thin-walled, smooth, eguttulate, base truncate, apex obtuse, straight or curved, constricted, obovoid (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P115">
<italic>Type species</italic>
:
<italic>S. carthusianum</italic>
(Sacc.) Sacc., Michelia 2(6): 11. 1880.</p>
<p id="P116">
<italic>Notes</italic>
: Although more than 120 species of
<italic>Septogloeum</italic>
have been described, the genus was reduced to just two species by Sutton & Pollack (
<xref ref-type="bibr" rid="R104">1974</xref>
). Sexual morphs have been linked to
<italic>Pleuroceras</italic>
in the
<italic>Diaporthales</italic>
(
<xref ref-type="bibr" rid="R78">Monod 1983</xref>
). The genus is in need of revision pending fresh collections.</p>
<p id="P117">
<bold>
<italic>Xenocylindrosporium</italic>
</bold>
Crous & Verkley, Fungal Planet 44. 2009.</p>
<p id="P118">
<italic>Conidiomata</italic>
immersed, black, opening by irregular rupture, acervuloid, up to 300 μm diam; wall consisting of 3-4 layers of pale brown
<italic>textura angularis. Conidiophores</italic>
hyaline, smooth, subcylindrical, branched, septate, or reduced to ampulliform conidiogenous cells.
<italic>Conidiogenous cells</italic>
hyaline, smooth, ampulliform to subcylindrical, terminal or lateral on septate conidiophores, monophialidic with minute periclinal thickening.
<italic>Conidia</italic>
solitary, hyaline, smooth, curved, widest in middle, tapering to acutely rounded apex and truncate base, 0 -1-septate.</p>
<p id="P119">
<italic>Type species</italic>
:
<italic>X. kirstenboschense</italic>
Crous & Verkley, Fungal Planet 44. 2009.</p>
</sec>
<sec id="S16">
<title>Stromatic forms</title>
<p id="P120">
<bold>
<italic>Dothistroma</italic>
</bold>
Hulbary, Bull. Ill. Nat. Hist. Surv. 21: 235. 1941.</p>
<p id="P121">
<italic>Mycelium</italic>
immersed, branched, septate, pale brown to hyaline.
<italic>Conidiomata</italic>
sometimes acervular, initially subepidermal later erumpent, composed of pale brown, thin-walled
<italic>textura angularis</italic>
, sometimes eustromatic, multilocular and of darker brown, thick-walled tissue.
<italic>Stromata</italic>
are strongly erumpent and finally pulvinate.
<italic>Conidiogenous cells</italic>
holoblastic, discrete, determinate, ampulliform, hyaline, smooth, non-proliferating, formed from the upper cells of stroma or from inner cells of the locular walls.
<italic>Conidia</italic>
hyaline, straight or curved, filiform, 1-5-euseptate, continuous, thin-walled and smooth (
<xref ref-type="bibr" rid="R5">Barnes
<italic>et al.</italic>
2004</xref>
).</p>
<p id="P122">
<italic>Type species</italic>
:
<italic>D. pini</italic>
Hulbary, Bull. Ill. Nat. Hist. Surv. 21: 235. 1941.</p>
<p id="P123">
<italic>Notes</italic>
:
<italic>Dothistroma</italic>
sexual morphs are mycosphaerella-like (
<xref ref-type="bibr" rid="R45">Evans 1984</xref>
), and the two species of
<italic>Dothistroma</italic>
that have been subjected to DNA sequencing (
<italic>D. septosporum</italic>
and
<italic>D. pini</italic>
) cluster together in the
<italic>“Dothistroma</italic>
clade” as described by Crous
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R25">2009a</xref>
,
<xref ref-type="bibr" rid="R29">c</xref>
). Because of a lack of recognisable morphological characteristics, it is virtually impossible to discriminate between
<italic>D. septosporum</italic>
and
<italic>D. pini</italic>
without molecular tools (
<xref ref-type="bibr" rid="R5">Barnes
<italic>et al.</italic>
2004</xref>
). Multiple morphological varieties of both
<italic>D. septosporum</italic>
and
<italic>D. pini</italic>
have been described based on differences in conidia length alone (
<italic>e.g. D. septosporum</italic>
var.
<italic>keniense</italic>
<bold>)</bold>
. However, controversy exists as to whether spore size represents an adequate characteristic to distinguish among these
<italic>Dothistroma</italic>
varieties, as since the introduction of molecular tools only
<italic>D. septosporum</italic>
and
<italic>D. pini</italic>
have been confirmed as distinct species.</p>
<p id="P124">
<bold>
<italic>Phlyctaeniella</italic>
</bold>
Petr., Ann. Mycol. 20: 323. 1922.
<xref ref-type="fig" rid="F18">Fig. 18</xref>
.</p>
<fig id="F18" position="float">
<label>Fig. 18.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Phlyctaeniella humuli</italic>
(IMI 202260) (redrawn from
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig18"></graphic>
</fig>
<p id="P125">Mycelium immersed, branched, septate, hyaline.
<italic>Conidiomata</italic>
eustromatic, separate, immersed, pale brown, globose, unilocular, scarcely erumpent; side wall and base of several cell layers of hyaline, thin-walled
<italic>textura angularis</italic>
, above of larger pale brown tissue.
<italic>Ostiole</italic>
indistinct, and dehiscence by rupture of the upper wall.
<italic>Conidiophores</italic>
hyaline, smooth, septate, irregularly branched, especially at the base, formed from the inner cells of the stroma wall.
<italic>Conidiogenous cells</italic>
phialidic, integrated or discrete, determinate, hyaline, markedly tapered at the apices, smooth, with apical or lateral apertures, collarette minute, with periclinal thickening; only rarely becoming percurrent.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, irregularly guttulate, filiform, straight, curved or irregular, multiseptate (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P126">
<italic>Type species</italic>
:
<italic>P. polonica</italic>
Petr., Ann. Mycol. 20: 323. 1922.</p>
<p id="P127">
<italic>Note</italic>
: Fresh material needs to be collected of this taxon (on
<italic>Aruncus silvestris</italic>
, Austria), before its taxonomy can be resolved.</p>
<p id="P128">
<bold>
<italic>Septocyta</italic>
</bold>
Petr., Ann. Mycol. 25: 330. 1927. Figs
<xref ref-type="fig" rid="F19">19</xref>
,
<xref ref-type="fig" rid="F20">20</xref>
.</p>
<fig id="F19" position="float">
<label>Fig. 19.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Septocyta ramealis</italic>
(PDD 51271). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig19"></graphic>
</fig>
<fig id="F20" position="float">
<label>Fig. 20.</label>
<caption>
<p>
<italic>Septocyta ramealis</italic>
(PDD 51271). A. Conidiomata on host tissue. B, C. Conidiogenous cells. D. Conidia. Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig20"></graphic>
</fig>
<p id="P129">
<italic>Mycelium</italic>
immersed, branched, septate, hyaline to pale brown.
<italic>Conidiomata</italic>
eustromatic, immersed, separate, erumpent, dark brown to black, finally opening widely, unilocular, multilocular or convoluted, thick-walled; wall of pale brown, thin-walled
<italic>textura angularis</italic>
except in the dehiscent region which is darker brown and more thick-walled.
<italic>Ostiole</italic>
absent, dehiscence by breakdown of the upper wall.
<italic>Conidiogenous cells</italic>
are holoblastic, sympodial with 1-3 apical, scarcely protruding, unthickened denticles, indeterminate, discrete, ampulliform to lageniform, hyaline, smooth, formed from the inner cells of the locular walls.
<italic>Conidia</italic>
hyaline, 1-3 euseptate, smooth, straight or slightly curved, acicular, apex obtuse, base truncate, often with minute guttules associated with septa (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P130">
<italic>Type species</italic>
:
<italic>S. ramealis</italic>
(Roberge ex Desm.) Petr., Ann. Mycol. 25: 330. 1927.</p>
<p id="P131">
<bold>
<italic>Septocyta ramealis</italic>
</bold>
(Roberge ex Desm.) Petr., Ann. Mycol. 25: 330. 1927.</p>
<p id="P132">
<italic>Conidiomata</italic>
eustromatic to pycnidial, black, up to 160 μm diam, aggregated in clusters, erumpent through ruptures in epidermis, convulated; wall of 3-8 layers of brown
<italic>textura angularis. Conidiophores</italic>
lining the inner cavity, reduced to conidiogenous cells, or one or two supporting cells.
<italic>Conidiogenous cells</italic>
hyaline, smooth, ampulliform, proliferating sympodially and percurrently near apex, also with lateral denticle-like protrusions, 6-12 × 2.5-4 μm.
<italic>Conidia</italic>
hyaline, smooth, guttulate, (9-)20-30(-35) × 1.5(-2) μm, 1(-3)-septate, irregularly curved, subcylindrical, apex obtuse, base tapering slightly to truncate hilum, 0.5 μm diam.</p>
<p id="P133">
<italic>Specimen examined</italic>
:
<bold>Germany</bold>
, Brandenberg, on
<italic>Rubus fructicosus</italic>
(
<italic>Rosaceae</italic>
), 7 June 1923, coll. P. Sydow, det. H. Sydow, Sydow Mycoth. Germ. PDD 51271.</p>
<p id="P134">
<italic>Notes</italic>
:
<italic>Septocyta ramealis</italic>
, the type of
<italic>Septocyta</italic>
, has a long list of synonyms. The specimen examined here (PDD 51271), differs somewhat from the description provided by Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
), and appears to represent a species of
<italic>Septoria s. str</italic>
., as the mode of conidiogenesis is not that different. Presently there is a single ITS sequence labelled as
<italic>S. ruborum</italic>
available on GenBank (JN133277.1), placing it in the middle of
<italic>Septoria s. str</italic>
. As no type material of
<italic>S. ramealis</italic>
could be located, this matter remains unresolved.</p>
<p id="P135">
<bold>
<italic>Septopatella</italic>
</bold>
Petr., Ann. Mycol. 23: 128. 1925.</p>
<p id="P136">
<italic>Mycelium</italic>
immersed, branched, septate, hyaline to subhyaline.
<italic>Conidiomata</italic>
superficial, often subtended by a superficial, pale brown, septate, branched mycelium, pulvinate, separate to occasionally aggregated, dark brown to black, finally opening widely, cupulate; basal wall of small-celled, brown, thin-walled
<italic>textura angularis,</italic>
becoming
<italic>textura porrecta</italic>
as it merges into the periclinal walls; a hypostroma attaches the conidioma to the substrate;
<italic>Ostiole</italic>
absent.
<italic>Conidiophores</italic>
hyaline, septate, branched at the base, thin-walled, cylindrical, formed from the gelatinized basal wall of the conidioma.
<italic>Conidiogenous cells</italic>
holoblastic, sympodial, integrated, indeterminate, cylindrical, hyaline, smooth, produced as 2-3 branches from the apex of the conidiophores.
<italic>Conidia</italic>
hyaline, 3-4-euseptate, thin-walled, smooth, minutely guttulate, straight or curved, occasionally irregularly filiform (
<xref ref-type="bibr" rid="R40">Dyko & Sutton 1979</xref>
,
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P137">
<italic>Type species: S. septata</italic>
(Jaap) Petr., Ann. Mycol. 23: 129. 1925.</p>
<p id="P138">
<italic>Note</italic>
: Not much is known about this genus, and as no cultures of
<italic>S. septata</italic>
are presently available (on
<italic>Pinus montana</italic>
, Czech Republic) this matter cannot be resolved.</p>
<p id="P139">
<bold>
<italic>Stictosepta</italic>
</bold>
Petr., Sydowia 17: 230. 1964. [1963].
<xref ref-type="fig" rid="F21">Fig. 21</xref>
.</p>
<fig id="F21" position="float">
<label>Fig. 21.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Stictosepta cupularis</italic>
(redrawn from
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig21"></graphic>
</fig>
<p id="P140">
<italic>Mycelium</italic>
immersed, branched, septate, hyaline.
<italic>Conidiomata</italic>
eustromatic, immersed, globose to collabent, papillate, unilocular, often convoluted, hyaline; walls thick, of hyaline, thin-walled
<italic>textura intricata. Ostiole</italic>
central and circular, single, furfuraceous.
<italic>Conidiophores</italic>
hyaline, septate, branched, anastomosing, formed from the inner cells of the locular wall.
<italic>Conidiogenous cells</italic>
sympodial or synchronous, integrated, indeterminate, hyaline, thin-walled, with usually two small, unthickened, apical, slightly protuberant conidiogenous loci.
<italic>Conidia</italic>
hyaline, thin-walled, smooth, multiseptate, slightly constricted at the septa, each cell medianly guttulate, straight or curved, base truncate, apex obtuse (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P141">
<italic>Type species</italic>
:
<italic>S. cupularis</italic>
Petr., Sydowia 17: 230. 1964. [1963].</p>
<p id="P142">
<italic>Note</italic>
: Not much is known about this genus, but as no isolate of
<italic>S. cupularis</italic>
is presently available (on stems of
<italic>Fraxinus</italic>
, Czech Republic), it will not be treated here.</p>
</sec>
<sec id="S17">
<title>Sexual morphs linked to
<italic>Septoria</italic>
</title>
<p id="P143">Several sexual genera have been linked to
<italic>Septoria</italic>
and allied genera in literature, but very few have been confirmed in culture. Most sexual states cluster in the
<italic>Mycosphaerella</italic>
complex.</p>
<p id="P144">
<bold>
<italic>Mycosphaerella</italic>
</bold>
Johanson, Öfvers. K. Svensk. Vetensk.-Akad. Förhandl. 41(no. 9): 163. 1884.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Ramularia</italic>
Unger, Exanth. Pflanzen (Wien): 119. 1833.</p>
</list-item>
</list>
<p id="P145">
<italic>Mycelium</italic>
immersed to superficial, septate, hyaline, branched.
<italic>Caespituli</italic>
usually whitish to greyish on host tissue.
<italic>Conidiophores</italic>
fasciculate to synnematal, rarely solitary, or forming small sporodochia, emerging through stomata, from inner hyphae or stromata; conidiophores straight, subcylindric to geniculate-sinuous, aseptate or septate, hyaline, occasionally branched, smooth, rarely rough.
<italic>Conidiogenous cells</italic>
integrated, terminal, polyblastic, elongating sympodially, apex more or less straight to geniculate-sinuous or strongly curved, cicatrized, conidial scars hardly to conspicuously thickened, but always darkened, refractive.
<italic>Conidia</italic>
solitary to catenate, sometimes in branched chains, 0-4(-multi)-septate, hyaline, ellipsoid-ovoid to cylindrical-fusoid, rarely filiform, occasionally constricted at the septa, smooth to verruculose-echinulate; hila distinct, slightly to conspicuously thickened, darkened, refractive; conidial secession schizolytic.
<italic>Ascomata</italic>
immersed to superficial, uniloculate, globose to subglobose with papillate, central, periphysate ostiole, dark brown to black, scattered or gregarious.
<italic>Peridium</italic>
of 3-6 layers of thin- to thick-walled
<italic>textura angularis</italic>
, dark brown to black.
<italic>Hamathecium</italic>
dissolves at maturity, and no stromatic tissue remains between the asci.
<italic>Asci</italic>
bitunicate, fissitunicate, 8-spored, cylindrical to cylindric-clavate, ovoid to ampulliform or saccate, sessile to subsessile, apex rounded with distinct or indistinct ocular chamber.
<italic>Ascospores</italic>
bi- to tri- or multiseriate, ellipsoid-fusoid to obclavate or subcylindrical, hyaline, medianly 1-septate, often constricted at the septum, smooth-walled, granular to guttulate, mostly lacking any sheath.</p>
<p id="P146">
<italic>Type species</italic>
:
<italic>Ramularia pusilla</italic>
Unger, Exanth. Pflanzen (Wien): 169. 1833.</p>
<p id="P147">
<italic>Notes</italic>
: Species of
<italic>Ramularia</italic>
(including the
<italic>Mycosphaerella</italic>
sexual morph) have evolved over a broad developmental and physiological adaptation range that includes endophytes, saprophytes and symbionts. However, for a major part
<italic>Ramularia</italic>
consists of a wide range of narrow host range, foliicolous plant pathogens which are the cause of significant economical losses in both temperate and tropical crops worldwide (
<xref ref-type="bibr" rid="R24">Crous
<italic>et al.</italic>
2001</xref>
). Verkley
<italic>et al</italic>
. (2004) showed that
<italic>Mycosphaerella s. str.</italic>
(linked to
<italic>M. punctiformis</italic>
) was in fact restricted to species with
<italic>Ramularia</italic>
anamorphs, leaving many “
<italic>Mycosphaerella”</italic>
species to be disposed to other genera. In employing the one fungus = one name concept (
<xref ref-type="bibr" rid="R61">Hawksworth
<italic>et al.</italic>
2011</xref>
,
<xref ref-type="bibr" rid="R122">Wingfield
<italic>et al</italic>
. 2012</xref>
), the choice is to use
<italic>Ramularia</italic>
over
<italic>Mycosphaerella</italic>
, as the former is monophyletic and recently monographed (Braun
<xref ref-type="bibr" rid="R10">1995</xref>
,
<xref ref-type="bibr" rid="R11">1998</xref>
), while
<italic>Mycosphaerella</italic>
is poly- and paraphyletic, and consists of more than 40 genera, many as yet untreated (
<xref ref-type="bibr" rid="R29">Crous
<italic>et al.</italic>
2009c</xref>
)</p>
<p id="P148">
<bold>
<italic>Sphaerulina</italic>
</bold>
Sacc., Michelia 1(no. 4): 399. 1878.</p>
<p id="P149">
<italic>Ascomata</italic>
pseudothecial, immersed, subepidermal, erumpent at the top, single to clustered, globose, papillate.
<italic>Ostiole</italic>
central, with hyaline periphyses; wall of
<italic>textura angularis</italic>
, composed of 2-4 layers of brown cells.
<italic>Hamathecium</italic>
dissolving at maturity.
<italic>Asci</italic>
bitunicate, fissitunicate, clustered, cylindrical to obclavate, rounded at apex, with or without a shallow apical chamber, short-stipitate or sessile, with 8 biseriate to triseriate ascospores.
<italic>Ascospores</italic>
subcylindrical to fusiform, rounded at ends, slightly tapered, straight or slightly curved, 1-3-septate, with a primary septum nearly median, hyaline, smooth, without sheath or appendages.</p>
<p id="P150">
<italic>Type species</italic>
:
<italic>Sphaerulina myriadea</italic>
(DC.) Sacc., Michelia 1(no. 4): 399. 1878.</p>
<p id="P151">
<italic>Notes</italic>
: The genus
<italic>Sphaerulina</italic>
was chiefly separated from
<italic>Mycosphaerella</italic>
on the basis of ascospore septation (
<xref ref-type="bibr" rid="R30">Crous
<italic>et al.</italic>
2011</xref>
).
<italic>Sphaerulina myriadea</italic>
, which occurs on hosts in the
<italic>Fagaceae</italic>
, appears to be a species complex. Results in this paper show that
<italic>Sphaerulina myriadea</italic>
clusters together with many septoria-like species in a clade that is distinct, but very closely related to
<italic>Septoria s. str.</italic>
The septoria-like species in this
<italic>Sphaerulina</italic>
clade were subsequently rediscribed in
<italic>Sphaerulina</italic>
. Species including ones with 1-septate ascospores and septoria-like asexual morphs are treated below and by Verkley
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R117">2013</xref>
).</p>
</sec>
<sec id="S18">
<title>Treatment of phylogenetic clades</title>
<p id="P152">Based on the phylogenetic data generated in this study, we were able to delineate several clades in the
<italic>Septoria</italic>
complex. Recognised clades, as well as novel species and genera, are described and discussed below. Taxa with descriptions that are freely available online in MycoBank or open access journals, are not repeated here.</p>
</sec>
<sec id="S19">
<title>Clade 1:
<italic>Septoria</italic>
</title>
<p id="P153">
<italic>Description</italic>
: See above.</p>
<p id="P154">
<italic>Type species</italic>
:
<italic>S. cytisi</italic>
Desm., Ann. Sci. Nat. Bot. 8: 24. 1847.</p>
<p id="P155">
<bold>
<italic>Septoria</italic>
cf
<italic>. agrimoniicola</italic>
</bold>
Bondartsev, Mater. mikol. obslêed. Ross. 2: 6. 1921.</p>
<p id="P156">
<italic>Leaf spots</italic>
on the upper leaf surface, distinct, scattered, brown with purplish margin, circular to angular, sometimes vein-limited, discrete lesions 2-4 mm diam, reaching 10 mm wide when confluent, finally the center becoming pale colored to nearly whitish; on the lower leaf surface similar but discoloured (
<xref ref-type="bibr" rid="R98">Shin & Sameva 2004</xref>
). On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
pycnidial, separate but frequently aggregated and linked by brown stromatic tissue in a stroma; globose, black, exuding a creamy conidial mass via a central ostiole; conidiomata up to 350 μm diam; wall of 6-12 layers of dark brown, thick-walled
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells or 1-2 supporting cells, hyaline, subcylindrical, lining the inner layer of conidioma.
<italic>Conidiogenous cells</italic>
hyaline, smooth, subcylindrical to ampulliform, 10-17 × 3-4 μm; proliferating sympodially but also percurrently near apex.
<italic>Conidia</italic>
hyaline, smooth, guttulate, filiform, apex subobtuse, base long obconically truncate, 1-4-septate, (20-)25-35(-40) × 1.5-2(-2.5) μm; microcyclic conidiation observed.</p>
<p id="P157">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, undulate with sparse, white aerial mycelium, surface olivaceous-black, reverse olivaceous-black, after 14 d, 3.5 cm diam; on MEA with sparse white aerial mycelium, surface olivaceous-black, reverse olivaceous-black, after 14 d, 5 cm diam; on OA with sparse white aerial mycelium, surface olivaceous, reverse olivaceous, after 14 d, 3 cm diam.</p>
<p id="P158">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, Guri, on leaves of
<italic>Agrimonia pilosa</italic>
(
<italic>Rosaceae</italic>
), 11 Jul. 2009, H.D. Shin (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21279&link_type=cbs">CBS H-21279</ext-link>
, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128602&link_type=cbs">CBS 128602</ext-link>
=KACC 44644 = SMKC 24292).</p>
<p id="P159">
<italic>Notes</italic>
: This fungus was first reported from Korea by Shin & Sameva (
<xref ref-type="bibr" rid="R97">2002</xref>
) as
<italic>S. agrimoniicola</italic>
, and fits well with the original description of this European taxon. However, fresh European collections and cultures are required for comparison, as
<italic>S. agrimoniicola</italic>
may well be restricted to Europe.</p>
<p id="P160">
<bold>
<italic>Septoria</italic>
cf
<italic>. stachydicola</italic>
</bold>
Hollós, Mathem. Természettud. Közlem. Magg. Tudom. Akad. 35(1): 60. 1926.</p>
<p id="P161">
<italic>Leaf spots</italic>
on the upper leaf surface distinct, scattered, brown with purplish margin, circular to angular, sometimes vein-limited, discrete lesions 2-4 mm diam, reaching 10 mm wide when confluent, finally the center becoming paler or nearly whitish; on the lower leaf surface similar but discoloured (
<xref ref-type="bibr" rid="R98">Shin & Sameva 2004</xref>
). On OA.
<italic>Conidiomata</italic>
solitary to aggregated, black, globose, becoming somewhat papillate, up to 250 μm diam, opening by means of central ostiole, up to 40 μm diam; wall of 6-8 layers of thick-walled, brown
<italic>textura angularis</italic>
; exuding a creamy conidial mass.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
lining the inner wall layer, hyaline, discrete, ampulliform to lageniform, 4-10 × 3-5 μm, proliferating sympodially or percurrently with inconspicuous proliferations.
<italic>Conidia</italic>
filiform, curved or flexuous, rarely straight, (60-)65-75(-90) × 1.5-2(-3) μm, hyaline, guttulate, 4-7(-11)-septate, apex subobtuse, slightly tapering from basal septum to truncate base, 1.5-2 μm.</p>
<p id="P162">
<italic>Culture characteristics</italic>
: Colonies on PDA erumpent, with feathery margin, with sparse white aerial mycelium, surface greenish-black, reverse olivaceous-black, after 14 d, 2.5 cm diam; on MEA with sparse white aerial mycelium, surface cinnamon to olivaceous-black in the younger patches, reverse cinnamon to olivaceous-black in patches, after 14 d, 4 cm diam; on OA with sparse white aerial mycelium, surface greenish-black, reverse fuscous-black, after 14 d, 3 cm diam.</p>
<p id="P163">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, Incheon, leaf of
<italic>Stachys riederi</italic>
var.
<italic>japonica</italic>
(
<italic>Lamiaceae</italic>
), 14 Aug. 2008, H.D. Shin (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21278&link_type=cbs">CBS H-21278</ext-link>
, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128668&link_type=cbs">CBS 128668</ext-link>
=KACC 44796 = SMKC 24663).</p>
<p id="P164">
<italic>Note</italic>
: The Korean collection was originally identified as
<italic>Septoria stachydicola</italic>
, which fits the original description provided for this taxon (
<xref ref-type="bibr" rid="R98">Shin & Sameva 2004</xref>
). However, authentic European material is required for a comparison to confirm this identification, as we suspect
<italic>S. stachydicola</italic>
may be restricted to Europe.</p>
<p id="P165">
<bold>
<italic>Septoria cretae</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804402&link_type=mb">MB804402</ext-link>
. Figs
<xref ref-type="fig" rid="F22">22</xref>
,
<xref ref-type="fig" rid="F23">23</xref>
.</p>
<fig id="F22" position="float">
<label>Fig. 22.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Septoria cretae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135095&link_type=cbs">CBS 135095</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig22"></graphic>
</fig>
<fig id="F23" position="float">
<label>Fig. 23.</label>
<caption>
<p>
<italic>Septoria cretae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135095&link_type=cbs">CBS 135095</ext-link>
). A. Colony sporulating in culture. B-F. Conidiophores and conidiogenous cells giving rise to conidia. G. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig23"></graphic>
</fig>
<p id="P166">
<italic>Etymology</italic>
: Named after Crete, the island from where it was collected.</p>
<p id="P167">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
up to 250 μm diam, brown, immersed, subepidermal, pycnidial, subglobose with central ostiole, exuding creamy conidial mass; wall of 2-3 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells, or with a supporting cell that gives rise to several conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to subcylindrical, straight to curved, proliferating sympodially near apex, 10-20 × 2-3.5 μm.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, subcylindrical to narrowly obclavate, granular, with subobtuse apex and obconically truncate to truncate base, 1-3-septate, (8-)15-22(-27) × 2(-3) μm.</p>
<p id="P168">
<italic>Culture characteristics</italic>
: Colonies on PDA erumpent, with feathery margin, lacking aerial mycelium, surface fuscous-black, reverse olivaceous-black, after 14 d, 3.5 cm diam; on MEA surface fuscous-black, reverse olivaceous-black, after 14 d, 4 cm diam; on OA surface fuscous-black, reverse fuscous-black, after 14 d, 3.5 cm diam.</p>
<p id="P169">
<italic>Specimen examined</italic>
:
<bold>Greece</bold>
, Crete, on leaves of
<italic>Nerium oleander</italic>
(
<italic>Apocynaceae</italic>
), 7 Jul. 2012, U. Damm, (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21277&link_type=cbs">CBS H-21277</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135095&link_type=cbs">CBS 135095</ext-link>
).</p>
<p id="P170">
<italic>Notes</italic>
: Several species of
<italic>Septoria</italic>
are known on
<italic>Nerium oleander</italic>
, namely
<italic>S. juliae</italic>
[conidia 1-6(-7)-septate, 26-54 × 2.5-5.5 μm],
<italic>S. neriicola</italic>
(conidia 1-septate, 30-40 × 0.7-1 μm),
<italic>S. oleandriicola</italic>
[conidia 1-3-septate, 12.5-22.5-37.5(-40) × 2.5-3(-4.5) μm],
<italic>S. oleandrina</italic>
(conidia 0-1-septate, 9-19 × 1-1.5 μm), and
<italic>S. roll-hansenii</italic>
(conidia 0-4-septate, 25-39 × 3-4 μm) (
<xref ref-type="bibr" rid="R7">Bedlan 2011</xref>
), which differ from
<italic>S. cretae</italic>
based on conidial dimensions and septation.</p>
<p id="P171">
<bold>
<italic>Septoria glycinicola</italic>
</bold>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804403&link_type=mb">MB804403</ext-link>
.
<xref ref-type="fig" rid="F24">Fig. 24</xref>
.</p>
<fig id="F24" position="float">
<label>Fig. 24.</label>
<caption>
<p>
<italic>Septoria glycinicola</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128618&link_type=cbs">CBS 128618</ext-link>
). A, B. Colonies sporulating on PDA. C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig24"></graphic>
</fig>
<p id="P172">
<italic>Etymology</italic>
: Named after the host genus on which it was collected,
<italic>Glycine</italic>
.</p>
<p id="P173">On OA.
<italic>Conidiomata</italic>
forming in concentric circles, pycnidial, separate, black, globose, up to 150 μm diam, opening by a central ostiole, up to 30 μm diam, exuding a creamy conidial mass; wall consisting of 3-6 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
lining the inner cavity, hyaline, smooth, ampulliform, 10-16 × 2.5-3.5 μm, proliferating sympodially near apex, holoblastic.
<italic>Conidia</italic>
hyaline, smooth, guttulate to granular, subcylindrical to narrowly obclavate, irregularly to gently curved, apex subobtuse, base long obconically truncate, 3-6-septate, (33-)45-55(-65) × (1.5-)2 μm.</p>
<p id="P174">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, circular, with sparse black aerial mycelium with black tufts, surface patches of olivaceous-black to fawn in the younger parts, reverse with patches of olivaceous-black in the older parts to mouse-grey and pale purplish grey in the younger mycelium, after 14 d, 6.5 cm diam, pinkish exudate; on OA lobate, with sparse white aerial mycelium, surface patches of vinaceous to olivaceous-black, reverse fuscous-black to vinaceous-buff; after 14 d, 8.5 cm diam, pinkish exudate; on MEA with radial lobes, very short white aerial mycelium, surface fuscous-black, reverse olivaceous-black; after 14 d, 4.5 cm diam.</p>
<p id="P175">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, Namyangju, on leaves of
<italic>Glycine max</italic>
(
<italic>Fabaceae</italic>
), 22 Sep. 2008, H.D. Shin (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21270&link_type=cbs">CBS H-21270</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128618&link_type=cbs">CBS 128618</ext-link>
=KACC 43091 = SMKC 22879).</p>
<p id="P176">
<italic>Notes</italic>
:
<italic>Septoria glycines</italic>
is the common
<italic>Septoria</italic>
species associated with brown spot of soybeans.
<italic>Septoria glycinicola</italic>
is distinct from
<italic>S. glycines</italic>
(conidia 1-4 septate, 21-45 × 1.5-2 μm) in that it has larger conidia.</p>
<p id="P177">
<bold>
<italic>Septoria oenanthicola</italic>
</bold>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804405&link_type=mb">MB804405</ext-link>
.
<xref ref-type="fig" rid="F25">Fig. 25</xref>
.</p>
<fig id="F25" position="float">
<label>Fig. 25.</label>
<caption>
<p>
<italic>Septoria oenanthicola</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128649&link_type=cbs">CBS 128649</ext-link>
). A. Colony sporulating on MEA. B. Section through conidiomata. C-G. Conidiogenous cells. H. Conidia. Scale bars: B = 200 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig25"></graphic>
</fig>
<p id="P178">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Oenanthe.</italic>
</p>
<p id="P179">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
pycnidial, separate but aggregated, black, globose, up to 200 μm diam, opening by central ostiole, up to 20 μm diam, exuding a creamy conidial mass; wall consisting of dark brown, thickened, 6-10 layers of
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells or to one supporting cell.
<italic>Conidiogenous cells</italic>
hyaline, smooth, 3-5 × 3-7 μm, ampulliform, proliferating sympodially near apex, holoblastic.
<italic>Conidia</italic>
hyaline, smooth, guttulate, subcylindrical to narrowly obclavate, apex subobtuse, base long obconically truncate, 1-6-septate, (17-)25-45(-55) × (2-)2.5(-3) μm.</p>
<p id="P180">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, undulate with sparse, white aerial mycelium, surface olivaceous-grey, reverse olivaceous, after 14 d, 2.5 cm diam; on MEA with sparse, white aerial mycelium, surface olivaceous-grey, reverse olivaceous-black, after 14 d, 5 cm diam; on OA with sparse white aerial mycelium, surface olivaceous-grey, reverse olivaceous, after 14 d, 3 cm diam.</p>
<p id="P181">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, Yangpyeong, on leaves of
<italic>Oenanthe javanica</italic>
(
<italic>Apiaceae</italic>
), 25 May 2006, H.D. Shin (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21281&link_type=cbs">CBS H-21281</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128649&link_type=cbs">CBS 128649</ext-link>
=KACC 42394 = SMKC 21807).</p>
<p id="P182">
<italic>Notes</italic>
: This fungus was originally recorded from Korea by Shin (1998) as
<italic>Septoria oenanthis</italic>
. However, conidia of Korean specimens (30-60 ×1.5-2.5 μm;
<xref ref-type="bibr" rid="R98">Shin & Sameva 2004</xref>
) are much larger than that of the American type collection (20-35 × 1.5-2 μm;
<xref ref-type="bibr" rid="R93">Saccardo 1895</xref>
), and therefore better treated as a separate taxon.</p>
<p id="P183">
<bold>
<italic>Septoria pseudonapelli</italic>
</bold>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804404&link_type=mb">MB804404</ext-link>
.
<xref ref-type="fig" rid="F26">Fig. 26</xref>
.</p>
<fig id="F26" position="float">
<label>Fig. 26.</label>
<caption>
<p>
<italic>Septoria pseudonapelli</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128664&link_type=cbs">CBS 128664</ext-link>
). A. Colony sporulating on PDA. B. Section through conidioma. C-E. Conidiogenous cells. F. Conidia. Scale bars: B = 125 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig26"></graphic>
</fig>
<p id="P184">
<italic>Etymology</italic>
: Named after its morphological similarity to
<italic>Septoria napelli</italic>
.</p>
<p id="P185">
<italic>Leaf spots</italic>
on the upper leaf surface, scattered to confluent, distinct, angular to irregular, usually vein-limited, small to large, up to 30 mm when confluent, at first appearing small angular brown discoloration, later turning blackish brown with or without distinct border line, finally central area becoming blackish and surrounded by pale greenish margin; on the lower leaf surface similar but discoloured (
<xref ref-type="bibr" rid="R98">Shin & Sameva 2004</xref>
). On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
pycnidial, separate, black, globose, papillate with short neck (at times 1-2 necks develop), up to 250 μm wide, 500 μm high with central ostiole; wall of 5-7 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
ampulliform, lining the inner cavity, hyaline, smooth, with sympodial or apical percurrent proliferation, 10-13 × 5-7 μm.
<italic>Conidia</italic>
filiform, curved to flexuous, (50-)75-90(-100) × (2.5-)3(-3.5) μm, hyaline, guttulate, 4-10-septate, apex subobtuse, base obconically truncate, 2 μm diam.</p>
<p id="P186">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, undulate with sparse, white aerial mycelium, surface olivaceous-black, reverse olivaceous-black, after 14 d, 2 cm diam; on MEA with sparse white aerial mycelium, surface olivaceous-black, reverse olivaceous-black, after 14 d, 4 cm diam; on OA with sparse white aerial mycelium, surface olivaceous, reverse olivaceous, after 14 d, 2 cm diam.</p>
<p id="P187">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, Chuncheon, on leaves of
<italic>Aconitum pseudolaeve</italic>
var.
<italic>erectum</italic>
(
<italic>Ranunculaceae</italic>
), 4 Sep. 2008, H.D. Shin (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21280&link_type=cbs">CBS H-21280</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128664&link_type=cbs">CBS 128664</ext-link>
=KACC 43952 = SMKC 23638).</p>
<p id="P188">
<italic>Notes</italic>
: This taxon was originally reported as
<italic>Septoria napelli</italic>
from Korea by Shin & Sameva (
<xref ref-type="bibr" rid="R98">2004</xref>
), and broadly corresponds with the original description provided for this taxon (
<xref ref-type="bibr" rid="R83">Petrak 1957</xref>
). However, we have examined European material authentic for the name (see
<xref ref-type="bibr" rid="R117">Verkley
<italic>et al</italic>
. 2013</xref>
, this issue), from which the Korean fungus is genetically different. Based on these observations we describe the Korean collection as new.</p>
</sec>
<sec id="S20">
<title>Clade 2:
<italic>Sphaerulina</italic>
</title>
<p id="P189">
<bold>
<italic>Sphaerulina</italic>
</bold>
Sacc., Michelia 1(no. 4): 399. 1878.</p>
<p id="P190">
<italic>Description</italic>
: See above.</p>
<p id="P191">
<italic>Type species</italic>
:
<italic>Sphaerulina myriadea</italic>
(DC.) Sacc., Michelia 1(no. 4): 399. 1878.</p>
<p id="P192">
<italic>Specimens examined</italic>
:
<bold>Germany</bold>
, Driesen, Lasch [Rabenhorst, Fungi Eur. no. 149] (L).
<bold>Japan</bold>
, Aomori, Tsugaru, Kidukuri, Bense-marsh (40°51’53” N, 140°17’42”E), on leaves of
<italic>Q. dentata</italic>
, 21 Apr. 2007, K. Tanaka 2243 (HHUF 29940; single ascospore culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=124646&link_type=cbs">CBS 124646</ext-link>
=JCM 15565).
<bold>UK</bold>
, on leaves of
<italic>Quercus robur</italic>
(
<italic>Fagaceae</italic>
), J.E. Vize [Microfungi Brit. Ex. No. 195] (ex IMI 57186, K(M) 167735).
<bold>USA</bold>
, California: Sequoia National Park. alt. 2590 m, on leaves of
<italic>Castanopsis sempervirens</italic>
, 18 Jun. 1931, H.E. Parks (BPI 623686); Lake Co., Hoberg’s Resort, on leaves of
<italic>Q. kelloggii</italic>
, 15 May 1943, V. Miller (BPI 623707); Maryland, Marlboro, on leaves of
<italic>Q. alba</italic>
, 26 Apr. 1929, C.L. Shear (BPI 623705); Texas, Houston, on leaves of
<italic>Q. alba</italic>
, 8 Apr. 1869, H.W. Ravenel (BPI 623704).</p>
<p id="P193">
<italic>Notes</italic>
: Sivanesan (
<xref ref-type="bibr" rid="R100">1984</xref>
) linked
<italic>Sphaerulina</italic>
to
<italic>Septoria, Cercospora</italic>
and
<italic>Cercosporella</italic>
asexual morphs, though these were never confirmed based on DNA data. The latter two genera have since been shown to be distinct (
<xref ref-type="bibr" rid="R19">Crous
<italic>et al</italic>
. 2013</xref>
,
<xref ref-type="bibr" rid="R57">Groenewald
<italic>et al</italic>
. 2013</xref>
; this volume), which leaves septoria-like asexual morphs such as
<italic>Sphaerulina rubi</italic>
Demaree & Wilcox (linked to
<italic>Cylindrosporium rubi</italic>
Ellis & Morgan), and
<italic>S. rehmiana</italic>
(linked to
<italic>Septoria rosae</italic>
), which confirms the results obtained here (
<xref ref-type="fig" rid="F1">Fig. 1</xref>
).</p>
<p id="P194">
<bold>
<italic>Sphaerulina abeliceae</italic>
</bold>
(Hiray.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804406&link_type=mb">MB804406</ext-link>
.</p>
<p id="P195">
<italic>Basionym</italic>
:
<italic>Septoria abeliceae</italic>
Hiray., Mem. Col. Agr. Kyoto. Imp. Univ. 13(3): 33. 1931.</p>
<p id="P196">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, Jeonju, on leaves of
<italic>Zelkova serrata</italic>
(
<italic>Ulmaceae</italic>
), 29 Oct. 2006, H.D. Shin,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128591&link_type=cbs">CBS 128591</ext-link>
=KACC 42626.</p>
<p id="P197">
<bold>
<italic>Sphaerulina amelanchier</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804407&link_type=mb">MB804407</ext-link>
. Figs
<xref ref-type="fig" rid="F27">27</xref>
,
<xref ref-type="fig" rid="F28">28</xref>
.</p>
<fig id="F27" position="float">
<label>Fig. 27.</label>
<caption>
<p>Conidia, conidiogenous cells, ascospore and ascus of
<italic>Sphaerulina amelanchier</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135110&link_type=cbs">CBS 135110</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig27"></graphic>
</fig>
<fig id="F28" position="float">
<label>Fig. 28.</label>
<caption>
<p>
<italic>Sphaerulina amelanchier</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135110&link_type=cbs">CBS 135110</ext-link>
). A. Colony on PDA. B. Conidiogenous cells. C. Ascomata on host tissue. D. Germinating ascospore. E, F. Asci. G. Ascospores. H. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig28"></graphic>
</fig>
<p id="P198">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Amelanchier</italic>
.</p>
<p id="P199">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
pycnidial, brown, separate, immersed, globose, up to 150 μm diam, exuding a creamy conidial mass via central ostiole; wall of 3-6 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
hyaline, smooth, subcylindrical, irregularly curved, branched to once geniculate-sinuous, 5-20 × 3-4 μm; proliferating sympodially.
<italic>Conidia</italic>
hyaline, smooth, guttulate, filiform, narrowly obclavate, apex subacutely rounded, base long obconically truncate, 1-8-septate, (25-)40-55(-60) × (1.5-)2(-2.5) μm; microcyclic conidiation common.
<italic>Ascomata</italic>
globose, brown, separate, immersed to erumpent, up to 150 μm diam.
<italic>Asci</italic>
broadly ellipsoid to obclavate, 22-35 × 7-9 μm; apical chamber visible, 1-1.5 μm diam.
<italic>Ascospores</italic>
fusoid-ellipsoid, hyaline, smooth, granular, not to slightly constricted at median septum, widest just above septum, prominently curved, (13-)17-20(-25) × (2.5-)3(-3.5) μm.
<italic>Ascospores</italic>
germinating from both ends, with germ tubes parallel to the long axis, developing lateral branches and becoming constricted at septum, 3-4 μm diam.</p>
<p id="P200">
<italic>Culture characteristics</italic>
: Colonies on PDA radially striate with lobate edge, sparse white aerial mycelium, surface fuscous-black to buff for the younger tissue, reverse cinnamon to olivaceous-black, after 14 d, 3 cm diam; on MEA surface patches of hazel to fawm to fuscous-black, reverse sepia to olivaceous-black, after 14 d, 4.5 cm diam; on OA surface pale-vinaceous to fuscous-black, reverse cinnamon to fuscous-black, after 14 d, 3 cm diam.</p>
<p id="P201">
<italic>Specimen examined</italic>
:
<bold>Netherlands</bold>
, Houten, on leaf litter of
<italic>Amelanchier</italic>
sp. (
<italic>Rosaceae</italic>
), 28 Mar. 2012, S. Videira (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21282&link_type=cbs">CBS H-21282</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135110&link_type=cbs">CBS 135110</ext-link>
=MP8 = S544).</p>
<p id="P202">
<italic>Note</italic>
: Presently there are no known species of septoria-like fungi known from
<italic>Amelanchier.</italic>
Phylogenetically, it is similar to
<italic>Sphaerulina rhabdoclinis</italic>
(conidia 8-30 × 1.5-2 μm), which infects needles of
<italic>Pseudotsuga menziesii</italic>
. Phylogenetically similar isolates occur on
<italic>Betula, Castanea</italic>
and
<italic>Quercus</italic>
. More isolates and molecular data are required to resolve this complex.</p>
<p id="P203">
<bold>
<italic>Sphaerulina azaleae</italic>
</bold>
(Voglino) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804408&link_type=mb">MB804408</ext-link>
.</p>
<p id="P204">
<italic>Basionym</italic>
:
<italic>Septoria azaleae</italic>
Voglino, Syll. Fung. (Abellini) 14(2): 976. 1899.</p>
<list list-type="simple">
<list-item>
<p>
<italic>Phloeospora azaleae</italic>
(Voglino) Priest, Fungi of Australia: 224. 2006.</p>
</list-item>
</list>
<p id="P205">
<italic>Specimens examined</italic>
:
<bold>Belgium</bold>
, on leaves of
<italic>Rhododendron</italic>
sp. (
<italic>Ericaceae</italic>
), J. van Holder,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=352.49&link_type=cbs">CBS 352.49</ext-link>
.
<bold>South Korea</bold>
, Hongcheon, on leaves of
<italic>Rhododendron</italic>
sp., 18 Oct. 2009, H.D. Shin, KACC 44865 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128605&link_type=cbs">CBS 128605</ext-link>
.</p>
<p id="P206">
<bold>
<italic>Sphaerulina berberidis</italic>
</bold>
(Niessl) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804409&link_type=mb">MB804409</ext-link>
.</p>
<p id="P207">
<italic>Basionym</italic>
:
<italic>Septoria berberidis</italic>
Niessl, in Rabenhorst, Bot. Ztg. 24: 411. 1866.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Sphaerella berberidis</italic>
Auersw., in Gonnermann & Rabenhorst, Mycol. eur. Abbild. Sämmtl. Pilze Eur. 5-6: 3. 1869 (nom. nov. for
<italic>Sphaeria berberis</italic>
Nitschke ex Fuckel).</p>
<list list-type="simple">
<list-item>
<p>
<italic>Mycosphaerella berberidis</italic>
(Auersw.) Lindau, in Engler & Prantl, Nat. Pflanzenfam., Teil. I (Leipzig) 1(1): 424. 1897.</p>
</list-item>
</list>
</list-item>
</list>
<p id="P208">
<italic>Description in vitro</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=116724&link_type=cbs">CBS 116724</ext-link>
):
<italic>Colonies</italic>
on OA 16-20 mm diam after 14 d, with an even, colourless margin; colonies spreading to restricted, somewhat elevated in the centre, the surface covered by a dense mat of pure white, woolly aerial mycelium; reverse in the centre dark brick to brown vinaceous, surrounded by cinnamon tinges; small amounts of a yellow to greenish pigment diffusies into the surrounding medium.
<italic>Colonies</italic>
on MEA 8-10 mm diam after 14 d, with an even to slighlty ruffled vinaceous buff margin; colonies restricted, pustulate, the surface ochraceous or darker, with diffuse to locally more dense finely felted grey aerial mycelium; reverse brown vinaceous to vinaceous buff. Culture remained sterile.</p>
<p id="P209">
<italic>Specimen examined</italic>
:
<bold>Switzerland</bold>
, Kt. Graubünden, Rodels-Realta, on
<italic>Berberis vulgaris</italic>
(
<italic>Berberidaceae</italic>
), 2 Jun. 1951, E. Müller, specimen
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-4984&link_type=cbs">CBS-H4984</ext-link>
, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=324.52&link_type=cbs">CBS 324.52</ext-link>
.</p>
<p id="P210">
<bold>
<italic>Sphaerulina betulae</italic>
</bold>
(Pass.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804410&link_type=mb">MB804410</ext-link>
.</p>
<p id="P211">
<italic>Basionym</italic>
:
<italic>Septoria betulae</italic>
Pass., Primo Elenc. Funghi Parm.: no. 52. 1867.</p>
<p id="P212">
<italic>Specimens examined</italic>
:
<bold>Netherlands</bold>
, Olst, leaves of
<italic>Betula pubescens</italic>
(
<italic>Betulaceae</italic>
), Sep. 2004, S. Green,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=116724&link_type=cbs">CBS 116724</ext-link>
.
<bold>South Korea</bold>
, Hongcheon, leaves of
<italic>B. platyphylla</italic>
var.
<italic>japonica</italic>
, 27 May 2008, H.D. Shin,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128600&link_type=cbs">CBS 128600</ext-link>
=KACC 43769.</p>
<p id="P213">
<bold>
<italic>Sphaerulina cercidis</italic>
</bold>
(Fr.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804411&link_type=mb">MB804411</ext-link>
.</p>
<p id="P214">
<italic>Basionym</italic>
:
<italic>Septoria cercidis</italic>
Fr., in Léveillé, Ann. Sci. Nat., Bot., Sér. 3 9: 251. 1848.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Septoria provencialis</italic>
Crous, Stud. Mycol. 55: 127. 2006.</p>
</list-item>
</list>
<p id="P215">
<italic>Specimens examined</italic>
:
<bold>Argentina</bold>
, La Plata, on
<italic>Cercis siliquastrum</italic>
(
<italic>Caesalpiniaceae</italic>
), 12 Feb. 2008, H.D. Shin, KACC 43596 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=129151&link_type=cbs">CBS 129151</ext-link>
; on
<italic>C. siliquastrum</italic>
, 1 Sep. 2007, H.D. Shin, KACC 44497 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128634&link_type=cbs">CBS 128634</ext-link>
.
<bold>France</bold>
, Provence, Cheval Blanc camping site, on leaves of
<italic>Eucalyptus</italic>
sp., 29 Jul. 2005, P.W. Crous,
<bold>holotype</bold>
of
<italic>S. provincialis</italic>
,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-19701&link_type=cbs">CBS H-19701</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=118910&link_type=cbs">CBS 118910</ext-link>
.
<bold>Netherlands</bold>
, on
<italic>C. siliquastrum</italic>
, Sep. 1950, G. van den Ende,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=501.50&link_type=cbs">CBS 501.50</ext-link>
.</p>
<p id="P216">
<bold>
<italic>Sphaerulina menispermi</italic>
</bold>
(Thüm.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804412&link_type=mb">MB804412</ext-link>
.</p>
<p id="P217">
<italic>Basionym</italic>
:
<italic>Septoria menispermi</italic>
Thüm., Pilzflora Siber.: no. 818. 1880.</p>
<p id="P218">
<italic>Specimens examined</italic>
:
<bold>South Korea</bold>
, Chuncheon, on leaves of
<italic>Menispermum dauricum</italic>
(
<italic>Menispermaceae</italic>
), 16 Jun. 2008, H.D. Shin, KACC 43848 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128761&link_type=cbs">CBS 128761</ext-link>
; Pyeongchang, on leaves of
<italic>M. dauricum</italic>
, 23 Sep. 2008, H.D. Shin, KACC 43968 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128666&link_type=cbs">CBS 128666</ext-link>
.</p>
<p id="P219">
<bold>
<italic>Sphaerulina musiva</italic>
</bold>
(Peck) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804413&link_type=mb">MB804413</ext-link>
.</p>
<p id="P220">
<italic>Basionym</italic>
:
<italic>Septoria musiva</italic>
Peck, Ann. Rep. N.Y. St. Mus. Nat. Hist. 35: 138. 1883 [1881]</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Mycosphaerella populorum</italic>
G.E. Thomps., Phytopathology 31: 246. 1941.</p>
<list list-type="simple">
<list-item>
<p>
<italic>Davidiella populorum</italic>
(G.E. Thomps.) Aptroot, CBS Diversity Ser. (Utrecht) 5: 164. 2006.</p>
</list-item>
</list>
</list-item>
<list-item>
<p>=
<italic>Cylindrosporium oculatum</italic>
Ellis & Everh., J. Mycol. 5(3): 155. 1889.</p>
</list-item>
</list>
<p id="P221">
<italic>Specimen examined</italic>
:
<bold>Canada</bold>
, Quebec, leaf spot of
<italic>Populus deltoids</italic>
(
<italic>Salicaceae</italic>
), J. LeBoldus,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=130570&link_type=cbs">CBS 130570</ext-link>
.</p>
<p id="P222">
<bold>
<italic>Sphaerulina oxyacanthae</italic>
</bold>
(Kunze & J.C. Schmidt) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804414&link_type=mb">MB804414</ext-link>
. Figs
<xref ref-type="fig" rid="F29">29</xref>
,
<xref ref-type="fig" rid="F30">30</xref>
.</p>
<fig id="F29" position="float">
<label>Fig. 29.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Sphaerulina oxyacanthae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135098&link_type=cbs">CBS 135098</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig29"></graphic>
</fig>
<fig id="F30" position="float">
<label>Fig. 30.</label>
<caption>
<p>
<italic>Sphaerulina oxyacanthae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135098&link_type=cbs">CBS 135098</ext-link>
). A. Leaves with leaf spots. B. Close-up of conidiomata. C. Section though conidioma. D-F. Conidiogenous cells. G. Conidia (note appendages). Scale bars: C = 150 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig30"></graphic>
</fig>
<p id="P223">
<italic>Basionym</italic>
:
<italic>Septoria oxyacanthae</italic>
Kunze & J.C. Schmidt, Myk. Hefte (Leipzig) 2: 108. 1823.</p>
<list list-type="simple">
<list-item>
<p>
<italic>Phloeospora oxyacanthae</italic>
(Kunze & J.C. Schmidt) Wallr., Fl. Crypt. Germ. (Norimbergae) 2: 117. 1833.</p>
</list-item>
</list>
<p id="P224">
<italic>Leaf spots</italic>
amphigenous, medium to dark brown, subcircular to angular, 1-6 mm diam, with dark brown border.
<italic>Conidiomata</italic>
epiphyllous, up to 150 μm diam, brown, immersed, subepidermal, opening by irregular rupture of upper layer, with 3-4 apical flaps, exuding a long crystalline flame-like cirrhus of conidia; wall 3-8 layers of brown
<italic>textura angularis</italic>
. On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiophores</italic>
reduced to conidiogenous cells, or with one supporting cell that can become fertile, forming a lateral conidiogenous locus just below the septum, 10-20 × 2.5-4 μm.
<italic>Conidiogenous cells</italic>
hyaline, smooth, aggregated, lining the inner cavity, terminal and lateral, ampulliform, 5-10 × 2.5-3.5 μm; proliferating several times percurrently near apex.
<italic>Conidia</italic>
hyaline, smooth, guttulate, 6-12-septate, falcate, widest in lower third of conidium, flexuous, apical cell tapering to subacute apex, forming a curved apical appendage-like elongation, 10-17 μm long, median cells are 5-10 μm long, basal cell forming an eccentric appendage that tapers to a subacutely rounded base, scar approximately 2-4 μm below basal septum; basal cell (incl. appendage) 11-20 μm long, conidia (60-)75-90(-100) × 2(-2.5) μm.</p>
<p id="P225">
<italic>Culture characteristics</italic>
: Colonies on PDA umbonate with undulate edge and sparse, white aerial mycelium, surface isabelline, reverse greyish sepia, after 14 d, 3 cm diam; similar on MEA and PDA.</p>
<p id="P226">
<italic>Specimen examined</italic>
:
<bold>Netherlands</bold>
, Wageningen, 51°57’50.43”N 5°41’0.41”E, on leaves of
<italic>Crataegus</italic>
sp. (
<italic>Rosaceae</italic>
), Sep. 2012, W. Quaedvlieg (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21291&link_type=cbs">CBS H-21291</ext-link>
, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135098&link_type=cbs">CBS 135098</ext-link>
=S654).</p>
<p id="P227">
<italic>Notes</italic>
: Several septoria-like species have been described from leaves of
<italic>Crataegus</italic>
(
<xref ref-type="bibr" rid="R49">Farr & Rossman 2013</xref>
). The present collection matches the description of
<italic>Septoria oxyacanthae</italic>
(leaf spots on
<italic>Crataegus oxyacantha</italic>
in Germany, conidia 8-12-septate; conidial dimensions not given). Unfortunately we have been unable to locate type material of this species.</p>
<p id="P228">
<bold>
<italic>Sphaerulina patriniae</italic>
</bold>
(Miura) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804415&link_type=mb">MB804415</ext-link>
.</p>
<p id="P229">
<italic>Basionym</italic>
:
<italic>Septoria patriniae</italic>
Miura, Flora of Manchuria and East Mongolia, III Cryptogams, Fungi (Industr. Contr. S. Manch. Rly 27) 3: 465. 1928.</p>
<p id="P230">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, Pocheon, on leaves of
<italic>Patrinia scabiosaefolia</italic>
(
<italic>Valerianaceae</italic>
), 20 Aug. 2006, H.D. Shin, KACC 42518 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128653&link_type=cbs">CBS 128653</ext-link>
.</p>
<p id="P231">
<bold>
<italic>Sphaerulina populicola</italic>
</bold>
(Peck) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804416&link_type=mb">MB804416</ext-link>
.</p>
<p id="P232">
<italic>Basionym</italic>
:
<italic>Septoria populicola</italic>
Peck, Ann. Rep. N.Y. St. Mus. 40: 59. 1887.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Septoria populicola</italic>
House, Bull. N.Y. St. Mus.: 59. 1920. (nom. illegit.)</p>
</list-item>
<list-item>
<p>=
<italic>Mycosphaerella populicola</italic>
C.H. Thomps., Phytopathology 31: 251. 1941.</p>
</list-item>
</list>
<p id="P233">
<italic>Specimen examined</italic>
:
<bold>USA</bold>
, Washington, Puyallup, on
<italic>Populus trichocarpa</italic>
(
<italic>Salicaceae</italic>
), 2 May 1997, G. Newcombe,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=100042&link_type=cbs">CBS 100042</ext-link>
.</p>
<p id="P234">
<bold>
<italic>Sphaerulina pseudovirgaureae</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804417&link_type=mb">MB804417</ext-link>
. Figs
<xref ref-type="fig" rid="F31">31</xref>
,
<xref ref-type="fig" rid="F32">32</xref>
.</p>
<fig id="F31" position="float">
<label>Fig. 31.</label>
<caption>
<p>Conidia, conidiogenous loci on a hypha, and conidiogenous cells of
<italic>Sphaerulina pseudovirgaureae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135109&link_type=cbs">CBS 135109</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig31"></graphic>
</fig>
<fig id="F32" position="float">
<label>Fig. 32.</label>
<caption>
<p>
<italic>Sphaerulina pseudovirgaureae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135109&link_type=cbs">CBS 135109</ext-link>
). A. Conidiomata forming in culture. B. Conidiogenous cells. C. Microcyclic conidiation. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig32"></graphic>
</fig>
<p id="P235">
<italic>Etymology</italic>
: Named after its similarity to
<italic>Septoria virgaureae</italic>
.</p>
<p id="P236">Conidiomata pycnidial, separate, erumpent, globose, up to 120 μm diam, dark brown, exusing a creamy conidial cirrhus through central ostiole, somewhat papillate; wall of 2-3 laters of brown textura angularis. Conidiophores reduced to conidiogenous cells or with one supporting cell, subcylindrical, 0-1-septate, branched below or not, pale brown at base, 10-20 × 3-5 μm. Conidiogenous cells integrated, hyaline, but pale brown at base, smooth, proliferating sympodially near apex, 7-17 × 2-3 μm. Conidia solitary, hyaline, smooth, guttulate, subcylindrical to narrowly obclavate, scolecosporous, irregularly curved, apex subobtuse, base truncate or narrowly obconically truncate, 3-10-septate, (30-)40-60(-80) × 2.5(-3) μm.</p>
<p id="P237">
<italic>Culture characteristics</italic>
: Colonies spreading, erumpent with sparse aerial mycelium and smooth, lobate margin and folded surface; reaching 13 mm diam after 2 wk. On MEA surface saffron with patches of dirty white, reverse saffron to orange; on PDA surface and reverse saffron; on OA surface saffron.</p>
<p id="P238">
<italic>Specimen examined</italic>
:
<bold>Netherlands</bold>
, Nijmegen, de Duffelt, on leaves of
<italic>Solidago gigantea</italic>
(
<italic>Asteraceae</italic>
), Aug. 2012, S. Videira (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21327&link_type=cbs">CBS H-21327</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135109&link_type=cbs">CBS 135109</ext-link>
=S669).</p>
<p id="P239">
<italic>Notes</italic>
: Several septoria-like species have been recorded on
<italic>Solidago</italic>
(
<xref ref-type="bibr" rid="R49">Farr & Rossman 2013</xref>
). Of these taxa
<italic>Sphaerulina pseudovirgaureae</italic>
is most similar to
<italic>Septoria virguareae</italic>
(conidia 80-100 × 1.5 μm) except that its conidia are shorter and wider.</p>
<p id="P240">
<bold>
<italic>Sphaerulina quercicola</italic>
</bold>
(Desm.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804419&link_type=mb">MB804419</ext-link>
. Figs
<xref ref-type="fig" rid="F33">33</xref>
,
<xref ref-type="fig" rid="F34">34</xref>
.</p>
<fig id="F33" position="float">
<label>Fig. 33.</label>
<caption>
<p>Ascospores and asci of
<italic>Sphaerulina quercicola</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=113266&link_type=cbs">CBS 113266</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig33"></graphic>
</fig>
<fig id="F34" position="float">
<label>Fig. 34.</label>
<caption>
<p>
<italic>Sphaerulina quercicola</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=663.94&link_type=cbs">CBS 663.94</ext-link>
). A. Leaves with leaf spots. B. Close-up of lesion. C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig34"></graphic>
</fig>
<p id="P241">
<italic>Basionym</italic>
:
<italic>Septoria incondita</italic>
var.
<italic>quercicola</italic>
Desm., Ann. Sci. nat., Sér. 3, Bot. 20: 95. 1853.</p>
<list list-type="simple">
<list-item>
<list list-type="simple">
<list-item>
<p>
<italic>Septoria quercicola</italic>
(Desm.) Sacc., Michelia 1: 174. 1879.</p>
</list-item>
<list-item>
<p>
<italic>Phleospora quercicola</italic>
(Desm.) Sacc., in
<xref ref-type="bibr" rid="R94">P. A. Saccardo & D. Saccardo, 1906</xref>
. Syll. Fung. 18: 490. 1906.</p>
</list-item>
</list>
</list-item>
<list-item>
<p>=
<italic>Septoria quercina</italic>
Fautr., in Fautrey & Lambotte, Revue Mycol. 17: 170. 1895 (nom. illeg., art. 53; non
<xref ref-type="bibr" rid="R38">Desmazières, 1847</xref>
). Nom. nov. pro
<italic>Septoria quercicola</italic>
f.
<italic>macrospora</italic>
Roum., Revue Mycol. 13: 80. 1891.</p>
</list-item>
</list>
<p id="P242">Description
<italic>in vivo. Symptoms</italic>
definite, small hologenous leaf spots, scattered or in clusters, in the centre orange brown, pale yellowish brown to white, usually delimited by a blackened, somewhat elevated zone, the surrounding leaf tissues becoming red or yellow.
<italic>Conidiomata</italic>
pycnidial or acervuloid, one to a few in each leafspot, scattered, semi-immersed, predominantly hypophyllous, pale to dark brown, lenticular to globose, 100-200 μm diam;
<italic>ostiolum</italic>
often not well-developed, initially circular, central, soon opening widely, lacking distinctly differentiated cells;
<italic>conidiomatal wall</italic>
composed of
<italic>textura angularis</italic>
without distinctly differentiated layers and sometimes only well-developed in the lower part of the conidioma, mostly 10-15 μm thick, the outer cells with brown, somewhat thickened walls and 4.5-8 μm diam, the inner cells hyaline, thin-walled, 3-8 μm diam.
<italic>Conidiogenous cells</italic>
hyaline, discrete or integrated in simple, short, (1-)3-5-septate conidiophores which may be branched at the base, doliiform, cylindrical, or ampuliform, hyaline, holoblastic, proliferating percurrently with one to several, more or less distinct annellations, or sympodially, sometimes both types of proliferation occurring in a single conidiogenous cell, 4.5-16(-22.5) × 3-4.5 μm.
<italic>Conidia</italic>
cylindrical, curved or flexuous, broadly rounded at the apex which is provided with a cap of mucilaginous material, attenuated gradually to a broadly or more narrowly truncate base which often is also provided with an amorphous mass of mucilaginous material, hyaline, (0-)1-3-septate, constricted around the septa, sometimes at one or more septa also some amorphous mucilaginous material may be present, contents with numerous small oil droplets, (32.5-)38-50(-65) × 3-4 μm.
<italic>Ascomata</italic>
not clearly associated with leaf spots, pseudothecial, predominantly hypophyllous, black, subepidermal, erumpent to superficial, globose, 100-150 μm diam; apical ostiole 5-10 μm wide; wall consisting of 2-3 layers of medium brown
<italic>textura angularis. Asci</italic>
aparaphysate, fasciculate, bitunicate, subsessile, broadly ellipsoidal to subcylindrical, straight to slightly curved, 8-spored, 35-50 × 9-12 μm.
<italic>Ascospores</italic>
tri- to multiseriate, overlapping, hyaline, guttulate, thin-walled, curved, rarely straight, fusoid-ellipsoidal with obtuse ends, widest at septum or just above, medianly 1-septate, not constricted at the septum, tapering towards both ends, (13-)15-18(-20) × (3.5-)4-4.5(-5) μm (av. 17 × 4.5 μm).</p>
<p id="P243">
<italic>Culture characteristics</italic>
: Colonies on OA reaching 5-7 mm diam in 21 d, with an even to undulating, colourless margin; colonies restricted, irregularly pustulate, immersed mycelium appearing dark greyish to olivaceous black, rosy buff near the margin, covered mostly with a dense mat of woolly, pure white or greyish aerial mycelium; reverse in the centre brown vinaceous or more greyish black, surrounded by brick to rosy buff. Pycnidia developing on the agar surface in the centre, releasing droplets of rosy-buff conidial slime.
<italic>Colonies</italic>
on MEA reaching 4-6(-8) mm diam in 21 d, with an even, to irregularly undulating margin which is mostly hidden under the aerial mycelium; colonies restricted, irregularly pustulate, the surface mostly blackish or very dark grey, covered by dense to diffuse, finely felted, white aerial mycelium; reverse mostly olivaceous black, near the margin cinnamon to buff. Numerous single and aggregated pycnidia developing on the colony surface in the centre, releasing milky white to rosy buff conidial slime.
<italic>Conidia</italic>
as
<italic>in planta</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=663.94&link_type=cbs">CBS 663.94</ext-link>
) though on average considerably longer, 51.5-74.5 × 3-4(-4.5) μm (OA), the apex, base and area around septa normally both provided with mucilaginous material as described above, (0-)1-3(-5)-septate.</p>
<p id="P244">
<italic>Specimens examined</italic>
:
<bold>Austria</bold>
, endophyte culture ex twig of
<italic>Quercus petraea</italic>
(
<italic>Fagaceae</italic>
), Aug. 1991, E. Halmschlager 212 (H. A. van der Aa 10986),
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=456.91&link_type=cbs">CBS 456.91</ext-link>
.
<bold>France</bold>
, loc. unknown, on leaves of
<italic>Quercus</italic>
sp. (“divers Chênes”), distributed in Desmazières, Pl. crypt. Fr., Fasc. 43, no. 2193 (PC, type of
<italic>Septoria incondita</italic>
var.
<italic>quercicola</italic>
Desm.).
<bold>Netherlands</bold>
, Utrecht, Baarn, on living leaves of
<italic>Q. robur</italic>
, 11 Aug. 1994, G. Verkley 225 (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21188&link_type=cbs">CBS H-21188</ext-link>
), living culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=663.94&link_type=cbs">CBS 663.94</ext-link>
; prov. Utrecht, Soest, De Stompert, on living leaves of
<italic>Q. rubra,</italic>
15 Aug. 1995, G. Verkley 310 (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21189&link_type=cbs">CBS H-21189</ext-link>
),
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=791.95&link_type=cbs">CBS 791.95</ext-link>
; Same loc., dead fallen leaves of
<italic>Q. robur</italic>
, Apr. 2003, G. Verkley
<italic>s.n.</italic>
, single ascospore-isolate
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=113266&link_type=cbs">CBS 113266</ext-link>
(’Crous 3’); Same loc., G. Verkley & I. van Kempen, endophyte isolates ex green leaves of
<italic>Q. robur</italic>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=115016&link_type=cbs">CBS 115016</ext-link>
,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=115136&link_type=cbs">115136</ext-link>
,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=115137&link_type=cbs">115137</ext-link>
; Prov. Gelderland, Amerongen, Park Kasteel Amerongen, leaf spot of
<italic>Q. rubra</italic>
, 11 Jul. 2000, G. Verkley 973 (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21231&link_type=cbs">CBS H-21231</ext-link>
), living culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=109009&link_type=cbs">CBS 109009</ext-link>
; Prov. Utrecht, Amelisweerd, on dead leaves of
<italic>Q. robur</italic>
, 25 Apr. 2005, G. Verkley 3108A, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=117803&link_type=cbs">CBS 117803</ext-link>
, CPC 12097.</p>
<p id="P245">
<bold>
<italic>Sphaerulina rhabdoclinis</italic>
</bold>
(Butin) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804420&link_type=mb">MB804420</ext-link>
.
<xref ref-type="fig" rid="F35">Fig. 35</xref>
.</p>
<fig id="F35" position="float">
<label>Fig. 35.</label>
<caption>
<p>
<italic>Sphaerulina rhabdoclinis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102195&link_type=cbs">CBS 102195</ext-link>
). A. Conidiomata forming in culture. B. Sporulation on PDA. C. Conidia. Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig35"></graphic>
</fig>
<p id="P246">
<italic>Basionym</italic>
:
<italic>Dothistroma rhabdoclinis</italic>
Butin, For. Path. 30: 196. 2000.</p>
<p id="P247">
<italic>Specimen examined</italic>
:
<bold>Germany</bold>
, Wolfenbüttel, on needles of
<italic>Pseudotsuga menziesii</italic>
(
<italic>Pinaceae</italic>
), 24 May 1998, H. Butin, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102195&link_type=cbs">CBS 102195</ext-link>
.</p>
<p id="P248">
<italic>Note</italic>
:
<italic>Sphaerulina rhabdoclinis</italic>
is phylogenetically closely related to
<italic>S. amelanchier</italic>
, which appears to be a species complex occurring on unrelated hosts (see
<xref ref-type="bibr" rid="R117">Verkley
<italic>et al</italic>
. 2013</xref>
).</p>
<p id="P249">
<bold>
<italic>Sphaerulina viciae</italic>
</bold>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804418&link_type=mb">MB804418</ext-link>
. Figs
<xref ref-type="fig" rid="F36">36</xref>
,
<xref ref-type="fig" rid="F37">37</xref>
.</p>
<fig id="F36" position="float">
<label>Fig. 36.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Sphaerulina viciae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=131898&link_type=cbs">CBS 131898</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig36"></graphic>
</fig>
<fig id="F37" position="float">
<label>Fig. 37.</label>
<caption>
<p>
<italic>Sphaerulina viciae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=131898&link_type=cbs">CBS 131898</ext-link>
). A. Conidiomata forming in culture. B, C, E. Conidiogenous cells. D, F. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig37"></graphic>
</fig>
<p id="P250">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Vicia</italic>
.</p>
<p id="P251">On
<italic>Anthriscus</italic>
stem. Conidiomata pycnidial, solitary, erumpent, brown, globose, up to 150 μm diam, with central ostiole; wall of 3-6 layers of textura angularis. Conidiophores reduced to conidiogenous cells. Conidiogenous cells lining the inner cavity, hyaline, smooth, subcylindrical, tapering and proliferating sympodially at apex, 5-10 × 3-4 μm. Conidia hyaline, smooth, guttulate, subcylindrical, irregularly curved, apex obtuse, base truncate, (3-)6-multiseptate, not or slightly constricted at septa (especially constricted on SNA, OA and MEA), (45-)55-75(-110) × (2.5-)3(-3.5) μm.</p>
<p id="P252">
<italic>Culture characteristics</italic>
: Colonies erumpent, spreading with folded surface and sparse aerial mycelium, and smooth, lobate margin; reaching 12 mm diam after 2 wk. On MEA and PDA surface and reverse olivaceous-grey. On OA surface pale olivaceous-grey.</p>
<p id="P253">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, on leaves of
<italic>Vicia amurense</italic>
(
<italic>Fabaceae</italic>
), 12 Aug. 2004, H.D. Shin (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21283&link_type=cbs">CBS H-21283</ext-link>
, culture ex-type CPC 11414, 11416, 11415 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=131898&link_type=cbs">CBS 131898</ext-link>
).</p>
<p id="P254">
<italic>Notes</italic>
: Several septoria-like species are known from
<italic>Vicia</italic>
(
<xref ref-type="bibr" rid="R49">Farr & Rossman 2013</xref>
). Of these,
<italic>Sphaerulina viciae</italic>
is most similar to
<italic>Septoria viceae</italic>
(conidia 30-60 × 2.5 μm), but distinct in having longer and wider conidia.</p>
</sec>
<sec id="S21">
<title>Clade 3:
<italic>Caryophylloseptoria</italic>
</title>
<p id="P255">
<italic>Description</italic>
: See Verkley
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R117">2013</xref>
)</p>
<p id="P256">
<italic>Type species</italic>
:
<italic>Caryophylloseptoria lychnidis</italic>
(Desm.) Verkley, Quaedvlieg & Crous.</p>
<p id="P257">
<bold>
<italic>Caryophylloseptoria pseudolychnidis</italic>
</bold>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804481&link_type=mb">MB804481</ext-link>
.
<xref ref-type="fig" rid="F38">Fig. 38</xref>
.</p>
<fig id="F38" position="float">
<label>Fig. 38.</label>
<caption>
<p>
<italic>Caryophylloseptoria pseudolychnidis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128630&link_type=cbs">CBS 128630</ext-link>
). A. Colony sporulating on MEA. B. Vertical section through conidiomata. C, D. Conidiogenous cells. E. Conidia. Scale bar: B = 250 μm, others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig38"></graphic>
</fig>
<p id="P258">
<italic>Etymology</italic>
: Named after its morphological similarity to
<italic>Septoria lychnidis</italic>
.</p>
<p id="P259">
<italic>Leaf spots</italic>
on the upper leaf surface, scattered to confluent, distinct, circular, angular to irregular, usually very large, reaching up to 20 mm diam, often surrounded with yellow halo, lacking concentric rings, initially dark brown with pale green border, becoming brown to dark brown, finally turning greyish brown to pallid in the centre; on the lower leaf surface greyish brown to brown with yellowish margin (
<xref ref-type="bibr" rid="R98">Shin & Sameva 2004</xref>
). On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
pycnidial, globose, up to 250 μm diam, black with central ostiole, but frequently splitting open at maturity, appearing acervular; wall of 6-8 layers of dark brown
<italic>textura angularis. Conidiophores</italic>
subcylindrical, lining the inner cavity, hyaline, smooth, reduced to conidiogenous cells, or with 1-2 supporting cells, frequently branched at base, 10-25 × 3-5 μm.
<italic>Conidiogenous cells</italic>
subcylindrical to ampulliform, 7-15 × 3-5 μm; proliferating sympodially or percurrently near apex.
<italic>Conidia</italic>
hyaline, smooth, guttulate, cylindrical, apex obtuse to subobtuse, base truncate, 3-3.5 μm; 1-3(-5)-septate, (25-)32-45(-50) × (2-)2.5-3(-3.5) μm.</p>
<p id="P260">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, undulate, very sparse, mixed grey and white aerial mycelium, surface isabelline to fuscous-black, reverse olivaceous-black to isabelline for the younger tissue, after 14 d, 3 cm diam; on MEA umbonate, striate, undulate, surface fuscous-black to honey for the younger tissue after 14 d 3.5 cm diam; on OA surface dark-mouse-grey, reverse iron-grey to mouse-grey.</p>
<p id="P261">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, Yangpyeong, Jungmi mountain, on leaves of
<italic>Lychnis cognata</italic>
(
<italic>Caryophyllaceae</italic>
), 27 May 2007, H.D. Shin (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21292&link_type=cbs">CBS H-21292</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128630&link_type=cbs">CBS 128630</ext-link>
=KACC 43866 = SMKC 23519).</p>
<p id="P262">
<italic>Notes</italic>
: Shin (
<xref ref-type="bibr" rid="R96">1995</xref>
) recorded this species for the first time in Korea, while Shin & Sameva (1999) provided a full morphologial description. Although it compared well with the original description of this European taxon, its conidia tend to be smaller than those of
<italic>S. lychnidis</italic>
(50-70 × 2.5-3 μm), of which we have also examined European material (see
<xref ref-type="bibr" rid="R117">Verkley
<italic>et al</italic>
. 2013</xref>
, this issue).</p>
</sec>
<sec id="S22">
<title>Clade 4: pseudocercosporella-like</title>
<p id="P263">
<italic>Note</italic>
: See Frank
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R52">2010</xref>
).</p>
</sec>
<sec id="S23">
<title>Clade 5:
<italic>Cercospora</italic>
</title>
<p id="P264">
<italic>Note</italic>
: See Groenewald
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R57">2013</xref>
).</p>
</sec>
<sec id="S24">
<title>Clade 6:
<italic>Phloeospora</italic>
</title>
<p id="P265">
<italic>Description</italic>
: See above.</p>
<p id="P266">
<italic>Type species</italic>
:
<italic>P. ulmi</italic>
(Fr.) Wallr., Fl. Crypt. Germ. (Norimbergae) 2: 177. 1833.</p>
<p id="P267">
<bold>
<italic>Phloeospora ulmi</italic>
</bold>
(Fr.) Wallr., Fl. Crypt. Germ. (Norimbergae) 2: 177. 1833. Figs
<xref ref-type="fig" rid="F39">39</xref>
,
<xref ref-type="fig" rid="F40">40</xref>
.</p>
<fig id="F39" position="float">
<label>Fig. 39.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Phloeospora ulmi</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=613.81&link_type=cbs">CBS 613.81</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig39"></graphic>
</fig>
<fig id="F40" position="float">
<label>Fig. 40.</label>
<caption>
<p>
<italic>Phloeospora ulmi</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=613.81&link_type=cbs">CBS 613.81</ext-link>
). A, B, D, E. Conidiomata bursting through host tissue. G, H. Microconidiogenous cells. K. Spermatia. C, F, I, J, L. Macroconidiogenous cells (arrows denote percurrent proliferation). M. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig40"></graphic>
</fig>
<list list-type="simple">
<list-item>
<list list-type="simple">
<list-item>
<p>
<italic>Septoria ulmi</italic>
Fr. [as ‘
<italic>Septaria</italic>
’], Novit. Fl. Svec. 5(cont.): 78. 1819.</p>
</list-item>
<list-item>
<p>
<italic>Septogloeum ulmi</italic>
(Fr. & Kunze) Died., Krypt. Fl. Brandenburg (Leipzig) 9: 836. 1915.</p>
</list-item>
<list-item>
<p>
<italic>Cylindrosporium ulmi</italic>
(Fr.) Vassiljevsky, Fungi Imperfecti Parasitici 2: 580. 1950.</p>
</list-item>
</list>
</list-item>
<list-item>
<p>=
<italic>Mycosphaerella ulmi</italic>
Kleb., Z. PflKrankh. 12: 257. 1902.</p>
</list-item>
<list-item>
<p>=
<italic>Sphaerella ulmi</italic>
(Kleb.) Sacc. & D. Sacc., Syll. Fung. (Abellini) 17: 642. 1905.</p>
</list-item>
</list>
<p id="P268">
<italic>Leaf spots</italic>
angular, vein limited, separate, becoming somewhat confluent, initially small yellow-green spots that finally turn brown.
<italic>Conidiomata</italic>
acervular, hypophyllous, separate, subepidermal, composed of thin-walled, medium brown
<italic>textura angularis</italic>
, up to 200 μm diam, opening by irregular rupture, and exuding a prominent cirrhus of orange to yellow-orange conidia.
<italic>Conidiophores</italic>
reduced to conidiogenous cells, or with 1-2 supporting cells, branched below or not, subcylindrical, 10-30 × 4-5 μm.
<italic>Conidiogenous cells</italic>
hyaline, smooth, subcylindrical, straight to once geniculate, with numerous prominent percurrent proliferations at apex, 10-15 × 4-5 μm.
<italic>Conidia</italic>
solitary, hyaline, smooth, straight to curved, guttulate or not, fusiform, tapering towards an obtuse or subobtuse apex, and truncate base, 2-3 μm diam, with minute marginal frill, 3-5-septate, (20-)30-50(-60) × (3.5-)4-5(-6) μm. Leaf spots also contain black spermatogonia and ascomata.</p>
<p id="P269">
<italic>Specimens examined</italic>
:
<bold>Austria</bold>
, Innsbruck, near Hungerburg, on leaves of
<italic>Ulmus</italic>
sp. (
<italic>Ulmaceae</italic>
), 21 Sep. 1981, H.A. van der Aa,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-14740&link_type=cbs">CBS H-14740</ext-link>
, H-14861, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=613.81&link_type=cbs">CBS 613.81</ext-link>
; Innsbruck, road to Hungerburg, on leaves of
<italic>Ulmus glabra</italic>
, 20 Oct. 1996, W. Gams,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=344.97&link_type=cbs">CBS 344.97</ext-link>
.
<bold>Netherlands</bold>
, Baarn, garden of CBS, Oosterstraat 1, on leaves of
<italic>Ulmus</italic>
sp., 26 Aug. 1998, H.A. van der Aa,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-14739&link_type=cbs">CBS H-14739</ext-link>
, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=101564&link_type=cbs">CBS 101564</ext-link>
.
<bold>Unknown</bold>
, on leaves of
<italic>Ulmus pedunculata</italic>
, 15 Jul. 1901, A. van Luijk,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-920&link_type=cbs">CBS H-920</ext-link>
.</p>
<p id="P270">
<italic>Note</italic>
: Distinct from
<italic>Septoria s. str.</italic>
by having acervuli, and conidiogenous cells with prominent percurrent proliferation.</p>
</sec>
<sec id="S25">
<title>Clade 7: septoria-like</title>
<p id="P271">
<bold>
<italic>Septoria gladioli</italic>
</bold>
Pass., in Rabenhorst, Fungi europ. exsicc.: no. 1956. 1875. Passerini, Atti Soc. crittog. ital. 2: 41. 1879.</p>
<p id="P272">
<italic>Descripton in vitro</italic>
(18 °C, NUV).
<italic>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=121.20&link_type=cbs">CBS 121.20</ext-link>
</italic>
:
<italic>Colonies</italic>
on OA 15-18 mm diam after 21 d, with an even to slightly ruffled, colourless margin; colonies plane, immersed mycelium olivaceous black, fading over amber towards the margin, aerial mycelium absent; reverse concolorous. No sporulation observed.
<italic>Colonies</italic>
on MEA 10-15 mm diam after 21 d, with an even, pale luteous to amber margin; colonies restricted, irregularly pustulate to cerebriform, immersed mycelium ochreous to salmon, covered by diffuse, finely felted, white aerial mycelium; reverse in the centre rust, fading towards the margin over apricot to pale luteous. No sporulation observed.
<italic>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=353.29&link_type=cbs">CBS 353.29</ext-link>
</italic>
:
<italic>Colonies</italic>
on OA 16-20 mm diam after 21 d, with an even to slightly ruffled, colourless margin; colonies plane, immersed mycelium rosy buff mixed with some olivaceous grey, aerial mycelium absent; reverse mainly pale purplish grey to pale mouse grey. No sporulation observed.
<italic>Colonies</italic>
on MEA 14-22(-26) mm diam after 21 d, with an even to lobed, buff margin; colonies restricted, elevated towards the centre, radially striate, immersed mycelium greenish olivaceous fading to ochreous or buff salmon, the central part mostly covered by diffuse, finely felted, white aerial mycelium; reverse in the centre dark brick to isabelline or hazel, fading towards the margin over pale cinnamon to buff. No sporulation observed.</p>
<p id="P273">
<italic>Specimen examined</italic>
:
<bold>Netherlands</bold>
, Mar. 1929, J.C. Went,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=353.29&link_type=cbs">CBS 353.29</ext-link>
. Unknown location and host, 1920, W.J. Kaiser,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=121.20&link_type=cbs">CBS 121.20</ext-link>
.</p>
<p id="P274">
<italic>Notes</italic>
: Priest (
<xref ref-type="bibr" rid="R86">2006</xref>
) provided a complete description of
<italic>S. gladioli</italic>
on host material, based on observations of an isotype in MEL, and several specimens on
<italic>Gladiolus</italic>
cultivars collected in Australia. The two strains available from the CBS are old and sterile, and show some differences that also seem to be reflected in the DNA data obtained.
<italic>Septoria gladioli</italic>
is the only species of septorioid fungi described from the genus
<italic>Gladiolus</italic>
. An unusual feature of the species is that it overwinters as “sclerotia”, that cause leaf infections in the next season (
<xref ref-type="bibr" rid="R86">Priest 2006</xref>
). The conidiogenous cells are holoblastic and very distinctly proliferate percurrently to form subsequent conidia, but no sympodial proliferation has been reported. Based on the multilocus phylogeny, the aforementioned isolates should be placed in their own genus, with the genus
<italic>Phloeospora</italic>
as its closest relative. Recollecting material will be required to determine the generic disposition, the delimitation of the taxa (as there seem to be at least two) and to which of these taxa the name
<italic>Septoria gladioli</italic>
should be applied.</p>
</sec>
<sec id="S26">
<title>Clade 8: passalora-like</title>
<p id="P275">
<bold>
<italic>Passalora dioscoreae</italic>
</bold>
(Ellis & G. Martin) U. Braun & Crous, in Crous & Braun, CBS Biodiversity Ser. (Utrecht) 1: 162. 2003.</p>
<p id="P276">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, on leaves of
<italic>Dioscorea tokoro</italic>
(
<italic>Dioscoreaceae</italic>
), 24 Oct. 2003, H.D. Shin (CPC 10855);
<italic>ibid</italic>
., on leaves of
<italic>Dioscorea tenuipes</italic>
, 1 Jan. 2004, H.D. Shin (CPC 11513).</p>
<p id="P277">
<italic>Notes</italic>
:
<italic>Passalora dioscoreae</italic>
is not congeneric with the type species of the genus,
<italic>P. bacilligera</italic>
. The taxonomy of
<italic>Passalora</italic>
and its relatives will be treated in a future publication (Videira
<italic>et al</italic>
., in prep.).</p>
</sec>
<sec id="S27">
<title>Clade 9:
<italic>Neoseptoria</italic>
</title>
<p id="P278">
<bold>
<italic>Neoseptoria</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804421&link_type=mb">MB804421</ext-link>
.</p>
<p id="P279">
<italic>Etymology</italic>
: Resembling the genus
<italic>Septoria</italic>
.</p>
<p id="P280">
<italic>Foliicolous. Conidiomata</italic>
black, immersed, subepidermal, pycnidial, subglobose with central ostiole, exuding creamy conidial mass; wall of 2-3 layers of brown
<italic>textura angularis. Conidiophores</italic>
0-2-septate, subcylindrical, hyaline to pale brown at base, smooth, straight to geniculate-sinuous.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, subcylindrical to ampulliform, straight to geniculate-sinuous; proliferating several times percurrently near apex, rarely sympodially.
<italic>Conidia</italic>
scolecosporous, hyaline, smooth, flexuous, rarely straight, granular, thin-walled, narrowly obclavate, apex subobtuse, base long obconically truncate, tapering to a truncate hilum, 3-multiseptate.</p>
<p id="P281">
<italic>Type species</italic>
:
<italic>Neoseptoria caricis</italic>
Quaedvlieg, Verkley & Crous.</p>
<p id="P282">
<italic>Note</italic>
: The genus
<italic>Neoseptoria</italic>
is morphologically similar to
<italic>Septoria</italic>
, but distinct in having mono- to polyphialidic conidiogenous cells that proliferate percurrently at the apex.</p>
<p id="P283">
<bold>
<italic>Neoseptoria caricis</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804422&link_type=mb">MB804422</ext-link>
. Figs
<xref ref-type="fig" rid="F41">41</xref>
,
<xref ref-type="fig" rid="F42">42</xref>
.</p>
<fig id="F41" position="float">
<label>Fig. 41.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Neoseptoria caricis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135097&link_type=cbs">CBS 135097</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig41"></graphic>
</fig>
<fig id="F42" position="float">
<label>Fig. 42.</label>
<caption>
<p>
<italic>Neoseptoria caricis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135097&link_type=cbs">CBS 135097</ext-link>
). A, B. Conidiomata developing in culture. C, D. Conidiogenous cells. E, F. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig42"></graphic>
</fig>
<p id="P284">
<italic>Etymology</italic>
: Named after the host genus on which it occurs,
<italic>Carex</italic>
.</p>
<p id="P285">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
up to 150 μm diam, black, immersed, subepidermal, pycnidial, subglobose with central ostiole, exuding creamy conidial mass; wall of 2-3 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells, or 0-2-septate, subcylindrical, hyaline to pale brown at base, smooth, straight to geniculate-sinuous, 10-30 × 2.5-3.5 μm.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, subcylindrical to ampulliform, straight to geniculate-sinuous, 8-15 × 2.5-3 μm; proliferating several times percurrently near apex, rarely sympodially.
<italic>Conidia</italic>
scolecosporous, hyaline, smooth, flexuous, rarely straight, granular, thin-walled, narrowly obclavate, apex subobtuse, base long obconically truncate, tapering to a truncate hilum, 1.5-2 μm diam, 3(-5)-septate, (40-)55-68(-80) × (2.5-)3(-3.5) μm.</p>
<p id="P286">
<italic>Culture characteristics</italic>
: Colonies on PDA erumpent, undulate, lacking aerial mycelium, reverse iron-grey, after 14 d, 3 cm diam; on MEA reverse greyish sepia, after 14 d, 3 cm diam, with fine, pale pink to orange aerial mycelium; on OA similar to MEA, but with pinkish tufts of aerial mycelium.</p>
<p id="P287">
<italic>Specimen examined</italic>
:
<bold>Netherlands</bold>
, Wageningen, on leaves of
<italic>Carex acutiformis</italic>
(
<italic>Cyperaceae</italic>
), Aug. 2012, W. Quaedvlieg (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21293&link_type=cbs">CBS H-21293</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135097&link_type=cbs">CBS 135097</ext-link>
=S653).</p>
<p id="P288">
<italic>Notes</italic>
: Several septoria-like species have been described from
<italic>Carex</italic>
(
<xref ref-type="bibr" rid="R49">Farr & Rossman 2013</xref>
). Of these,
<italic>N. caricis</italic>
is most similar to
<italic>S. caricicola</italic>
(conidia 25-55 × 4 μm; (6-)7(-8)-septate), but distinct in having longer and narrower conidia with less septa.</p>
</sec>
<sec id="S28">
<title>Clade 10:
<italic>Pseudocercospora</italic>
</title>
<p id="P289">
<italic>Note</italic>
: See Crous
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R19">2013</xref>
)</p>
</sec>
<sec id="S29">
<title>Clade 11:
<italic>Zymoseptoria</italic>
</title>
<p id="P290">
<italic>Note</italic>
: See Quaedvlieg
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R89">2011</xref>
).</p>
</sec>
<sec id="S30">
<title>Clade 12:
<italic>Ramularia</italic>
</title>
<p id="P291">
<italic>Note</italic>
: See Crous
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R25">2009a</xref>
,
<xref ref-type="bibr" rid="R29">c</xref>
).</p>
</sec>
<sec id="S31">
<title>Clade 13:
<italic>Dothistroma</italic>
</title>
<p id="P292">
<italic>Note</italic>
: See Barnes
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R5">2004</xref>
).</p>
</sec>
<sec id="S32">
<title>Clade 14:
<italic>Stromatoseptoria</italic>
</title>
<p id="P293">
<bold>
<italic>Stromatoseptoria</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804423&link_type=mb">MB804423</ext-link>
.</p>
<p id="P294">
<italic>Etymology</italic>
: Stroma = referring to central stoma in pycnidium that gives rise to conidiophores;
<italic>Septoria</italic>
= septoria-like morphology.</p>
<p id="P295">
<italic>Foliicolous</italic>
, plant pathogenic.
<italic>Conidiomata</italic>
pycnidial, hypophyllous, subglobose to lenticular, very pale brown to dark brown, immersed to erumpent, exuding conidia in white cirrhus;
<italic>ostiolum</italic>
central, circular, surrounding cells concolorous;
<italic>conidiomatal wall</italic>
composed of a homogenous tissue of hyaline to very pale brown, angular to irregular cells.
<italic>Conidiophores</italic>
subcylindrical, branched, hyaline, septate.
<italic>Conidiogenous cells</italic>
hyaline, discrete or integrated, cylindrical or narrowly ampulliform, holoblastic, often also proliferating percurrently.
<italic>Conidia</italic>
cylindrical, slightly to distinctly curved, broadly rounded apex, attenuated towards a truncate base, transversely euseptate, mostly constricted at septa.</p>
<p id="P296">
<italic>Type species</italic>
:
<italic>Stromatoseptoria castaneicola</italic>
(Desm.) Quaedvlieg, Verkley & Crous.</p>
<p id="P297">
<italic>Notes</italic>
:
<italic>Stromatoseptoria</italic>
is distinguished from
<italic>Septoria</italic>
based on the central cushion or stroma that gives rise to its conidiophores (
<italic>sensu Coniella</italic>
and
<italic>Pilidiella</italic>
;
<xref ref-type="bibr" rid="R80">van Niekerk
<italic>et al</italic>
. 2004</xref>
), and conidia that tend to be olivaceous-brown in mass, and also turn olivaceous and verruculose with age.</p>
<p id="P298">
<bold>
<italic>Stromatoseptoria castaneicola</italic>
</bold>
(Desm.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804424&link_type=mb">MB804424</ext-link>
.
<xref ref-type="fig" rid="F43">Fig. 43</xref>
.</p>
<fig id="F43" position="float">
<label>Fig. 43.</label>
<caption>
<p>
<italic>Stromatoseptoria castaneicola</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102320&link_type=cbs">CBS 102320</ext-link>
). A. Colony sporulating on MEA. B. Stroma giving rise to conidiogenous cells. C, D. Conidiogenous cells. E. Conidia. Scale bars: B = 200 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig43"></graphic>
</fig>
<p id="P299">
<italic>Basionym</italic>
:
<italic>Septoria castaneicola</italic>
Desm., Ann. Sci. Nat., Sér. 3, Bot. 8: 26. 1847.</p>
<list list-type="simple">
<list-item>
<list list-type="simple">
<list-item>
<p>≡ (?)
<italic>Phleospora castanicola</italic>
(Desm.) D. Sacc., Mycoth. Ital., Cent. 1-2, no. 173.</p>
</list-item>
</list>
</list-item>
<list-item>
<p>=
<italic>Septoria gilletiana</italic>
Sacc., Michelia 1: 359. 1878.</p>
</list-item>
<list-item>
<p>?=
<italic>Septoria castaneae</italic>
Lév., Ann. Sci. Nat., Sér. 3, Bot. 5: 278. 1846.</p>
<list list-type="simple">
<list-item>
<p>
<italic>Cylindrosporium castaneae</italic>
Krenner, Bot. Közl. 41(3-4): 126. 1944.</p>
</list-item>
</list>
</list-item>
</list>
<p id="P300">Description
<italic>in vivo. Leaf spots</italic>
numerous, small, angular, and often merging to irregular patterns, visible on both sides of the leaf, initially pale yellowish brown, later reddish brown with a narrow, darker border;
<italic>Conidiomata</italic>
pycnidial, hypophyllous, several in each leaf spot, subglobose to lenticular, very pale brown to dark brown, usually fully immersed, 80-150(-200) μm diam, releasing conidia in white cirrhi;
<italic>ostiolum</italic>
not well-differentiated, central, circular, 18-50 μm wide, surrounding cells concolorous;
<italic>conidiomatal wall</italic>
about 10-17 μm thick, composed of a homogenous tissue of hyaline to very pale brown, angular to irregular cells 4-10 μm diam;
<italic>Conidiophores</italic>
subcylindrical, branched at base, hyaline, smooth, 1-2-septate; base frequently brown, verruculose.
<italic>Conidiogenous cells</italic>
hyaline, discrete or integrated in conidiophores cylindrical or narrowly ampulliform, holoblastic, often also proliferating percurrently with up to 3 closely positioned annellations, 7-17(-20) × 3-4(-5) μm.
<italic>Conidia</italic>
cylindrical, slightly to distinctly curved, irregularly bent or flexuous, with a relatively broadly rounded apex, attenuated towards a truncate base, basal and apical cell often both wider than intermediate cells, (0-)2-3(-4)-septate, mostly constricted around the septa in the living state, hyaline, contents with several oil-droplets and granular material in each cell in the living state, with granular contents in the rehydrated state, 30-46 × 3-4 μm (“T”; rehydrated, “NT” 2-3 μm wide). Conidia are olivaceous-brown in mass, and older conidia also turn olivaceous and verruculose, and at times anastomose in culture.</p>
<p id="P301">
<italic>Culture characteristics</italic>
: Colonies (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102322&link_type=cbs">CBS 102322</ext-link>
) on OA reaching 4-8 mm diam in 25 d (9-12 mm in 33 d), with an even, glabrous, buff margin; colonies restricted, up to 1 mm high, immersed mycelium homogeneously buff, where conidiomatal complexes develop dark brick to black, in part covered by pure white, dense, appressed and woolly aerial mycelium, later a salmon haze occurs in the immersed mycelium; reverse buff, locally cinnamon to sepia.
<italic>Colonies</italic>
on CMA reaching (4-)7-11 mm diam in 25 d (8-12 mm in 33 d), as on OA, but with a halo of reddish to salmon, diffusing pigment, which becomes more intense after 33 d, and immersed mycelium in the centre darker, and aerial mycelium more strongly developed, later becoming locally salmon or citrine; reverse brick and dark brick, surrounded by a reddish to salmon zone. Colonies on MEA reaching 6.5-9 mm diam in 25 d (9-11.5 mm in 33 d), with an even, buff to cinnamon margin, entirely hidden under the aerial mycelium, with a very faint halo of diffusing pigment; colonies restricted, up to 4 mm high, hemispherical to irregularly pustulate, entirely covered by a dense mat of felted aerial mycelium, which, especialy in the centre, attains a rosy buff or primrose to citrine haze; reverse cinnamon to hazel, around a brick to dark brick centre. Colonies on CHA reaching 7-9 mm diam in 25 d (9-11 mm in 33 d), as on MEA, but no diffusing pigment observed around the colonies.
<italic>Conidiomata</italic>
on OA developing after 10-15 d, black, globose, single or merged to complexes up to 250 μm diam, releasing milky white conidial slime.
<italic>Conidiogenous cells</italic>
as
<italic>in planta. Conidia</italic>
as
<italic>in planta</italic>
, mostly 3-septate, 30-45 × 3.5-4.5 μm (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102320&link_type=cbs">CBS 102320</ext-link>
, OA, “T”; “NT” 3 μm wide).</p>
<p id="P302">
<italic>Specimens examined</italic>
:
<bold>Austria</bold>
, Tirol, Klausen, on leaves of
<italic>Castanea vesca</italic>
(
<italic>Fagaceae</italic>
), Aug., distributed in F. von Höhnel, Krypt. exsicc. no. 415, (PC0084576, PC0084583).
<bold>France</bold>
, Lébisey, Aug. and Sep. 1843, M. Roberge, ‘Coll. Desmazières 1863, no. 8’, on leaves of
<italic>Castanea sativa</italic>
(PC0084574, type of
<italic>Septoria castanicola</italic>
Desm.); same substr., Meudon, 1 Aug. 1849 (PC0084571, PC0084589, PC0084590, PC0084591) and Jul. 1852 (PC0084572); same substr., loc. and date unknown, ‘Coll. Desmazières 1863, no. 8’ (PC0084570); Seine-et-Marne, Fontainebleau, Sep 1881, distributed in Roumeguère, Fungi Gallici exsicc. no. 2029 (PC0084575).
<bold>Netherlands</bold>
, prov. Utrecht, Baarn, Lage Vuursche, on living leaves of
<italic>Castanea sativa</italic>
, 29 Aug. 1999, G. Verkley 912 (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21200&link_type=cbs">CBS H-21200</ext-link>
), cultures
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102320-102322&link_type=cbs">CBS 102320-102322</ext-link>
; same substr., prov. Limburg, St. Jansberg, 9 Sep. 1999, G. Verkley 932 (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21214&link_type=cbs">CBS H-21214</ext-link>
), culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=102377&link_type=cbs">CBS 102377</ext-link>
; same substr., prov. Limburg, Molenhoek, Heumense Schans (46-12-55), 23 Aug. 2004, G. Verkley & M. Starink 3040, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=116464&link_type=cbs">CBS 116464</ext-link>
.</p>
<p id="P303">
<italic>Notes</italic>
: According to the original diagnosis that Desmazières published in 1847 based on material on
<italic>Castanea</italic>
collected in autumn, the conidia are elongated, thin and curved, and about 40 μm in length. No further details like conidial septa were given. The material PC0084574 is the only collection received from PC that antidates the publication and assumedly is the type. It consists of several leaves with numerous pycnidia in leaf spots, some of which belong to
<italic>Septoria castaneicola</italic>
with the characteristic conidia, but most are a spermatial state of most likely the
<italic>Mycosphaerella punctiformis</italic>
complex (=
<italic>Ramularia</italic>
, Verkley
<italic>et al.</italic>
2004).</p>
<p id="P304">Teterevnikova-Babayan (
<xref ref-type="bibr" rid="R111">1987</xref>
) treated
<italic>S. castaneicola</italic>
Desm. as a synonym of
<italic>S. castaneae</italic>
Lév., and both originally were described from the same host,
<italic>Castanea sativa</italic>
(syn.
<italic>C. vesca</italic>
). Teterevnikova-Babayan (
<xref ref-type="bibr" rid="R111">1987</xref>
) described the conidia as 3-septate, 25-40 × 2.5-4.5 μm, which is in fairly good agreement with present observations. The type of
<italic>S. castanaea</italic>
Lév. could not be studied and the name remains doubtful. Even though Léveillé described symptoms that match those of
<italic>S. castaneicola</italic>
fairly well, he described the conidia as aseptate, and failed to give information about their size.</p>
</sec>
<sec id="S33">
<title>Clade 15:
<italic>Lecanosticta</italic>
</title>
<p id="P305">
<italic>Note</italic>
: See Quaedvlieg
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R88">2012</xref>
).</p>
</sec>
<sec id="S34">
<title>Clade 16:
<italic>Phaeophleospora</italic>
</title>
<p id="P306">
<italic>Note</italic>
: See Crous et al. (
<xref ref-type="bibr" rid="R28">2009b</xref>
,
<xref ref-type="bibr" rid="R29">c</xref>
).</p>
</sec>
<sec id="S35">
<title>Clade 17:
<italic>Cytostagonospora</italic>
</title>
<p id="P307">
<bold>
<italic>Cytostagonospora</italic>
</bold>
Bubák, Ann. Mycol. 14: 150. 1916.</p>
<p id="P308">Description: See above.</p>
<p id="P309">
<italic>Type species</italic>
:
<italic>Cytostagonospora photiniicola</italic>
Bubák [as “
<italic>photinicola</italic>
”], Ann. Mycol. 14: 150. 1916.</p>
<p id="P310">
<bold>
<italic>Cytostagonospora martiniana</italic>
</bold>
(Sacc.) B. Sutton & H.J. Swart, Trans. Br. mycol. Soc. 87: 99. 1986. Figs
<xref ref-type="fig" rid="F44">44</xref>
,
<xref ref-type="fig" rid="F45">45</xref>
.</p>
<fig id="F44" position="float">
<label>Fig. 44.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Cytostagonospora martiniana</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135102&link_type=cbs">CBS 135102</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig44"></graphic>
</fig>
<fig id="F45" position="float">
<label>Fig. 45.</label>
<caption>
<p>
<italic>Cytostagonospora martiniana</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135102&link_type=cbs">CBS 135102</ext-link>
). A. Leaf spot. B. Conidiomata forming in culture. C-F. Conidiogenous cells. G. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig45"></graphic>
</fig>
<p id="P311">
<italic>Basionym</italic>
:
<italic>Septoria martiniana</italic>
Sacc., Syll. Fung. (Abellini) 10: 351. 1892.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Septoria phyllodiorum</italic>
Cooke & Massee, Grevillea 19(90): 47. 1890, non
<italic>S. phyllodiorum</italic>
Sacc., Hedwigia 29: 156. 1890.</p>
</list-item>
</list>
<p id="P312">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Leaf spots</italic>
amphigenous, circular, grey to brown with raised dark brown border, 1-3 mm diam.
<italic>Conidiomata</italic>
immersed, subepidermal, epiphyllous, solitary to aggregated with stromatic tissue, with central ostiolar opening exuding a creamy to white conidial mass, rupturing at maturity (pycnidial to acervular), brown, globose, up to 400 μm diam; wall of 3-6 layers of brown
<italic>textura angularis. Conidiophores</italic>
hyaline, smooth, subcylindrical, 0-5-septate, branched or not, 10-15(-50) × 3-4 μm, giving rise to terminal and lateral conidiogenous cells.
<italic>Conidiogenous cells</italic>
hyaline, smooth, subcylindrical or ampulliform, 4-8 × 3-4 μm, polyphialidic, with apical and lateral loci, with visible periclinal thickening, at times also proliferating percurrently (both modes can also be present on the same conidiogenous cell).
<italic>Conidia</italic>
hyaline, smooth, granular, irregularly curved, subcylindrical to narrowly obclavate, apex subobtuse, base long, obconically truncate, (1-)3-septate, (18-)32-45(-50) × (1.5-)2(-3) μm; base not thickened, 0.5-1 μm diam.</p>
<p id="P313">
<italic>Culture characteristics</italic>
: Colonies on PDA convex, erumpent with feathery margin, lacking aerial mycelium, surface fuscous-black, reverse olivaceous-black, after 14 d, 4 cm diam, with a beautifull purple exudate at the outer edges; on MEA, after 14 d, 3.5 cm diam, lacking any exudate; on OA surface fuscous-black, reverse olivaceous-grey, after 14 d, 4 cm diam, purplish-red coloured exudate.</p>
<p id="P314">
<italic>Specimen examined</italic>
:
<bold>Australia</bold>
, Warneet close to Melbourne, S38°13’37.8” E145°18’25.4”, on leaves of
<italic>Acacia pycnantha</italic>
(
<italic>Mimosaceae</italic>
), 21 Oct. 2009, P.W. Crous (specimen
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21297&link_type=cbs">CBS H-21297</ext-link>
, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135102&link_type=cbs">CBS 135102</ext-link>
=CPC 17727).</p>
<p id="P315">
<italic>Notes</italic>
: The present collection matches the description of
<italic>Cytostagonospora martiniana</italic>
provided by Sutton & Swart (
<xref ref-type="bibr" rid="R107">1986</xref>
). As discussed by the authors, this genus is distinct from
<italic>Septoria s. str</italic>
. based on its conidiomata aggregated in stromatic tissue, and unique mode of conidiogenesis. In culture conidiogenous cells exhibited a mixture of sympodial proliferation, or were polyphialidic with periclinal thickening, but also proliferated percurrently. Species of
<italic>Septoria</italic>
occurring on
<italic>Acacia</italic>
were treated by Sutton & Pascoe (
<xref ref-type="bibr" rid="R105">1987</xref>
).</p>
</sec>
<sec id="S36">
<title>Clade 18:
<italic>Zasmidium</italic>
</title>
<p id="P316">
<italic>Note</italic>
: See Crous
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R18">2007a</xref>
,
<xref ref-type="bibr" rid="R20">b</xref>
,
<xref ref-type="bibr" rid="R29">2009c</xref>
).</p>
</sec>
<sec id="S37">
<title>Clade 19:
<italic>Polyphialoseptoria</italic>
</title>
<p id="P317">
<bold>
<italic>Polyphialoseptoria</italic>
</bold>
Quaedvlieg, R.W. Barreto, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804425&link_type=mb">MB804425</ext-link>
.</p>
<p id="P318">
<italic>Etymology</italic>
: Polyphialo = polyphialides;
<italic>Septoria</italic>
= septoria-like.</p>
<p id="P319">
<italic>Foliicolous,</italic>
plant pathogenic
<italic>. Conidiomata</italic>
brown, erumpent, pycnidial (acervular in culture), globose, brown; wall of 3-6 layers of pale brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
hyaline, smooth, subcylindrical to ampulliform; proliferating sympodially at apex, forming polyphialides with minute periclinal thickening, or as solitary loci on superficial mycelium in culture.
<italic>Conidia</italic>
hyaline, smooth, granular to guttulate, scolecosporous, irregularly curved, apex subobtuse, base long obconically truncate, transversely multi-euseptate, in older cultures disarticulating at septa; microcyclic conidiation also common in older cultures.</p>
<p id="P320">
<italic>Type species</italic>
:
<italic>Polyphialoseptoria terminaliae</italic>
Quaedvlieg, R.W. Barreto, Verkley & Crous.</p>
<p id="P321">
<bold>
<italic>Polyphialoseptoria tabebuiae-serratifoliae</italic>
</bold>
Quaedvlieg, Alfenas & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804427&link_type=mb">MB804427</ext-link>
. Figs
<xref ref-type="fig" rid="F46">46</xref>
,
<xref ref-type="fig" rid="F47">47</xref>
.</p>
<fig id="F46" position="float">
<label>Fig. 46.</label>
<caption>
<p>Conidia and conidiogenous loci on hypha of
<italic>Polyphialoseptoria tabebuiae-serratifoliae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=112650&link_type=cbs">CBS 112650</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig46"></graphic>
</fig>
<fig id="F47" position="float">
<label>Fig. 47.</label>
<caption>
<p>
<italic>Polyphialoseptoria tabebuiae-serratifoliae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=112650&link_type=cbs">CBS 112650</ext-link>
). A. Conidiomata forming in culture. B. Conidiogenous cells. C. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig47"></graphic>
</fig>
<p id="P322">
<italic>Etymology</italic>
: Named after its host,
<italic>Tabebuia serratifolia.</italic>
</p>
<p id="P323">
<italic>Leaf spots</italic>
variable in number on mature leaves; initially as small spots or purple-brown areas, with the inner part becoming grey-white with age, surrounded by a purple-brown halo.
<italic>Conidiomata</italic>
developing on sterile barley leaves on WA, pale cream in colour, erumpent, globose, up to 180 μm diam; wall of 2-3 layers of pale brown
<italic>textura angularis. Conidiophores</italic>
hyaline, smooth, cylindrical, septate, branched, 10-35 × 1.5 μm.
<italic>Conidiogenous cells</italic>
terminal and lateral, cylindrical, hyaline, smooth, proliferating sympodially, 10-15 × 1.5 μm.
<italic>Conidia</italic>
solitary, hyaline, smooth, granular, irregularly curved, subcylindrical, apex subobtuse, base truncate, (0-)1-3(-4)-septate, (15-)25-35(-55) × 1.5(-2) μm.</p>
<p id="P324">
<italic>Culture characteristics</italic>
: Colonies flat, spreading, with sparse aerial mycelium and smooth, even margins, reaching 40 mm diam after 2 wk. On OA surface dirty pink; on PDA surface and reverse dirty white. On MEA surface folded, dirty white, reverse cinnamon.</p>
<p id="P325">
<italic>Specimen examined</italic>
:
<bold>Brazil</bold>
, Minas Gerais, Viçosa, on leaves of
<italic>Tabebuia serratifolia</italic>
(
<italic>Bignoniaceae</italic>
), 1999, A.C. Alfenas (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21299&link_type=cbs">CBS H-21299</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=112650&link_type=cbs">CBS 112650</ext-link>
).</p>
<p id="P326">
<italic>Notes</italic>
: Inácio & Dianese (
<xref ref-type="bibr" rid="R63">1998</xref>
) described
<italic>Septoria tabebuiae-impetiginosae</italic>
on
<italic>T. impetiginosa</italic>
(conidia 25-67 × 2-4 μm, 2-6-septate), and also compared this species to
<italic>S. tabebuiae</italic>
(18-40 × 1.7-2.5 μm, aseptate conidia) on
<italic>T. berteroi,</italic>
and
<italic>S. cucutana</italic>
(34-40 × 0.8-1 μm) on
<italic>T. pentaphylla</italic>
and
<italic>T. spectabilis</italic>
. Furthermore, they also referred to an undescribed species Ferreira (
<xref ref-type="bibr" rid="R51">1989</xref>
) mentioned on
<italic>T. serratifolia</italic>
in Viçosa, Minas Gerais, which is named as
<italic>S. tabebuiae-serratifoliae</italic>
in the present study.
<italic>Polyphialoseptoria tabebuiae-serratifoliae</italic>
is distinct from species of
<italic>Septoria</italic>
known from
<italic>Tabebuia</italic>
based on its conidial morphology.</p>
<p id="P327">
<bold>
<italic>Polyphialoseptoria terminaliae</italic>
</bold>
Quaedvlieg, R.W. Barreto, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804426&link_type=mb">MB804426</ext-link>
.
<xref ref-type="fig" rid="F48">Fig. 48</xref>
.</p>
<fig id="F48" position="float">
<label>Fig. 48.</label>
<caption>
<p>
<italic>Polyphialoseptoria terminaliae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135106&link_type=cbs">CBS 135106</ext-link>
). A. Leaves with leaf spots. B, C. Conidiomata sporulating in culture. D-F. Conidiogenous cells and loci. G. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig48"></graphic>
</fig>
<p id="P328">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Terminalia</italic>
.</p>
<p id="P329">
<italic>Leaf spots</italic>
irregular to subcircular, amphigenous, mostly aggregated along leaf veins, pale brown, 3-8 mm diam, surrounded by a prominent, wide, red-purple border. On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
brown, erumpent, pycnidial (acervular in culture), up to 600 μm diam, globose, brown, exuding a crystalline cirrhus of conidia; wall of 3-6 layers of pale brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
hyaline, smooth, subcylindrical to ampulliform, 5-10 × 3-4 μm; proliferating sympodially at apex, forming polyphialides with minute periclinal thickening, or as solitary loci on superficial mycelium in culture.
<italic>Conidia</italic>
hyaline, smooth, granular to guttulate, scolecosporous, irregularly curved, apex subobtuse, base long obconically truncate (1-1.5 μm diam), multiseptate (-16), in older cultures disarticulating at septa; microcyclic conidiation also common in older cultures, (40-)75-120(-140) × 2-3(-3.5) μm.</p>
<p id="P330">
<italic>Culture characteristics</italic>
: Colonies on PDA erumpent with feathery margin, lacking aerial mycelium, surface fuscous-black, reverse olivaceous-black to buff in the younger tissue, after 14 d, 1 cm diam; on MEA surface and reverse isabelline to greyish-sepia; on OA surface pale-vinaceous, reverse rosy-buff to buff.</p>
<p id="P331">
<italic>Specimen examined</italic>
:
<bold>Brazil</bold>
, Minas Gerais, Viçosa, on leaves of
<italic>Terminalia catappa</italic>
(
<italic>Combretaceae</italic>
), 18 May 2010, R.W. Barreto (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21298&link_type=cbs">CBS H-21298</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135106&link_type=cbs">CBS 135106</ext-link>
=CPC 19611); ibed., (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135475&link_type=cbs">CBS 135475</ext-link>
=CPC 19487)</p>
<p id="P332">
<italic>Notes</italic>
: As far as we could establish there are presently no species of
<italic>Septoria</italic>
described from
<italic>Terminalia</italic>
, and as this taxon is distinct from all taxa in GenBank, we herewith describe it as a novel species. A
<italic>Septoria</italic>
sp. has been reported on leaves of
<italic>Terminalia</italic>
sp. in Florida and Venezuela (
<xref ref-type="bibr" rid="R49">Farr & Rossman 2013</xref>
).
<italic>Polyphialoseptoria</italic>
is distinct from
<italic>Septoria</italic>
based on the presence of polyphialides.
<italic>Neoseptoria</italic>
also has phialides as observed in
<italic>Polyphialoseptoria</italic>
, but these tend to chiefly be monophialides.</p>
</sec>
<sec id="S38">
<title>Clade 20:
<italic>Ruptoseptoria</italic>
</title>
<p id="P333">
<bold>
<italic>Ruptoseptoria</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804428&link_type=mb">MB804428</ext-link>
.</p>
<p id="P334">
<italic>Etymology</italic>
: Rupto = irregular rupture of conidiomata;
<italic>Septoria</italic>
= septoria-like.</p>
<p id="P335">
<italic>Foliicolous,</italic>
plant pathogenic.
<italic>Conidiomata</italic>
black, appressed, elongated, pycnidial, but opening via irregular rupture, convulated; exuding a creamy white conidial mass; outer wall dark brown, crusty, consisting of 6-8 layers of dark brown
<italic>textura angularis</italic>
; giving rise to 2-3 inner layers of pale brown to hyaline
<italic>textura angularis. Conidiophores</italic>
lining the inner cavity, hyaline, smooth or pale brown, verruculose at base, branched below, septate, subcylindrical.
<italic>Conidiogenous cells</italic>
integrated, terminal, subcylindrical, smooth; proliferating sympodially at apex, or apex phialidic with minute periclinal thickening.
<italic>Conidia</italic>
solitary, hyaline, smooth, guttulate, subcylindrical to narrowly obclavate, gently to irregularly curved, apex subobtuse, base truncate to narrowly obovoid, transversely septate.</p>
<p id="P336">
<italic>Type species</italic>
:
<italic>Ruptoseptoria unedonis</italic>
(Roberge ex Desm.) Quaedvlieg, Verkley & Crous.</p>
<p id="P337">
<bold>
<italic>Ruptoseptoria unedonis</italic>
</bold>
(Roberge ex Desm.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804429&link_type=mb">MB804429</ext-link>
. Figs
<xref ref-type="fig" rid="F49">49</xref>
,
<xref ref-type="fig" rid="F50">50</xref>
.</p>
<fig id="F49" position="float">
<label>Fig. 49.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Ruptoseptoria unedonis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=355.86&link_type=cbs">CBS 355.86</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig49"></graphic>
</fig>
<fig id="F50" position="float">
<label>Fig. 50.</label>
<caption>
<p>
<italic>Ruptoseptoria unedonis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=355.86&link_type=cbs">CBS 355.86</ext-link>
). A, C. Conidiomata forming in culture. B, D. Conidiogenous cells. E. Conidia. Scale bars: A = 450 μm, C = 110 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig50"></graphic>
</fig>
<p id="P338">
<italic>Basionym</italic>
:
<italic>Septoria unedonis</italic>
Roberge ex Desm., Ann. Sci. Nat., Bot., Sér. 3(8): 20. 1847.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Sphaerella arbuticola</italic>
Peck, Bull. Torrey Bot. Club 10(7): 75. 1883.</p>
<list list-type="simple">
<list-item>
<p>
<italic>Mycosphaerella arbuticola</italic>
(Peck) Jaap, Ann. Mycol. 14(1/2): 13. 1916.</p>
</list-item>
<list-item>
<p>
<italic>Mycosphaerella arbuticola</italic>
(Peck) House, Contr. Univ. Mich. Herb. 9(8): 587. 1972.</p>
</list-item>
</list>
</list-item>
</list>
<p id="P339">
<italic>Leaf spots</italic>
numerous, small, amphigenous, irregular to subcircular, whitish in the middle, with very broad, purple borders.
<italic>Conidiomata</italic>
black, appressed, elongated, pycnidial, but opening via irregular rupture, convulated, up to 450 μm diam, exuding a creamy white conidial mass; outer wall dark brown, crusty, consisting of 6-8 layers of dark brown
<italic>textura angularis</italic>
; giving rise to 2-3 inner layers of pale brown to hyaline
<italic>textura angularis. Conidiophores</italic>
lining the inner cavity, hyaline, smooth or pale brown, verruculose at base, branched below, 1-2-septate, subcylindrical, 10-15 × 2-4 μm.
<italic>Conidiogenous cells</italic>
integrated, terminal, subcylindrical, smooth, 6-12 × 2.5-3.5 μm; proliferating sympodially at apex, or apex phialidic with minute periclinal thickening.
<italic>Conidia</italic>
solitary, hyaline, smooth, guttulate, subcylindrical to narrowly obclavate, gently to irregularly curved, apex subobtuse, base truncate to narrowly obovoid, 1-3(-6)-septate, (25-)30-47(-56) × 2(-3) um.</p>
<p id="P340">
<italic>Culture characteristics</italic>
: Colonies on OA spreading with moderate aerial mycelium and smooth, even margins; surface olivaceous-grey in outer region, centre dirty white to pale pink, reverse iron grey; on MEA surface dark-mouse-grey to mouse-grey, reverse greenish-black; on PDA surface mouse-grey to dark-mouse-grey, reverse greenish-black.</p>
<p id="P341">
<italic>Specimen examined</italic>
:
<bold>France</bold>
, Seignosse le Penon, Lamdes, Forest communale de Seignosse, on leaves of
<italic>Arbutus unedo</italic>
(
<italic>Ericaceae</italic>
), Aug. 1986, H.A. van der Aa (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-14645&link_type=cbs">CBS H-14645</ext-link>
, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=355.86&link_type=cbs">CBS 355.86</ext-link>
).</p>
<p id="P342">
<italic>Notes</italic>
:
<italic>Mycosphaerella arbuticola</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=355.86&link_type=cbs">CBS 355.86</ext-link>
) is a species pathogenic to
<italic>Arbutus menziesii</italic>
in California (
<xref ref-type="bibr" rid="R1">Aptroot 2006</xref>
), clusters with “
<italic>Septoria</italic>
<italic>unedonis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=755.70&link_type=cbs">CBS 755.70</ext-link>
,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-18192&link_type=cbs">CBS H-18192</ext-link>
), which is associated with leaf spots on
<italic>Arbutus unedo</italic>
in Croatia, and elsewhere in Europe. Based on these results, the sexual-asexual link between these two names is confirmed. Morphologically, however,
<italic>Ruptoseptoria</italic>
is similar to
<italic>Septoria</italic>
, and can only be distinguished based on its conidiomata that are convulated, opening by irregular rupture, and conidiogenous cells that are frequently phialidic.</p>
</sec>
<sec id="S39">
<title>Clade 21:
<italic>Dissoconium</italic>
(
<italic>Dissoconiaceae</italic>
)</title>
<p id="P343">
<italic>Note</italic>
: See Li
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R70">2012</xref>
).</p>
</sec>
<sec id="S40">
<title>Clade 22:
<italic>Readeriella</italic>
(
<italic>Teratosphaeriaceae</italic>
)</title>
<p id="P344">
<italic>Note</italic>
: See Crous
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R18">2007a</xref>
,
<xref ref-type="bibr" rid="R25">2009a</xref>
,
<xref ref-type="bibr" rid="R28">b</xref>
,
<xref ref-type="bibr" rid="R29">c</xref>
).</p>
</sec>
<sec id="S41">
<title>Clade 23:
<italic>Teratosphaeria</italic>
</title>
<p id="P345">
<italic>Note</italic>
: See Crous
<italic>et al.</italic>
(2007,
<xref ref-type="bibr" rid="R29">2009c</xref>
).</p>
</sec>
<sec id="S42">
<title>Clade 24: septoria-like</title>
<p id="P346">
<italic>Specimen examined</italic>
:
<bold>Brazil</bold>
, Nova Friburgo, on leaves of
<italic>Tibouchina herbacea</italic>
(
<italic>Melastomataceae</italic>
), 15 Dec. 2007, D.F. Parreira (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=134910&link_type=cbs">CBS 134910</ext-link>
=CPC 19500).</p>
<p id="P347">
<italic>Note</italic>
: The taxonomy of this species could not be resolved, as isolate CPC 19500 proved to be sterile.</p>
</sec>
<sec id="S43">
<title>Clade 25:
<italic>Cylindroseptoria</italic>
</title>
<p id="P348">
<bold>
<italic>Cylindroseptoria</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804430&link_type=mb">MB804430</ext-link>
.</p>
<p id="P349">
<italic>Etymology</italic>
: Cylindro = cylindrical conidia;
<italic>Septoria</italic>
= septoria-like.</p>
<p id="P350">
<italic>Conidiomata</italic>
pycnidial with central ostiole, or cupulate, separate, brown, short-stipitate, tapering towards base; rim with elongated brown, thick-walled cells with obtuse ends; rim covered with mucoid layer that flows over from conidiomatal cavity, filled with conidial mass; wall of 3-4 layers of medium brown
<italic>textura angularis</italic>
, becoming hyaline towards inner region.
<italic>Conidiogenous cells</italic>
hyaline, smooth, ampulliform, lining inner cavity, with prominent periclinal thickening at apex.
<italic>Conidia</italic>
solitary, hyaline, smooth, granular or not, cylindrical with obtuse apex, tapering at base to truncate scar, aseptate.</p>
<p id="P351">
<italic>Type species</italic>
:
<italic>Cylindroseptoria ceratoniae</italic>
Quaedvlieg, Verkley & Crous.</p>
<p id="P352">
<bold>
<italic>Cylindroseptoria ceratoniae</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804431&link_type=mb">MB804431</ext-link>
. Figs
<xref ref-type="fig" rid="F51">51</xref>
,
<xref ref-type="fig" rid="F52">52</xref>
.</p>
<fig id="F51" position="float">
<label>Fig. 51.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Cylindroseptoria ceratoniae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=477.69&link_type=cbs">CBS 477.69</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig51"></graphic>
</fig>
<fig id="F52" position="float">
<label>Fig. 52.</label>
<caption>
<p>
<italic>Cylindroseptoria ceratoniae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=477.69&link_type=cbs">CBS 477.69</ext-link>
). A, B. Conidiomata forming in culture. C, D. Conidiogenous cells giving rise to conidia. E. Conidia. Scale bars: B = 45 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig52"></graphic>
</fig>
<p id="P353">
<italic>Etymology</italic>
: Named after the host genus on which it occurs,
<italic>Ceratonia</italic>
.</p>
<p id="P354">
<italic>Conidiomata</italic>
separate, brown, cupulate, short-stipitate, rim up to 300 μm diam, 100-180 μm tall, tapering towards base, 20-50 μm diam (on
<italic>Anthriscus sylvestris</italic>
stems, not on OA or PDA, where they appear more flattened with agar surface); rim with elongated brown, thick-walled cells with obtuse ends, 5-12 × 4-5 μm; rim covered with mucoid layer that flows over from conidiomatal cavity, filled with conidial mass; wall of 3-4 layers of medium brown
<italic>textura angularis</italic>
, becoming hyaline towards inner region.
<italic>Conidiogenous cells</italic>
hyaline, smooth, ampulliform, lining inner cavity, 7-12 × 4-6 μm; apex 2 μm diam, with prominent periclinal thickening.
<italic>Conidia</italic>
solitary, hyaline, smooth, granular or not, cylindrical with obtuse apex, tapering at base to truncate scar 1 μm diam, aseptate, (10-) 12-14(-16) × 3(-3.5) μm.</p>
<p id="P355">
<italic>Culture characteristics</italic>
: Colonies spreading, reaching 28 mm diam after 2 wk, with sparse aerial mycelium and even, lobate margins. On MEA surface iron-grey, reverse olivaceous-grey. On OA surface olivaceous-grey. On PDA surface and reverse iron-grey.</p>
<p id="P356">
<italic>Specimen examined</italic>
:
<bold>Spain</bold>
, Mallorca, Can Pastilla, on leaves of
<italic>Ceratonia siliqua</italic>
(
<italic>Caesalpinaceae</italic>
), 24 May 1969, H.A. van der Aa (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21300&link_type=cbs">CBS H-21300</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=477.69&link_type=cbs">CBS 477.69</ext-link>
).</p>
<p id="P357">
<italic>Notes</italic>
:
<italic>Cylindroseptoria ceratoniae</italic>
is quite distinct in that it has cup-shaped acervuli, ampilliform conidiogenous cells with periclinal thickening, and hyaline, aseptate, cylindrical conidia.
<italic>Cylindroseptoria</italic>
needs to be compared with
<italic>Satchmopsis</italic>
(infundibular conidiomata),
<italic>Cornucopiella</italic>
(tubular conidiomata) and
<italic>Thaptospora</italic>
(cylindrical / lageniform / campanulate conidiomata), but the combination of cupulate conidiomata and cylindrical, and aseptate conidia is distinct.</p>
<p id="P358">
<bold>
<italic>Cylindroseptoria pistaciae</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804432&link_type=mb">MB804432</ext-link>
. Figs
<xref ref-type="fig" rid="F53">53</xref>
,
<xref ref-type="fig" rid="F54">54</xref>
.</p>
<fig id="F53" position="float">
<label>Fig. 53.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Cylindroseptoria pistaciae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=471.69&link_type=cbs">CBS 471.69</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig53"></graphic>
</fig>
<fig id="F54" position="float">
<label>Fig. 54.</label>
<caption>
<p>
<italic>Cylindroseptoria pistaciae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=471.69&link_type=cbs">CBS 471.69</ext-link>
). A, B. Conidiomata sporulating in culture. C, D. Intercalary chains of chlamydospore-like cells. E, F. Conidiogenous cells. G, H. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig54"></graphic>
</fig>
<p id="P359">
<italic>Etymology</italic>
: Named after the host genus on which it occurs,
<italic>Pistacia</italic>
.</p>
<p id="P360">
<italic>Conidiomata</italic>
pycnidial, erumpent, globose, black, separate, with black crusty outer layer of cells, up to 200 μm diam, with central ostiole; wall of 3-6 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic (mostly monophialidic, but a few observed to also be polyphialidic), lining the inner cavity, hyaline, smooth, ampulliform, 5-8 × 3-4 μm, proliferating percurrently (inconspicuous) or with periclinal thickening at apex (also occurring as solitary loci on superficial hyphae surrounding pycnidia).
<italic>Conidia</italic>
hyaline, smooth, cylindrical, mostly straight, rarely slightly curved, apex subobtuse, base truncate, guttulate, aseptate, (9-)11-13(-18) × 2.5-3(-3.5) μm.</p>
<p id="P361">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, circular, lacking aerial mycelium, surface fuscous-black, reverse olivaceous-black, after 14 d, 3.5 cm diam; on MEA surface fuscous-black, reverse olivaceous-black, after 14 d, 4.5 cm diam; on OA similar to PDA.</p>
<p id="P362">
<italic>Specimen examined</italic>
:
<bold>Spain</bold>
, Mallorca, El Arenal, on leaves of
<italic>Pistacia lentiscus</italic>
(
<italic>Anacardiaceae</italic>
), 25 May 1969, H.A. van der Aa (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21301&link_type=cbs">CBS H-21301</ext-link>
, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=471.69&link_type=cbs">CBS 471.69</ext-link>
).</p>
<p id="P363">
<italic>Notes</italic>
:
<italic>Cylindroseptoria pistaciae</italic>
is tentatively placed in
<italic>Cylindroseptoria</italic>
, as it has pycnidial rather than cupulate conidiomata. However, synapomorphies with
<italic>Cylindroseptoria</italic>
include phialides with periclinal thickening, and cylindrical, aseptate conidia. Further collections are required to determine if conidiomatal anatomy is more important than conidiogenesis and conidial morphology. For the present, however, the generic circumscription of
<italic>Cylindroseptoria</italic>
has been widened to include taxa with pycnidial conidiomata.
<italic>Cylindroseptoria pistaciae</italic>
could be confused with
<italic>Septoria pistaciae</italic>
, though conidia of the latter are 20-30 × 1.6 μm, and are 1(-3)-septate (Chitzanidis & Michaelides 2002).</p>
</sec>
<sec id="S44">
<title>Clade 26:
<italic>Pseudoseptoria</italic>
</title>
<p id="P364">
<bold>
<italic>Pseudoseptoria</italic>
</bold>
Speg., Ann. Mus. Nac. B. Aires, Ser. 3 13: 388. 1910.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Aphanofalx</italic>
B. Sutton, Trans. Brit. Mycol. Soc. 86: 21. 1986.</p>
</list-item>
</list>
<p id="P365">
<italic>Caulicolous</italic>
and
<italic>foliicolous</italic>
, plant pathogenic or saprobic. Conidiomata stromatic, pycnidioid, unilocular, glabrous, black, ostiolate; wall of
<italic>textura angularis</italic>
, in some cases cells in the upper wall larger and darker than cells in the lower wall.
<italic>Conidiophores</italic>
reduced to conidiogenous cells lining the cavity of the conidioma.
<italic>Conidiogenous cells</italic>
discrete or integrated, cylindrical or lageniform, colourless, smooth-walled, invested in mucus, with a prominent cylindrical papilla with several percurrent proliferations at the apex; collarette prominent and extanding past conidia, or reduced and inconspicuous.
<italic>Conidia</italic>
fusiform, lunate or irregular, curved, unicellular, colourless, smooth-walled with or without an excentric basal appendage, continuous with conidium body, plectronoid to podiform, or with a blunt or spathulate distal end.</p>
<p id="P366">
<italic>Type species</italic>
:
<italic>P. donacicola</italic>
Speg., Ann. Mus. Nac. B. Aires, Ser. 3 13: 388. 1910. [=
<italic>P. donacis</italic>
(Pass.) B. Sutton].</p>
<p id="P367">
<bold>
<italic>Pseudoseptoria collariana</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804433&link_type=mb">MB804433</ext-link>
.
<xref ref-type="fig" rid="F55">Fig. 55</xref>
.</p>
<fig id="F55" position="float">
<label>Fig. 55.</label>
<caption>
<p>
<italic>Pseudoseptoria collariana</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135104&link_type=cbs">CBS 135104</ext-link>
). A, B. Colonies sporulating in culture. C-F. Conidiogenous cells with prominent collarettes. G, H. Conidia. Scale bars: A = 400 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig55"></graphic>
</fig>
<p id="P368">
<italic>Etymology</italic>
: Named after its prominently flared collarettes, forming a sleeve.</p>
<p id="P369">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
immersed to erumpent, globose, dark brown, up to 400 μm diam, unilocular, opening via central ostiole; wall of 6-10 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells, or branched at the base with one supporting cell that is dark brown, encased in a mucilaginous matrix.
<italic>Conidiogenous cells</italic>
subcylindrical to ampulliform, hyaline, smooth to pale brown, finely verruculose, 18-35 × 3.5-8 μm; apical region with numerous conspicuous percurrent proliferations, with long, prominent collarettes that completely enclose and extend above young, developing conidia, but disintegrating into a mucoid mass with age.
<italic>Conidia</italic>
fusiform, lunate, curved, aseptate, hyaline, smooth, tapering to an subobtuse to spathulate apex, base truncate (1 μm diam), with a single, unbranched, eccentric basal appendage, 2-4 μm long; conidia (from apex to hilum) (24-)26-28(-30) × (2.5-)3 μm.</p>
<p id="P370">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, round with feathery margins, lacking aerial mycelium, surface olivaceous-black to rosy-buff for younger tissue, reverse olivaceous-black, to rosy-buff for younger tissue, after 14 d 1.5 cm diam; on MEA surface olivaceous-black to buff for younger tissue, reverse olivaceous-black to brick for younger tissue, after 14 d, 2 cm diam; on OA similar to MEA.</p>
<p id="P371">
<italic>Specimen examined</italic>
:
<bold>Iran</bold>
, Golestan Province, on leaves of Bamboo (
<italic>Poaceae</italic>
), 12 May 2009, A. Mirzadi Gohari (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21302&link_type=cbs">CBS H-21302</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135104&link_type=cbs">CBS 135104</ext-link>
=CPC 18119).</p>
<p id="P372">
<bold>
<italic>Pseudoseptoria obscura</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804434&link_type=mb">MB804434</ext-link>
.
<xref ref-type="fig" rid="F56">Fig. 56</xref>
.</p>
<fig id="F56" position="float">
<label>Fig. 56.</label>
<caption>
<p>
<italic>Pseudoseptoria obscura</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135103&link_type=cbs">CBS 135103</ext-link>
). A, B. Colony sporulating in culture. C. Chlamydospore-like cells developing. D, E. Conidiogenous cells. F-H. Conidia. Scale bars: B = 250 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig56"></graphic>
</fig>
<p id="P373">
<italic>Etymology</italic>
: Named after the obscure basal appendage that occurs on some conidia.</p>
<p id="P374">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
immersed to erumpent, globose, dark brown, up to 250 μm diam (smaller than in 18119), unilocular, opening via central ostiole; wall of 3-6 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
subcylindrical to doliiform, hyaline, smooth to pale brown, finely verruculose, 6-12 × 2-5 μm; apical region with numerous inconspicuous to conspicuous percurrent proliferations; collarettes absent to prominent.
<italic>Conidia</italic>
fusiform, lunate, curved, aseptate, hyaline, smooth, tapering to an subobtuse apex; base truncate, rarely with a single, unbranched, eccentric basal appendage, 1-2 μm long; conidia (from apex to hilum) (8-) 12-14(-15) × (2-)2.5(-3) μm.</p>
<p id="P375">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, undulate with feathery margins, lacking aerial mycelium, surface concentric rings of fuscous-black to pale purplish grey to fuscous-black, reverse concentric rings of greyish-sepia to fawn to fuscous-black, after 14 d, 2 cm diam; on MEA similar to PDA; OA flat, undulate, lacking aerial mycelium, surface fuscous-black to purplish grey for the younger tissue, reverse greyish-sepia to vinaceous-buff for the younger tissue.</p>
<p id="P376">
<italic>Specimen examined</italic>
:
<bold>Iran</bold>
, Golestan Province, on leaves of Bamboo (
<italic>Poaceae</italic>
), 12 May 2009, A. Mirzadi Gohari (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21303&link_type=cbs">CBS H-21303</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135103&link_type=cbs">CBS 135103</ext-link>
=CPC 18118).</p>
<p id="P377">
<italic>Notes</italic>
: Species of the genus
<italic>Aphanofalx</italic>
occur on members of
<italic>Poaceae</italic>
, presumably as saprobes. The genus is characterised by having taxa with pycnidial conidiomata, and percurrently proliferating conidiogenous cells, and hyaline, aseptate conidia with a basal, excentric appendage. In contrast, species of
<italic>Pseudoseptoria</italic>
are known to occur on members of
<italic>Poaceae</italic>
as plant pathogens. The genus is also characterised by having taxa with pycnidial conidiomata, and percurrently proliferating conidiogenous cells, and hyaline, aseptate conidia that lack basal appendages. During this study we also investigated three strains identified as
<italic>P. donasis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=291.69&link_type=cbs">CBS 291.69</ext-link>
,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=313.68&link_type=cbs">313.68</ext-link>
and
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=417.51&link_type=cbs">417.51</ext-link>
), the type species of
<italic>Pseudoseptoria</italic>
. Much to our surprise they formed a monophyletic lineage (results not shown) with the two strains described here (which have basal appendages), suggesting that
<italic>Pseudoseptoria</italic>
represents an older name for
<italic>Aphanofalx</italic>
, and that the basal appendage is a species-specific character, as also found in other groups of coelomycetes (
<xref ref-type="bibr" rid="R31">Crous
<italic>et al.</italic>
2012b</xref>
).</p>
<p id="P378">
<italic>Aphanofalx</italic>
is presently known from two species,
<italic>A. mali</italic>
(conidia 26-33 × 2-2.5 μm), and
<italic>A. irregularis</italic>
(conidia 12-28(-31) × (2-)2.5-3(-3.5) μm (
<xref ref-type="bibr" rid="R79">Nag Raj 1993</xref>
).
<italic>Pseudoseptoria collariana</italic>
[conidia (24-) 26-28(-30) × (2.5-)3 μm] and
<italic>P. obscura</italic>
[conidia (8-)12-14(-15) × (2-)2.5(-3) μm] are easily distinguished from these taxa based on their conidial dimensions. The three species of
<italic>Pseudoseptoria</italic>
treated by Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
), namely
<italic>P. donacis</italic>
(conidia 20-23 × 2-2.5 μm),
<italic>P. stromaticola</italic>
(conidia 16-18.5 × 2 μm) and
<italic>P. bromigena</italic>
(conidia 20-23 × 2-2.5 μm) can be distinguished from
<italic>P. collorata</italic>
and
<italic>P. obscura</italic>
by conidial dimensions, and lacking basal conidial appendages.</p>
</sec>
<sec id="S45">
<title>Clade 27:
<italic>Parastagonospora</italic>
</title>
<p id="P379">
<bold>
<italic>Parastagonospora</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804435&link_type=mb">MB804435</ext-link>
.</p>
<p id="P380">
<italic>Etymology</italic>
: Resembling the genus
<italic>Stagonospora</italic>
.</p>
<p id="P381">
<italic>Foliicolous</italic>
, plant pathogenic. Ascocarps immersed, globose, becoming depressed, medium brown to black; wall of 3-6 layers of thick-walled, brown
<italic>textura angularis</italic>
; ostiole slightly papillate. Asci clavate, cylindrical or curved, shortly stipitate, 8-spored; ascus wall thick, bitunicate. Ascospores fusoid, subhyaline to pale brown, transversely euseptate (-3), constricted at the septa, penultimate cell swollen. Pseudoparaphyses filiform, hyaline, septate.
<italic>Conidiomata</italic>
black, immersed, subepidermal, pycnidial, subglobose with central ostiole, exuding creamy conidial mass; wall of 2-3 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to subcylindrical, with percurrent proliferation near apex.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, cylindrical, granular to multi-guttulate, with obtuse apex and truncate base, transversely euseptate.</p>
<p id="P382">
<italic>Type species</italic>
:
<italic>Parastagonospora nodorum</italic>
(Berk.) Quaedvlieg, Verkley & Crous.</p>
<p id="P383">
<italic>Notes</italic>
: The genus
<italic>Parastagonospora</italic>
is introduced to accommodate several serious cereal pathogens that were formerly accommodated in either
<italic>Septoria/Stagonospora</italic>
, or
<italic>Leptosphaeria/Phaeosphaeria</italic>
. As shown previously,
<italic>Septoria</italic>
is not available for these fungi (
<xref ref-type="bibr" rid="R89">Quaedvlieg
<italic>et al</italic>
. 2011</xref>
), and neither is
<italic>Leptosphaeria</italic>
(
<xref ref-type="bibr" rid="R59">de Gruyter
<italic>et al</italic>
. 2013</xref>
). Furthermore, in the present study we also clarify the phylogenetic positions of
<italic>Stagonospora</italic>
and
<italic>Phaeosphaeria</italic>
, which cluster apart from this group of cereal pathogens, which are best accommodated in their own genus,
<italic>Parastagonospora</italic>
.</p>
<p id="P384">
<italic>Parastagonospora</italic>
is distinguished from
<italic>Stagonospora</italic>
in that
<italic>Stagonospora</italic>
has conidiogenous cells that proliferate percurrently, or via phialides with periclinal thickening, and conidia that are subcylindrical to fusoid-ellipsoidal. Sexual morphs known for species of
<italic>Parastagonospora</italic>
are phaeosphaeria-like, whereas those observed for
<italic>Stagonospora s. str</italic>
. are didymella-like.</p>
<p id="P385">
<bold>
<italic>Parastagonospora avenae</italic>
</bold>
(A.B. Frank) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804436&link_type=mb">MB804436</ext-link>
.</p>
<p id="P386">
<italic>Basionym</italic>
:
<italic>Septoria avenae</italic>
A.B. Frank, Ber. Dt. Bot. Ges. 13: 64. 1895.</p>
<list list-type="simple">
<list-item>
<list list-type="simple">
<list-item>
<p>
<italic>Stagonospora avenae</italic>
(A.B. Frank) Bissett [as ‘avena’], Fungi Canadenses, Ottawa 239: 1. 1982</p>
</list-item>
</list>
</list-item>
<list-item>
<p>=
<italic>Leptosphaeria avenaria</italic>
G.F. Weber, Phytopath. 12: 449. 1922.</p>
<list list-type="simple">
<list-item>
<p>
<italic>Phaeosphaeria avenaria</italic>
(G.F. Weber) O.E. Erikss., Ark. Bot., Ser. 2 6: 408. 1967.</p>
</list-item>
</list>
</list-item>
<list-item>
<p>=
<italic>Pleospora tritici</italic>
Garov., Arch. Triennale Lab. Bot. Crittog. 1: 123. 1874.</p>
</list-item>
</list>
<p id="P387">
<italic>Specimens examined</italic>
:
<bold>Germany</bold>
, Kiel-Kitzeberg, on
<italic>Lolium multiflorum</italic>
, 1968, U.G. Schlösser,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=290.69&link_type=cbs">CBS 290.69</ext-link>
,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=289.69&link_type=cbs">CBS 289.69</ext-link>
.</p>
<p id="P388">
<italic>Notes</italic>
: Although the oldest epithet for this taxon is
<italic>Pleospora tritici</italic>
(1874), “
<italic>avenae</italic>
” has been well established in literature, and accepted by the community. We thus recommend that this epithet be retained for this pathogen. Parastagonospora avenae leaf blotch of barley and rye (f.sp.
<italic>tritici</italic>
), appears distinct from the pathogen on oats (f.sp.
<italic>avenaria</italic>
) (
<xref ref-type="bibr" rid="R34">Cunfer 2000</xref>
), and further research is required to resolve this issue.</p>
<p id="P389">
<bold>
<italic>Parastagonospora caricis</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804437&link_type=mb">MB804437</ext-link>
. Figs
<xref ref-type="fig" rid="F57">57</xref>
,
<xref ref-type="fig" rid="F58">58</xref>
.</p>
<fig id="F57" position="float">
<label>Fig. 57.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Parastagonospora caricis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21304&link_type=cbs">CBS H-21304</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig57"></graphic>
</fig>
<fig id="F58" position="float">
<label>Fig. 58.</label>
<caption>
<p>
<italic>Parastagonospora caricis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21304&link_type=cbs">CBS H-21304</ext-link>
). A. Colony sporulating in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig58"></graphic>
</fig>
<p id="P390">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Carex</italic>
.</p>
<p id="P391">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
up to 250 μm diam, black, immersed, subepidermal, pycnidial, subglobose with central ostiole, exuding pale pink conidial cirrhus; wall of 2-3 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform, 8-15 × 4-6 μm, with percurrent proliferation at apex.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, scolecosporous, subcylindrical, with subobtuse apex and truncate base, 7-15-septate, (50-)60-70(-75) × (5-)6 μm.</p>
<p id="P392">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, undulate, with short, white aerial mycelium, surface olivaceous-black in the older parts, vinaceous-buff in the younger mycelium, reverse olivaceous-black in the older parts, brick in the younger mycelium, after 14 d, 4 cm diam; on MEA convex, fimbriate, surface fawn to hazel, reverse fusceous-black to cinnamon, after 14 d, 3 cm diam; on OA similar to MEA.</p>
<p id="P393">
<italic>Specimen examined</italic>
:
<bold>Netherlands</bold>
, Veenendaal, de Blauwe Hel, on leaves of
<italic>Carex acutiformis</italic>
(
<italic>Cyperaceae</italic>
), 25 Jul. 2012, W. Quaedvlieg (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21304&link_type=cbs">CBS H-21304</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135671&link_type=cbs">CBS 135671</ext-link>
=S615).</p>
<p id="P394">
<italic>Note</italic>
: Conidia of
<italic>P. caricis</italic>
are larger than those of
<italic>P. avenae</italic>
, which are (1-)3(-7)-septate, 17-46 × 2.5-4.5 μm (
<xref ref-type="bibr" rid="R8">Bissett 1982</xref>
), and narrower than those of
<italic>Stagonospora gigaspora</italic>
, which are 58-84 × 10-14 μm (
<xref ref-type="bibr" rid="R43">Ellis & Ellis 1997</xref>
).</p>
<p id="P395">
<bold>
<italic>Parastagonospora nodorum</italic>
</bold>
(Berk.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804438&link_type=mb">MB804438</ext-link>
.
<xref ref-type="fig" rid="F59">Fig. 59</xref>
.</p>
<fig id="F59" position="float">
<label>Fig. 59.</label>
<caption>
<p>
<italic>Parastagonospora nodorum</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-13909&link_type=cbs">CBS H-13909</ext-link>
). A, C. Ascomata and conidiomata forming in culture. B, D, F. Asci with ascospores. E, G. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig59"></graphic>
</fig>
<p id="P396">
<italic>Basionym</italic>
:
<italic>Depazea nodorum</italic>
Berk., Gard. Chron., London: 601. 1845.</p>
<list list-type="simple">
<list-item>
<list list-type="simple">
<list-item>
<p>
<italic>Septoria nodorum</italic>
(Berk.) Berk., Gard. Chron., London: 601. 1845.</p>
</list-item>
<list-item>
<p>
<italic>Stagonospora nodorum</italic>
(Berk.) E. Castell. & Germano, Annali Fac. Sci. Agr. Univ. Torino 10: 71. 1977. [1975-76]</p>
</list-item>
</list>
</list-item>
<list-item>
<p>=
<italic>Leptosphaeria nodorum</italic>
E. Müll., Phytopath. J. 19: 409. 1952.</p>
<list list-type="simple">
<list-item>
<p>
<italic>Phaeosphaeria nodorum</italic>
(E. Müll.) Hedjar., Sydowia 22: 79. 1969. [1968]</p>
</list-item>
</list>
</list-item>
</list>
<p id="P397">
<italic>Specimen examined</italic>
:
<bold>Denmark</bold>
, on
<italic>Lolium perenne</italic>
, Feb. 2002, M.P.S. Câmara,
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=110109&link_type=cbs">CBS 110109</ext-link>
.</p>
<p id="P398">
<italic>Notes</italic>
: Parastagonospora nodorum blotch is an important disease of cereals, having been reported from barley and wheat in most countries where these crops are cultivated (
<xref ref-type="bibr" rid="R34">Cunfer 2000</xref>
). Recent studies have also indicated that
<italic>P. nodorum</italic>
probably resembles a species complex, awaiting further morphological characterisation (McDonald
<italic>et al.</italic>
2013).</p>
<p id="P399">
<bold>
<italic>Parastagonospora poae</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804439&link_type=mb">MB804439</ext-link>
. Figs
<xref ref-type="fig" rid="F60">60</xref>
,
<xref ref-type="fig" rid="F61">61</xref>
.</p>
<fig id="F60" position="float">
<label>Fig. 60.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Parastagonospora poae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135091&link_type=cbs">CBS 135091</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig60"></graphic>
</fig>
<fig id="F61" position="float">
<label>Fig. 61.</label>
<caption>
<p>
<italic>Parastagonospora poae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135091&link_type=cbs">CBS 135091</ext-link>
). A, B. Conidiomata forming in culture. C-E. Conidiogenous cells. F, G. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig61"></graphic>
</fig>
<p id="P400">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Poa</italic>
.</p>
<p id="P401">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
up to 250 μm diam, black, immersed, subepidermal, pycnidial, subglobose with central ostiole, exuding creamy conidial mass; wall of 2-3 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to subcylindrical, with percurrent proliferation near apex, 6-10 × 3-4(-5) μm.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, cylindrical, granular, with obtuse apex and truncate base, medianly 1-septate, (20-)25-27(-32) × (2-)2.5(-2.5) μm; ends becoming swollen and guttulate with age.</p>
<p id="P402">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, circular, with sparse, white aerial mycelium, surface dark-mouse-grey, reverse black, after 14 d, 8.5 cm diam; on MEA surface hazel, reverse dark-brick to sepia; OA similar to MEA.</p>
<p id="P403">
<italic>Specimens examined</italic>
:
<bold>Netherlands</bold>
, Wageningen, on leaves of
<italic>Poa</italic>
sp. (
<italic>Poaceae</italic>
), 2 Aug. 2012, S. Videira J (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21305&link_type=cbs">CBS H-21305</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135089&link_type=cbs">CBS 135089</ext-link>
=S606); Wageningen, on leaves of
<italic>Poa</italic>
sp., 2 Aug. 2012, S. Videira
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135091&link_type=cbs">CBS 135091</ext-link>
=S613).</p>
<p id="P404">
<italic>Note</italic>
: Conidia of
<italic>P. poae</italic>
are narrower than those of
<italic>P. nodorum</italic>
, which are (0-)1-3-septate, 13-28 × 2.8-4.6 μm (
<xref ref-type="bibr" rid="R8">Bissett 1982</xref>
).</p>
</sec>
<sec id="S46">
<title>Clade 28:
<italic>Neostagonospora</italic>
</title>
<p id="P405">
<bold>
<italic>Neostagonospora</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804440&link_type=mb">MB804440</ext-link>
.</p>
<p id="P406">
<italic>Etymology</italic>
: Resembling the genus
<italic>Stagonospora</italic>
.</p>
<p id="P407">
<italic>Foliicolous. Conidiomata</italic>
immersed, pycnidial, globose, exuding a pale luteous to creamy conidial mass; wall of 2-3 layers of pale brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to doliiform, tapering at apex with prominent periclinal thickening.
<italic>Conidia</italic>
hyaline, smooth, granular, thin-walled, narrowly fusoid-ellipsoidal to subcylindrical, apex subobtusely rounded, base truncate, widest in middle, transversely euseptate, becoming constricted with age.</p>
<p id="P408">
<italic>Type species</italic>
:
<italic>Neostagonospora caricis</italic>
Quaedvlieg, Verkley & Crous.</p>
<p id="P409">
<italic>Note</italic>
:
<italic>Neostagonospora</italic>
is similar to
<italic>Stagonospora</italic>
by having pycnidial conidiomata with euseptate, hyaline, fusoid-ellipsoidal to subcylindrical conidia, but distinct in having conidiogenous cells that are phialidic, with prominent periclinal thickening.</p>
<p id="P410">
<bold>
<italic>Neostagonospora caricis</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804441&link_type=mb">MB804441</ext-link>
. Figs
<xref ref-type="fig" rid="F62">62</xref>
,
<xref ref-type="fig" rid="F63">63</xref>
.</p>
<fig id="F62" position="float">
<label>Fig. 62.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Neostagonospora caricis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135092&link_type=cbs">CBS 135092</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig62"></graphic>
</fig>
<fig id="F63" position="float">
<label>Fig. 63.</label>
<caption>
<p>
<italic>Neostagonospora caricis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135092&link_type=cbs">CBS 135092</ext-link>
). A. Conidioma forming in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig63"></graphic>
</fig>
<p id="P411">
<italic>Etymology</italic>
: Named after the host genus on which it occurs,
<italic>Carex</italic>
.</p>
<p id="P412">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
immersed, pycnidial, globose, up to 200 μm diam, exuding a pale luteous to creamy conidial mass; wall of 2-3 layers of pale brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to doliiform, 5-7 × 5-7 μm; tapering at apex with prominent periclinal thickening.
<italic>Conidia</italic>
hyaline, smooth, granular, thin-walled, narrowly fusoid-ellipsoidal, apex subobtusely rounded, base truncate, widest in middle, 1-septate, becoming constricted with age, (10-)13-16(-19) × (3-)3.5(-4) μm.</p>
<p id="P413">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, undulate, with sparse, powdery white aerial mycelium, surface greyish-sepia to isabelline, reverse olivaceous-grey to pale olivaceous-grey, after 14 d, 8.5 cm diam; on MEA erumpent, circular, with fine white aerial mycelium, surface honey, reverse cinnamon, after 14 d, 6 cm diam; on OA similar to PDA but surface honey, reverse cinnamon.</p>
<p id="P414">
<italic>Specimen examined</italic>
:
<bold>Netherlands</bold>
, Veenendaal, de Blauwe Hel, on leaves of
<italic>Carex acutiformis</italic>
(
<italic>Cyperaceae</italic>
), Aug. 2012, W. Quaedvlieg (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21306&link_type=cbs">CBS H-21306</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135092&link_type=cbs">CBS 135092</ext-link>
=S616).</p>
<p id="P415">
<italic>Note</italic>
:
<italic>Neostagonospora caricis</italic>
is similar to
<italic>Septoria caricis</italic>
(conidia 1-septate, 20-35 × 2.5-3 μm;
<xref ref-type="bibr" rid="R43">Ellis & Ellis 1997</xref>
), although its conidia are shorter.</p>
<p id="P416">
<bold>
<italic>Neostagonospora elegiae</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804442&link_type=mb">MB804442</ext-link>
. Figs
<xref ref-type="fig" rid="F64">64</xref>
,
<xref ref-type="fig" rid="F65">65</xref>
.</p>
<fig id="F64" position="float">
<label>Fig. 64.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Neostagonospora elegiae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135101&link_type=cbs">CBS 135101</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig64"></graphic>
</fig>
<fig id="F65" position="float">
<label>Fig. 65.</label>
<caption>
<p>
<italic>Neostagonospora elegiae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135101&link_type=cbs">CBS 135101</ext-link>
). A. Conidioma forming in culture. B-D. Conidiogenous cells. E. Conidia. Scale bars: A = 150 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig65"></graphic>
</fig>
<p id="P417">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Elegia.</italic>
</p>
<p id="P418">On
<italic>Anthriscus</italic>
stem.
<italic>Conidiomata</italic>
pycnidial, up to 150 μm diam, erumpent, globose, brown, opening by a central ostiole, exuding a crystalline conidial mass; wall consisting of 3-6 layers of pale brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, lining the inner cavity, hyaline, smooth, ampulliform, 4-7 × 4-6 μm; apex with prominent periclinal thickening.
<italic>Conidia</italic>
hyaline, smooth, guttulate to granular, scolecosporous, irregularly curved, subcylindrical, apex subobtuse, base truncate (slight taper from apical septum to apex and basal septum to hilum visible in some conidia), (0-)3-septate, (20-)50-65(-70) × (2.5-)3 μm.</p>
<p id="P419">
<italic>Culture characteristics</italic>
: Colonies spreading, erumpent with moderate aerial mycelium and smooth, even margins; reaching 35 mm diam after 2 wk. On OA pale luteous. On MEA dirty white on surface, luteous in reverse. On PDA dirty white on surface, pale luteous in reverse.</p>
<p id="P420">
<italic>Specimen examined</italic>
:
<bold>South Africa</bold>
, Western Cape Province, Harold Porter Botanical Garden, on leaves of
<italic>Elegia cuspidata</italic>
(
<italic>Restionaceae</italic>
), 30 Nov. 2001, S. Lee (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21307&link_type=cbs">CBS H-21307</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135101&link_type=cbs">CBS 135101</ext-link>
=CPC 16977).</p>
<p id="P421">
<italic>Notes</italic>
: No septoria-like fungi are presently known from
<italic>Elegia</italic>
(
<xref ref-type="bibr" rid="R69">Lee
<italic>et al</italic>
. 2004</xref>
)
<italic>. Neostagonospora elegiae</italic>
is distinguished from
<italic>N. caricis</italic>
based on its conidial morphology.</p>
</sec>
<sec id="S47">
<title>Clade 29:
<italic>Phaeosphaeriopsis</italic>
</title>
<p id="P422">
<bold>
<italic>Phaeosphaeriopsis</italic>
</bold>
M.P.S. Câmara, M.E. Palm & A.W. Ramaley, Mycol. Res. 107: 519. 2003.</p>
<p id="P423">
<italic>Saprobic</italic>
or
<italic>plant pathogenic. Ascomata</italic>
solitary or aggregated, immersed, subepidermal to erumpent, pushing up flaps of the epidermis, globose to pyriform, often papillate, solitary or gregarious in a stroma of scleroplectenchyma or dark brown
<italic>textura angularis</italic>
, often surrounded by septate, brown hyphae extending into the host tissues.
<italic>Asci</italic>
8-spored, bitunicate, cylindrical to broadly fusoid, short stipitate, with visible apical chamber.
<italic>Ascospores</italic>
uni- to triseriate, cylindrical, broadly rounded at apex, tapering to narrowly rounded base, 4-5-septate, first septum submedian, often constricted, medium brown, echinulate, punctate or verrucose. Asexual morph coniothyrium-like or phaeostagonospora-like.
<italic>Conidiomata</italic>
pseudoparenchymatous, sometimes of scleroplectenchyma.
<italic>Conidiogenous cells</italic>
lining locule, ampulliform, hyaline, proliferating percurrently, resulting in inconspicuous annellations.
<italic>Conidia</italic>
cylindrical, with bluntly rounded ends, 0-3-septate, yellowish brown, punctate (
<xref ref-type="bibr" rid="R12">Câmara
<italic>et al</italic>
. 2003</xref>
,
<xref ref-type="bibr" rid="R124">Zhang
<italic>et al</italic>
. 2012</xref>
).</p>
<p id="P424">
<italic>Type species</italic>
:
<italic>Phaeosphaeriopsis glaucopunctata</italic>
(Grev.) M.P.S. Câmara, M.E. Palm & A.W. Ramaley, Mycol. Res., 107: 519. 2003.</p>
<p id="P425">
<bold>
<italic>Phaeosphaeriopsis glaucopunctata</italic>
</bold>
(Grev.) M.P.S. Câmara, M.E. Palm & A.W. Ramaley, Mycol. Res. 107: 519. 2003. Figs
<xref ref-type="fig" rid="F66">66</xref>
,
<xref ref-type="fig" rid="F67">67</xref>
.</p>
<fig id="F66" position="float">
<label>Fig. 66.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Phaeosphaeriopsis glaucopunctata</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=653.86&link_type=cbs">CBS 653.86</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig66"></graphic>
</fig>
<fig id="F67" position="float">
<label>Fig. 67.</label>
<caption>
<p>
<italic>Phaeosphaeriopsis glaucopunctata</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=653.86&link_type=cbs">CBS 653.86</ext-link>
). A. Colony on MEA. B. Colony on OA. C-F. Conidiogenous cells giving rise to conidia. G. Conidia. Scale bars = 10 μm</p>
</caption>
<graphic xlink:href="307fig67"></graphic>
</fig>
<p id="P426">
<italic>Basionym</italic>
:
<italic>Cryptosphaeria glaucopunctata</italic>
Grev., Fl. Edin.: 362. 1824.</p>
<list list-type="simple">
<list-item>
<list list-type="simple">
<list-item>
<p>
<italic>Paraphaeosphaeria glaucopunctata</italic>
(Grev.) Shoemaker & C. E. Babc., Can. J. Bot. 63: 1286. 1985.</p>
</list-item>
</list>
</list-item>
<list-item>
<p>=
<italic>Sphaeria rusci</italic>
Wallr., Fl. Crypt. Germ. 2: 776. 1833.</p>
<list list-type="simple">
<list-item>
<p>
<italic>Leptosphaeria rusci</italic>
(Wallr.) Sacc., Syll. Fung. 2: 74. 1883.</p>
</list-item>
<list-item>
<p>
<italic>Paraphaeosphaeria rusci</italic>
(Wallr.) O. E. Erikss., Ark. Bot., Ser. 2 6: 406. 1967.</p>
</list-item>
</list>
</list-item>
</list>
<p id="P427">
<italic>Ascomata</italic>
scattered or aggregated, immersed, globose to subglobose, up to 250 μm diam; peridium up to 25 μm wide, of thick-walled
<italic>textura angularis</italic>
;
<italic>hamathecium</italic>
of dense, wide, cellular pseudoparaphyses, 3-5 μm diam.
<italic>Asci</italic>
8-spored, bitunicate, cylindrical to broadly fusoid, with a short pedicel and small apical chamber, 50-110 × 10-16 μm.
<italic>Ascospores</italic>
uni- to triseriate, cylindrical, medium brown, 4(-5)-septate, without constriction or slightly constricted at the basal septum, the forth cell from the apex usually slightly inflated, the basal cell often longer, 14-28 × (3.5-)5-7.5 μm.
<italic>Conidiomata</italic>
pycnidial, immersed, scattered or aggregated, dark brown, subglobose, ostiolate, up to 200 μm diam.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
lining the inner cavity, ampulliform, hyaline, smooth, 5-10 × 3-6 μm; proliferating percurrently at apex.
<italic>Conidia</italic>
aseptate, smooth to finely verruculose, medium brown, subcylindrical, straight to reniform with obtuse ends, (5-)7-9(-10) × (2.5-)3(-5) μm.</p>
<p id="P428">
<italic>Culture characteristics</italic>
: On PDA colonies flat, spreading, with sparse aerial mycelium and smooth, lobate, even margins, surface primrose, reverse olivaceous-buff, On OA buff with patches of isabelline due to sporulating conidiomata. On MEA dirty white on surface, isabelline in reverse (centre), cinnamon in outer region.</p>
<p id="P429">
<italic>Specimen examined</italic>
:
<bold>Switzerland</bold>
, Kt. Basel-Stadt, Park Basel, on
<italic>Ruscus aculeatus</italic>
(
<italic>Ruscaceae</italic>
), 25 Sep. 1980,
<italic>A. Leuchtmann</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21308&link_type=cbs">CBS H-21308</ext-link>
, culture
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=653.86&link_type=cbs">CBS 653.86</ext-link>
).</p>
<p id="P430">
<italic>Notes</italic>
: The genus
<italic>Phaeosphaeriopsis</italic>
is characterised by having uni- or multiloculate stromata and 4-5-septate ascospores. It presently contains species with coniothyrium-like, and phaeostagonospora-like asexual morphs (
<italic>e.g. P. musae</italic>
;
<xref ref-type="bibr" rid="R3">Arzanlou & Crous 2006</xref>
). The type species,
<italic>Phaeosphaeriopsis glaucopunctata</italic>
, is associated with leaf spot and necrosis on
<italic>Ruscus aculeatus</italic>
(
<xref ref-type="bibr" rid="R12">Câmara
<italic>et al</italic>
. 2003</xref>
,
<xref ref-type="bibr" rid="R54">Golzar & Wang 2012</xref>
). The fact that an isolate identified as
<italic>Chaetosphaeronema hispidulum</italic>
(lectotype of
<italic>Chaetosphaeronema</italic>
) clusters in this clade is puzzling. The genus
<italic>Chaetosphaeronema</italic>
is characterised by setose, dark brown pycnidia with thick-walled outer cell layers, producing hyaline, 1-septate conidia (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
). Isolate
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=216.75&link_type=cbs">CBS 216.75</ext-link>
proved to be sterile, however, so this matter could unfortunately not be resolved.</p>
</sec>
<sec id="S48">
<title>Clade 30:
<italic>Sclerostagonospora</italic>
</title>
<p id="P431">
<italic>Description</italic>
: See above.</p>
<p id="P432">
<italic>Type species</italic>
:
<italic>S. heraclei</italic>
(Sacc.) Höhn., Hedwigia 59: 252. 1917.</p>
<p id="P433">
<bold>
<italic>Sclerostagonospora phragmiticola</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804443&link_type=mb">MB804443</ext-link>
.
<xref ref-type="fig" rid="F68">Fig. 68</xref>
.</p>
<fig id="F68" position="float">
<label>Fig. 68.</label>
<caption>
<p>
<italic>Sclerostagonospora phragmiticola</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=338.86&link_type=cbs">CBS 338.86</ext-link>
). A. Colony sporulating in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig68"></graphic>
</fig>
<p id="P434">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Phragmites.</italic>
</p>
<p id="P435">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
pycnidial, brown, globose, immersed to erumpent, up to 400 μm diam with central ostiole; wall of 6-8 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
lining the inner cavity of conidioma, hyaline to pale olivaceous, smooth, subcylindrical to doliiform, 6-15 × 3-4 μm, proliferating several times percurrently at apex.
<italic>Conidia</italic>
brown, smooth, subcylindrical, apex obtuse, base truncate, straight to gently curved, (1-)3(-5)-euseptate, older conidia swelling, becoming widest in second or third cell from base, (15-)20-25(-27) × (3-)3.5(-4) μm.</p>
<p id="P436">
<italic>Specimen examined</italic>
:
<bold>France</bold>
, Landes, Seignosse, Étang d’Hardy, on leaves of
<italic>Phragmites australis</italic>
(
<italic>Poaceae</italic>
), 11 June 1986, H.A. van der Aa (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21309&link_type=cbs">CBS H-21309</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=338.86&link_type=cbs">CBS 338.86</ext-link>
).</p>
<p id="P437">
<italic>Notes</italic>
:
<italic>Sclerostagonospora caricicola</italic>
fits the concept of
<italic>Sclerostagonospora</italic>
by having pycnidial conidiomata that give rise to hyaline conidiogenous cells that proliferate percurrently, and subcylindrical, pigmented conidia. Until fresh material of the type species,
<italic>S. heraclei</italic>
has been recollected and subjected to DNA analysis, the application of this generic name will remain tentative. Several other species cluster in this clade, suggesting that the sexual morph is phaeosphaeria-like.</p>
</sec>
<sec id="S49">
<title>Clade 31:
<italic>Phaeosphaeria</italic>
</title>
<p id="P438">
<bold>
<italic>Phaeosphaeria</italic>
</bold>
I. Miyake, Bot. Mag., Tokyo 23: 93. 1909.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Phaeoseptoria</italic>
Speg., Revta Mus. La Plata 15: 39. 1908.</p>
</list-item>
</list>
<p id="P439">
<italic>Foliicolous. Ascomata</italic>
immersed, subepidermal, ellipsoidal to globose, glabrous; ostiole central, devoid of periphyses; wall of 2-3 layers of brown
<italic>textura angularis. Pseudoparaphyses</italic>
transversely septate, guttulate, encased in mucous.
<italic>Asci</italic>
stipitate, clavate to cylindrical, stalked, biseriate.
<italic>Ascospores</italic>
brown, narrowly fusiform, straight or slightly curved, transversely septate, smooth to verruculose, enclosed in a mucoid sheath or not.
<italic>Conidiomata</italic>
pycnidial, immersed, becoming erumpent, brown, with central ostiole; wall of 2-3 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
hyaline, ampulliform to subcylindrical or doliiform; proliferating inconspicuously percurrently near apex.
<italic>Conidia</italic>
solitary, pale brown, smooth, guttulate, subcylindrical to narrowly obclavate, apex obtuse, base truncate, straight to curved, transversely euseptate, at times slightly constricted at septa; hilum not darkened nor thickened.</p>
<p id="P440">
<italic>Type species</italic>
:
<italic>P. oryzae</italic>
I. Miyake, Bot. Mag. Tokyo, 23(266): 93. 1909.</p>
<p id="P441">
<italic>Notes</italic>
:
<italic>Phaeosphaeria</italic>
(1909; based on
<italic>P. oryzae</italic>
) is congeneric with
<italic>Phaeoseptoria</italic>
(1908; based on
<italic>P. papayae</italic>
). We choose to use the sexual name
<italic>Phaeosphaeria</italic>
, as it is well established, and less confused than
<italic>Phaeoseptoria</italic>
, which has become a confused concept applied to numerous septoria-like taxa with pigmented conidia (see
<xref ref-type="bibr" rid="R120">Walker
<italic>et al</italic>
. 1992</xref>
).</p>
<p id="P442">
<bold>
<italic>Phaeosphaeria oryzae</italic>
</bold>
I. Miyake, Bot. Mag. Tokyo, 23(266): 93. 1909. Figs
<xref ref-type="fig" rid="F69">69</xref>
,
<xref ref-type="fig" rid="F70">70</xref>
.</p>
<fig id="F69" position="float">
<label>Fig. 69.</label>
<caption>
<p>Asci and ascospores of
<italic>Phaeosphaeria oryzae</italic>
(BPI 744438). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig69"></graphic>
</fig>
<fig id="F70" position="float">
<label>Fig. 70.</label>
<caption>
<p>
<italic>Phaeosphaeria oryzae</italic>
(BPI 744438). A. Ascomata on host tissue. B-G. Asci. H. Ascospores. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig70"></graphic>
</fig>
<list list-type="simple">
<list-item>
<list list-type="simple">
<list-item>
<p>
<italic>Pleospora oryzae</italic>
(I. Miyake) Hara, J. Agric. Soc. Japan 31(361): 17. 1927.</p>
</list-item>
<list-item>
<p>
<italic>Trematosphaerella oryzae</italic>
(I. Miyake) Padwick, A manual of rice diseases: 153. 1950.</p>
</list-item>
<list-item>
<p>
<italic>Leptosphaerella oryzae</italic>
(I. Miyake) Hara, A monograph of rice diseases: 53. 1959.</p>
</list-item>
<list-item>
<p>
<italic>Leptosphaerulina oryzae</italic>
(I. Miyake) Karan, Mycopath. Mycol. Appl. 24: 88. 1964.</p>
</list-item>
</list>
</list-item>
<list-item>
<p>=
<italic>Phaeoseptoria oryzae</italic>
I. Miyake, J. Coll. Agric. Imp. Univ. Tokyo 2(4): 260. 1910.</p>
</list-item>
</list>
<p id="P443">
<italic>Ascomata</italic>
immersed, subepidermal, ellipsoidal to globose, glabrous, up to 150 μm diam, ostiole central, up to 20 μm diam, devoid of periphyses; wall of 2-3 layers of brown
<italic>textura angularis. Pseudoparaphyses</italic>
2-3 μm diam, transversely septate, guttulate, encased in mucous.
<italic>Asci</italic>
stipitate, cylindrical, 30-55 × 7-9 μm, stalked, biseriate.
<italic>Ascospores</italic>
brown, narrowly fusiform, straight or slightly curved, (15-)17-20(-23) × 4(-5) μm, 3-septate, uniformly verruculose, enclosed in a mucoid sheath; after discharge, ascospores become prominently swollen, up to 33 μm long and 8 μm wide.</p>
<p id="P444">
<italic>Specimens examined</italic>
:
<bold>Japan</bold>
, No. 196178, on 2, Prov. Susuya Shizuoka, Sep. 1907, ex Herb. Sydow, ex S., as
<italic>Leptosphaeria oryzae</italic>
Hori =
<italic>Phaeosphaeria oryzae</italic>
I. Miyake, slides prepared by O. Eriksson,
<bold>lectotype</bold>
(UPS).
<bold>Korea</bold>
, on leaf of
<italic>Oryza sativa</italic>
(
<italic>Poaceae</italic>
), intercepted at Port San Francisco, CA, 29 Dec. 1997, coll. L. Hausch, det. M.E. Palm,
<bold>epitype</bold>
designated here as BPI 744438, culture ex-epitype
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=110110&link_type=cbs">CBS 110110</ext-link>
(MBT175330).</p>
<p id="P445">
<italic>Notes</italic>
: Several detailed accounts of this species are available (
<xref ref-type="bibr" rid="R44">Eriksson 1967</xref>
,
<xref ref-type="bibr" rid="R99">Shoemaker & Babcock 1989</xref>
,
<xref ref-type="bibr" rid="R53">Fukuhara 2002</xref>
). The epitype chosen here closely matches the lectotype in morphology.</p>
<p id="P446">
<bold>
<italic>Phaeosphaeria papayae</italic>
</bold>
(Speg.) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804444&link_type=mb">MB804444</ext-link>
. Figs
<xref ref-type="fig" rid="F71">71</xref>
,
<xref ref-type="fig" rid="F72">72</xref>
.</p>
<fig id="F71" position="float">
<label>Fig. 71.</label>
<caption>
<p>Conidia, ascospores and ascus of
<italic>Phaeosphaeria papayae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21310&link_type=cbs">CBS H-21310</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig71"></graphic>
</fig>
<fig id="F72" position="float">
<label>Fig. 72.</label>
<caption>
<p>
<italic>Phaeosphaeria papayae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21310&link_type=cbs">CBS H-21310</ext-link>
). A. Leaf spot. B. Conidioma with ostiole (arrow). C-E. Conidiogenous cells. F. Conidia. G-K. Asci and ascospores. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig72"></graphic>
</fig>
<p id="P447">
<italic>Basionym</italic>
:
<italic>Phaeoseptoria papayae</italic>
Speg., Revta Mus. La Plata: 39. 1908.</p>
<p id="P448">
<italic>Leaf spots</italic>
associated with infections of
<italic>Asperisporium caricae</italic>
, amphigenous, pale brown to grey-white, subcircular to angular, 1-5 mm diam, with red-purple margin; conidiomata developing and sporulating on leaves when incubated in moist chambers, with white, fluffy mycelium erumpting from lesions.
<italic>Conidiomata</italic>
amphigenous, pycnidial, brown, globose, up to 120 μm diam, with central ostiole, exuding a brown conidial cirrhus; wall of 3-4 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
lining the inner cavity, hyaline, smooth, ampulliform to subcylindrical or doliiform, 5-12 × 4-6 μm; proliferating inconspicuously percurrently near apex (conidiogenous cells disintegrating at maturity).
<italic>Conidia</italic>
solitary, pale brown, smooth, guttulate, subcylindrical to narrowly obclavate, apex obtuse, base truncate, (1-)3(-4)-septate, at times slightly constricted at septa, straight to slightly curved, (15-)26-32(-35) × (2.5-)3 μm; hilum not darkened nor thickened, 2 μm diam.
<italic>Ascomata</italic>
developed after 4 wk in culture on sterile nettle stems: aggregated in black clusters, globose, up to 150 μm diam, with central ostiole; wall of 2-3 layers of brown
<italic>textura angularis. Asci</italic>
bitunicate, curved to straight, fasciculate, short stipitate with ocular chamber, 40-60 × 8-11 μm.
<italic>Pseudoparaphyses</italic>
hyaline, smooth, 2-3 μm, septate, constricted at septa, not anastomosing, hypha-like with obtuse ends, distributed among asci.
<italic>Ascospores</italic>
tri to multiseriate, fusoid, curved to straight, brown, verruculose throughout, somewhat constricted at septa with age, second cell from apex swollen, (18-)24-26(-29) × (3-)4(-5) μm.</p>
<p id="P449">
<italic>Culture characteristics</italic>
: Colonies with abundant aerial mycelium, covering dish within 2 wk at 24 °C, fast growing, olivaceous-grey on MEA (surface and reverse); margins smooth, even, sterile on MEA, PDA and OA, as well as on SNA with sterile barley leaves.</p>
<p id="P450">
<italic>Specimens examined</italic>
:
<bold>Brazil</bold>
, São Paulo, Botanical Garden, on leaves of
<italic>Carica papaya</italic>
(
<italic>Caricaceae</italic>
), Sep. 1908, IMI 246301, slide ex-holotype; Minas Gerais, Viçosa, UFV campus, on leaves of
<italic>Carica papaya</italic>
, Mar. 2013, A.C. Alfenas,
<bold>epitype</bold>
designated here as
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21310&link_type=cbs">CBS H-21310</ext-link>
, culture ex-epitype
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135416&link_type=cbs">CBS 135416</ext-link>
(MBT175331).</p>
<p id="P451">
<italic>Notes</italic>
: It is interesting to note that Walker
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R120">1992</xref>
) also observed
<italic>Phaeoseptoria papayae</italic>
to co-occur with
<italic>Asperisporium caricae</italic>
on the holotype specimen (noted by Spegazzini as
<italic>Cercospora caricae</italic>
), suggesting that the co-occurrence of these two pathogens is quite common. The fresh collection obtained in this study enabled us to elucide the conidiogenesis of the fungus (not observed by
<xref ref-type="bibr" rid="R120">Walker
<italic>et al</italic>
. 1992</xref>
), and also designate an epitype specimen. Phylogenetically it is closely related to
<italic>Phaeosphaeria oryzae</italic>
, which has
<italic>Phaeoseptoria oryzae</italic>
as asexual morph.</p>
</sec>
<sec id="S50">
<title>Clade 32:
<italic>Neosetophoma</italic>
</title>
<p id="P452">
<bold>
<italic>Neosetophoma</italic>
</bold>
Gruyter, Aveskamp & Verkley, Mycologia 102(5): 1075. 2010.</p>
<p id="P453">
<italic>Foliicolous,</italic>
plant pathogenic
<italic>. Conidiomata</italic>
pycnidial, solitary to confluent, on upper surface of agar, globose to irregular, with mycelial outgrowths, or confluent, with papillate ostioles, sometimes developing long necks, honey to olivaceous or olivaceous-black, with up to 10 layers of pseudoparenchymatal cells.
<italic>Conidiogenous cells</italic>
hyaline, monophyalidic.
<italic>Conidia</italic>
slightly yellowish, 0-1(-3)-septate, ellipsoidal to cylindrical, usally attenuate at one end, often guttulate.</p>
<p id="P454">
<italic>Type species</italic>
:
<italic>N. samarorum</italic>
Gruyter, Aveskamp & Verkley, Mycologia 102(5): 1075. 2010.</p>
<p id="P455">
<italic>Note</italic>
: The fact that several strains with a phaeosphaeria-like morphology cluster in this clade, suggests that sexual states do exist for species of
<italic>Neosetophoma.</italic>
</p>
</sec>
<sec id="S51">
<title>Clade 33:
<italic>Paraphoma</italic>
</title>
<p id="P456">
<bold>
<italic>Paraphoma</italic>
</bold>
Morgan-Jones & J.F. White, Mycotaxon 18: 58. 1983.</p>
<p id="P457">
<italic>Mycelium</italic>
consisting of branched, septate, subhyaline to pale brown, smooth hyphae.
<italic>Conidiomata</italic>
pycnidial, solitary to aggregated, superficial to immersed, dark brown, globose to subglobose, papillate, uniloculate, setose; ostiole circular, single; wall of 3-6 layers of brown
<italic>textura angularis. Setae</italic>
copious, straight to flexuous, smooth to verruculose, thick-walled, septate, pale brown to brown.
<italic>Conidiogenous cells</italic>
lageniform, monophalidic, formed from inner layer of conidiomatal wall, hyaline to subhyaline, discrete.
<italic>Conidia</italic>
ellipsoid, aseptate, hyaline, smooth, guttulate.
<italic>Chlamydospores</italic>
if present unicellular.</p>
<p id="P458">
<italic>Type species</italic>
:
<italic>P. radicina</italic>
(McAlpine) Morgan-Jones & J.F. White, Mycotaxon 18: 60. 1983.</p>
<p id="P459">
<bold>
<italic>Paraphoma dioscoreae</italic>
</bold>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804445&link_type=mb">MB804445</ext-link>
. Figs
<xref ref-type="fig" rid="F73">73</xref>
,
<xref ref-type="fig" rid="F74">74</xref>
.</p>
<fig id="F73" position="float">
<label>Fig. 73.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Paraphoma dioscoreae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135100&link_type=cbs">CBS 135100</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig73"></graphic>
</fig>
<fig id="F74" position="float">
<label>Fig. 74.</label>
<caption>
<p>
<italic>Paraphoma dioscoreae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135100&link_type=cbs">CBS 135100</ext-link>
). A. Conidioma forming in culture. B-E. Conidiogenous cells. F. Conidia. Scale bars: B = 350 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig74"></graphic>
</fig>
<p id="P460">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Dioscorea.</italic>
</p>
<p id="P461">On
<italic>Anthriscus</italic>
stem.
<italic>Conidiomata</italic>
pycnidial, separate, immersed becoming erumpent, globose, with papillate neck and central ostiole exuding a crystalline conidial mass; conidiomata up to 350 μm diam, neck up to 150 μm diam, of darker brown cells than body, which is pale brown; wall of 3-6 layers of pale brown
<italic>textura angularis. Conidiophores</italic>
hyaline, smooth, subcylindrical, reduced to conidiogenous cells, 1-5-septate, irregularly branched, 5-20 × 3-5 μm.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, ampulliform to subcylindrical (long, elongated neck on
<italic>Anthriscus</italic>
stem, but not on MEA), 5-15 × 2-3 μm; apex with prominent periclinal thickening, or with several percurrent prolferations (especially on conidiogenous cells with elongated necks).
<italic>Conidia</italic>
solitary, straight to slightly curved, hyaline, smooth, aseptate, cylindrical with obtuse ends and a guttule at each end, (5-)6(-7) × 2(-2.5) μm.</p>
<p id="P462">
<italic>Culture characteristics</italic>
: Colonies flat, spreading with sparse aerial mycelium and even, smooth margins; after 2 wk reaching 30 mm diam on MEA, 40 mm on PDA and 50 mm on OA. On PDA dark brick, reverse fuscous-black. On OA dark brick with patches of sienna and ochreous. On MEA surface dirty white (due to aerial mycelium), also somewhat sectored, reverse umber.</p>
<p id="P463">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, on leaves of
<italic>Dioscorea tokoro</italic>
(
<italic>Dioscoreaceae</italic>
), 24 Oct. 2003, H.D. Shin (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21311&link_type=cbs">CBS H-21311</ext-link>
, culture ex-type CPC 11357 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135100&link_type=cbs">CBS 135100</ext-link>
).</p>
<p id="P464">
<italic>Note</italic>
:
<italic>Paraphoma dioscoreae</italic>
is phylogenetically distinct from the three other species presently known in the genus (
<xref ref-type="bibr" rid="R58">de Gruyter
<italic>et al.</italic>
2010</xref>
).</p>
</sec>
<sec id="S52">
<title>Clade 34:
<italic>Xenoseptoria</italic>
</title>
<p id="P465">
<bold>
<italic>Xenoseptoria</italic>
</bold>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804446&link_type=mb">MB804446</ext-link>
.</p>
<p id="P466">
<italic>Etymology</italic>
: Similar to the genus
<italic>Septoria s. str</italic>
., but distinct.</p>
<p id="P467">
<italic>Foliicolous,</italic>
plant pathogenic.
<italic>Conidiomata</italic>
separate, pycnidial, immersed becoming erumpent, globose, brown, developing 1-3 papillate necks, exuding a pink to orange conidial mass; wall of 4-8 layers of brown
<italic>textura angularis. Conidiophores</italic>
hyaline, smooth, reduced to conidiogenous cells or septate, branched below.
<italic>Conidiogenous cells</italic>
lining the inner cavity, hyaline, smooth, ampulliform to doliiform or subcylindrical, mono- to polyphialidic, with prominent periclinal thickening, but also with percurrent proliferation.
<italic>Conidia</italic>
hyaline, smooth, guttulate, scolecosporous, straight to irregularly curved, cylindrical to obclavate, transversely euseptate, tapering to subobtuse apex, base obtuse.</p>
<p id="P468">
<italic>Type species</italic>
:
<italic>Xenoseptoria neosaccardoi</italic>
Quaedvlieg, Verkley & Crous.</p>
<p id="P469">
<bold>
<italic>Xenoseptoria neosaccardoi</italic>
</bold>
Quaedvlieg, H.D. Shin, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804447&link_type=mb">MB804447</ext-link>
. Figs
<xref ref-type="fig" rid="F75">75</xref>
,
<xref ref-type="fig" rid="F76">76</xref>
.</p>
<fig id="F75" position="float">
<label>Fig. 75.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Xenoseptoria neosaccardoi</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128665&link_type=cbs">CBS 128665</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig75"></graphic>
</fig>
<fig id="F76" position="float">
<label>Fig. 76.</label>
<caption>
<p>
<italic>Xenoseptoria neosaccardoi</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128665&link_type=cbs">CBS 128665</ext-link>
). A, B. Pycnidia forming in culture. C-E. Conidiogenous cells. F, G. Conidia. Scale bars: B = 170 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig76"></graphic>
</fig>
<p id="P470">
<italic>Etymology</italic>
: Resembling
<italic>Septoria saccardoi</italic>
, but morphologically distinct.</p>
<p id="P471">
<italic>Leaf spots</italic>
on the upper leaf surface, scattered, distinct, circular, 2-4 mm diam, initially appearing as reddish brown discolouration, later turning brown to reddish brown without a distinct border line, finally central area becoming greyish brown to dull grey and surrounded by reddish to dark brown margin, reddish pigments may diffuse outward to form a halo; on the lower leaf surface initially showing reddish discolouration, later becoming brown with distinct border line, center greyish brown to grey with indistinct border (
<xref ref-type="bibr" rid="R98">Shin & Sameva 2004</xref>
). On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
separate, pycnidial, immersed becoming erumpent, globose, up to 350 μm diam, brown, becoming ostiolate, developing 1-3 papillate necks, exuding a pink to orange conidial mass; wall of 4-8 layers of brown
<italic>textura angularis. Conidiophores</italic>
hyaline, smooth, reduced to conidiogenous cells or 1-2-septate, branched below, 10-20 × 4-6 μm.
<italic>Conidiogenous cells</italic>
lining the inner cavity, hyaline, smooth, ampulliform to doliiform or subcylindrical, mono- to polyphialidic, with prominent periclinal thickening, but also with percurrent proliferation, 5-15 × 3-5 μm.
<italic>Conidia</italic>
hyaline, smooth, guttulate, scolecosporous, straight to irregularly curved, cylindrical to obclavate, (1-)3-septate, (23-)33-45(-48) × (2.5-)3(-4) μm, tapering to subobtuse apex, base obtuse, 2-2.5 μm diam.</p>
<p id="P472">
<italic>Culture characteristics</italic>
: Colonies flat, spreading, with sparse aerial mycelium and lobate, feathery mergins, reaching 30 mm after 2 wk. On PDA surface iron-grey, reverse olivaceous-grey; on OA surface olivaceous-grey; on MEA surface folded, bay, reverse umber.</p>
<p id="P473">
<italic>Specimen examined</italic>
:
<bold>South Korea</bold>
, Pyeongchang, on leaves of
<italic>Lysimachia vulgaris</italic>
var.
<italic>davurica</italic>
(
<italic>Primulaceae</italic>
), 30 May 2007, H.D. Shin (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21312&link_type=cbs">CBS H-21312</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128665&link_type=cbs">CBS 128665</ext-link>
=KACC 43962 = SMKC 23666).</p>
<p id="P474">
<italic>Notes</italic>
: An isolate of
<italic>Septoria saccardoi</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=128756&link_type=cbs">CBS 128756</ext-link>
) clusters in
<italic>Septoria s. str</italic>
., thus well apart from this taxon, which was collected in Korea. The Korean collection closely matches that of the original description of
<italic>Septoria saccardoi</italic>
(on
<italic>Lysimachia vulgaris</italic>
in Italy), having 3-septate, curved, cylindrical conidia, 38-40 × 3.5 μm, 3-septate (
<xref ref-type="bibr" rid="R94">Saccardo & Saccardo 1906</xref>
).
<italic>Xenoseptoria</italic>
is however distinct from
<italic>Septoria s. str</italic>
. in forming pycnidia with multiple papillate necks, and having conidiogenous cells that are mono- or polyphialidic.</p>
</sec>
<sec id="S53">
<title>Clade 35:
<italic>Vrystaatia</italic>
</title>
<p id="P475">
<bold>
<italic>Vrystaatia</italic>
</bold>
Quaedvlieg, W.J. Swart, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804448&link_type=mb">MB804448</ext-link>
.</p>
<p id="P476">
<italic>Etymology</italic>
: Named after the Free State Province in South Africa, “Vrystaat” in Afrikaans, where this fungus was collected.</p>
<p id="P477">
<italic>Foliicolous. Conidiomata</italic>
black, globose, pycnidial with central, dark brown ostiolar area, substomatal on host, erumpent in culture; wall of 6-8 layers of pale brown
<italic>textura angularis</italic>
; exuding cirrhus of orange conidia.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
lining the inner cavity of conidioma, globose to ampulliform, rarely allantoid, hyaline, smooth; with prominent periclinal thickening, or proliferating several times percurrently near apex, giving rise to macro- and microconidia.
<italic>Macroconidia</italic>
solitary, hyaline, smooth, guttulate, subcylindrical to narrowly obclavate or acicular, apex obtuse to subobtuse, base truncate to long obconically truncate, conidia widest at or just above basal septum, transversely euseptate.
<italic>Microconidia</italic>
hyaline, smooth, aseptate, pear-shaped to globose or ellipsoid, apex obtuse, base truncate.</p>
<p id="P478">
<italic>Type species</italic>
:
<italic>Vrystaatia aloeicola</italic>
Quaedvlieg, Verkley, W.J. Swart & Crous.</p>
<p id="P479">
<bold>
<italic>Vrystaatia aloeicola</italic>
</bold>
Quaedvlieg, Verkley, W.J. Swart & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804449&link_type=mb">MB804449</ext-link>
. Figs
<xref ref-type="fig" rid="F77">77</xref>
,
<xref ref-type="fig" rid="F78">78</xref>
.</p>
<fig id="F77" position="float">
<label>Fig. 77.</label>
<caption>
<p>Macro- and microconidia and conidiogenous cells of
<italic>Vrystaatia aloeicola</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135107&link_type=cbs">CBS 135107</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig77"></graphic>
</fig>
<fig id="F78" position="float">
<label>Fig. 78.</label>
<caption>
<p>
<italic>Vrystaatia aloeicola</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135107&link_type=cbs">CBS 135107</ext-link>
). A. Conidiomata sporulating on PDA, with characteristic orange conidial cirrhi. B-D. Conidiogenous cells. E, F. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig78"></graphic>
</fig>
<p id="P480">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Aloe.</italic>
</p>
<p id="P481">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
black, globose, pycnidial with central, dark brown ostiolar area, substomatal on host, erumpent in culture; wall of 6-8 layers of pale brown
<italic>textura angularis</italic>
; exuding cirrhus of orange conidia.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
lining the inner cavity of conidioma, globose to ampulliform, rarely allantoid, hyaline, smooth, 5-12 × 4-6 μm; with prominent periclinal thickening, or proliferating several times percurrently near apex, 2-2.5 μm diam, giving rise to macro- and microconidia.
<italic>Macroconidia</italic>
solitary, hyaline, smooth, guttulate, subcylindrical to narrowly obclavate or acicular, apex obtuse to subobtuse, base truncate to long obconically truncate, conidia widest at or just above basal septum, (1-)3-septate, (30-)40-52(-65) × (2.5-) 3(-3.5) μm.
<italic>Microconidia</italic>
hyaline, smooth, aseptate, pear-shaped to globose or ellipsoid, apex obtuse, base truncate, 4-6 × 3-3.5 μm.</p>
<p id="P482">
<italic>Culture characteristics</italic>
: On MEA colonies spreading fast, with moderate aerial mycelium and smooth, even margin, reaching 30 mm diam after 2 wk; surface with concentric zones of umber and apricot; reverse umber, produces brown exudates; on PDA round lobate margins, lacking aerial mycelium, reaching 20 mm diam after 2 wk, surface fuscous-black to greyish-sepia for younger mycelium, reverse fuscous-black to greyish-sepia for younger mycelium; on OA round, lobate, lacking aerial mycelium, reaching 30 mm diam after 2 wk, surface vinaceous-grey, reverse greyish sepia.</p>
<p id="P483">
<italic>Specimen examined</italic>
:
<bold>South Africa</bold>
, Orange Free State, Bloemfontein, Free State National Botanical Garden, on dead leaf tips of
<italic>Aloe maculata</italic>
(
<italic>Aloaceae</italic>
), 7 May 2012, P.W. Crous & W.J. Swart (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21313&link_type=cbs">CBS H-21313</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135107&link_type=cbs">CBS 135107</ext-link>
=CPC 20617).</p>
<p id="P484">
<italic>Notes</italic>
:
<italic>Vrystaatia</italic>
is distinct from
<italic>Septoria s. str</italic>
. in that it has phialidic conidiogenous cells that proliferate percurrently or with prominent periclinal thickening, and form macro- as well as microconidia in culture, which is not typical of
<italic>Septoria. Rhabdospora aloetica</italic>
was described from stems of
<italic>Aloe</italic>
sp. in Portugal, with aseptate conidia, 12-16 × 1.5 μm (
<xref ref-type="bibr" rid="R94">Saccardo & Saccardo 1906</xref>
); it is likely this is an asexual morph of
<italic>Diaporthe</italic>
. As far as we could establish, no septoria-like fungi have thus far been described from
<italic>Aloe</italic>
.</p>
</sec>
<sec id="S54">
<title>Clade 36:
<italic>Setophoma</italic>
</title>
<p id="P485">
<bold>
<italic>Setophoma</italic>
</bold>
Gruyter, Aveskamp & Verkley, Mycologia 102: 1077. 2010.</p>
<p id="P486">
<italic>Conidiomata</italic>
pycnidial, solitary to confluent, superficial or submerged in agar, globose to subglobose, setose, with papillate ostioles, honey to olivaceous to olivaceous-black, with 2-7(-11) layers of pseudoparenchymatal cells.
<italic>Conidiogenous cells</italic>
hyaline, monophyalidic.
<italic>Conidia</italic>
aseptate, ellipsoidal to subcylindrical to subfusoid, guttulate.</p>
<p id="P487">
<italic>Type species</italic>
:
<italic>S. terrestris</italic>
(H.N. Hansen) Gruyter, Aveskamp & Verkley, Mycologia 102: 1077. 2010.</p>
<p id="P488">
<bold>
<italic>Setophoma chromolaenae</italic>
</bold>
Quaedvlieg, Verkley, R.W. Barreto & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804450&link_type=mb">MB804450</ext-link>
. Figs
<xref ref-type="fig" rid="F79">79</xref>
,
<xref ref-type="fig" rid="F80">80</xref>
.</p>
<fig id="F79" position="float">
<label>Fig. 79.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Setophoma chromolaenae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135105&link_type=cbs">CBS 135105</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig79"></graphic>
</fig>
<fig id="F80" position="float">
<label>Fig. 80.</label>
<caption>
<p>
<italic>Setophoma chromolaenae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135105&link_type=cbs">CBS 135105</ext-link>
). A. Conidiomata forming on OA. B, C, F. Conidiomata with setae. D, E. Conidiogenous cells. G. Conidia. Scale bars: B = 22 μm, C, F = 45 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig80"></graphic>
</fig>
<p id="P489">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Chromolaena.</italic>
</p>
<p id="P490">
<italic>Conidiomata</italic>
pycnidial, brown, globose, separate, erumpent, up to 90 μm diam; outer surface covered in brown setae, up to 80 μm long, brown, thick-walled, 3-5 μm diam, 1-4-septate, with slight apical taper to obtuse apex; conidial wall of 3-6 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
lining the inner cavity, ampulliform, hyaline, smooth, 4-6 × 3-6 μm, with prominent periclinal thickening at apex.
<italic>Conidia</italic>
hyaline, smooth, subcylindrical, somewhat narrowly ellipsoid when old, with two prominent guttules at ends, (4.5-)5-6 (-7) × (2-)2.5(-3) μm.</p>
<p id="P491">
<italic>Culture characteristics</italic>
: On MEA spreading, with sparse aerial mycelium, folded surface, margin smooth, lobate; surface umber with patches of apricot and dirty white, reverse ochreous. On PDA surface iron-grey, reverse olivaceous-grey. On OA surface iron-grey, surrounded by orange to apricot diffuse pigment layer in agar; reaching 55 mm diam after 2 wk.</p>
<p id="P492">
<italic>Specimen examined</italic>
:
<bold>Brazil</bold>
, Rio de Janeiro, Fazenda Santa Rosa, Ponte das Laranjeiras, on leaves of
<italic>Chromolaena odorata</italic>
(
<italic>Asteraceae</italic>
), 6 Apr. 2010, R.W. Barreto (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21314&link_type=cbs">CBS H-21314</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135105&link_type=cbs">CBS 135105</ext-link>
=CPC 18553).</p>
<p id="P493">
<italic>Note</italic>
:
<italic>Setophoma chromolaenae</italic>
is phylogenetically distinct from
<italic>S. sacchari</italic>
and
<italic>S. terrestris</italic>
, the two other species presently known from the genus (
<xref ref-type="bibr" rid="R58">de Gruyter
<italic>et al.</italic>
2010</xref>
).</p>
</sec>
<sec id="S55">
<title>Clade 37:
<italic>Coniothyrium</italic>
(
<italic>Coniothyriaceae</italic>
)</title>
<p id="P494">
<bold>
<italic>Coniothyrium</italic>
</bold>
Corda, Icon. Fung. (Prague) 4: 38. 1840.</p>
<p id="P495">
<italic>Mycelium</italic>
immersed, consisting of septate, hyaline to brown, branched hyphae.
<italic>Conidiomata</italic>
pycnidial, separate, globose, pale to dark brown, immersed, unilocular, thin-walled; wall of brown, thick-walled
<italic>textura angularis. Ostiole</italic>
circular, central, papillate or not.
<italic>Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
lining the inner cavity, phialidic, annellidic, indeterminate, discrete, doliiform to cylindrical, hyaline to pale brown, smooth, several annellations at apex.
<italic>Conidia</italic>
subcylindrical, spherical, ellipsoid or broadly clavate, brown, thick-walled, 0(-1)-euseptate, smooth to verruculose, apex obtuse, base truncate, at times with minute marginal frill (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P496">
<italic>Type species</italic>
:
<italic>C. palmarum</italic>
Corda, Icon. Fung. (Prague) 4: 38. 1840.</p>
<p id="P497">
<bold>
<italic>Coniothyrium sidae</italic>
</bold>
Quaedvlieg, Verkley, R.W. Barreto & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804451&link_type=mb">MB804451</ext-link>
. Figs
<xref ref-type="fig" rid="F81">81</xref>
,
<xref ref-type="fig" rid="F82">82</xref>
.</p>
<fig id="F81" position="float">
<label>Fig. 81.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Coniothyrium sidae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135108&link_type=cbs">CBS 135108</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig81"></graphic>
</fig>
<fig id="F82" position="float">
<label>Fig. 82.</label>
<caption>
<p>
<italic>Coniothyrium sidae</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135108&link_type=cbs">CBS 135108</ext-link>
). A-E. Conidiomata forming in culture, showing setae. F, G. Conidiogenous cells. H. Conidia. I-K. Asci and ascospores. Scale bars: B, D, E = 100 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig82"></graphic>
</fig>
<p id="P498">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Sida</italic>
.</p>
<p id="P499">
<italic>Conidiomata</italic>
pycnidial, globose, immersed becoming erumpent, up to 200 μm diam; wall consisting of 3-4 layers of subhyaline to pale brown
<italic>textura angularis. Ostiole</italic>
central, papillate, dark brown, up to 30 μm diam, surrounded by a whorl of brown setae, smooth, thick-walled, 4-8-septate, straight to curved, tapering to subobtuse apices, up to 130 μm long, 5-8 μm diam at base.
<italic>Conidiogenous cells</italic>
hyaline, smooth, lining the inner cavity, ampulliform to globose, 4-7 × 4-6 μm; apex with prominent periclinal thickening.
<italic>Conidia</italic>
solitary, hyaline, smooth, aseptate, granular (in Shear’s medium, prominently guttulate in lactic acid), fusoid-ellipsoidal, straight to slightly curved, apex obtuse, base truncate to bluntly rounded, (9-)10-12(-13) × (2.5-)3 μm.
<italic>Ascomata</italic>
developing after several weeks on MEA, separate, pseudothecial, erumpent, uniloculate, papillate, brown, up to 300 μm diam; wall of 4-8 layers of brown
<italic>textura angularis. Asci</italic>
fasciculate, 8-spored, short papillate, hyaline, smooth, subcylindrical, bitunicate, with well-developed apical chamber, 2 μm diam, 55-65 × 8-11 μm.
<italic>Ascospores</italic>
bi- to triseriate, brown, smooth, guttulate, straight to slightly curved, (3-)5-septate, apical cell obtusely rounded, basal cell somewhat elongated and subobtuse; in ascospores that are 4-septate, the second cell from the apex is markedly swollen, in 5-septate ascospores the third cell from the apex is markedly swollen, (18-)20-24(-26) × (4-)5(-5.5) μm.
<italic>Pseudoparaphyses</italic>
hyaline, smooth, intermingled among asci, anastomosing, cellular, constricted at septa, up to 80 μm long, 2-4 μm diam.</p>
<p id="P500">
<italic>Culture characteristics</italic>
: Colonies erumpent, spreading, moderate aerial mycelium even, lobate margins. On MEA surface olivaceous-grey, reverse umber. On OA suface olivaceous-grey with diffuse umber pigment in agar. On PDA surface and reverse olivaceous-grey.</p>
<p id="P501">
<italic>Specimen examined</italic>
:
<bold>Brazil</bold>
, Rio de Janeiro, Nova Friburgo, Riograndina, along roadside on
<italic>Sida</italic>
sp. (
<italic>Malvaceae</italic>
), 24 Feb. 2008, R.W. Barreto (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21315&link_type=cbs">CBS H-21315</ext-link>
, culture ex-type CPC 19602 = RWB 866 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135108&link_type=cbs">CBS 135108</ext-link>
).</p>
<p id="P502">
<italic>Note</italic>
: De Gruyter
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R59">2013</xref>
) placed several phoma-like species with a similar morphology in the genus
<italic>Coniothyrium</italic>
, to which
<italic>C. sidae</italic>
is allied. Of interest is the paraphaeosphaeria-like sexual morph that developed in culture, which is newly linked here to
<italic>Coniothyrium</italic>
. The genus
<italic>Paraphaeosphaeria</italic>
is linked to
<italic>Paraconiothyrium</italic>
(Verkley
<italic>et al.</italic>
2004).</p>
</sec>
<sec id="S56">
<title>Clade 38:
<italic>Xenobotryosphaeria</italic>
</title>
<p id="P503">
<bold>
<italic>Xenobotryosphaeria</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804452&link_type=mb">MB804452</ext-link>
.</p>
<p id="P504">
<italic>Etymology</italic>
: Resembling the genus
<italic>Botryosphaeria</italic>
, but distinct.</p>
<p id="P505">
<italic>Ascomata</italic>
brown, globose, smooth, ostiolate, superficial on stems; wall of 3-4 layers of brown
<italic>textura angularis. Asci</italic>
clavate, hyaline, smooth, short stipitate, fasciculate, bitunicate, thin-walled, apical chamber not visible, 6-8-spored.
<italic>Ascospores</italic>
multiseriate, hyaline, smooth and thin-walled, granular, broadly ellipsoid, ends obtuse, aseptate.
<italic>Pseudoparaphyses</italic>
not seen.</p>
<p id="P506">
<italic>Type species</italic>
:
<italic>Xenobotryosphaeria calamagrostidis</italic>
Quaedvlieg, Verkley & Crous.</p>
<p id="P507">
<bold>
<italic>Xenobotryosphaeria calamagrostidis</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804453&link_type=mb">MB804453</ext-link>
. Figs
<xref ref-type="fig" rid="F83">83</xref>
,
<xref ref-type="fig" rid="F84">84</xref>
.</p>
<fig id="F83" position="float">
<label>Fig. 83.</label>
<caption>
<p>Ascospores and asci of
<italic>Xenobotryosphaeria calamagrostidis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=303.71&link_type=cbs">CBS 303.71</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig83"></graphic>
</fig>
<fig id="F84" position="float">
<label>Fig. 84.</label>
<caption>
<p>
<italic>Xenobotryosphaeria calamagrostidis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=303.71&link_type=cbs">CBS 303.71</ext-link>
). A, C. Ascomata forming in culture. E, G. broken wall with asci. B, D, F. Asci. H. Ascospores. Scale bars: C = 45 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig84"></graphic>
</fig>
<p id="P508">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Calamagrostis.</italic>
</p>
<p id="P509">On
<italic>Anthriscus</italic>
stem.
<italic>Ascomata</italic>
brown, globose, smooth, superficial on stems, ostiolate, up to 180 μm diam; wall of 3-4 layers of brown
<italic>textura angularis. Asci</italic>
clavate, hyaline, smooth, short stipitate, fasciculate, bitunicate, thin-walled, apical chamber not visible, 6-8-spored, 60-80 × 30-40 μm.
<italic>Ascospores</italic>
multiseriate, hyaline, smooth and thin-walled, granular, broadly ellipsoid, ends obtuse, aseptate, (17-)18-20(-24) × (11-)12-13(-14) μm.
<italic>Pseudoparaphyses</italic>
not seen.</p>
<p id="P510">
<italic>Culture characteristics</italic>
: Colonies flat, spreading, with sparse to no aerial mycelium. On PDA surface and reverse dirty white; on MEA concolorous with agar; on OA pale pink on surface.</p>
<p id="P511">
<italic>Specimen examined</italic>
:
<bold>Italy</bold>
, Bergamo Vigolo, on
<italic>Calamagrostis</italic>
sp. (
<italic>Poaceae</italic>
), 20 Jun. 1967, G.A. Hedjaroude (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21316&link_type=cbs">CBS H-21316</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=303.71&link_type=cbs">CBS 303.71</ext-link>
).</p>
<p id="P512">
<italic>Notes</italic>
: Hedjaroude (1968) studied the specimen (ETH 7131; as
<italic>Phaeosphaeria silvatica</italic>
), but obviously the incorrect fungus was cultivated, as
<italic>X. calamagrostidis</italic>
is quite distinct from
<italic>P. silvatica</italic>
, which has cylindrical-fusoid, brown, 6-8-septate ascospores, 18-18 × 4-5 μm.
<italic>Xenobotryosphaeria</italic>
is reminiscent of genera in the
<italic>Botryosphaeriales</italic>
, but is phylogenetically distinct (
<xref ref-type="bibr" rid="R27">Crous
<italic>et al.</italic>
2006</xref>
,
<xref ref-type="bibr" rid="R85">Phillips
<italic>et al.</italic>
2008</xref>
,
<xref ref-type="bibr" rid="R71">Liu
<italic>et al</italic>
. 2012</xref>
). It also resembles species of
<italic>Muyocopron</italic>
(
<italic>Muyocopronaceae</italic>
), but the latter genus differs in that it has circular, flattened ascomata, as well as prominent pseudoparaphyses, which are absent in
<italic>Xenobotryosphaeria.</italic>
</p>
</sec>
<sec id="S57">
<title>Clade 39:
<italic>Phoma</italic>
</title>
<p id="P513">
<italic>Note</italic>
: See Aveskamp
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R4">2010</xref>
), de Gruyter
<italic>et al</italic>
. (2009,
<xref ref-type="bibr" rid="R59">2013</xref>
).</p>
</sec>
<sec id="S58">
<title>Clade 40:
<italic>Acicuseptoria</italic>
</title>
<p id="P514">
<bold>
<italic>Acicuseptoria</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804454&link_type=mb">MB804454</ext-link>
.</p>
<p id="P515">
<italic>Etymology</italic>
:
<italic>Acicu</italic>
- from acicular (conidia), and
<italic>Septoria</italic>
= septoria-like.</p>
<p id="P516">
<italic>Conidiomata</italic>
pycnidial, erumpent, brown, globose, with central ostiole, exuding a cream conidial mass; wall consisting of 3-6 layers of thin, brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
hyaline, smooth, ampulliform; proliferating inconspicuously and percurrently at apex, or simply appearing holoblastic.
<italic>Conidia</italic>
solitary, hyaline, granular, acicular, straight to gently curved, tapering towards apex that is acutely rounded, base truncate, transversely euseptate.</p>
<p id="P517">
<italic>Type species</italic>
:
<italic>Acicuseptoria rumicis</italic>
Quaedvlieg, Verkley & Crous.</p>
<p id="P518">
<bold>
<italic>Acicuseptoria rumicis</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804455&link_type=mb">MB804455</ext-link>
.
<xref ref-type="fig" rid="F85">Fig. 85</xref>
.</p>
<fig id="F85" position="float">
<label>Fig. 85.</label>
<caption>
<p>
<italic>Acicuseptoria rumicis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=522.78&link_type=cbs">CBS 522.78</ext-link>
). A. Conidiomata sporulating in culture. B-E. Conidiogenous cells. F, G. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig85"></graphic>
</fig>
<p id="P519">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Rumex</italic>
.</p>
<p id="P520">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
pycnidial, erumpent, brown, globose, up to 300 μm diam, with central ostiole, exuding a cream conidial mass; wall consisting of 3-6 layers of thin, brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
hyaline, smooth, ampulliform, 7-15 × 5-7 μm; proliferating inconspicuously and percurrently at apex, or simply appearing holoblastic.
<italic>Conidia</italic>
solitary, hyaline, granular, acicular, straight to gently curved, tapering towards apex that is acutely rounded, base truncate, 1.5-2 μm diam, up to 8-septate, (32-)40-60(-70) × 2(-2.5) μm.</p>
<p id="P521">
<italic>Culture characteristics</italic>
: Colonies lobate, flat with little appressed, white aerial mycelium. On MEA surface olivaceous-grey, reverse umber. On OA suface olivaceous-grey. On PDA surface and reverse olivaceous-grey.</p>
<p id="P522">
<italic>Specimen examined</italic>
:
<bold>France</bold>
, Haute Savoie, Mt. Beaudin, 2000 m alt., stem of
<italic>Rumex alpinus</italic>
(
<italic>Polygonaceae</italic>
), Oct. 1978, H.A. van der Aa (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-18163&link_type=cbs">CBS H-18163</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=522.78&link_type=cbs">CBS 522.78</ext-link>
).</p>
<p id="P523">
<italic>Notes</italic>
:
<italic>Acicuseptoria rumicis</italic>
was originally deposited as
<italic>Septoria rumicum</italic>
, but is distinct from the latter in having acicular, narrower conidia.
<italic>Acicuseptoria</italic>
is distinct from
<italic>Septoria s. str.</italic>
in having acicular conidia.</p>
</sec>
<sec id="S59">
<title>Clade 41:
<italic>Stagonospora</italic>
</title>
<p id="P524">
<bold>
<italic>Stagonospora</italic>
</bold>
(Sacc.) Sacc., Syll. Fung. (Abellini) 3: 445. 1884.</p>
<p id="P525">
<italic>Description</italic>
: See above.</p>
<p id="P526">
<italic>Type species</italic>
:
<italic>S. paludosa</italic>
(Sacc. & Speg.) Sacc., Syll. Fung. (Abellini) 3: 453. 1884.</p>
<p id="P527">
<bold>
<italic>Stagonospora duoseptata</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804459&link_type=mb">MB804459</ext-link>
. Figs
<xref ref-type="fig" rid="F86">86</xref>
,
<xref ref-type="fig" rid="F87">87</xref>
.</p>
<fig id="F86" position="float">
<label>Fig. 86.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Stagonospora duoseptata</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135093&link_type=cbs">CBS 135093</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig86"></graphic>
</fig>
<fig id="F87" position="float">
<label>Fig. 87.</label>
<caption>
<p>
<italic>Stagonospora duoseptata</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135093&link_type=cbs">CBS 135093</ext-link>
). A. Conidiomata forming in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig87"></graphic>
</fig>
<p id="P528">
<italic>Etymology</italic>
: Named after the fact that conidia are 2-septate.</p>
<p id="P529">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
dark brown, immersed, subepidermal, pycnidial, globose, up to 400 μm diam, exuding a short, hyaline cirrhus of conidia; wall of 3-4 layers of medium brown
<italic>textura angularis. Conidiophores</italic>
hyaline, smooth, lining inner cavity, 0-1-septate, subcylindrical, 10-20 × 4-5 μm.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, subcylindrical to ampulliform or doliiform, 6-8 × 3-4 μm; phialidic with several apical percurrent proliferations.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, granular, fusoid-ellipsoidal, 2-septate, with septa 4-6 μm inwards from both obtuse conidial ends; conidia widest in middle, (18-)20-23(-25) × (5-)6(-7) μm.</p>
<p id="P530">
<italic>Culture characteristics</italic>
: Colonies on PDA flattened, circular with lobate edges, and fine grey aerial mycelium, surface mouse-grey, reverse olivaceous-black, after 14 d, 4 cm diam; on MEA after 14 d, 4.5 cm diam; on OA similar to MEA.</p>
<p id="P531">
<italic>Specimen examined</italic>
:
<bold>Netherlands</bold>
, Nijmegen, de Duffelt, on leaves of a
<italic>Carex acutiformis</italic>
(
<italic>Cyperaceae</italic>
), 29 Jul. 2012, W. Quaedvlieg (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21321&link_type=cbs">CBS H-21321</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135093&link_type=cbs">CBS 135093</ext-link>
=S618).</p>
<p id="P532">
<italic>Notes</italic>
:
<italic>Stagonospora duoseptata</italic>
is distinct from other species occurring on
<italic>Carex</italic>
in that it has fusoid-ellipsoidal, 2-septate conidia, (18-)20-23(-25) × (5-)6(-7) μm, with septa positioned 4-6 μm inwards from its obtuse conidial ends.
<italic>Stagonospora biseptata</italic>
(occurring on
<italic>Carex lanuginosa</italic>
, Wisconsin, USA) has conidia that are larger, (35-)40-50(-55) × (2-)10-11(-13) μm (
<xref ref-type="bibr" rid="R56">Greene 1961</xref>
).</p>
<p id="P533">
<bold>
<italic>Stagonospora paludosa</italic>
</bold>
(Sacc. & Speg.) Sacc., Syll. Fung. (Abellini) 3: 453. 1884. Figs
<xref ref-type="fig" rid="F88">88</xref>
,
<xref ref-type="fig" rid="F89">89</xref>
.</p>
<fig id="F88" position="float">
<label>Fig. 88.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Stagonospora paludosa</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135088&link_type=cbs">CBS 135088</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig88"></graphic>
</fig>
<fig id="F89" position="float">
<label>Fig. 89.</label>
<caption>
<p>
<italic>Stagonospora paludosa</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135088&link_type=cbs">CBS 135088</ext-link>
). A, B. Conidiomata forming in culture. C, D. Conidiogenous cells. E, F. Conidia. Scale bars: B = 400 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig89"></graphic>
</fig>
<p id="P534">
<italic>Basionym</italic>
:
<italic>Hendersonia paludosa</italic>
Sacc. & Speg., Michelia 1(no. 3): 353. 1878.</p>
<p id="P535">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
black, immersed, subepidermal, pycnidial, globose, up to 400 μm diam, exuding a short, hyaline cirrhus of conidia; wall of 3-4 layers of medium brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to doliiform, 5-10 × 5-10 μm; tapering at apex with prominent periclinal thickening or 1-2 inconspicuous percurrent proliferations visible at apex.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, granular, or each cell with a large central guttule, subcylindrical to fusoid, apex subobtusely to obtusely rounded, base truncate (4-7 μm diam), (6-)7-8-septate (becoming constricted at septa with age), (45-)55-63(-65) × (9-)10-11 μm.</p>
<p id="P536">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, circular, with grey aerial mycelium, reverse olivaceous-black to buff at the margins, after 14 d, 8.5 cm diam; on MEA umbonate, round, with appressed, grey aerial mycelium, with white patches; OA similar to PDA, but reverse buff with iron-grey patches at the outer region.</p>
<p id="P537">
<italic>Specimens examined</italic>
:
<bold>Italy</bold>
, on
<italic>Carex riparia</italic>
(
<italic>Cyperaceae</italic>
), Feb. 1878, holotype (presumably lost).
<bold>Netherlands</bold>
, Utrecht, Veenendal, de Blauwe Hel,
<italic>Carex acutiformis</italic>
(
<italic>Cyperaceae</italic>
), 23 Jul. 2012, W. Quaedvlieg (
<bold>neotype</bold>
designated here
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21317&link_type=cbs">CBS H-21317</ext-link>
, culture ex-type S601 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135088&link_type=cbs">CBS 135088</ext-link>
) (MBT175339).</p>
<p id="P538">
<italic>Notes</italic>
: For more than a century,
<italic>Stagonospora</italic>
was confused with
<italic>Septoria.</italic>
The introduction of molecular techniques around the turn of the century made it possible to definitively establish that
<italic>Stagonospora</italic>
was not linked to
<italic>Septoria</italic>
, and that it in fact clusters with other important plant pathogenic genera like
<italic>Phoma</italic>
and
<italic>Leptosphaeria</italic>
in the
<italic>Pleosporales</italic>
(
<xref ref-type="bibr" rid="R35">Cunfer & Ueng 1999</xref>
,
<xref ref-type="bibr" rid="R101">Solomon
<italic>et al</italic>
. 2006</xref>
). The type of
<italic>Stagonospora</italic>
(
<italic>S. paludosa</italic>
) was recollected from a
<italic>Carex</italic>
during this study and phylogenetic analyses showed that this species clustered separately from most other known “
<italic>Stagonospora”</italic>
spp. (mostly isolated from
<italic>Poaceae</italic>
), but together with several other
<italic>Stagonospora</italic>
species that were also collected from
<italic>Carex</italic>
. This led to the conclusion that
<italic>Stagonospora s. str</italic>
. was limited to
<italic>Carex</italic>
, and that other commercially important stagonospora-like species on
<italic>Poaceae</italic>
(
<italic>e.g. S. avenae</italic>
and
<italic>S. nodorum</italic>
) in fact belonged to different genera.</p>
<p id="P539">
<bold>
<italic>Stagonospora perfecta</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804458&link_type=mb">MB804458</ext-link>
. Figs
<xref ref-type="fig" rid="F90">90</xref>
,
<xref ref-type="fig" rid="F91">91</xref>
.</p>
<fig id="F90" position="float">
<label>Fig. 90.</label>
<caption>
<p>Conidia, conidiogenous cells and ascus with ascospores of
<italic>Stagonospora perfecta</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135099&link_type=cbs">CBS 135099</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig90"></graphic>
</fig>
<fig id="F91" position="float">
<label>Fig. 91.</label>
<caption>
<p>
<italic>Stagonospora perfecta</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135099&link_type=cbs">CBS 135099</ext-link>
). A. Conidiomata forming in culture. B. Ascomata forming in culture. C-F, I, J. Asci and pseudoparaphyses. G, H. Conidiogenous cells. K. Conidia. Scale bars: B = 300 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig91"></graphic>
</fig>
<p id="P540">
<italic>Etymology</italic>
: Named after the fact that both sexual and asexual morphs of the fungus developed in culture.</p>
<p id="P541">On sterile
<italic>Carex</italic>
leaves on SNA.
<italic>Ascomata</italic>
developing on SNA, solitary, globose, brown, erumpent, up to 300 μm diam, with central ostiole; wall of 3-4 layers of brown
<italic>textura angularis. Pseudoparaphyses</italic>
intermingled among asci, hyaline, smooth, guttulate, multi-septate, constricted at septa, branched, hyphal-like, 4-6 μm diam, filling entire cavity.
<italic>Asci</italic>
stipitate, hyaline, smooth, clavate to fusoid-ellipsoidal, bitunicate, with prominent apiculus, 1.5-2.5 μm diam, 8-spored, 45-100 × 12-18 μm.
<italic>Ascospores</italic>
hyaline, smooth, 3- to multi-seriate in ascus, fusoid-ellipsoidal with median septum, prominently constricted at septum, tapering towards subobtuse apices, with 1-2 large guttules per cell, thin-walled, widest just above septum in upper cell, (20-)23-25(-27) × (5-)6-7(-8) μm.
<italic>Conidiomata</italic>
up to 300 μm diam, brown, immersed, subepidermal, pycnidial, subglobose with central ostiole, exuding crystalline to creamy conidial mass; wall of 2-3 layers of brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to doliiform or subcylindrical, with several percurrent proliferations near apex, 5-12 × 4-6 μm.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, subcylindrical to narrowly fusoid-ellipsoidal, with obtuse apex and bluntly rounded base, 2-3-septate, slightly constricted at septa, with 1-2 large guttules per cell, (19-)25-29(-32) × (6-)7(-8) μm.</p>
<p id="P542">
<italic>Culture characteristics</italic>
: Colonies on PDA flattened, convex, circular, with white aerial mycelium, surface fuscous-black, reverse iron-grey to black, after 14 d, 8.5 cm diam; on MEA surface fuscous-black, reverse olivaceous-black; on OA surface isabelline, reverse fuscous-black.</p>
<p id="P543">
<italic>Specimen examined</italic>
:
<bold>Netherlands</bold>
, Limburg, Weert, Moerselpeel, on leaves of
<italic>Carex acutiformis</italic>
(
<italic>Cyperaceae</italic>
), Sep. 2012, W. Quaedvlieg (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21320&link_type=cbs">CBS H-21320</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135099&link_type=cbs">CBS 135099</ext-link>
=S656).</p>
<p id="P544">
<italic>Notes</italic>
:
<italic>Stagonospora perfecta</italic>
is the first species with a confirmed sexual state in the genus
<italic>Stagonospora</italic>
. Of interest is the fact that it is didymella-like, rather than phaeosphaeria-like in morphology, which also explains it clustering in the
<italic>Didymellaceae</italic>
. Morphologically
<italic>S. perfecta</italic>
resembles
<italic>S. vitensis</italic>
(18-32 × 4-6 μm, 2-3(-4)-septate;
<xref ref-type="bibr" rid="R43">Ellis & Ellis 1997</xref>
), but conidia are wider.
<italic>Stagonospora perfecta</italic>
is closely related to
<italic>S. pseudovitensis</italic>
, though in the latter conidia are slightly longer, more fusoid-ellipsoidal in shape, and lack a sexual morph in culture.</p>
<p id="P545">
<bold>
<italic>Stagonospora pseudocaricis</italic>
</bold>
Quaedvlieg, Verkley, Gardiennet & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804456&link_type=mb">MB804456</ext-link>
. Figs
<xref ref-type="fig" rid="F92">92</xref>
,
<xref ref-type="fig" rid="F93">93</xref>
.</p>
<fig id="F92" position="float">
<label>Fig. 92.</label>
<caption>
<p>Conidia of
<italic>Stagonospora pseudocaricis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135132&link_type=cbs">CBS 135132</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig92"></graphic>
</fig>
<fig id="F93" position="float">
<label>Fig. 93.</label>
<caption>
<p>
<italic>Stagonospora pseudocaricis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135132&link_type=cbs">CBS 135132</ext-link>
). A. Conidiomata forming in culture. B, C. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig93"></graphic>
</fig>
<p id="P546">
<italic>Etymology</italic>
: Named after the species that it resembles,
<italic>Stagonospora caricis</italic>
.</p>
<p id="P547">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
black, immersed, subepidermal, pycnidial, globose, up to 400 μm diam, exuding a short, hyaline cirrhus of conidia; wall of 3-4 layers of medium brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to doliiform, 5-9 × 5-8 μm; tapering at apex with prominent periclinal thickening or 1-2 inconspicuous percurrent proliferations visible at apex.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, granular, or each cell with a large central guttule, subcylindrical to fusoid, apex subobtusely to obtusely rounded, base truncate, (5-)6(-7)-septate, (35-)42-48(-50) × (6-)7-8 μm.</p>
<p id="P548">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, circular, with appressed, grey aerial mycelium, surface sepia, reverse olivaceous-black to buff, after 14 d, 8.5 cm diam; on MEA umbonate, round, with appressed, grey aerial mycelium with white patches, surface greyish sepia, reverse fuscous-black to olivaceous-black; OA similar to PDA.</p>
<p id="P549">
<italic>Specimens examined</italic>
:
<bold>France</bold>
, Foncegrive, Rive de la Venelle, on
<italic>Carex acutiformis</italic>
(
<italic>Cyperaceae</italic>
), Oct. 2012, A. Gardiennet (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21318&link_type=cbs">CBS H-21318</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135132&link_type=cbs">CBS 135132</ext-link>
=S610);
<italic>ibed</italic>
., S609 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135414&link_type=cbs">CBS 135414</ext-link>
).</p>
<p id="P550">
<italic>Note</italic>
: Conidia of
<italic>S. pseudocaricis</italic>
closely resemble those of
<italic>S. caricis</italic>
(25-45 × 4-8 μm, 5-7-septate;
<xref ref-type="bibr" rid="R43">Ellis & Ellis 1997</xref>
), but are longer.</p>
<p id="P551">
<bold>
<italic>Stagonospora pseudovitensis</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804457&link_type=mb">MB804457</ext-link>
. Figs
<xref ref-type="fig" rid="F94">94</xref>
,
<xref ref-type="fig" rid="F95">95</xref>
.</p>
<fig id="F94" position="float">
<label>Fig. 94.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Stagonospora pseudovitensis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135094&link_type=cbs">CBS 135094</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig94"></graphic>
</fig>
<fig id="F95" position="float">
<label>Fig. 95.</label>
<caption>
<p>
<italic>Stagonospora pseudovitensis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135094&link_type=cbs">CBS 135094</ext-link>
). A. Conidiomata forming in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig95"></graphic>
</fig>
<p id="P552">
<italic>Etymology</italic>
: Named after the species that it resembles,
<italic>Stagonospora vitensis</italic>
.</p>
<p id="P553">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
black, immersed, subepidermal, pycnidial, globose with central ostiole, up to 180 μm diam; wall of 3-4 layers of pale brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to doliiform, 5-7 × 4-5 μm; tapering at apex with inconspicuous periclinal thickening or percurrent proliferation.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, granular, subcylindrical with obtuse apex and truncate to bluntly rounded base, 3-4 μm diam, 3-septate, with large central guttule in each cell, (25-)28-33(-36) × (6-)7(-8) μm.</p>
<p id="P554">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, circular, aerial mycelium consisting of some grey tufts, surface pale mouse-grey, reverse olivaceous-black, after 14 d, 8.5 cm diam; on MEA similar to PDA, but with appressed, white aerial mycelium, and with some grey tufts; OA similar to MEA, but reverse olivaceous-grey.</p>
<p id="P555">
<italic>Specimens examined</italic>
:
<bold>Netherlands</bold>
, Veenendaal, de Blauwe Hel, on leaves of
<italic>Carex acutiformis</italic>
(
<italic>Cyperaceae</italic>
), 23 Jul. 2012, W. Quaedvlieg (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21319&link_type=cbs">CBS H-21319</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135094&link_type=cbs">CBS 135094</ext-link>
=S620);
<italic>ibed</italic>
., S602.</p>
<p id="P556">
<italic>Note</italic>
: Conidia of
<italic>S. pseudovitensis</italic>
differ from that of
<italic>S. vitensis</italic>
(18-32 × 4-6 μm, 2-3(-4)-septate;
<xref ref-type="bibr" rid="R43">Ellis & Ellis 1997</xref>
), by having consistently 3-septate, wider conidia.</p>
<p id="P557">
<bold>
<italic>Stagonospora uniseptata</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804460&link_type=mb">MB804460</ext-link>
. Figs
<xref ref-type="fig" rid="F96">96</xref>
,
<xref ref-type="fig" rid="F97">97</xref>
.</p>
<fig id="F96" position="float">
<label>Fig. 96.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Stagonospora uniseptata</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135090&link_type=cbs">CBS 135090</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig96"></graphic>
</fig>
<fig id="F97" position="float">
<label>Fig. 97.</label>
<caption>
<p>
<italic>Stagonospora uniseptata</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135090&link_type=cbs">CBS 135090</ext-link>
). A. Conidiomata sporulating in culture. B. Conidiogenous cells. C. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig97"></graphic>
</fig>
<p id="P558">
<italic>Etymology</italic>
: Named after the fact that conidia are 1-septate.</p>
<p id="P559">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
up to 150 μm diam, black, immersed, subepidermal, pycnidial, globose with central ostiole, exuding yellow conidial masses; wall of 3-4 layers of red-brown
<italic>textura angularis. Conidiophores</italic>
reduced to conidiogenous cells.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, aggregated, lining the inner cavity, ampulliform to subcylindrical, 5-8 × 3-4 μm, with percurrent proliferation at apex.
<italic>Conidia</italic>
hyaline, smooth, thin-walled, fusoid-ellipsoidal, with obtuse apex and truncate to bluntly rounded base (2 μm diam), medianly 1-septate, prominently constricted at septum, straight to irregularly curved, widest in middle of either apical or basal cell, granular, including yellow-green reflective guttules, (13-)16-20(-22) × (5-)5.5(-6) μm.</p>
<p id="P560">
<italic>Culture characteristics</italic>
: Colonies on PDA appressed, circular, with short, greyish-white aerial mycelium, surface fusous-black, reverse olivaceous-black to hazel, after 14 d, 8.5 cm diam; on MEA surface hazel, reverse cinnamon; on OA with patches of white aerial mycelium, surface isabelline, reverse olivaceous to fuscous-black.</p>
<p id="P561">
<italic>Specimens examined</italic>
:
<bold>Netherlands</bold>
, Nijmegen, de Duffelt, on leaves of a
<italic>Carex acutiformis</italic>
(
<italic>Cyperaceae</italic>
), 29 Jul. 2012, W. Quaedvlieg, (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21322&link_type=cbs">CBS H-21322</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135090&link_type=cbs">CBS 135090</ext-link>
=S611);
<italic>ibed</italic>
., S607, S608 = CPC 22151 and CPC 22150.</p>
<p id="P562">
<italic>Notes</italic>
: Of the
<italic>Stagonospora</italic>
and
<italic>Septoria</italic>
species occurring on
<italic>Carex, Stagonospora uniseptata</italic>
is most similar to
<italic>Septoria caricis</italic>
(conidia 20-35 × 2.5-3 μm, 1-septate;
<xref ref-type="bibr" rid="R43">Ellis & Ellis 1997</xref>
), but distinct in that conidia are shorter and wider.</p>
</sec>
<sec id="S60">
<title>Clade 42:
<italic>Corynespora</italic>
</title>
<p id="P563">
<bold>
<italic>Corynespora</italic>
</bold>
Güssow, Z. PflKrankh. PflPath. PflSchutz 16: 10. 1906.</p>
<p id="P564">
<italic>Mycelium</italic>
immersed or superficial.
<italic>Stroma</italic>
present in some species.
<italic>Setae</italic>
and hyphopodia absent.
<italic>Conidiophores</italic>
macronematous, mononematous, straight or flexuous, unbranched, brown or olivaceous brown, smooth.
<italic>Conidiogenous cells</italic>
monotretic, integrated, terminal, percurrent, cylindrical or doliiform.
<italic>Conidia</italic>
solitary or catenate, dry, acrogenous, simple, obclavate, rarely cylindrical, subhyaline, pale to dark brown or olivaceous brown or straw-coloured, euseptate or distoseptate, smooth, rarely verruculose (
<xref ref-type="bibr" rid="R41">Ellis 1971</xref>
).</p>
<p id="P565">
<italic>Type species</italic>
:
<italic>C. mazei</italic>
Güssow, Consp. Regni Veget. (Leipzig) 16: 13. 1906. [=
<italic>C. cassiicola</italic>
(Berk. & M.A. Curtis) C.T. Wei, Mycol. Pap. 34: 5. 1950.]</p>
<p id="P566">
<bold>
<italic>Corynespora leucadendri</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804461&link_type=mb">MB804461</ext-link>
. Figs
<xref ref-type="fig" rid="F98">98</xref>
,
<xref ref-type="fig" rid="F99">99</xref>
.</p>
<fig id="F98" position="float">
<label>Fig. 98.</label>
<caption>
<p>Conidia and conidiogenous loci of
<italic>Corynespora leucadendri</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135133&link_type=cbs">CBS 135133</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig98"></graphic>
</fig>
<fig id="F99" position="float">
<label>Fig. 99.</label>
<caption>
<p>
<italic>Corynespora leucadendri</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135133&link_type=cbs">CBS 135133</ext-link>
). A-C. Conidiogenous cells giving rise to conidia. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig99"></graphic>
</fig>
<p id="P567">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Leucadendron.</italic>
</p>
<p id="P568">On MEA and PDA after 2 wk.
<italic>Mycelium</italic>
consisting of creeping, branched, septate, hyaline, smooth, 3-4(-5) μm diam hyphae that become brown close to conidiophores; stroma lacking.
<italic>Conidiophores</italic>
subcylindrical, erect, medium brown, 100-300 μm tall, 4-6(-7) μm diam, thick-walled, transversely multiseptate, with several swollen nodes of conidiophore rejuvenation (up to 12 μm diam).
<italic>Conidiogenous cells</italic>
terminal, cylindrical, medium brown, smooth, ends swollen or not, central locus somewhat darkened or inconspicuous, 15-40 × 5-6(-7) μm.
<italic>Conidia</italic>
medium brown, obclavate to subcylindrical, straight to slightly curved, thick-walled, (3-)4-6(-10)-distoseptate, basal locus thickened, darkened, protruding, 2-3 μm diam, (35-)70-110(-170) × (6-)7-8(-11) μm.</p>
<p id="P569">
<italic>Culture characteristics</italic>
: Colonies erumpent, spreading with moderate aerial mycelium and smooth, even margin; reaching 25 mm diam after 2 wk. On MEA surface dirty white, reverse cinnamon. On PDA surface dirty white, reverse buff to rosy buff with diffuse rosy buff pigment. On OA surface dirty white with diffuse rosy buff pigment in agar.</p>
<p id="P570">
<italic>Specimen examined</italic>
:
<bold>South Africa</bold>
, Western Cape Province, Helderberg Nature Reserve, from the leaves of
<italic>Leucadendron</italic>
sp. (
<italic>Proteaceae</italic>
), 14 Aug. 2000, S. Lee (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21323&link_type=cbs">CBS H-21323</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=135133&link_type=cbs">CBS 135133</ext-link>
=CPC 19345).</p>
<p id="P571">
<italic>Notes</italic>
: This species was not treated by Marincowitz
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R74">2008</xref>
), and presently no species of
<italic>Corynespora</italic>
are known from
<italic>Leucadendron</italic>
. Furthermore, based on conidial morphology, none of the species treated by Ellis (
<xref ref-type="bibr" rid="R41">1971</xref>
,
<xref ref-type="bibr" rid="R42">1976</xref>
) resemble
<italic>C. leucadendri</italic>
, nor is it similar to any
<italic>Corynespora</italic>
sequence presently deposited in GenBank. For these reasons we thus introduce
<italic>C. leucadendri</italic>
as a new taxon.</p>
</sec>
<sec id="S61">
<title>Clade 43:
<italic>Setoseptoria</italic>
</title>
<p id="P572">
<bold>
<italic>Setoseptoria</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804462&link_type=mb">MB804462</ext-link>
.</p>
<p id="P573">
<italic>Etymology</italic>
: Named after its conidiomata which are septoria-like, but setose.</p>
<p id="P574">
<italic>Conidiomata</italic>
pycnidial, brown, immersed, globose with central ostiole, somewhat papillate, apical erumpent part at times with brown, verruculose to warty setae; wall of 6-8 layers of brown
<italic>textura angularis</italic>
; inner layer of 6-10 layers of hyaline
<italic>textura angularis. Conidiophores</italic>
lining the inner cavity, reduced to conidiogenous cells, or with one supporting cell.
<italic>Conidiogenous cells</italic>
hyaline, smooth, subcylindrical to doliiform; apical region with several inconspicuous percurrent proliferations, or with periclinal thickening; collarette inconspicuous, or prominent, flared.
<italic>Conidia</italic>
hyaline, smooth, becoming somewhat olivaceous and verruculose in older cultures, subcylindrical, tapering in apical part to obtuse or subobtuse apex, base truncate, transversely euseptate, straight to somewhat curved, mostly with one large central guttule per cell, older conidia becoming constricted at septa, disarticulating into phragmospores.</p>
<p id="P575">
<italic>Type species</italic>
:
<italic>Setoseptoria phragmites</italic>
Quaedvlieg, Verkley & Crous.</p>
<p id="P576">
<bold>
<italic>Setoseptoria phragmitis</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804463&link_type=mb">MB804463</ext-link>
.
<xref ref-type="fig" rid="F100">Fig. 100</xref>
.</p>
<fig id="F100" position="float">
<label>Fig. 100.</label>
<caption>
<p>
<italic>Setoseptoria phragmitis</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=114802&link_type=cbs">CBS 114802</ext-link>
). Conidioma sporulating in culture. B. Setae. C, D. Conidiogenous cells. E. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig100"></graphic>
</fig>
<p id="P577">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Phragmites.</italic>
</p>
<p id="P578">On sterile
<italic>Carex</italic>
leaves on WA.
<italic>Conidiomata</italic>
pycnidial, brown, immersed, globose with central ostiole, up to 30 μm diam, somewhat papillate, up to 200 μm diam, apical erumpent part at times with brown, verruculose to warty setae; wall of 6-8 layers of brown
<italic>textura angularis</italic>
; inner layer of 6-10 layers of hyaline
<italic>textura angularis. Conidiophores</italic>
lining the inner cavity, reduced to conidiogenous cells, or with one supporting cell.
<italic>Conidiogenous cells</italic>
hyaline, smooth, subcylindrical to doliiform, 7-12 × 3-4 μm; apical region with several inconspicuous percurrent proliferations, or with periclinal thickening; collarette inconspicuous, or prominent, flared.
<italic>Conidia</italic>
hyaline, smooth, becoming somewhat olivaceous and verruculose in older cultures, subcylindrical, (1-)3-septate, (19-)25-35(-38) × (3.5-)4 μm, tapering in apical part to obtuse or subobtuse apex, base truncate, 1.5-2.5 μm diam, straight to somewhat curved, mostly with one large central guttule per cell, older conidia becoming constricted at septa, disarticulating into phragmospores.</p>
<p id="P579">
<italic>Culture characteristics</italic>
: Colonies on PDA umbonate, round, fluffy grey white aerial mycelium on the younger parts with longer grey blackish tufts on the older parts, surface olivaceous-black to buff at the younger mycelium, reverse olivaceous-black at the older parts to buff at the younger mycelium, after 14 days 6 cm diam; on MEA similar toPDA but after 14 d, 7 cm diam; on OA similar to PDA.</p>
<p id="P580">
<italic>Specimens examined</italic>
:
<bold>hong Kong</bold>
, Mai Po Mangrove, from the leaves of
<italic>Phragmites australis</italic>
(
<italic>Poaceae</italic>
), 12 Mar. 1998, K.D. Hyde (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21324&link_type=cbs">CBS H-21324</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=114802&link_type=cbs">CBS 114802</ext-link>
=HKUCC 2689);
<italic>ibid</italic>
., 3 Feb. 2000, K.D. Hyde (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=114966&link_type=cbs">CBS 114966</ext-link>
=HKUCC 6029).</p>
<p id="P581">
<italic>Notes</italic>
:
<italic>Setoseptoria</italic>
needs to be compared to
<italic>Dearnessia</italic>
and
<italic>Trichoseptoria</italic>
(see above). The genus
<italic>Trichoseptoria</italic>
is poorly known, and details about its conidiogenesis is lacking, and thus it cannot be compared until it has been recollected.
<italic>Setoseptoria</italic>
is distinct from
<italic>Dearnessia</italic>
in that it has conidiogenous cells with prominent percurrent proliferation, and conidia that tend to become olivaceous and verruculose in older cultures, and disarticulate into phragmospores. Several
<italic>Septoria</italic>
species have been described from
<italic>Phragmites</italic>
, including
<italic>S. phragmitis</italic>
(conidia 20-30 × 1.5-2 μm),
<italic>S. arundinacea</italic>
(conidia 6-7-septate, 60-70 × 5-6 μm),
<italic>S. curva</italic>
(conidia 14-20 × 3.5-4.5 μm), and
<italic>S. graminum</italic>
(conidia multiseptate, 55-75 × 1-1.3 μm), all of which appear to differ from
<italic>Setoseptoria phragmitis</italic>
based on its conidial morphology.</p>
</sec>
<sec id="S62">
<title>Clade 44:
<italic>Septorioides</italic>
</title>
<p id="P582">
<bold>
<italic>Septorioides</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804464&link_type=mb">MB804464</ext-link>
.</p>
<p id="P583">
<italic>Etymology</italic>
: Resembling the genus
<italic>Septoria</italic>
.</p>
<p id="P584">
<italic>Foliicolous. Conidiomata</italic>
black, unilocular, globose, flattened, opening by means of irregular rupture; wall consisting of 6-10 layers of dark brown
<italic>textura irregularis</italic>
to
<italic>angularis</italic>
, exuding a crystal conidial mass.
<italic>Paraphyses</italic>
intermingled among conidiophores, hyaline, cylindrical, branched at base, septate with obtuse ends.
<italic>Microconidia</italic>
hyaline, smooth, cylindrical, mostly straight, apex obtuse, base truncate.
<italic>Conidiophores</italic>
reduced to conidiogenous cells or with a supporting cell.
<italic>Conidiogenous cells</italic>
lining the inner cavity in basal layer, hyaline, smooth, subcylindrical to ampulliform, giving rise to macro- and microconidia.
<italic>Spermatia</italic>
formed in conidiomata, cylindrical, hyaline, smooth, straight to curved.
<italic>Macroconidia</italic>
hyaline, smooth, guttulate, subcylindrical, straight to irregularly curved, tapering in apical cell to subobtuse apex, base truncate, transversely euseptate.</p>
<p id="P585">
<italic>Type species</italic>
:
<italic>Septorioides pini-thunbergii</italic>
(S. Kaneko) Quaedvlieg, Verkley & Crous.</p>
<p id="P586">
<bold>
<italic>Septorioides pini-thunbergii</italic>
</bold>
(S. Kaneko) Quaedvlieg, Verkley & Crous,
<bold>comb. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804465&link_type=mb">MB804465</ext-link>
.
<xref ref-type="fig" rid="F101">Fig. 101</xref>
.</p>
<fig id="F101" position="float">
<label>Fig. 101.</label>
<caption>
<p>
<italic>Septorioides pini-thunbergii</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=473.91&link_type=cbs">CBS 473.91</ext-link>
). A. Colony sporulating on PDA. B. Spermatia. C-E. Conidiogenous cells. F. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig101"></graphic>
</fig>
<p id="P587">
<italic>Basionym</italic>
:
<italic>Septoria pini-thunbergii</italic>
S. Kaneko, Trans. Mycol. Soc. Japan 30(4): 463. 1989.</p>
<p id="P588">Associated with needle blight, or isolated as endophyte. On PDA.
<italic>Conidiomata</italic>
black, unilocular, globose, flattened, up to 400 μm diam, opening by means of irregular rupture; wall consisting of 6-10 layers of dark brown
<italic>textura irregularis</italic>
to
<italic>angularis</italic>
, exuding a crystal conidial mass.
<italic>Paraphyses</italic>
intermingled among conidiophores, hyaline, cylindrical, branched at base, septate with obtuse ends, 2-2.5 μm diam, up to 80 μm long.
<italic>Microconidia</italic>
hyaline, smooth, cylindrical, mostly straight, apex obtuse, base truncate, 5-15 × 2-2.5 μm.
<italic>Conidiophores</italic>
reduced to conidiogenous cells or with a supporting cell.
<italic>Conidiogenous cells</italic>
lining the inner cavity in basal layer, hyaline, smooth, subcylindrical to ampulliform, 10-15 × 4-6 μm, giving rise to macro- and microconidia.
<italic>Spermatia</italic>
formed in conidiomata, cylindrical, hyaline, smooth, straight to curved, 3-7 × 2 μm.
<italic>Macroconidia</italic>
hyaline, smooth, guttulate, subcylindrical, straight to irregularly curved, tapering in apical cell to subobtuse apex, base truncate, (60-)70-80(-110) × 3.5(-4) μm, (1-)3-6(-10)-septate.</p>
<p id="P589">
<italic>Specimen examined</italic>
:
<bold>Japan</bold>
, Akita Prefecture, Tenno-cho, on needles of
<italic>Pinus thunbergii</italic>
(
<italic>Pinaceae</italic>
), Aug. 1984, S. Kaneko & Y. Zinno, culture ex-type of
<italic>Septoria pini-thunberghii</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=473.91&link_type=cbs">CBS 473.91</ext-link>
).</p>
<p id="P590">
<italic>Note</italic>
:
<italic>Septorioides</italic>
is distinguished from
<italic>Septoria</italic>
by having conidiomata that open by means of an irregular split (acervular), and having paraphyses intermingled among its conidiophores.
<italic>Septorioides pini-thunbergii</italic>
was originally described from blighted needles of
<italic>Pinus thunbergii</italic>
in Japan (
<xref ref-type="bibr" rid="R66">Kaneko
<italic>et al.</italic>
1989</xref>
). It was also recently isolated as endophyte from needles of
<italic>P. densiflora</italic>
in Korea (
<xref ref-type="bibr" rid="R123">Yoo & Eom 2012</xref>
).</p>
</sec>
<sec id="S63">
<title>Clade 45:
<italic>Phlyctema</italic>
</title>
<p id="P591">
<bold>
<italic>Phlyctema</italic>
</bold>
Desm., Ann. Sci. Nat., Sér. 3, 8: 16. 1847.</p>
<list list-type="simple">
<list-item>
<p>=
<italic>Allantozythia</italic>
Höhn., Mykol. Unters. 3: 322. 1923.</p>
</list-item>
</list>
<p id="P592">
<italic>Mycelium</italic>
immersed, branched, septate, hyaline.
<italic>Conidiomata</italic>
eustromatic, immersed, erumpent, sporodochial, separate, yellowish brown, pulvinate, circular, unilocular but convoluted, thick-walled; wall of
<italic>textura angularis</italic>
, darker brown and thicker-walled at base than at the sides.
<italic>Ostiole</italic>
absent, dehiscence by irregular rupture.
<italic>Conidiophores</italic>
hyaline, septate, branched irregularly, cylindrical to filiform, formed from the wall lining the conidiomata.
<italic>Conidiogenous cells</italic>
enteroblastic, phialidic, integrated or discrete, determinate, hyaline, with minute collarette and periclinal thickening.
<italic>Conidia</italic>
hyaline, aseptate, fusiform, eguttulate, straight to slightly curved or irregular (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
).</p>
<p id="P593">
<italic>Type species</italic>
:
<italic>P. vagabunda</italic>
Desm., Ann. Sci. Nat., Bot., Sér. 3, 8: 16. 1847.</p>
<p id="P594">
<italic>Notes</italic>
:
<italic>Phlyctema</italic>
is characterised by having eustromatic, convulated, pulvinate to sporodochial conidiomata, branched, hyaline conidiophores, and phialidic conidiogenous cells that give rise to hyaline, aseptate, fusiform, straight to curved conidia. The genus has more than 80 names, and is in need of revision.. The type species is linked to a sexual morph known as
<italic>Neofabraea alba</italic>
(
<xref ref-type="bibr" rid="R112">Verkley 1999</xref>
).</p>
<p id="P595">
<bold>
<italic>Phlyctema vincetoxici</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804466&link_type=mb">MB804466</ext-link>
. Figs
<xref ref-type="fig" rid="F102">102</xref>
,
<xref ref-type="fig" rid="F103">103</xref>
.</p>
<fig id="F102" position="float">
<label>Fig. 102.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Phlyctema vincetoxici</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123727&link_type=cbs">CBS 123727</ext-link>
). Scale bar = 10 μm.</p>
</caption>
<graphic xlink:href="307fig102"></graphic>
</fig>
<fig id="F103" position="float">
<label>Fig. 103.</label>
<caption>
<p>
<italic>Phlyctema vincetoxici</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123727&link_type=cbs">CBS 123727</ext-link>
). A. Colonies forming on OA. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig103"></graphic>
</fig>
<p id="P596">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Vincetoxicum.</italic>
</p>
<p id="P597">
<italic>Conidiomata</italic>
immersed, separate, eustromatic, unilocular, convulated, opening by irregular rupture, becoming acervular to sporodochial, up to 450 μm diam; wall of 3-6 layers of brown
<italic>textura angularis</italic>
; outer surface covered in brown, warty hyphae.
<italic>Conidiophores</italic>
hyaline, smooth, subcylindrical, lining the inner layer, branched, 1-4-septate, 15-50 × 4-5 μm.
<italic>Conidiogenous cells</italic>
phialidic, hyaline, smooth, subcylindrical to cymbiform or doliiform, with apical periclinal thickening and minute, non-flaring collarette, 7-18 × 3.5-5 μm.
<italic>Conidia</italic>
hyaline, smooth, guttulate, aseptate, fusiform, curved, tapering to subobtuse apex and truncate base, (27-)33-37(-40) × 3(-3.5) μm.</p>
<p id="P598">
<italic>Culture characteristics</italic>
: Colonies on PDA flat, circular, with sparse, white aerial mycelium, surface dark-brick, reverse greyish sepia, after 14 d, 7 cm diam; on MEA undulate, lacking aerial mycelium, after 14 d, 6 cm diam; on OA flat, circular, lacking aerial mycelium, after 14 d, 8.5 cm diam.</p>
<p id="P599">
<italic>Specimen examined</italic>
:
<bold>Czech Republic</bold>
, Moravia, Podyji National Park, Masovice, Klinka area, on leaves of
<italic>Vincetoxicum officinale</italic>
(
<italic>Asclepiadaceae</italic>
), 17 Sep. 2008, G. Verkley (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21325&link_type=cbs">CBS H-21325</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=123727&link_type=cbs">CBS 123727</ext-link>
=V6015.2).</p>
<p id="P600">
<italic>Notes</italic>
: No species of
<italic>Phlyctema</italic>
has thus far been described on
<italic>Vincetoxicum. Septoria vincetoxici</italic>
(conidia 30-50 × 1-1.5 μm;
<xref ref-type="bibr" rid="R92">Saccardo 1884</xref>
) has somewhat longer, narrower conidia.
<italic>Phlyctema vincetoxici</italic>
was found sporulating in leaf spots showing numerous hypophyllous teleospore sori of the rust fungus
<italic>Cronartium flaccidum</italic>
(identified by H.A. van der Aa).</p>
</sec>
<sec id="S64">
<title>Clade 46:
<italic>Kirstenboschia</italic>
</title>
<p id="P601">
<bold>
<italic>Kirstenboschia</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>gen. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804467&link_type=mb">MB804467</ext-link>
.</p>
<p id="P602">
<italic>Etymology</italic>
: Kirstenbosch National Botanical Garden is one of the most acclaimed botanical gardens of the world, set against the foot of Cape Town’s Table Mountain. With more than 7000 plant species, it has also proven to be a source of numerous undescribed fungal species. Kirstenbosch was established in 1913, and to celebrate its centenary (2013), the fungal genus
<italic>Kirstenboschia</italic>
is named after this beautiful garden.</p>
<p id="P603">
<italic>Foliicolous. Conidiomata</italic>
erumpent, sporodochial, separate, with slightly raised outer margin of 3-10 layers of
<italic>textura intricata. Conidiophores</italic>
lining the inner cavity, hyaline, smooth, septate, subcylindrical, branched below and above.
<italic>Conidiogenous cells</italic>
terminal and lateral, hyaline, smooth, ampulliform to subcylindrical, proliferating sympodially, apical loci truncate, at times appearing subdenticulate.
<italic>Conidia</italic>
solitary, hyaline, scolecosporous, smooth, granular, thin-walled, acicular to narrowly obclavate with subobtuse apex and truncate to long obconically truncate base, 3-septate, irregularly curved.</p>
<p id="P604">
<italic>Type species</italic>
:
<italic>K. diospyri</italic>
Quaedvlieg, Verkley & Crous.</p>
<p id="P605">
<bold>
<italic>Kirstenboschia diospyri</italic>
</bold>
Quaedvlieg, Verkley & Crous,
<bold>sp. nov.</bold>
MycoBank
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=MB804468&link_type=mb">MB804468</ext-link>
. Figs
<xref ref-type="fig" rid="F104">104</xref>
,
<xref ref-type="fig" rid="F105">105</xref>
.</p>
<fig id="F104" position="float">
<label>Fig. 104.</label>
<caption>
<p>Conidia and conidiogenous cells of
<italic>Kirstenboschia diospyri</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=134911&link_type=cbs">CBS 134911</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig104"></graphic>
</fig>
<fig id="F105" position="float">
<label>Fig. 105.</label>
<caption>
<p>
<italic>Kirstenboschia diospyri</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=134911&link_type=cbs">CBS 134911</ext-link>
). A. Conidiomata forming in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars: A = 300 μm, all others = 10 μm.</p>
</caption>
<graphic xlink:href="307fig105"></graphic>
</fig>
<p id="P606">
<italic>Etymology</italic>
: Named after the host genus from which it was collected,
<italic>Diospyros.</italic>
</p>
<p id="P607">
<italic>Conidiomata</italic>
erumpent, sporodochial, up to 300 μm diam, separate, appearing creamy to pale yellow when sporulating on SNA with barley leaves, with slightly raised outer margin of 3-10 layers of
<italic>textura intricata. Conidiophores</italic>
lining the inner cavity, hyaline, smooth, 0-4-septate, subcylindrical, branched below and above, 5-15 × 2-4 μm.
<italic>Conidiogenous cells</italic>
5-10 × 2-3 μm, terminal and lateral, hyaline, smooth, ampulliform to subcylindrical, proliferating sympodially, apical loci truncate, at times appearing subdenticulate, 1 μm diam.
<italic>Conidia</italic>
solitary, hyaline, scolecosporous, smooth, granular, thin-walled, acicular to narrowly obclavate with subobtuse apex and truncate to long obconically truncate base, 3-septate, irregularly curved, (40-)60-70(-75) × (1.5-)2 μm.</p>
<p id="P608">
<italic>Culture characteristics</italic>
: Colonies on PDA erumpent, with moderate aerial mycelium, and smooth, lobate margin; surface and reverse dirty white. On OA dirty white with diffuse brown pigment in agar. On MEA surface folded, irregular, strongly erumpent, dirty white, reverse sienna.</p>
<p id="P609">
<italic>Specimen examined</italic>
:
<bold>South Africa</bold>
, Western Cape Province, Kirstenbosch Botanical Garden, on leaves of
<italic>Diospyros whyteana</italic>
(
<italic>Ebenaceae</italic>
), 9 Aug. 2011, P.W. Crous (
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-21326&link_type=cbs">CBS H-21326</ext-link>
, culture ex-type
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=134911&link_type=cbs">CBS 134911</ext-link>
=CPC 19869).</p>
<p id="P610">
<italic>Note</italic>
:
<italic>Kirstenboschia</italic>
is distinguished from
<italic>Septoria s. str</italic>
. and allied genera based on its distinctive, sporodochial conidiomata, and conidiogenous cells that proliferate sympodially, but at times are subdenticulate.</p>
</sec>
<sec id="S65">
<title>Clade 47:
<italic>Phlogicylindrium</italic>
</title>
<p id="P611">
<bold>
<italic>Phlogicylindrium</italic>
</bold>
Crous, Summerb. & Summerell, Fungal Diversity 23: 340. 2006.</p>
<p id="P612">
<italic>Foliicolous. Conidiomata</italic>
synnematal to sporodochial, pale brown.
<italic>Macroconidiophores</italic>
arising from a brown stroma of 3-6 layers of
<italic>textura angularis</italic>
, giving rise to subcylindrical, hyaline (dark brown at the base), smooth, frequently branched conidiophores, 0-2(-6)-septate.
<italic>Macroconidiogenous cells</italic>
hyaline, smooth, subcylindrical, proliferating sympodially and percurrently near apex.
<italic>Macroconidia</italic>
hyaline, smooth, subcylindrical, transversely septate, apex obtusely rounded, base truncate, slightly curved.
<italic>Microconidia</italic>
formed in acervular conidiomata together with macroconidia.
<italic>Microconidiophores</italic>
intermingled among macroconidiophores, hyaline, smooth, subcylindrical, branched, 1-4-septate.
<italic>Microconidiogenous cells</italic>
terminal and lateral, hyaline, smooth, ampulliform, phialidic, solitary or in penicillate clusters.
<italic>Microconidia</italic>
hyaline, smooth, hamate, curved, apex subobtuse, base truncate, widest in upper third, aseptate (
<xref ref-type="bibr" rid="R103">Summerell
<italic>et al</italic>
. 2006</xref>
).</p>
<p id="P613">
<italic>Type species</italic>
:
<italic>P. eucalypti</italic>
Crous, Summerb. & Summerell, Fungal Diversity 23: 340. 2006.</p>
<p id="P614">
<bold>
<italic>Phlogicylindrium eucalyptorum</italic>
</bold>
Crous, Fungal Planet 20. 2007. Figs
<xref ref-type="fig" rid="F106">106</xref>
,
<xref ref-type="fig" rid="F107">107</xref>
.</p>
<fig id="F106" position="float">
<label>Fig. 106.</label>
<caption>
<p>Macro- and microconidia and conidiogenous cells of
<italic>Phlogicylindrium eucalyptorum</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111689&link_type=cbs">CBS 111689</ext-link>
). Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig106"></graphic>
</fig>
<fig id="F107" position="float">
<label>Fig. 107.</label>
<caption>
<p>
<italic>Phlogicylindrium eucalyptorum</italic>
(
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111689&link_type=cbs">CBS 111689</ext-link>
). A. Colony on OA. B, E. Microcyclic conidiation with macro- and macroconidia. C. Macroconidiogenous cells. D. Microconidia. F. Macroconidia. Scale bars = 10 μm.</p>
</caption>
<graphic xlink:href="307fig107"></graphic>
</fig>
<p id="P615">On OA.
<italic>Conidiomata</italic>
synnematal to sporodochial, pale brown up to 300 μm diam.
<italic>Macroconidiophores</italic>
arising from a brown stroma of 3-6 layers of textura angularis, giving rise to subcylindrical, hyaline (dark brown at the base), smooth, frequently branched conidiophores, 0-2(-6)-septate, 15-25(-45) × 3-4 μm.
<italic>Macroconidiogenous cells</italic>
hyaline, smooth, subcylindrical, 10-15 × 2-4 μm, proliferating sympodially and percurrently near apex.
<italic>Macroconidia</italic>
hyaline, smooth, subcylindrical, 1(-3)-septate, apex obtusely rounded, base truncate, slightly curved, (27-)40-50(-55) × 2-2.5(-3) μm.
<italic>Microconidia</italic>
formed in acervular conidiomata together with macroconidia.
<italic>Microconidiophores</italic>
intermingled among macroconidiophores, hyaline, smooth, subcylindrical, branched, 1-4-septate, 20-40 × 2-2.5 μm.
<italic>Microconidiogenous cells</italic>
terminal and lateral, hyaline, smooth, ampulliform, phialidic, 5-16 × 2-2.5 μm, solitary or in penicillate clusters of up to 3.
<italic>Microconidia</italic>
hyaline, smooth, hamate, curved, apex subobtuse, base truncate, widest in upper third, aseptate, (16-)17-20(-24) 1.5(-2) μm.</p>
<p id="P616">
<italic>Specimens examined</italic>
:
<bold>Australia</bold>
, Victoria, Otway Ranges, (near Gellibrand), latitude: -38.568412, longitude: 143.539586, elevation: 175 m, on leaves of
<italic>Eucalyptus globulus</italic>
(
<italic>Myrtaceae</italic>
), Sep. 2005, I. Smith,
<bold>holotype</bold>
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=-19771&link_type=cbs">CBS H-19771</ext-link>
, cultures ex-type CPC 12429 =
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=120221&link_type=cbs">CBS 120221</ext-link>
; New South Wales, on leaves of
<italic>E. nitens</italic>
, 22 Nov. 1996, P.W. Crous (
<ext-link ext-link-type="uri" xlink:href="http://www.studiesinmycology.org/cgi/external_ref?access_num=111689&link_type=cbs">CBS 111689</ext-link>
=CPC 1547 = STE-U 1547).</p>
<p id="P617">
<italic>Notes</italic>
: The present strain represents the second collection of this fungus. Isolates from this collection formed a microconidial state not observed in the type (
<xref ref-type="bibr" rid="R23">Crous
<italic>et al</italic>
. 2007c</xref>
), and novel for species of
<italic>Phlogicylindrium</italic>
.</p>
</sec>
</sec>
<sec sec-type="discussion" id="S66">
<title>DISCUSSION</title>
<p id="P618">The main question considered in the present study was: what is
<italic>Septoria</italic>
? To address this we included 370 isolates representing 170 species, sampled from six continents. Furthermore, we also generated several phylogenetic datasets based on partial sequences of the ITS, LSU, Btub, RPB2 and EF-1α loci. In the final analysis, it was clear that
<italic>Septoria</italic>
is a well-defined genus and phylogenetic clade, with pycnidial, ostiolate conidiomata, conidiophores reduced to conidiogenous cells that proliferate sympodially, and hyaline, filiform conidia with transverse eusepta, fitting the original concept of Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
). However, when host material has been incubated for a while, several pycnidial species tend to form acervuli (also not clearly defined when studied in culture on normal agar media), and conidiogenous cells could have a combination of sympodial and percurrent proliferation (as observed in
<italic>Pseudocercospora</italic>
;
<xref ref-type="bibr" rid="R19">Crous
<italic>et al.</italic>
2013</xref>
).</p>
<p id="P619">The present study, including that of Verkley
<italic>et al</italic>
. (
<xref ref-type="bibr" rid="R117">2013</xref>
) defined an additional 15 genera that were formerly treated as “septoria” in the widest sense. Although it has recently been shown that
<italic>Phoma</italic>
is a generic complex representing many morphologic and phylogenetic genera (
<xref ref-type="bibr" rid="R4">Aveskamp et al. 2010</xref>
, de Gruyter et al.
<xref ref-type="bibr" rid="R58">2010</xref>
,
<xref ref-type="bibr" rid="R59">2013</xref>
), this was not expected to also be the case for
<italic>Septoria</italic>
. Furthermore, many of the septoria-like genera discussed earlier in this paper are presently still not known from sequence, and thus their phylogeny remains to be resolved, meaning that they could add futher entities to the list of acknowledged septoria-like genera.</p>
<p id="P620">Although
<italic>Septoria s. str</italic>
. is a genus in the
<italic>Mycosphaerellaceae</italic>
(
<italic>Capnodiales</italic>
), several of the septoria-like genera clustered outside this family. Species of
<italic>Septoria</italic>
are morphologically conserved, and in the past many taxa were identified based on host, which has been shown to be unreliable (see
<xref ref-type="bibr" rid="R117">Verkley
<italic>et al</italic>
. 2013</xref>
), as several taxa have wide host ranges. Another complication revealed in the present study is that many septoria-like genera cluster in different phylogenetic clades, but have still retained the
<italic>Septoria</italic>
morphological characters, which means that as in
<italic>Phoma</italic>
, future identifications in this complex will also have to rely on DNA sequence data to support morphological conclusions.</p>
<p id="P621">The genus
<italic>Stagonospora</italic>
has always been separated from
<italic>Septoria</italic>
on the basis that
<italic>Septoria</italic>
has conidiogenous cells with sympodial proliferation, whereas in
<italic>Stagonospora</italic>
they proliferate percurrently. As shown in the present study, however, conidiogenesis is far too broad a feature to define all genera that express these modes of proliferation in their conidiogenous cells.
<italic>Stagonospora</italic>
, which is based on
<italic>S. paludosa</italic>
, was epitypified in this study, and shown to cluster apart from
<italic>Septoria s. str.</italic>
Another major surprise lies in the fact that Septoria nodorum blotch, caused by “
<italic>Stagonospora</italic>
<italic>nodorum</italic>
, clusters in a distinct genus, unrelated to
<italic>Stagonospora s. str</italic>
., and also separate from
<italic>Phaeosphaeria s. str</italic>
. A repercussion from these findings is the fact that the common cereal pathogens, which are neither
<italic>Stagonospora, Septoria, Phaeosphaeria</italic>
or
<italic>Leptosphaeria</italic>
(see
<xref ref-type="bibr" rid="R59">de Gruyter
<italic>et al</italic>
. 2013</xref>
), now have to be accommodated in a new genus,
<italic>Parastagonospora</italic>
. Furthermore, it appears that
<italic>Stagonospora s. str</italic>
. occurs on
<italic>Poaceae</italic>
, but has thus far only been confirmed from
<italic>Carex</italic>
, though further sampling will undoubtedly extend the host range of this genus.
<italic>Parastagonospora</italic>
is thus a novel, distinct stagonospora-like genus, which has sexual morphs that are phaeosphaeria-like in morphology, thus quite unlike those of
<italic>Stagonospora s. str</italic>
., which are more didymella-like in morphology.</p>
<p id="P622">The genus
<italic>Phaeosphaeria</italic>
is based on
<italic>P. oryzae</italic>
(asexual morph
<italic>Phaeoseptoria oryzae</italic>
), for which we could designate an epitype in this study. Furthermore, we also recollected the type species of
<italic>Phaeoseptoria, P. papayae</italic>
, for which we also designated an epitype. As expected,
<italic>Phaeoseptoria</italic>
clusters with
<italic>Phaeosphaeria</italic>
, for which we choose the name of the sexual morph,
<italic>Phaeosphaeria</italic>
, on the basis that it is clearly resolved, and well established in literature. In contrast,
<italic>Phaeoseptoria</italic>
has in recent years become a muddled concept harbouring unrelated coelomycetes with pigmented conidia.</p>
<p id="P623">Obtaining a culture of
<italic>Cytostagonospora martiniana</italic>
clarified the phylogenetic position of the genus as distinct from
<italic>Septoria</italic>
, resolving the difference of opinion between von Arx (
<xref ref-type="bibr" rid="R2">1983</xref>
), who regarded it as synonym of
<italic>Septoria</italic>
, versus Sutton (
<xref ref-type="bibr" rid="R110">1980</xref>
), who retained it as separate genus. Of interest is the unique mode of conidiogenesis, ranging from holoblastic sympodial to polyphialides with periclinal thickening to percurrent proliferation. It should be noted, however, that although this is a distinct genus,
<italic>C. mariniana</italic>
is not the type of
<italic>Cytostagonospora</italic>
, and
<italic>C. photiniicola</italic>
(occurring on
<italic>Photinia serrulata</italic>
, Austria) will have to be recollected to confirm that these two fungi are congeneric.</p>
<p id="P624">The genus
<italic>Phloeospora</italic>
(based on
<italic>P. ulmi</italic>
) has for long been assumed to be a synonym of
<italic>Septoria</italic>
based on morphology. It is thus good to finally see it resolved as separate phylogenetic lineage, which is also supported morphologically based on its acervular conidiomata and conidiogenous cells with prominent percurrent proliferation. In spite of resolving 21 genera, several lineages remain unresolved, and are simply treated as “septoria-like” awaiting the recollection of additional material.</p>
<p id="P625">It is surprising that so many of the cereal pathogens actually have a confused taxonomy. Eyespot disease of wheat, formely treated as
<italic>Tapesia</italic>
(
<italic>Ramulispora</italic>
asexual states), was shown to represent a distinct genus
<italic>Oculimacula</italic>
(
<italic>Helgardia</italic>
asexual states) (
<xref ref-type="bibr" rid="R22">Crous
<italic>et al</italic>
. 2003</xref>
), while Quaedvlieg
<italic>et al.</italic>
(
<xref ref-type="bibr" rid="R89">2011</xref>
) determined that Septoria tritici blotch, caused by “
<italic>Septoria</italic>
<italic>tritici</italic>
, is in fact better accommodated in a new genus,
<italic>Zymoseptoria</italic>
, which appears to be restricted to members of
<italic>Poaceae</italic>
. The present study also resolved the phylogenetic position of Septoria nodorum blotch, which proved to not represent a member of
<italic>Septoria, Stagonospora</italic>
, or
<italic>Phaeosphaeria</italic>
, but to represent a distinct genus, described here as
<italic>Parastagonospora</italic>
. Clearly more attention should be directed towards resolving the taxonomy of the pathogens of agricultural crops of major economic importance in future, as these findings also have implications for genomic studies, where organisms from different genera, and even families get compared to one another, and new evolutionary hypotheses are proposed on the assumption that these taxa are congeneric. To clarify the taxonomy of well-known plant pathogens, however, many species will have to be recollected, and epitypified, so that authentic cultures and DNA barcodes will become available to fix the genetic application of these names.</p>
<sec id="S67">
<title>General conclusions</title>
<p id="P626">The genus
<italic>Septoria</italic>
is defined by having pycnidial to acervular conidiomata, and hyaline conidiophores that give rise to conidiogenous cells that proliferate sympodially and percurrently, forming hyaline, filiform conidia with transverse eusepta. Many species have wide host ranges, and host occurrence should not be used as primary character for identification (see
<xref ref-type="bibr" rid="R117">Verkley
<italic>et al</italic>
. 2013</xref>
, this issue). Although species of
<italic>Septoria</italic>
and several of the novel genera introduced here have mycosphaerella-like sexual states, the name
<italic>Mycosphaerella</italic>
is restricted to the genus
<italic>Ramularia</italic>
, and is unavailable for species of
<italic>Septoria</italic>
and related genera.</p>
</sec>
</sec>
</body>
<back>
<ack>
<p>We thank the technical staff, Arien van Iperen (cultures), and Marjan Vermaas (photographic plates), for their invaluable assistance. The research leading to these results has received funding from the European Community’s Seventh Framework Program (FP7/2007-2013)/grant agreement no. 226482 (Project: QBOL - Development of a new diagnostic tool using DNA barcoding to identify quarantine organisms in support of plant health) by the European Commission under the theme “Development of new diagnostic methods in support of Plant Health policy” (no. KBBE-2008-1-4-01). Special thanks also go to Dr Ellen van Agtmaal who prepared the line drawings included in this paper from photomicrographs and published materials (
<xref ref-type="bibr" rid="R110">Sutton 1980</xref>
) using Adobe Photoshop CS3.</p>
</ack>
<ref-list>
<title>REFERENCES</title>
<ref id="R1">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Aptroot</surname>
<given-names>A</given-names>
</name>
</person-group>
(
<year>2006</year>
).
<article-title>
<italic>Mycosphaerella</italic>
and its anamorphs. 2, Conspectus of
<italic>Mycosphaerella</italic>
</article-title>
.
<source>CBS Biodiversity Series</source>
<volume>5</volume>
<publisher-name>CBS-KNAW Fungal Biodiversity Centre</publisher-name>
,
<publisher-loc>Utrecht, The Netherlands</publisher-loc>
</mixed-citation>
</ref>
<ref id="R2">
<mixed-citation publication-type="confproc">
<person-group person-group-type="author">
<name>
<surname>Arx</surname>
<given-names>JA von</given-names>
</name>
</person-group>
(
<year>1983</year>
).
<article-title>
<italic>Mycosphaerella</italic>
and its anamorphs</article-title>
.
<source>Proceedings of the Koninklijke Nederlandse Akademie van Wetenschappen Series C-Biological and Medical Sciences</source>
<volume>86</volume>
(
<issue>1</issue>
):
<fpage>15</fpage>
<lpage>54</lpage>
</mixed-citation>
</ref>
<ref id="R3">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Arzanlou</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2006</year>
).
<article-title>Phaeosphaeriopsis musae</article-title>
.
<source>Fungal Planet</source>
<volume>9</volume>
<publisher-name>CBS-KNAW Fungal Biodiversity Centre</publisher-name>
,
<publisher-loc>Utrecht, The Netherlands</publisher-loc>
</mixed-citation>
</ref>
<ref id="R4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aveskamp</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Gruyter</surname>
<given-names>H de</given-names>
</name>
<name>
<surname>Woudenberg</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Verkley</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2010</year>
).
<article-title>Highlights of the
<italic>Didymellaceae</italic>
: A polyphasic approach to characterise
<italic>Phoma</italic>
and related pleosporalean genera</article-title>
.
<source>Studies in Mycology</source>
<volume>65</volume>
:
<fpage>1</fpage>
<lpage>60</lpage>
<pub-id pub-id-type="pmid">20502538</pub-id>
</mixed-citation>
</ref>
<ref id="R5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barnes</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>BD</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
</person-group>
(
<year>2004</year>
).
<article-title>Multigene phylogenies reveal that red band needle blight of
<italic>Pinus</italic>
is caused by two distinct species of
<italic>Dothistroma, D. septosporum</italic>
and
<italic>D. pini</italic>
</article-title>
.
<source>Studies in Mycology</source>
<volume>50</volume>
:
<fpage>551</fpage>
<lpage>565</lpage>
</mixed-citation>
</ref>
<ref id="R6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Beach</surname>
<given-names>WS</given-names>
</name>
</person-group>
(
<year>1919</year>
).
<article-title>Biologic specialization in the genus
<italic>Septoria</italic>
</article-title>
.
<source>American Journal of Botany</source>
<volume>6</volume>
:
<fpage>1</fpage>
<lpage>32</lpage>
</mixed-citation>
</ref>
<ref id="R7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bedlan</surname>
<given-names>G</given-names>
</name>
</person-group>
(
<year>2011</year>
).
<article-title>
<italic>Septoria juliae</italic>
sp. nov. - a new
<italic>Septoria</italic>
species on
<italic>Nerium oleander</italic>
</article-title>
.
<source>Journal für Kulturpflanzen</source>
<volume>63</volume>
:
<fpage>430</fpage>
<lpage>431</lpage>
</mixed-citation>
</ref>
<ref id="R8">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Bissett</surname>
<given-names>J</given-names>
</name>
</person-group>
(
<year>1982</year>
).
<article-title>Stagonospora avenae</article-title>
.
<source>Fungi Canadenses</source>
<volume>239</volume>
<publisher-name>National Mycological Herbarium, Biosystematics Research Institute</publisher-name>
,
<publisher-loc>Agriculture Canada, Ottawa</publisher-loc>
</mixed-citation>
</ref>
<ref id="R9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Braun</surname>
<given-names>U</given-names>
</name>
</person-group>
(
<year>1990</year>
).
<article-title>Taxonomic problems of the
<italic>Ramularia</italic>
/
<italic>Cercosporella</italic>
complex</article-title>
.
<source>Studies in Mycology</source>
<volume>32</volume>
:
<fpage>65</fpage>
<lpage>75</lpage>
</mixed-citation>
</ref>
<ref id="R10">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Braun</surname>
<given-names>U</given-names>
</name>
</person-group>
(
<year>1995</year>
).
<source>A monograph of
<italic>Cercosporella, Ramularia</italic>
and allied genera (Phytopathogenic Hyphomycetes)</source>
. Vol.
<volume>1</volume>
<publisher-name>IHW-Verlag</publisher-name>
,
<publisher-loc>Eching</publisher-loc>
</mixed-citation>
</ref>
<ref id="R11">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Braun</surname>
<given-names>U</given-names>
</name>
</person-group>
(
<year>1998</year>
).
<source>A monograph of
<italic>Cercosporella, Ramularia</italic>
and allied genera (Phytopathogenic Hyphomycetes)</source>
. Vol.
<volume>2</volume>
<publisher-name>IHW-Verlag</publisher-name>
,
<publisher-loc>Eching</publisher-loc>
</mixed-citation>
</ref>
<ref id="R12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Câmara</surname>
<given-names>MPS</given-names>
</name>
<name>
<surname>Ramaley</surname>
<given-names>AW</given-names>
</name>
<name>
<surname>Castlebury</surname>
<given-names>LA</given-names>
</name>
<name>
<surname>Palm</surname>
<given-names>ME</given-names>
</name>
</person-group>
(
<year>2003</year>
).
<article-title>
<italic>Neophaeosphaeria</italic>
and
<italic>Phaeosphaeriopsis</italic>
, segregates of
<italic>Paraphaeosphaeria</italic>
</article-title>
.
<source>Mycological Research</source>
<volume>107</volume>
:
<fpage>516</fpage>
<lpage>522</lpage>
<pub-id pub-id-type="pmid">12884947</pub-id>
</mixed-citation>
</ref>
<ref id="R13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Carbone</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Kohn</surname>
<given-names>LM</given-names>
</name>
</person-group>
(
<year>1999</year>
).
<article-title>A method for designing primer sets for speciation studies in filamentous ascomycetes</article-title>
.
<source>Mycologia</source>
<volume>91</volume>
:
<fpage>553</fpage>
<lpage>556</lpage>
</mixed-citation>
</ref>
<ref id="R14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheewangkoon</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Hyde</surname>
<given-names>KD</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>To-anan</surname>
<given-names>C</given-names>
</name>
</person-group>
(
<year>2008</year>
).
<article-title>Species of
<italic>Mycosphaerella</italic>
and related anamorphs on
<italic>Eucalyptus</italic>
leaves from Thailand</article-title>
.
<source>Persoonia</source>
<volume>21</volume>
:
<fpage>77</fpage>
<lpage>91</lpage>
<pub-id pub-id-type="pmid">20396579</pub-id>
</mixed-citation>
</ref>
<ref id="R15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Constantinescu</surname>
<given-names>O</given-names>
</name>
</person-group>
(
<year>1984</year>
).
<article-title>Taxonomic revision of
<italic>Septoria</italic>
-like fungi parasitic on
<italic>Betulaceae</italic>
</article-title>
.
<source>Transactions of the British Mycological Society</source>
<volume>83</volume>
:
<fpage>383</fpage>
<lpage>398</lpage>
</mixed-citation>
</ref>
<ref id="R16">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>1998</year>
).
<article-title>
<italic>Mycosphaerella</italic>
spp. and their anamorphs associated with leaf spot diseases of
<italic>Eucalyptus</italic>
</article-title>
.
<source>Mycologia Memoir</source>
<volume>21</volume>
<publisher-name>APS Press</publisher-name>
,
<publisher-loc>MN, USA</publisher-loc>
</mixed-citation>
</ref>
<ref id="R17">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Braun</surname>
<given-names>U</given-names>
</name>
</person-group>
(
<year>2003</year>
).
<article-title>
<italic>Mycosphaerella</italic>
and its anamorphs: 1. Names published in
<italic>Cercospora</italic>
and
<italic>Passalora</italic>
</article-title>
.
<source>CBS Biodiversity Series</source>
<volume>1</volume>
<publisher-name>CBS-KNAW Fungal Biodiversity Centre</publisher-name>
,
<publisher-loc>Utrecht, The Netherlands</publisher-loc>
</mixed-citation>
</ref>
<ref id="R18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Braun</surname>
<given-names>U</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
</person-group>
(
<year>2007a</year>
).
<article-title>
<italic>Mycosphaerella</italic>
is polyphyletic</article-title>
.
<source>Studies in Mycology</source>
<volume>58</volume>
:
<fpage>1</fpage>
<lpage>32</lpage>
<pub-id pub-id-type="pmid">18490994</pub-id>
</mixed-citation>
</ref>
<ref id="R19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Braun</surname>
<given-names>U</given-names>
</name>
<name>
<surname>Hunter</surname>
<given-names>GC</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2013</year>
).
<article-title>Phylogenetic lineages in
<italic>Pseudocercospora</italic>
</article-title>
.
<source>Studies in Mycology</source>
<volume>75</volume>
:
<fpage>37</fpage>
<lpage>114</lpage>
</mixed-citation>
</ref>
<ref id="R20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Braun</surname>
<given-names>U</given-names>
</name>
<name>
<surname>Schubert</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
</person-group>
(
<year>2007b</year>
).
<article-title>Delimiting
<italic>Cladosporium</italic>
from morphologically similar genera</article-title>
.
<source>Studies in Mycology</source>
<volume>58</volume>
:
<fpage>33</fpage>
<lpage>56</lpage>
<pub-id pub-id-type="pmid">18490995</pub-id>
</mixed-citation>
</ref>
<ref id="R21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Ferreira</surname>
<given-names>FA</given-names>
</name>
<name>
<surname>Sutton</surname>
<given-names>BC</given-names>
</name>
</person-group>
(
<year>1997</year>
).
<article-title>A comparison of the fungal genera
<italic>Phaeophleospora</italic>
and
<italic>Kirramyces</italic>
(coelomycetes)</article-title>
.
<source>South African Journal of Botany</source>
<volume>63</volume>
:
<fpage>111</fpage>
<lpage>115</lpage>
</mixed-citation>
</ref>
<ref id="R22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Gams</surname>
<given-names>W</given-names>
</name>
</person-group>
(
<year>2003</year>
).
<article-title>Eyespot of cereals revisited: ITS phylogeny reveals new species relationships</article-title>
.
<source>European Journal of Plant Pathology</source>
<volume>109</volume>
:
<fpage>841</fpage>
<lpage>850</lpage>
</mixed-citation>
</ref>
<ref id="R23">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Smith</surname>
<given-names>IW</given-names>
</name>
</person-group>
(
<year>2007c</year>
).
<article-title>Phlogicylindrium eucalyptorum</article-title>
.
<source>Fungal Planet</source>
<volume>20</volume>
<publisher-name>CBS-KNAW Fungal Biodiversity Centre</publisher-name>
,
<publisher-loc>Utrecht, The Netherlands</publisher-loc>
</mixed-citation>
</ref>
<ref id="R24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Braun</surname>
<given-names>U</given-names>
</name>
</person-group>
(
<year>2001</year>
).
<article-title>A phylogenetic redefinition of anamorph genera in
<italic>Mycosphaerella</italic>
based on ITS rDNA sequence and morphology</article-title>
.
<source>Mycologia</source>
<volume>93</volume>
:
<fpage>1081</fpage>
<lpage>1101</lpage>
</mixed-citation>
</ref>
<ref id="R25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Schoch</surname>
<given-names>CL</given-names>
</name>
<name>
<surname>Hyde</surname>
<given-names>KD</given-names>
</name>
<name>
<surname>Wood</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Gueidan</surname>
<given-names>C</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2009a</year>
).
<article-title>Phylogenetic lineages in the
<italic>Capnodiales</italic>
</article-title>
.
<source>Studies in Mycology</source>
<volume>64</volume>
:
<fpage>17</fpage>
<lpage>47</lpage>
<pub-id pub-id-type="pmid">20169022</pub-id>
</mixed-citation>
</ref>
<ref id="R26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Shivas</surname>
<given-names>RG</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Summerell</surname>
<given-names>BA</given-names>
</name>
<name>
<surname>Rossman</surname>
<given-names>AY</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2012a</year>
).
<article-title>Fungal Planet description sheets 128-127</article-title>
.
<source>Persoonia</source>
<volume>29</volume>
:
<fpage>138</fpage>
<lpage>153</lpage>
<pub-id pub-id-type="pmid">23105159</pub-id>
</mixed-citation>
</ref>
<ref id="R27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Slippers</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Rheeder</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Marasas</surname>
<given-names>WFO</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2006</year>
).
<article-title>Phylogenetic lineages in the
<italic>Botryosphaeriaceae</italic>
</article-title>
.
<source>Studies in Mycology</source>
<volume>55</volume>
:
<fpage>235</fpage>
<lpage>253</lpage>
<pub-id pub-id-type="pmid">18490983</pub-id>
</mixed-citation>
</ref>
<ref id="R28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Summerell</surname>
<given-names>BA</given-names>
</name>
<name>
<surname>Carnegie</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
</person-group>
(
<year>2009b</year>
).
<article-title>Novel species of
<italic>Mycosphaerellaceae</italic>
and
<italic>Teratosphaeriaceae</italic>
</article-title>
.
<source>Persoonia</source>
<volume>23</volume>
:
<fpage>119</fpage>
<lpage>146</lpage>
<pub-id pub-id-type="pmid">20198165</pub-id>
</mixed-citation>
</ref>
<ref id="R29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Summerell</surname>
<given-names>BA</given-names>
</name>
<name>
<surname>Carnegie</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Hunter</surname>
<given-names>GC</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2009c</year>
).
<article-title>Unravelling
<italic>Mycosphaerella</italic>
: do you believe in genera?</article-title>
<source>Persoonia</source>
<volume>23</volume>
:
<fpage>99</fpage>
<lpage>118</lpage>
<pub-id pub-id-type="pmid">20198164</pub-id>
</mixed-citation>
</ref>
<ref id="R30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Summerell</surname>
<given-names>BA</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
</person-group>
(
<year>2011</year>
).
<article-title>Additions to the
<italic>Mycosphaerella</italic>
complex</article-title>
.
<source>IMA Fungus</source>
<volume>2</volume>
:
<fpage>49</fpage>
<lpage>64</lpage>
<pub-id pub-id-type="pmid">22679588</pub-id>
</mixed-citation>
</ref>
<ref id="R31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Christensen</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Castañeda-Ruiz</surname>
<given-names>RF</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
</person-group>
(
<year>2012b</year>
).
<article-title>How important are conidial appendages?</article-title>
<source>Persoonia</source>
<volume>28</volume>
:
<fpage>126</fpage>
<lpage>137</lpage>
<pub-id pub-id-type="pmid">23105158</pub-id>
</mixed-citation>
</ref>
<ref id="R32">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Samson</surname>
<given-names>RA</given-names>
</name>
</person-group>
(
<year>2009d</year>
).
<source>CBS Laboratory Manual Series</source>
<volume>1</volume>
<publisher-name>CBS-KNAW Fungal Biodiversity Centre</publisher-name>
,
<publisher-loc>Utrecht, The Netherlands</publisher-loc>
</mixed-citation>
</ref>
<ref id="R33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>RF</given-names>
</name>
</person-group>
(
<year>1991</year>
).
<article-title>
<italic>Mycosphaerella nubilosa</italic>
a synonym of
<italic>M. molleriana</italic>
</article-title>
.
<source>Mycological Research</source>
<volume>95</volume>
:
<fpage>628</fpage>
<lpage>632</lpage>
</mixed-citation>
</ref>
<ref id="R34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cunfer</surname>
<given-names>BM</given-names>
</name>
</person-group>
(
<year>2000</year>
).
<article-title>
<italic>Stagonospora</italic>
and
<italic>Septoria</italic>
diseases of barley, oat, and rye</article-title>
.
<source>Canadian Journal of Plant Pathology</source>
<volume>22</volume>
:
<fpage>332</fpage>
<lpage>348</lpage>
</mixed-citation>
</ref>
<ref id="R35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cunfer</surname>
<given-names>BM</given-names>
</name>
<name>
<surname>Ueng</surname>
<given-names>PP</given-names>
</name>
</person-group>
(
<year>1999</year>
).
<article-title>Taxonomy and identification of
<italic>Septoria</italic>
and
<italic>Stagonospora</italic>
species on small-grain cereals</article-title>
.
<source>Annual Review of Phytopathology</source>
<volume>37</volume>
:
<fpage>267</fpage>
<lpage>284</lpage>
</mixed-citation>
</ref>
<ref id="R36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deighton</surname>
<given-names>FC</given-names>
</name>
</person-group>
(
<year>1987</year>
).
<article-title>New species of
<italic>Pseudocercospora</italic>
and
<italic>Mycovellosiella</italic>
, and new combinations into
<italic>Pseudocercospora</italic>
and
<italic>Phaeoramularia</italic>
</article-title>
.
<source>Transactions of the British Mycological Society</source>
<volume>88</volume>
:
<fpage>365</fpage>
<lpage>391</lpage>
</mixed-citation>
</ref>
<ref id="R37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Demaree</surname>
<given-names>JB</given-names>
</name>
<name>
<surname>Wilcox</surname>
<given-names>MS</given-names>
</name>
</person-group>
(
<year>1943</year>
).
<article-title>The fungus causing the so-called “Septoria leaf-spot disease” of raspberry</article-title>
.
<source>Phytopathology</source>
<volume>33</volume>
:
<fpage>986</fpage>
<lpage>1003</lpage>
</mixed-citation>
</ref>
<ref id="R38">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Desmazières</surname>
<given-names>JBHJ</given-names>
</name>
</person-group>
(
<year>1847</year>
).
<article-title>Quatorzième notice sur les plantes cryptogames récemment découvertes en France</article-title>
.
<source>Annales des Sciences Naturelles Botanique</source>
,
<series>Série
<bold>3,</bold>
</series>
<volume>8</volume>
:
<page-range>9-37, 172-193</page-range>
</mixed-citation>
</ref>
<ref id="R39">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Donk</surname>
<given-names>MA</given-names>
</name>
</person-group>
(
<year>1964</year>
).
<article-title>Nomina conervana proposita</article-title>
.
<source>Deuteromycetes. Regnum Vegetable</source>
<volume>34</volume>
:
<fpage>7</fpage>
<lpage>15</lpage>
</mixed-citation>
</ref>
<ref id="R40">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dyko</surname>
<given-names>BJ</given-names>
</name>
<name>
<surname>Sutton</surname>
<given-names>BC</given-names>
</name>
</person-group>
(
<year>1979</year>
).
<article-title>Two new and unusual deuteromycetes</article-title>
.
<source>Transactions of the British Mycological Society</source>
<volume>72</volume>
:
<fpage>411</fpage>
<lpage>417</lpage>
</mixed-citation>
</ref>
<ref id="R41">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Ellis</surname>
<given-names>MB</given-names>
</name>
</person-group>
(
<year>1971</year>
).
<source>Dematiaceous Hyphomycetes</source>
.
<publisher-name>Commonwealth Mycological Institute</publisher-name>
,
<publisher-loc>Kew, Surrey, UK</publisher-loc>
</mixed-citation>
</ref>
<ref id="R42">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Ellis</surname>
<given-names>MB</given-names>
</name>
</person-group>
(
<year>1976</year>
).
<source>More Dematiaceous Hyphomycetes</source>
.
<publisher-name>Commonwealth Mycological Institute</publisher-name>
,
<publisher-loc>Kew, Surrey, UK</publisher-loc>
</mixed-citation>
</ref>
<ref id="R43">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Ellis</surname>
<given-names>MB</given-names>
</name>
<name>
<surname>Ellis</surname>
<given-names>JP</given-names>
</name>
</person-group>
(
<year>1997</year>
).
<source>Microfungi on Land Plants - An Identification Handbook</source>
.
<publisher-name>Richmond Publishing</publisher-name>
,
<publisher-loc>England</publisher-loc>
</mixed-citation>
</ref>
<ref id="R44">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eriksson</surname>
<given-names>OE</given-names>
</name>
</person-group>
(
<year>1967</year>
).
<article-title>On graminicolous pyrenomycetes from Fennoscandia I, II, Ill. Phragmosporous and scolecosporous species</article-title>
.
<source>Arkiv för Botanik Series 2</source>
,
<volume>6</volume>
:
<fpage>381</fpage>
<lpage>440</lpage>
</mixed-citation>
</ref>
<ref id="R45">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Evans</surname>
<given-names>HC</given-names>
</name>
</person-group>
(
<year>1984</year>
).
<article-title>The genus
<italic>Mycosphaerella</italic>
and its anamorphs
<italic>Cercoseptoria, Dothistroma</italic>
and
<italic>Lecanosticta</italic>
on pines</article-title>
.
<source>Mycological Papers</source>
<volume>153</volume>
:
<fpage>1</fpage>
<lpage>102</lpage>
</mixed-citation>
</ref>
<ref id="R46">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Eyal</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Sharen</surname>
<given-names>AL</given-names>
</name>
<name>
<surname>Prescott</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Ginkel</surname>
<given-names>M van</given-names>
</name>
</person-group>
(
<year>1987</year>
).
<source>The Septoria diseases of wheat: concepts and methods of disease management</source>
.
<publisher-loc>Mexico, DF, CIMMYT</publisher-loc>
</mixed-citation>
</ref>
<ref id="R47">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Farr</surname>
<given-names>DF</given-names>
</name>
</person-group>
(
<year>1991</year>
).
<article-title>
<italic>Septoria</italic>
species on cornus</article-title>
.
<source>Mycologia</source>
<volume>83</volume>
:
<fpage>611</fpage>
<lpage>623</lpage>
</mixed-citation>
</ref>
<ref id="R48">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Farr</surname>
<given-names>DF</given-names>
</name>
</person-group>
(
<year>1992</year>
).
<article-title>Species of
<italic>Septoria</italic>
on the
<italic>Fabaceae</italic>
, subfamily
<italic>Faboidae</italic>
, tribe
<italic>Genistae</italic>
</article-title>
.
<source>Sydowia</source>
<volume>44</volume>
:
<fpage>13</fpage>
<lpage>31</lpage>
</mixed-citation>
</ref>
<ref id="R49">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Farr</surname>
<given-names>DF</given-names>
</name>
<name>
<surname>Rossman</surname>
<given-names>AY</given-names>
</name>
</person-group>
(
<year>2013</year>
).
<source>Fungal Databases</source>
,
<publisher-name>Systematic Mycology and Microbiology Laboratory</publisher-name>
,
<publisher-loc>ARS, USDA</publisher-loc>
<comment>Retrieved May 3, 2013</comment>
, from
<uri xlink:type="simple" xlink:href="http://nt.ars-grin.gov/fungaldatabases/">http://nt.ars-grin.gov/fungaldatabases/</uri>
</mixed-citation>
</ref>
<ref id="R50">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feau</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Hamelin</surname>
<given-names>RC</given-names>
</name>
<name>
<surname>Bernier</surname>
<given-names>L</given-names>
</name>
</person-group>
(
<year>2006</year>
).
<article-title>Attributes and congruence of three molecular data sets: Inferring phylogenies among
<italic>Septoria</italic>
related species from woody perennial plants</article-title>
.
<source>Molecular Phylogenetics and Evolution</source>
<volume>40</volume>
:
<fpage>808</fpage>
<lpage>829</lpage>
<pub-id pub-id-type="pmid">16707264</pub-id>
</mixed-citation>
</ref>
<ref id="R51">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Ferreira</surname>
<given-names>FA</given-names>
</name>
</person-group>
(
<year>1989</year>
).
<source>Patologia Florestal. Principais Doenças Florestais No Brasil</source>
.
<publisher-name>Sociedade de Investigaçoes Florestais, Viçosa, MG</publisher-name>
,
<publisher-loc>Brasil</publisher-loc>
</mixed-citation>
</ref>
<ref id="R52">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Frank</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Oertel</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Hyde</surname>
<given-names>KD</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2010</year>
).
<article-title>
<italic>Microcyclospora</italic>
and
<italic>Microcyclosporella</italic>
: novel genera accommodating epiphytic fungi causing sooty blotch on apple</article-title>
.
<source>Persoonia</source>
<volume>24</volume>
:
<fpage>93</fpage>
<lpage>105</lpage>
<pub-id pub-id-type="pmid">20664763</pub-id>
</mixed-citation>
</ref>
<ref id="R53">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fukuhara</surname>
<given-names>M</given-names>
</name>
</person-group>
(
<year>2002</year>
).
<article-title>Three
<italic>Phaeosphaeria</italic>
species and
<italic>Paraphaeosphaeria michotii</italic>
isolated from
<italic>Phragmites</italic>
leaves in Osaka, Japan</article-title>
.
<source>Mycoscience</source>
<volume>43</volume>
:
<fpage>275</fpage>
<lpage>382</lpage>
</mixed-citation>
</ref>
<ref id="R54">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Golzar</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>C</given-names>
</name>
</person-group>
(
<year>2012</year>
).
<article-title>First report of
<italic>Phaeosphaeriopsis glaucopunctata</italic>
as the cause of leaf spot and nectrosis on
<italic>Ruscus aculeatus</italic>
in Australia</article-title>
.
<source>Australasian Plant Disease Notes</source>
<volume>7</volume>
:
<fpage>13</fpage>
<lpage>15</lpage>
</mixed-citation>
</ref>
<ref id="R55">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Goodwin</surname>
<given-names>SB</given-names>
</name>
</person-group>
(
<year>2004</year>
).
<article-title>Minimum phylogenetic coverage: An additional criterion to guide the selection of microbial pathogens for initial genomic sequencing efforts</article-title>
.
<source>Phytopathology</source>
<volume>94</volume>
:
<fpage>800</fpage>
<lpage>804</lpage>
<pub-id pub-id-type="pmid">18943098</pub-id>
</mixed-citation>
</ref>
<ref id="R56">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Greene</surname>
<given-names>HC</given-names>
</name>
</person-group>
(
<year>1961</year>
).
<article-title>Notes on Wisconsin parasitic fungi. XXVII</article-title>
.
<source>Wisconsin Academy of Sciences, Arts and Letters</source>
<volume>50</volume>
:
<fpage>141</fpage>
<lpage>161</lpage>
</mixed-citation>
</ref>
<ref id="R57">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Nakashima</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Nishikawa</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Shin</surname>
<given-names>H-D</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>J-H</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2013</year>
).
<article-title>Species concepts in
<italic>Cercospora</italic>
: spotting the weeds among the roses</article-title>
.
<source>Studies in Mycology</source>
<volume>75</volume>
:
<fpage>115</fpage>
<lpage>170</lpage>
</mixed-citation>
</ref>
<ref id="R58">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gruyter</surname>
<given-names>J de</given-names>
</name>
<name>
<surname>Woudenberg</surname>
<given-names>JHC</given-names>
</name>
<name>
<surname>Aveskamp</surname>
<given-names>MM</given-names>
</name>
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2010</year>
).
<article-title>Systematic reappraisal of species in
<italic>Phoma</italic>
section
<italic>Paraphoma, Pyrenochaeta</italic>
and
<italic>Pleurophoma</italic>
</article-title>
.
<source>Mycologia</source>
<volume>102</volume>
:
<fpage>1066</fpage>
<lpage>1081</lpage>
<pub-id pub-id-type="pmid">20943506</pub-id>
</mixed-citation>
</ref>
<ref id="R59">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gruyter</surname>
<given-names>J de</given-names>
</name>
<name>
<surname>Woudenberg</surname>
<given-names>JHC</given-names>
</name>
<name>
<surname>Aveskamp</surname>
<given-names>MM</given-names>
</name>
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2013</year>
).
<article-title>Redisposition of
<italic>Phoma</italic>
-like anamorphs in
<italic>Pleosporales</italic>
</article-title>
.
<source>Studies in Mycology</source>
<volume>75</volume>
:
<fpage>1</fpage>
<lpage>36</lpage>
</mixed-citation>
</ref>
<ref id="R60">
<mixed-citation publication-type="confproc">
<person-group person-group-type="author">
<name>
<surname>Hall</surname>
<given-names>TA</given-names>
</name>
</person-group>
(
<year>1999</year>
).
<article-title>BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT</article-title>
.
<source>Nucleic Acids Symposium Series</source>
<volume>41</volume>
:
<fpage>95</fpage>
<lpage>98</lpage>
</mixed-citation>
</ref>
<ref id="R61">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hawksworth</surname>
<given-names>DL</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Redhead</surname>
<given-names>SA</given-names>
</name>
<name>
<surname>Reynolds</surname>
<given-names>DR</given-names>
</name>
<name>
<surname>Samson</surname>
<given-names>RA</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2011</year>
).
<article-title>The Amsterdam Declaration on Fungal Nomenclature</article-title>
.
<source>IMA Fungus</source>
<volume>2</volume>
:
<fpage>105</fpage>
<lpage>112</lpage>
<pub-id pub-id-type="pmid">22679594</pub-id>
</mixed-citation>
</ref>
<ref id="R62">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huelsenbeck</surname>
<given-names>JP</given-names>
</name>
<name>
<surname>Ronquist</surname>
<given-names>F</given-names>
</name>
</person-group>
(
<year>2001</year>
).
<article-title>MRBAYES: Bayesian inference of phylogenetic trees</article-title>
.
<source>Bioinformatics</source>
<volume>17</volume>
:
<fpage>754</fpage>
<lpage>755</lpage>
<pub-id pub-id-type="pmid">11524383</pub-id>
</mixed-citation>
</ref>
<ref id="R63">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Inácio</surname>
<given-names>CA</given-names>
</name>
<name>
<surname>Dianese</surname>
<given-names>JC</given-names>
</name>
</person-group>
(
<year>1998</year>
).
<article-title>Some foliicolous fungi on
<italic>Tabebuia</italic>
species</article-title>
.
<source>Mycological Research</source>
<volume>102</volume>
:
<fpage>695</fpage>
<lpage>708</lpage>
</mixed-citation>
</ref>
<ref id="R64">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Jørstad</surname>
<given-names>I</given-names>
</name>
</person-group>
(
<year>1965</year>
).
<source>
<italic>Septoria</italic>
and septoroid fungi on dicotyleones in Norway</source>
.
<publisher-name>Oslo University Press</publisher-name>
,
<publisher-loc>Oslo</publisher-loc>
</mixed-citation>
</ref>
<ref id="R65">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Jørstad</surname>
<given-names>I</given-names>
</name>
</person-group>
(
<year>1967</year>
).
<source>
<italic>Septoria</italic>
and Septoroid fungi on
<italic>Gramineae</italic>
in Norway</source>
.
<publisher-name>Oslo University Press</publisher-name>
,
<publisher-loc>Oslo</publisher-loc>
</mixed-citation>
</ref>
<ref id="R66">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaneko</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Fujioka</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Zinno</surname>
<given-names>Y</given-names>
</name>
</person-group>
(
<year>1989</year>
).
<article-title>A new species of
<italic>Septoria</italic>
on Japanese black pine</article-title>
.
<source>Transactions of the Mycological Society of Japan</source>
<volume>30</volume>
:
<fpage>463</fpage>
<lpage>466</lpage>
</mixed-citation>
</ref>
<ref id="R67">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Katoh</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Misawa</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Kuma</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Miyata</surname>
<given-names>T</given-names>
</name>
</person-group>
(
<year>2002</year>
).
<article-title>MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform</article-title>
.
<source>Nucleic Acids Research</source>
<volume>30</volume>
:
<fpage>3059</fpage>
<lpage>3066</lpage>
<pub-id pub-id-type="pmid">12136088</pub-id>
</mixed-citation>
</ref>
<ref id="R68">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lamprecht</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Tewoldemedhin</surname>
<given-names>YT</given-names>
</name>
<name>
<surname>Marasas</surname>
<given-names>WFO</given-names>
</name>
</person-group>
(
<year>2011</year>
).
<article-title>
<italic>Diaporthaceae</italic>
associated with root rot of maize</article-title>
.
<source>IMA Fungus</source>
<volume>2</volume>
:
<fpage>13</fpage>
<lpage>24</lpage>
<pub-id pub-id-type="pmid">22679583</pub-id>
</mixed-citation>
</ref>
<ref id="R69">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Mel’nik</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>JE</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2004</year>
).
<article-title>Diversity of saprobic hyphomycetes on
<italic>Proteaceae</italic>
and
<italic>Restionaceae</italic>
from South Africa</article-title>
.
<source>Fungal Diversity</source>
<volume>17</volume>
:
<fpage>91</fpage>
<lpage>114</lpage>
</mixed-citation>
</ref>
<ref id="R70">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>HY</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>GY</given-names>
</name>
<name>
<surname>Zhai</surname>
<given-names>XR</given-names>
</name>
<name>
<surname>Batzer</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Mayfield</surname>
<given-names>DA</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2012</year>
).
<article-title>
<italic>Dissoconiaceae</italic>
associated with sooty blotch and flyspeck on fruits in China and the United States</article-title>
.
<source>Persoonia</source>
<volume>28</volume>
:
<fpage>113</fpage>
<lpage>125</lpage>
<pub-id pub-id-type="pmid">23105157</pub-id>
</mixed-citation>
</ref>
<ref id="R71">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>JK</given-names>
</name>
<name>
<surname>Phookamsak</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Mingkhuan</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Wikee</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>YM</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2012</year>
)
<article-title>Towards a natural classification of
<italic>Botryosphaeriales</italic>
</article-title>
.
<source>Fungal Diversity</source>
<volume>57</volume>
:
<fpage>149</fpage>
<lpage>210</lpage>
</mixed-citation>
</ref>
<ref id="R72">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Whelen</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Hall</surname>
<given-names>B</given-names>
</name>
</person-group>
(
<year>1999</year>
).
<article-title>Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit</article-title>
.
<source>Molecular Biology and Evolution</source>
<volume>16</volume>
:
<fpage>1799</fpage>
<lpage>1808</lpage>
<pub-id pub-id-type="pmid">10605121</pub-id>
</mixed-citation>
</ref>
<ref id="R73">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lombard</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>BD</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
</person-group>
(
<year>2010</year>
).
<article-title>Species concepts in
<italic>Calonectria</italic>
(
<italic>Cylindrocladium</italic>
)</article-title>
.
<source>Studies in Mycology</source>
<volume>66</volume>
:
<fpage>1</fpage>
<lpage>13</lpage>
<pub-id pub-id-type="pmid">20806003</pub-id>
</mixed-citation>
</ref>
<ref id="R74">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Marincowitz</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
</person-group>
(
<year>2008</year>
).
<article-title>Microfungi occurring on
<italic>Proteaceae</italic>
in the fynbos</article-title>
.
<source>CBS Biodiversity Series</source>
<volume>7</volume>
<publisher-name>CBS-KNAW Fungal Biodiversity Centre</publisher-name>
,
<publisher-loc>Utrecht, The Netherlands</publisher-loc>
</mixed-citation>
</ref>
<ref id="R75">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mason-Gamer</surname>
<given-names>RJ</given-names>
</name>
<name>
<surname>Kellogg</surname>
<given-names>EA</given-names>
</name>
</person-group>
(
<year>1996</year>
).
<article-title>Testing for phylogenetic conflict among molecular data sets in the tribe
<italic>Triticeae</italic>
(
<italic>Gramineae</italic>
)</article-title>
.
<source>Systematic Biology</source>
<volume>45</volume>
:
<fpage>524</fpage>
<lpage>545</lpage>
</mixed-citation>
</ref>
<ref id="R76">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>McDonald</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Razavi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Friesen</surname>
<given-names>TL</given-names>
</name>
<name>
<surname>Brunner</surname>
<given-names>PC</given-names>
</name>
<name>
<surname>McDonald</surname>
<given-names>BA</given-names>
</name>
</person-group>
(
<year>2012</year>
).
<article-title>Phylogenetic and population genetic analyses of
<italic>Phaeosphaeria nodorum</italic>
and its close relatives indicate cryptic species and an origin in the Fertile Crescent</article-title>
.
<source>Fungal Genetics and Biology</source>
<volume>49</volume>
:
<fpage>882</fpage>
<lpage>895</lpage>
<pub-id pub-id-type="pmid">22922546</pub-id>
</mixed-citation>
</ref>
<ref id="R77">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Michaelides</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Morgan</surname>
<given-names>DP</given-names>
</name>
<name>
<surname>Doster</surname>
<given-names>MA</given-names>
</name>
</person-group>
(
<year>1995</year>
).
<article-title>Foliar and fruit fungal diseases</article-title>
. In:
<source>Pistachio Production</source>
(
<person-group person-group-type="editor">
<name>
<surname>Ferguson</surname>
<given-names>L</given-names>
</name>
</person-group>
, ed).
<publisher-name>Center for Fruit and Nut Crop Research and Information, Pomology Department, University of California</publisher-name>
,
<publisher-loc>Davis CA.</publisher-loc>
:
<fpage>148</fpage>
<lpage>159</lpage>
</mixed-citation>
</ref>
<ref id="R78">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Monod</surname>
<given-names>M</given-names>
</name>
</person-group>
(
<year>1983</year>
).
<article-title>Monographie taxonomique des gnomoniacées ascomycètes de l’ordre des
<italic>Diaporthales</italic>
</article-title>
.
<source>Sydowia</source>
<volume>9</volume>
:
<fpage>1</fpage>
<lpage>315</lpage>
</mixed-citation>
</ref>
<ref id="R79">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Nag Raj</surname>
<given-names>TR</given-names>
</name>
</person-group>
(
<year>1993</year>
).
<source>Coelomycetous anamorphs with appendage-bearing conidia</source>
.
<publisher-name>Mycologue Publications</publisher-name>
,
<publisher-loc>Waterloo, Ontario</publisher-loc>
</mixed-citation>
</ref>
<ref id="R80">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Niekerk</surname>
<given-names>JM van</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Fourie</surname>
<given-names>PH</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2004</year>
).
<article-title>Systematic reappraisal of
<italic>Coniella</italic>
and
<italic>Pilidiella</italic>
, with specific reference to species occurring on
<italic>Eucalyptus</italic>
and
<italic>Vitis</italic>
in South Africa</article-title>
.
<source>Mycological Research</source>
<volume>108</volume>
:
<fpage>283</fpage>
<lpage>303</lpage>
<pub-id pub-id-type="pmid">15185979</pub-id>
</mixed-citation>
</ref>
<ref id="R81">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nylander</surname>
<given-names>JAA</given-names>
</name>
</person-group>
(
<year>2004</year>
).
<article-title>MrModeltest v2. Program distributed by the author</article-title>
.
<source>Evolutionary Biology Centre Uppsala University</source>
<volume>2</volume>
:
<fpage>1</fpage>
<lpage>2</lpage>
</mixed-citation>
</ref>
<ref id="R82">
<mixed-citation publication-type="confproc">
<person-group person-group-type="author">
<name>
<surname>O’Donnell</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Kistler</surname>
<given-names>HC</given-names>
</name>
<name>
<surname>Cigelnik</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Ploetz</surname>
<given-names>RC</given-names>
</name>
</person-group>
(
<year>1998</year>
).
<article-title>Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies</article-title>
.
<source>Proceedings of the National Academy of Sciences of the United States of America</source>
<volume>95</volume>
:
<fpage>2044</fpage>
<lpage>2049</lpage>
<pub-id pub-id-type="pmid">9482835</pub-id>
</mixed-citation>
</ref>
<ref id="R83">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Petrak</surname>
<given-names>F</given-names>
</name>
</person-group>
(
<year>1957</year>
).
<article-title>Über die auf
<italic>Aconitum</italic>
vorkommenden Arten der gattung
<italic>Septoria</italic>
</article-title>
.
<source>Sydowia</source>
<volume>11</volume>
:
<fpage>375</fpage>
<lpage>379</lpage>
</mixed-citation>
</ref>
<ref id="R84">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Petrak</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Sydow</surname>
<given-names>H</given-names>
</name>
</person-group>
(
<year>1927</year>
).
<article-title>Die Gattungen der Pyrenomyzeten, Sphaeropsideen und Melanconieen. 1. Teil. Die phaeosporen Sphaeropsideen und die Gattung
<italic>Macrophoma</italic>
</article-title>
.
<source>Repertorium specierum novarum regni vegetabilis</source>
,
<comment>Beihefte Bd 42</comment>
</mixed-citation>
</ref>
<ref id="R85">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Phillips</surname>
<given-names>AJL</given-names>
</name>
<name>
<surname>Alves</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Pennycook</surname>
<given-names>SR</given-names>
</name>
<name>
<surname>Johnston</surname>
<given-names>PR</given-names>
</name>
<name>
<surname>Ramaley</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2008</year>
).
<article-title>Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the
<italic>Botryosphaeriaceae</italic>
</article-title>
.
<source>Persoonia</source>
<volume>21</volume>
:
<fpage>29</fpage>
<lpage>55</lpage>
<pub-id pub-id-type="pmid">20396576</pub-id>
</mixed-citation>
</ref>
<ref id="R86">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Priest</surname>
<given-names>MJ</given-names>
</name>
</person-group>
(
<year>2006</year>
).
<source>Fungi of Australia:
<italic>Septoria</italic>
</source>
.
<publisher-loc>ABRS, Canberra</publisher-loc>
:
<publisher-name>CSIRO publishing, Melbourne, Australia</publisher-name>
</mixed-citation>
</ref>
<ref id="R87">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Punithalingam</surname>
<given-names>E</given-names>
</name>
</person-group>
(
<year>1976</year>
).
<article-title>Septoria chrysanthemella</article-title>
.
<source>CMI Descriptions of Pathogenic Fungi and Bacteria</source>
<volume>669</volume>
<publisher-name>Commonwealth Mycological Institute</publisher-name>
,
<publisher-loc>Kew, UK</publisher-loc>
</mixed-citation>
</ref>
<ref id="R88">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Quaedvlieg</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>de Jesús Yáñez-Morales</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2012</year>
).
<article-title>DNA barcoding of
<italic>Mycosphaerella</italic>
species of quarantine importance to Europe</article-title>
.
<source>Persoonia</source>
<volume>29</volume>
:
<fpage>101</fpage>
<lpage>115</lpage>
<pub-id pub-id-type="pmid">23606768</pub-id>
</mixed-citation>
</ref>
<ref id="R89">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Quaedvlieg</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Kema</surname>
<given-names>GHJ</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Seifbarghi</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2011</year>
).
<article-title>
<italic>Zymoseptoria</italic>
gen. nov.: a new genus to accommodate
<italic>Septoria</italic>
-like species occurring on graminicolous hosts</article-title>
.
<source>Persoonia</source>
<volume>26</volume>
:
<fpage>57</fpage>
<lpage>69</lpage>
<pub-id pub-id-type="pmid">22025804</pub-id>
</mixed-citation>
</ref>
<ref id="R90">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Rayner</surname>
<given-names>RW</given-names>
</name>
</person-group>
(
<year>1970</year>
).
<source>A mycological colour chart</source>
.
<publisher-name>CMI and British Mycological Society</publisher-name>
<publisher-loc>Kew, UK</publisher-loc>
</mixed-citation>
</ref>
<ref id="R91">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rogers</surname>
<given-names>DP</given-names>
</name>
</person-group>
(
<year>1949</year>
).
<article-title>Nomina conservanda proposita and nomina confusa - Fungi: Nomina conservanda</article-title>
.
<source>Farlowia</source>
<volume>3</volume>
:
<fpage>425</fpage>
<lpage>493</lpage>
</mixed-citation>
</ref>
<ref id="R92">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Saccardo</surname>
<given-names>PA</given-names>
</name>
</person-group>
(
<year>1884</year>
).
<source>Sylloge Fungorum: Sylloge Sphaeropsidearum et Melanconiearum</source>
<volume>3</volume>
:
<fpage>542</fpage>
<publisher-loc>Padova, Italy</publisher-loc>
</mixed-citation>
</ref>
<ref id="R93">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Saccardo</surname>
<given-names>PA</given-names>
</name>
</person-group>
(
<year>1895</year>
).
<source>Sylloge Fungorum: Supplementum Universale, Pars III</source>
<volume>11</volume>
:
<fpage>542</fpage>
<publisher-loc>Padova, Italy</publisher-loc>
</mixed-citation>
</ref>
<ref id="R94">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Saccardo</surname>
<given-names>PA</given-names>
</name>
<name>
<surname>Saccardo</surname>
<given-names>D</given-names>
</name>
</person-group>
(
<year>1906</year>
).
<source>Sylloge Fungorum: Supplementum Universale, Pars VII</source>
<volume>18</volume>
:
<fpage>1</fpage>
<lpage>828</lpage>
<publisher-loc>Padova, Italy</publisher-loc>
</mixed-citation>
</ref>
<ref id="R95">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Saccardo</surname>
<given-names>PA</given-names>
</name>
<name>
<surname>Trotter</surname>
<given-names>A</given-names>
</name>
</person-group>
(
<year>1913</year>
).
<source>Sylloge Fungorum: Supplementum Universale, Pars IX</source>
<volume>22</volume>
:
<fpage>1</fpage>
<lpage>1612</lpage>
<publisher-loc>Padova, Italy</publisher-loc>
</mixed-citation>
</ref>
<ref id="R96">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shin</surname>
<given-names>HD</given-names>
</name>
</person-group>
(
<year>1995</year>
).
<article-title>New fungal diseases of economic resource plants in Korea (II)</article-title>
.
<source>Korean Journal of Plant Pathology</source>
<volume>11</volume>
:
<fpage>120</fpage>
<lpage>131</lpage>
</mixed-citation>
</ref>
<ref id="R97">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shin</surname>
<given-names>HD</given-names>
</name>
<name>
<surname>Sameva</surname>
<given-names>EF</given-names>
</name>
</person-group>
(
<year>2002</year>
).
<article-title>Taxonomic notes on the genus
<italic>Septoria</italic>
in Korea (II)</article-title>
.
<source>Mycotaxon</source>
<volume>83</volume>
:
<fpage>287</fpage>
<lpage>300</lpage>
</mixed-citation>
</ref>
<ref id="R98">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Shin</surname>
<given-names>HD</given-names>
</name>
<name>
<surname>Sameva</surname>
<given-names>EF</given-names>
</name>
</person-group>
(
<year>2004</year>
).
<source>
<italic>Septoria</italic>
in Korea</source>
.
<publisher-name>National Institute of Agricultural Science and Technology</publisher-name>
,
<publisher-loc>Republic of Korea</publisher-loc>
</mixed-citation>
</ref>
<ref id="R99">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shoemaker</surname>
<given-names>RA</given-names>
</name>
<name>
<surname>Babcock</surname>
<given-names>CE</given-names>
</name>
</person-group>
(
<year>1989</year>
).
<article-title>Phaeosphaeria</article-title>
.
<source>Canadian Journal of Botany</source>
<volume>67</volume>
:
<fpage>1500</fpage>
<lpage>1599</lpage>
</mixed-citation>
</ref>
<ref id="R100">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Sivanesan</surname>
<given-names>A</given-names>
</name>
</person-group>
(
<year>1984</year>
).
<source>The Bitunicate Ascomycetes and their anamorphs</source>
.
<publisher-name>J. Cramer</publisher-name>
,
<publisher-loc>Vaduz, Germany</publisher-loc>
</mixed-citation>
</ref>
<ref id="R101">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Solomon</surname>
<given-names>PS</given-names>
</name>
<name>
<surname>Lowe</surname>
<given-names>RGT</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>KC</given-names>
</name>
<name>
<surname>Waters</surname>
<given-names>ODC</given-names>
</name>
<name>
<surname>Oliver</surname>
<given-names>RP</given-names>
</name>
</person-group>
(
<year>2006</year>
).
<article-title>
<italic>Stagonospora nodorum</italic>
: cause of stagonospora nodorum blotch of wheat</article-title>
.
<source>Molecular Plant Pathology</source>
<volume>7</volume>
:
<fpage>147</fpage>
<lpage>156</lpage>
<pub-id pub-id-type="pmid">20507435</pub-id>
</mixed-citation>
</ref>
<ref id="R102">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stukenbrock</surname>
<given-names>EH</given-names>
</name>
<name>
<surname>Quaedvlieg</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Javan-Nikhah</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Zala</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>McDonald</surname>
<given-names>BA</given-names>
</name>
</person-group>
(
<year>2012</year>
).
<article-title>
<italic>Zymoseptoria ardabilia</italic>
and
<italic>Z. pseudotritici,</italic>
two progenitor species of the septoria tritici leaf blotch fungus
<italic>Z. tritici</italic>
(synonym:
<italic>Mycosphaerella graminicola</italic>
)</article-title>
.
<source>Mycologia</source>
<volume>104</volume>
:
<fpage>1397</fpage>
<lpage>1407</lpage>
<pub-id pub-id-type="pmid">22675045</pub-id>
</mixed-citation>
</ref>
<ref id="R103">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Summerell</surname>
<given-names>BA</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Carnegie</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Summerbell</surname>
<given-names>RC</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2006</year>
).
<article-title>
<italic>Eucalyptus</italic>
microfungi known from culture. 2.
<italic>Alysidiella, Fusculina</italic>
and
<italic>Phlogicylindrium</italic>
genera nova, with notes on some other poorly known taxa</article-title>
.
<source>Fungal Diversity</source>
<volume>23</volume>
:
<fpage>323</fpage>
<lpage>350</lpage>
</mixed-citation>
</ref>
<ref id="R104">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sutton</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Pollack</surname>
<given-names>F</given-names>
</name>
</person-group>
(
<year>1974</year>
).
<article-title>Microfungi on
<italic>Cercocarpus</italic>
</article-title>
.
<source>Mycopathologia</source>
<volume>52</volume>
:
<fpage>331</fpage>
<lpage>351</lpage>
</mixed-citation>
</ref>
<ref id="R105">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sutton</surname>
<given-names>BC</given-names>
</name>
<name>
<surname>Pascoe</surname>
<given-names>IG</given-names>
</name>
</person-group>
(
<year>1987</year>
).
<article-title>
<italic>Septoria</italic>
species on
<italic>Acacia</italic>
</article-title>
.
<source>Transactions of the British Mycological Society</source>
<volume>89</volume>
:
<fpage>521</fpage>
<lpage>532</lpage>
</mixed-citation>
</ref>
<ref id="R106">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sutton</surname>
<given-names>BC</given-names>
</name>
<name>
<surname>Pascoe</surname>
<given-names>IG</given-names>
</name>
</person-group>
(
<year>1989</year>
).
<article-title>Some
<italic>Septoria</italic>
species on native Australian plants</article-title>
.
<source>Studies in Mycology</source>
<volume>31</volume>
:
<fpage>177</fpage>
<lpage>186</lpage>
</mixed-citation>
</ref>
<ref id="R107">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sutton</surname>
<given-names>BC</given-names>
</name>
<name>
<surname>Swart</surname>
<given-names>HJ</given-names>
</name>
</person-group>
(
<year>1986</year>
).
<article-title>Australian leaf-inhabiting fungi XXIII.
<italic>Colletogloeum</italic>
species and similar fungi on
<italic>Acacia</italic>
</article-title>
.
<source>Transactions of the British Mycological Society</source>
<volume>87</volume>
:
<fpage>93</fpage>
<lpage>102</lpage>
</mixed-citation>
</ref>
<ref id="R108">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Sutton</surname>
<given-names>BC</given-names>
</name>
</person-group>
(
<year>1964</year>
).
<article-title>Coelomycetes III.
<italic>Annellolacinia</italic>
gen. nov.,
<italic>Aristastoma, Phaecytostroma, Seimatosporium</italic>
, etc.</article-title>
<source>Mycological Papers</source>
<volume>64</volume>
<publisher-name>Commonwealth Mycological Institute</publisher-name>
,
<publisher-loc>Kew, UK</publisher-loc>
</mixed-citation>
</ref>
<ref id="R109">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Sutton</surname>
<given-names>BC</given-names>
</name>
</person-group>
(
<year>1977</year>
).
<article-title>Coelomycetes VI. Nomenclature of generic names proposed for Coelomycetes</article-title>
.
<source>Mycological Papers</source>
<volume>141</volume>
<publisher-name>Commonwealth Mycological Institute</publisher-name>
,
<publisher-loc>Kew, UK</publisher-loc>
</mixed-citation>
</ref>
<ref id="R110">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Sutton</surname>
<given-names>BC</given-names>
</name>
</person-group>
(
<year>1980</year>
).
<source>The coelomycetes. Fungi imperfecti with pycnidia, acervuli and stromata</source>
.
<publisher-name>Commonwealth Mycological Institute</publisher-name>
,
<publisher-loc>Kew, UK</publisher-loc>
</mixed-citation>
</ref>
<ref id="R111">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Teterevnikova-Babayan</surname>
<given-names>DN</given-names>
</name>
</person-group>
(
<year>1987</year>
).
<source>Fungi of the genus
<italic>Septoria</italic>
in the U.S.S.R.</source>
<publisher-name>Akademiya Nauk Armyanskoi SSR</publisher-name>
,
<publisher-loc>Yerevan</publisher-loc>
</mixed-citation>
</ref>
<ref id="R112">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
</person-group>
(
<year>1999</year>
).
<article-title>A monograph of the genus
<italic>Pezicula</italic>
and its anamorphs</article-title>
.
<source>Studies in Mycology</source>
<volume>44</volume>
:
<fpage>1</fpage>
<lpage>180</lpage>
</mixed-citation>
</ref>
<ref id="R113">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Priest</surname>
<given-names>MJ</given-names>
</name>
</person-group>
(
<year>2000</year>
).
<article-title>
<italic>Septoria</italic>
and similar coelomycetous anamorphs of
<italic>Mycosphaerella</italic>
</article-title>
.
<source>Studies in Mycology</source>
<volume>45</volume>
:
<fpage>123</fpage>
<lpage>128</lpage>
</mixed-citation>
</ref>
<ref id="R114">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<name>
<surname>Braun</surname>
<given-names>U</given-names>
</name>
<name>
<surname>Aptroot</surname>
<given-names>A</given-names>
</name>
</person-group>
(
<year>2004a</year>
).
<article-title>
<italic>Mycosphaerella punctiformis</italic>
revisited: morphology, phylogeny, and epitypification of the type species of the genus
<italic>Mycosphaerella</italic>
(
<italic>Dothideales, Ascomycota</italic>
)</article-title>
.
<source>Mycological Research</source>
<volume>108</volume>
:
<fpage>1271</fpage>
<lpage>1282</lpage>
<pub-id pub-id-type="pmid">15587478</pub-id>
</mixed-citation>
</ref>
<ref id="R115">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Silva da</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Wicklow</surname>
<given-names>DT</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2004b</year>
).
<article-title>
<italic>Paraconiothyrium</italic>
, a new genus to accommodate the mycoparasite
<italic>Coniothyrium minitans</italic>
, anamorphs of
<italic>Paraphaeosphaeria,</italic>
and four new species</article-title>
.
<source>Studies in Mycology</source>
<volume>50</volume>
:
<fpage>323</fpage>
<lpage>335</lpage>
</mixed-citation>
</ref>
<ref id="R116">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Starink-Willemse</surname>
<given-names>M</given-names>
</name>
<name>
<surname>van Iperen</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Abeln</surname>
<given-names>ECA</given-names>
</name>
</person-group>
(
<year>2004c</year>
).
<article-title>Phylogenetic analyses of
<italic>Septoria</italic>
species based on the ITS and LSU-D2 regions of nuclear ribosomal DNA</article-title>
.
<source>Mycologia</source>
<volume>96</volume>
:
<fpage>558</fpage>
<lpage>571</lpage>
<pub-id pub-id-type="pmid">21148878</pub-id>
</mixed-citation>
</ref>
<ref id="R117">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verkley</surname>
<given-names>GJM</given-names>
</name>
<name>
<surname>Quaedvlieg</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Shin</surname>
<given-names>HD</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
</person-group>
(
<year>2013</year>
).
<article-title>A new approach to species delimitation in
<italic>Septoria</italic>
</article-title>
.
<source>Studies in Mycology</source>
<volume>75</volume>
:
<fpage>213</fpage>
<lpage>305</lpage>
</mixed-citation>
</ref>
<ref id="R118">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vilgalys</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Hester</surname>
<given-names>M</given-names>
</name>
</person-group>
<year>1990</year>
<article-title>Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several
<italic>Cryptococcus</italic>
species</article-title>
.
<source>Journal of Bacteriology</source>
<volume>172</volume>
:
<fpage>4238</fpage>
<lpage>4246</lpage>
<pub-id pub-id-type="pmid">2376561</pub-id>
</mixed-citation>
</ref>
<ref id="R119">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wakefield</surname>
<given-names>EM</given-names>
</name>
</person-group>
(
<year>1940</year>
).
<article-title>Nomina generica conservanda</article-title>
.
<source>Transactions of the British Mycological Society</source>
<volume>24</volume>
:
<fpage>282</fpage>
<lpage>293</lpage>
</mixed-citation>
</ref>
<ref id="R120">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Walker</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Sutton</surname>
<given-names>BC</given-names>
</name>
<name>
<surname>Pascoe</surname>
<given-names>IG</given-names>
</name>
</person-group>
(
<year>1992</year>
).
<article-title>
<italic>Phaeoseptoria eucalypti</italic>
and similar fungi on
<italic>Eucalyptus</italic>
, with description of
<italic>Kirramyces</italic>
gen. nov. (Coelomycetes)</article-title>
.
<source>Mycological Research</source>
<volume>96</volume>
:
<fpage>911</fpage>
<lpage>924</lpage>
</mixed-citation>
</ref>
<ref id="R121">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>White</surname>
<given-names>TJ</given-names>
</name>
<name>
<surname>Bruns</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>J</given-names>
</name>
</person-group>
(
<year>1990</year>
).
<article-title>Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics</article-title>
.
<italic>In:</italic>
<source>PCR Protocols: a guide to methods and applications</source>
(
<person-group person-group-type="editor">
<name>
<surname>Innis</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Gelfand</surname>
<given-names>DH</given-names>
</name>
<name>
<surname>Sninsky</surname>
<given-names>JJ</given-names>
</name>
<name>
<surname>White</surname>
<given-names>TJ</given-names>
</name>
</person-group>
, eds).
<publisher-name>Academic Press</publisher-name>
,
<publisher-loc>San Diego, California</publisher-loc>
:
<fpage>315</fpage>
<lpage>322</lpage>
</mixed-citation>
</ref>
<ref id="R122">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wingfield</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>De Beer</surname>
<given-names>ZW</given-names>
</name>
<name>
<surname>Slippers</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Wingfield</surname>
<given-names>BD</given-names>
</name>
<name>
<surname>Groenewald</surname>
<given-names>JZ</given-names>
</name>
<etal></etal>
</person-group>
(
<year>2012</year>
).
<article-title>One fungus, one name promotes progressive plant pathology</article-title>
.
<source>Molecular Plant Pathology</source>
<volume>13</volume>
:
<fpage>604</fpage>
<lpage>613</lpage>
<pub-id pub-id-type="pmid">22146077</pub-id>
</mixed-citation>
</ref>
<ref id="R123">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yoo</surname>
<given-names>J-J</given-names>
</name>
<name>
<surname>Eom</surname>
<given-names>A-H</given-names>
</name>
</person-group>
(
<year>2012</year>
).
<article-title>Molecular identification of endophytic fungi isolated from needle leaves of conifers in Bohyeon Mountain, Korea</article-title>
.
<source>Mycobiology</source>
<volume>40</volume>
:
<fpage>231</fpage>
<lpage>235</lpage>
<pub-id pub-id-type="pmid">23323047</pub-id>
</mixed-citation>
</ref>
<ref id="R124">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Crous</surname>
<given-names>PW</given-names>
</name>
<name>
<surname>Schoch</surname>
<given-names>CL</given-names>
</name>
<name>
<surname>Hyde</surname>
<given-names>KD</given-names>
</name>
</person-group>
(
<year>2012</year>
).
<article-title>Pleosporales</article-title>
.
<source>Fungal Diversity</source>
<volume>53</volume>
:
<fpage>1</fpage>
<lpage>221</lpage>
<pub-id pub-id-type="pmid">23097638</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 0013040 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 0013040 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024