Links to Exploration step
Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en">The Draft Genome Sequence of European Pear (<italic>Pyrus communis</italic>
L. ‘Bartlett’)</title>
<author><name sortKey="Chagne, David" sort="Chagne, David" uniqKey="Chagne D" first="David" last="Chagné">David Chagné</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Crowhurst, Ross N" sort="Crowhurst, Ross N" uniqKey="Crowhurst R" first="Ross N." last="Crowhurst">Ross N. Crowhurst</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Pindo, Massimo" sort="Pindo, Massimo" uniqKey="Pindo M" first="Massimo" last="Pindo">Massimo Pindo</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Thrimawithana, Amali" sort="Thrimawithana, Amali" uniqKey="Thrimawithana A" first="Amali" last="Thrimawithana">Amali Thrimawithana</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Deng, Cecilia" sort="Deng, Cecilia" uniqKey="Deng C" first="Cecilia" last="Deng">Cecilia Deng</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ireland, Hilary" sort="Ireland, Hilary" uniqKey="Ireland H" first="Hilary" last="Ireland">Hilary Ireland</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fiers, Mark" sort="Fiers, Mark" uniqKey="Fiers M" first="Mark" last="Fiers">Mark Fiers</name>
<affiliation><nlm:aff id="aff4"><addr-line>Lincoln Research Centre, Plant & Food Research, Lincoln, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Dzierzon, Helge" sort="Dzierzon, Helge" uniqKey="Dzierzon H" first="Helge" last="Dzierzon">Helge Dzierzon</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cestaro, Alessandro" sort="Cestaro, Alessandro" uniqKey="Cestaro A" first="Alessandro" last="Cestaro">Alessandro Cestaro</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fontana, Paolo" sort="Fontana, Paolo" uniqKey="Fontana P" first="Paolo" last="Fontana">Paolo Fontana</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bianco, Luca" sort="Bianco, Luca" uniqKey="Bianco L" first="Luca" last="Bianco">Luca Bianco</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lu, Ashley" sort="Lu, Ashley" uniqKey="Lu A" first="Ashley" last="Lu">Ashley Lu</name>
<affiliation><nlm:aff id="aff4"><addr-line>Lincoln Research Centre, Plant & Food Research, Lincoln, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Storey, Roy" sort="Storey, Roy" uniqKey="Storey R" first="Roy" last="Storey">Roy Storey</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kn Bel, Mareike" sort="Kn Bel, Mareike" uniqKey="Kn Bel M" first="Mareike" last="Kn Bel">Mareike Kn Bel</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff5"><addr-line>School of Biological Sciences, University of Auckland, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Saeed, Munazza" sort="Saeed, Munazza" uniqKey="Saeed M" first="Munazza" last="Saeed">Munazza Saeed</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff6"><addr-line>Institute of Food, Nutrition and Human Health, Massey University, Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Montanari, Sara" sort="Montanari, Sara" uniqKey="Montanari S" first="Sara" last="Montanari">Sara Montanari</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff7"><addr-line>Institut de Recherche en Horticulture et Semences (IRHS), Institut National en Recherche Agronomique (INRA), Angers, France</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kim, Yoon Kyeong" sort="Kim, Yoon Kyeong" uniqKey="Kim Y" first="Yoon Kyeong" last="Kim">Yoon Kyeong Kim</name>
<affiliation><nlm:aff id="aff8"><addr-line>National Institute of Horticultural and Herbal Science (NIHHS), Rural Development Administration (RDA), Naju, Republic of Korea</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nicolini, Daniela" sort="Nicolini, Daniela" uniqKey="Nicolini D" first="Daniela" last="Nicolini">Daniela Nicolini</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Larger, Simone" sort="Larger, Simone" uniqKey="Larger S" first="Simone" last="Larger">Simone Larger</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Stefani, Erika" sort="Stefani, Erika" uniqKey="Stefani E" first="Erika" last="Stefani">Erika Stefani</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Allan, Andrew C" sort="Allan, Andrew C" uniqKey="Allan A" first="Andrew C." last="Allan">Andrew C. Allan</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff5"><addr-line>School of Biological Sciences, University of Auckland, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bowen, Judith" sort="Bowen, Judith" uniqKey="Bowen J" first="Judith" last="Bowen">Judith Bowen</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Harvey, Isaac" sort="Harvey, Isaac" uniqKey="Harvey I" first="Isaac" last="Harvey">Isaac Harvey</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Johnston, Jason" sort="Johnston, Jason" uniqKey="Johnston J" first="Jason" last="Johnston">Jason Johnston</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Malnoy, Mickael" sort="Malnoy, Mickael" uniqKey="Malnoy M" first="Mickael" last="Malnoy">Mickael Malnoy</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Troggio, Michela" sort="Troggio, Michela" uniqKey="Troggio M" first="Michela" last="Troggio">Michela Troggio</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Perchepied, Laure" sort="Perchepied, Laure" uniqKey="Perchepied L" first="Laure" last="Perchepied">Laure Perchepied</name>
<affiliation><nlm:aff id="aff7"><addr-line>Institut de Recherche en Horticulture et Semences (IRHS), Institut National en Recherche Agronomique (INRA), Angers, France</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Sawyer, Greg" sort="Sawyer, Greg" uniqKey="Sawyer G" first="Greg" last="Sawyer">Greg Sawyer</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wiedow, Claudia" sort="Wiedow, Claudia" uniqKey="Wiedow C" first="Claudia" last="Wiedow">Claudia Wiedow</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Won, Kyungho" sort="Won, Kyungho" uniqKey="Won K" first="Kyungho" last="Won">Kyungho Won</name>
<affiliation><nlm:aff id="aff8"><addr-line>National Institute of Horticultural and Herbal Science (NIHHS), Rural Development Administration (RDA), Naju, Republic of Korea</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Viola, Roberto" sort="Viola, Roberto" uniqKey="Viola R" first="Roberto" last="Viola">Roberto Viola</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Hellens, Roger P" sort="Hellens, Roger P" uniqKey="Hellens R" first="Roger P." last="Hellens">Roger P. Hellens</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Brewer, Lester" sort="Brewer, Lester" uniqKey="Brewer L" first="Lester" last="Brewer">Lester Brewer</name>
<affiliation><nlm:aff id="aff9"><addr-line>Motueka Research Centre, Plant & Food Research, Motueka, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bus, Vincent G M" sort="Bus, Vincent G M" uniqKey="Bus V" first="Vincent G. M." last="Bus">Vincent G. M. Bus</name>
<affiliation><nlm:aff id="aff10"><addr-line>Hawke's Bay Research Centre, Plant & Food Research, Havelock North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Schaffer, Robert J" sort="Schaffer, Robert J" uniqKey="Schaffer R" first="Robert J." last="Schaffer">Robert J. Schaffer</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff5"><addr-line>School of Biological Sciences, University of Auckland, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Gardiner, Susan E" sort="Gardiner, Susan E" uniqKey="Gardiner S" first="Susan E." last="Gardiner">Susan E. Gardiner</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Velasco, Riccardo" sort="Velasco, Riccardo" uniqKey="Velasco R" first="Riccardo" last="Velasco">Riccardo Velasco</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">24699266</idno>
<idno type="pmc">3974708</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3974708</idno>
<idno type="RBID">PMC:3974708</idno>
<idno type="doi">10.1371/journal.pone.0092644</idno>
<date when="2014">2014</date>
<idno type="wicri:Area/Pmc/Corpus">001195</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main">The Draft Genome Sequence of European Pear (<italic>Pyrus communis</italic>
L. ‘Bartlett’)</title>
<author><name sortKey="Chagne, David" sort="Chagne, David" uniqKey="Chagne D" first="David" last="Chagné">David Chagné</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Crowhurst, Ross N" sort="Crowhurst, Ross N" uniqKey="Crowhurst R" first="Ross N." last="Crowhurst">Ross N. Crowhurst</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Pindo, Massimo" sort="Pindo, Massimo" uniqKey="Pindo M" first="Massimo" last="Pindo">Massimo Pindo</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Thrimawithana, Amali" sort="Thrimawithana, Amali" uniqKey="Thrimawithana A" first="Amali" last="Thrimawithana">Amali Thrimawithana</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Deng, Cecilia" sort="Deng, Cecilia" uniqKey="Deng C" first="Cecilia" last="Deng">Cecilia Deng</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Ireland, Hilary" sort="Ireland, Hilary" uniqKey="Ireland H" first="Hilary" last="Ireland">Hilary Ireland</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fiers, Mark" sort="Fiers, Mark" uniqKey="Fiers M" first="Mark" last="Fiers">Mark Fiers</name>
<affiliation><nlm:aff id="aff4"><addr-line>Lincoln Research Centre, Plant & Food Research, Lincoln, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Dzierzon, Helge" sort="Dzierzon, Helge" uniqKey="Dzierzon H" first="Helge" last="Dzierzon">Helge Dzierzon</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Cestaro, Alessandro" sort="Cestaro, Alessandro" uniqKey="Cestaro A" first="Alessandro" last="Cestaro">Alessandro Cestaro</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Fontana, Paolo" sort="Fontana, Paolo" uniqKey="Fontana P" first="Paolo" last="Fontana">Paolo Fontana</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bianco, Luca" sort="Bianco, Luca" uniqKey="Bianco L" first="Luca" last="Bianco">Luca Bianco</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Lu, Ashley" sort="Lu, Ashley" uniqKey="Lu A" first="Ashley" last="Lu">Ashley Lu</name>
<affiliation><nlm:aff id="aff4"><addr-line>Lincoln Research Centre, Plant & Food Research, Lincoln, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Storey, Roy" sort="Storey, Roy" uniqKey="Storey R" first="Roy" last="Storey">Roy Storey</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kn Bel, Mareike" sort="Kn Bel, Mareike" uniqKey="Kn Bel M" first="Mareike" last="Kn Bel">Mareike Kn Bel</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff5"><addr-line>School of Biological Sciences, University of Auckland, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Saeed, Munazza" sort="Saeed, Munazza" uniqKey="Saeed M" first="Munazza" last="Saeed">Munazza Saeed</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff6"><addr-line>Institute of Food, Nutrition and Human Health, Massey University, Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Montanari, Sara" sort="Montanari, Sara" uniqKey="Montanari S" first="Sara" last="Montanari">Sara Montanari</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff7"><addr-line>Institut de Recherche en Horticulture et Semences (IRHS), Institut National en Recherche Agronomique (INRA), Angers, France</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Kim, Yoon Kyeong" sort="Kim, Yoon Kyeong" uniqKey="Kim Y" first="Yoon Kyeong" last="Kim">Yoon Kyeong Kim</name>
<affiliation><nlm:aff id="aff8"><addr-line>National Institute of Horticultural and Herbal Science (NIHHS), Rural Development Administration (RDA), Naju, Republic of Korea</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Nicolini, Daniela" sort="Nicolini, Daniela" uniqKey="Nicolini D" first="Daniela" last="Nicolini">Daniela Nicolini</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Larger, Simone" sort="Larger, Simone" uniqKey="Larger S" first="Simone" last="Larger">Simone Larger</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Stefani, Erika" sort="Stefani, Erika" uniqKey="Stefani E" first="Erika" last="Stefani">Erika Stefani</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Allan, Andrew C" sort="Allan, Andrew C" uniqKey="Allan A" first="Andrew C." last="Allan">Andrew C. Allan</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff5"><addr-line>School of Biological Sciences, University of Auckland, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bowen, Judith" sort="Bowen, Judith" uniqKey="Bowen J" first="Judith" last="Bowen">Judith Bowen</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Harvey, Isaac" sort="Harvey, Isaac" uniqKey="Harvey I" first="Isaac" last="Harvey">Isaac Harvey</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Johnston, Jason" sort="Johnston, Jason" uniqKey="Johnston J" first="Jason" last="Johnston">Jason Johnston</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Malnoy, Mickael" sort="Malnoy, Mickael" uniqKey="Malnoy M" first="Mickael" last="Malnoy">Mickael Malnoy</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Troggio, Michela" sort="Troggio, Michela" uniqKey="Troggio M" first="Michela" last="Troggio">Michela Troggio</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Perchepied, Laure" sort="Perchepied, Laure" uniqKey="Perchepied L" first="Laure" last="Perchepied">Laure Perchepied</name>
<affiliation><nlm:aff id="aff7"><addr-line>Institut de Recherche en Horticulture et Semences (IRHS), Institut National en Recherche Agronomique (INRA), Angers, France</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Sawyer, Greg" sort="Sawyer, Greg" uniqKey="Sawyer G" first="Greg" last="Sawyer">Greg Sawyer</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Wiedow, Claudia" sort="Wiedow, Claudia" uniqKey="Wiedow C" first="Claudia" last="Wiedow">Claudia Wiedow</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Won, Kyungho" sort="Won, Kyungho" uniqKey="Won K" first="Kyungho" last="Won">Kyungho Won</name>
<affiliation><nlm:aff id="aff8"><addr-line>National Institute of Horticultural and Herbal Science (NIHHS), Rural Development Administration (RDA), Naju, Republic of Korea</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Viola, Roberto" sort="Viola, Roberto" uniqKey="Viola R" first="Roberto" last="Viola">Roberto Viola</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Hellens, Roger P" sort="Hellens, Roger P" uniqKey="Hellens R" first="Roger P." last="Hellens">Roger P. Hellens</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Brewer, Lester" sort="Brewer, Lester" uniqKey="Brewer L" first="Lester" last="Brewer">Lester Brewer</name>
<affiliation><nlm:aff id="aff9"><addr-line>Motueka Research Centre, Plant & Food Research, Motueka, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Bus, Vincent G M" sort="Bus, Vincent G M" uniqKey="Bus V" first="Vincent G. M." last="Bus">Vincent G. M. Bus</name>
<affiliation><nlm:aff id="aff10"><addr-line>Hawke's Bay Research Centre, Plant & Food Research, Havelock North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Schaffer, Robert J" sort="Schaffer, Robert J" uniqKey="Schaffer R" first="Robert J." last="Schaffer">Robert J. Schaffer</name>
<affiliation><nlm:aff id="aff2"><addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
<affiliation><nlm:aff id="aff5"><addr-line>School of Biological Sciences, University of Auckland, Auckland, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Gardiner, Susan E" sort="Gardiner, Susan E" uniqKey="Gardiner S" first="Susan E." last="Gardiner">Susan E. Gardiner</name>
<affiliation><nlm:aff id="aff1"><addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</nlm:aff>
</affiliation>
</author>
<author><name sortKey="Velasco, Riccardo" sort="Velasco, Riccardo" uniqKey="Velasco R" first="Riccardo" last="Velasco">Riccardo Velasco</name>
<affiliation><nlm:aff id="aff3"><addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series><title level="j">PLoS ONE</title>
<idno type="eISSN">1932-6203</idno>
<imprint><date when="2014">2014</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><p>We present a draft assembly of the genome of European pear (<italic>Pyrus communis</italic>
) ‘Bartlett’. Our assembly was developed employing second generation sequencing technology (Roche 454), from single-end, 2 kb, and 7 kb insert paired-end reads using Newbler (version 2.7). It contains 142,083 scaffolds greater than 499 bases (maximum scaffold length of 1.2 Mb) and covers a total of 577.3 Mb, representing most of the expected 600 Mb <italic>Pyrus</italic>
genome. A total of 829,823 putative single nucleotide polymorphisms (SNPs) were detected using re-sequencing of ‘Louise Bonne de Jersey’ and ‘Old Home’. A total of 2,279 genetically mapped SNP markers anchor 171 Mb of the assembled genome. <italic>Ab initio</italic>
gene prediction combined with prediction based on homology searching detected 43,419 putative gene models. Of these, 1219 proteins (556 clusters) are unique to European pear compared to 12 other sequenced plant genomes. Analysis of the expansin gene family provided an example of the quality of the gene prediction and an insight into the relationships among one class of cell wall related genes that control fruit softening in both European pear and apple (<italic>Malus</italic>
×<italic>domestica</italic>
). The ‘Bartlett’ genome assembly v1.0 (<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0">http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0</ext-link>
) is an invaluable tool for identifying the genetic control of key horticultural traits in pear and will enable the wide application of marker-assisted and genomic selection that will enhance the speed and efficiency of pear cultivar development.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Potter, D" uniqKey="Potter D">D Potter</name>
</author>
<author><name sortKey="Eriksson, T" uniqKey="Eriksson T">T Eriksson</name>
</author>
<author><name sortKey="Evans, Rc" uniqKey="Evans R">RC Evans</name>
</author>
<author><name sortKey="Oh, S" uniqKey="Oh S">S Oh</name>
</author>
<author><name sortKey="Smedmark, Jee" uniqKey="Smedmark J">JEE Smedmark</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Argout, X" uniqKey="Argout X">X Argout</name>
</author>
<author><name sortKey="Salse, J" uniqKey="Salse J">J Salse</name>
</author>
<author><name sortKey="Aury, J M" uniqKey="Aury J">J-M Aury</name>
</author>
<author><name sortKey="Guiltinan, Mj" uniqKey="Guiltinan M">MJ Guiltinan</name>
</author>
<author><name sortKey="Droc, G" uniqKey="Droc G">G Droc</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Garcia Mas, J" uniqKey="Garcia Mas J">J Garcia-Mas</name>
</author>
<author><name sortKey="Benjak, A" uniqKey="Benjak A">A Benjak</name>
</author>
<author><name sortKey="Sanseverino, W" uniqKey="Sanseverino W">W Sanseverino</name>
</author>
<author><name sortKey="Bourgeois, M" uniqKey="Bourgeois M">M Bourgeois</name>
</author>
<author><name sortKey="Mir, G" uniqKey="Mir G">G Mir</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Huang, S" uniqKey="Huang S">S Huang</name>
</author>
<author><name sortKey="Li, R" uniqKey="Li R">R Li</name>
</author>
<author><name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author><name sortKey="Li, L" uniqKey="Li L">L Li</name>
</author>
<author><name sortKey="Gu, X" uniqKey="Gu X">X Gu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jaillon, O" uniqKey="Jaillon O">O Jaillon</name>
</author>
<author><name sortKey="Aury, J M" uniqKey="Aury J">J-M Aury</name>
</author>
<author><name sortKey="Noel, B" uniqKey="Noel B">B Noel</name>
</author>
<author><name sortKey="Policriti, A" uniqKey="Policriti A">A Policriti</name>
</author>
<author><name sortKey="Clepet, C" uniqKey="Clepet C">C Clepet</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ming, R" uniqKey="Ming R">R Ming</name>
</author>
<author><name sortKey="Hou, S" uniqKey="Hou S">S Hou</name>
</author>
<author><name sortKey="Feng, Y" uniqKey="Feng Y">Y Feng</name>
</author>
<author><name sortKey="Yu, Q" uniqKey="Yu Q">Q Yu</name>
</author>
<author><name sortKey="Dionne Laporte, A" uniqKey="Dionne Laporte A">A Dionne-Laporte</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Paterson, Ah" uniqKey="Paterson A">AH Paterson</name>
</author>
<author><name sortKey="Bowers, Je" uniqKey="Bowers J">JE Bowers</name>
</author>
<author><name sortKey="Bruggmann, R" uniqKey="Bruggmann R">R Bruggmann</name>
</author>
<author><name sortKey="Dubchak, I" uniqKey="Dubchak I">I Dubchak</name>
</author>
<author><name sortKey="Grimwood, J" uniqKey="Grimwood J">J Grimwood</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Schmutz, J" uniqKey="Schmutz J">J Schmutz</name>
</author>
<author><name sortKey="Cannon, Sb" uniqKey="Cannon S">SB Cannon</name>
</author>
<author><name sortKey="Schlueter, J" uniqKey="Schlueter J">J Schlueter</name>
</author>
<author><name sortKey="Ma, J" uniqKey="Ma J">J Ma</name>
</author>
<author><name sortKey="Mitros, T" uniqKey="Mitros T">T Mitros</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tomato Genome, C" uniqKey="Tomato Genome C">C Tomato Genome</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tuskan, Ga" uniqKey="Tuskan G">GA Tuskan</name>
</author>
<author><name sortKey="Difazio, S" uniqKey="Difazio S">S DiFazio</name>
</author>
<author><name sortKey="Jansson, S" uniqKey="Jansson S">S Jansson</name>
</author>
<author><name sortKey="Bohlmann, J" uniqKey="Bohlmann J">J Bohlmann</name>
</author>
<author><name sortKey="Grigoriev, I" uniqKey="Grigoriev I">I Grigoriev</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Van Bakel, H" uniqKey="Van Bakel H">H van Bakel</name>
</author>
<author><name sortKey="Stout, Jm" uniqKey="Stout J">JM Stout</name>
</author>
<author><name sortKey="Cote, Ag" uniqKey="Cote A">AG Cote</name>
</author>
<author><name sortKey="Tallon, Cm" uniqKey="Tallon C">CM Tallon</name>
</author>
<author><name sortKey="Sharpe, Ag" uniqKey="Sharpe A">AG Sharpe</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Velasco, R" uniqKey="Velasco R">R Velasco</name>
</author>
<author><name sortKey="Zharkikh, A" uniqKey="Zharkikh A">A Zharkikh</name>
</author>
<author><name sortKey="Troggio, M" uniqKey="Troggio M">M Troggio</name>
</author>
<author><name sortKey="Cartwright, Da" uniqKey="Cartwright D">DA Cartwright</name>
</author>
<author><name sortKey="Cestaro, A" uniqKey="Cestaro A">A Cestaro</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xu, X" uniqKey="Xu X">X Xu</name>
</author>
<author><name sortKey="Pan, S" uniqKey="Pan S">S Pan</name>
</author>
<author><name sortKey="Cheng, S" uniqKey="Cheng S">S Cheng</name>
</author>
<author><name sortKey="Zhang, B" uniqKey="Zhang B">B Zhang</name>
</author>
<author><name sortKey="Mu, D" uniqKey="Mu D">D Mu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Guo, S" uniqKey="Guo S">S Guo</name>
</author>
<author><name sortKey="Zhang, J" uniqKey="Zhang J">J Zhang</name>
</author>
<author><name sortKey="Sun, H" uniqKey="Sun H">H Sun</name>
</author>
<author><name sortKey="Salse, J" uniqKey="Salse J">J Salse</name>
</author>
<author><name sortKey="Lucas, Wj" uniqKey="Lucas W">WJ Lucas</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Xu, Q" uniqKey="Xu Q">Q Xu</name>
</author>
<author><name sortKey="Chen, L L" uniqKey="Chen L">L-L Chen</name>
</author>
<author><name sortKey="Ruan, X" uniqKey="Ruan X">X Ruan</name>
</author>
<author><name sortKey="Chen, D" uniqKey="Chen D">D Chen</name>
</author>
<author><name sortKey="Zhu, A" uniqKey="Zhu A">A Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Shulaev, V" uniqKey="Shulaev V">V Shulaev</name>
</author>
<author><name sortKey="Sargent, Dj" uniqKey="Sargent D">DJ Sargent</name>
</author>
<author><name sortKey="Crowhurst, Rn" uniqKey="Crowhurst R">RN Crowhurst</name>
</author>
<author><name sortKey="Mockler, Tc" uniqKey="Mockler T">TC Mockler</name>
</author>
<author><name sortKey="Folkerts, O" uniqKey="Folkerts O">O Folkerts</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Velasco, R" uniqKey="Velasco R">R Velasco</name>
</author>
<author><name sortKey="Zharkikh, A" uniqKey="Zharkikh A">A Zharkikh</name>
</author>
<author><name sortKey="Affourtit, J" uniqKey="Affourtit J">J Affourtit</name>
</author>
<author><name sortKey="Dhingra, A" uniqKey="Dhingra A">A Dhingra</name>
</author>
<author><name sortKey="Cestaro, A" uniqKey="Cestaro A">A Cestaro</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wu, J" uniqKey="Wu J">J Wu</name>
</author>
<author><name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author><name sortKey="Shi, Z" uniqKey="Shi Z">Z Shi</name>
</author>
<author><name sortKey="Zhang, S" uniqKey="Zhang S">S Zhang</name>
</author>
<author><name sortKey="Ming, R" uniqKey="Ming R">R Ming</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Verde, I" uniqKey="Verde I">I Verde</name>
</author>
<author><name sortKey="Abbott, Ag" uniqKey="Abbott A">AG Abbott</name>
</author>
<author><name sortKey="Scalabrin, S" uniqKey="Scalabrin S">S Scalabrin</name>
</author>
<author><name sortKey="Jung, S" uniqKey="Jung S">S Jung</name>
</author>
<author><name sortKey="Shu, S" uniqKey="Shu S">S Shu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Celton, J M" uniqKey="Celton J">J-M Celton</name>
</author>
<author><name sortKey="Chagne, D" uniqKey="Chagne D">D Chagné</name>
</author>
<author><name sortKey="Tustin, Sd" uniqKey="Tustin S">SD Tustin</name>
</author>
<author><name sortKey="Terakami, S" uniqKey="Terakami S">S Terakami</name>
</author>
<author><name sortKey="Nishitani, C" uniqKey="Nishitani C">C Nishitani</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Terakami, S" uniqKey="Terakami S">S Terakami</name>
</author>
<author><name sortKey="Shoda, M" uniqKey="Shoda M">M Shoda</name>
</author>
<author><name sortKey="Adachi, Y" uniqKey="Adachi Y">Y Adachi</name>
</author>
<author><name sortKey="Gonai, T" uniqKey="Gonai T">T Gonai</name>
</author>
<author><name sortKey="Kasumi, M" uniqKey="Kasumi M">M Kasumi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yamamoto, T" uniqKey="Yamamoto T">T Yamamoto</name>
</author>
<author><name sortKey="Kimura, T" uniqKey="Kimura T">T Kimura</name>
</author>
<author><name sortKey="Sawamura, Y" uniqKey="Sawamura Y">Y Sawamura</name>
</author>
<author><name sortKey="Manabe, T" uniqKey="Manabe T">T Manabe</name>
</author>
<author><name sortKey="Kotobuki, K" uniqKey="Kotobuki K">K Kotobuki</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yamamoto, T" uniqKey="Yamamoto T">T Yamamoto</name>
</author>
<author><name sortKey="Kimura, T" uniqKey="Kimura T">T Kimura</name>
</author>
<author><name sortKey="Shoda, M" uniqKey="Shoda M">M Shoda</name>
</author>
<author><name sortKey="Imai, T" uniqKey="Imai T">T Imai</name>
</author>
<author><name sortKey="Saito, T" uniqKey="Saito T">T Saito</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Yamamoto, T" uniqKey="Yamamoto T">T Yamamoto</name>
</author>
<author><name sortKey="Kimura, T" uniqKey="Kimura T">T Kimura</name>
</author>
<author><name sortKey="Terakami, S" uniqKey="Terakami S">S Terakami</name>
</author>
<author><name sortKey="Nishitani, C" uniqKey="Nishitani C">C Nishitani</name>
</author>
<author><name sortKey="Sawamura, Y" uniqKey="Sawamura Y">Y Sawamura</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Illa, E" uniqKey="Illa E">E Illa</name>
</author>
<author><name sortKey="Sargent, Dj" uniqKey="Sargent D">DJ Sargent</name>
</author>
<author><name sortKey="Girona, El" uniqKey="Girona E">EL Girona</name>
</author>
<author><name sortKey="Bushakra, J" uniqKey="Bushakra J">J Bushakra</name>
</author>
<author><name sortKey="Cestaro, A" uniqKey="Cestaro A">A Cestaro</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jung, S" uniqKey="Jung S">S Jung</name>
</author>
<author><name sortKey="Cestaro, A" uniqKey="Cestaro A">A Cestaro</name>
</author>
<author><name sortKey="Troggio, M" uniqKey="Troggio M">M Troggio</name>
</author>
<author><name sortKey="Main, D" uniqKey="Main D">D Main</name>
</author>
<author><name sortKey="Zheng, P" uniqKey="Zheng P">P Zheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Schaffer, Rj" uniqKey="Schaffer R">RJ Schaffer</name>
</author>
<author><name sortKey="Friel, En" uniqKey="Friel E">EN Friel</name>
</author>
<author><name sortKey="Souleyre, Ejf" uniqKey="Souleyre E">EJF Souleyre</name>
</author>
<author><name sortKey="Bolitho, K" uniqKey="Bolitho K">K Bolitho</name>
</author>
<author><name sortKey="Thodey, K" uniqKey="Thodey K">K Thodey</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Langmead, B" uniqKey="Langmead B">B Langmead</name>
</author>
<author><name sortKey="Salzberg, Sl" uniqKey="Salzberg S">SL Salzberg</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tacken, E" uniqKey="Tacken E">E Tacken</name>
</author>
<author><name sortKey="Ireland, H" uniqKey="Ireland H">H Ireland</name>
</author>
<author><name sortKey="Gunaseelan, K" uniqKey="Gunaseelan K">K Gunaseelan</name>
</author>
<author><name sortKey="Karunairetnam, S" uniqKey="Karunairetnam S">S Karunairetnam</name>
</author>
<author><name sortKey="Wang, D" uniqKey="Wang D">D Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Parra, G" uniqKey="Parra G">G Parra</name>
</author>
<author><name sortKey="Bradnam, K" uniqKey="Bradnam K">K Bradnam</name>
</author>
<author><name sortKey="Korf, I" uniqKey="Korf I">I Korf</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Chagne, D" uniqKey="Chagne D">D Chagné</name>
</author>
<author><name sortKey="Crowhurst, Rn" uniqKey="Crowhurst R">RN Crowhurst</name>
</author>
<author><name sortKey="Troggio, M" uniqKey="Troggio M">M Troggio</name>
</author>
<author><name sortKey="Davey, Mw" uniqKey="Davey M">MW Davey</name>
</author>
<author><name sortKey="Gilmore, B" uniqKey="Gilmore B">B Gilmore</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Montanari, S" uniqKey="Montanari S">S Montanari</name>
</author>
<author><name sortKey="Saeed, M" uniqKey="Saeed M">M Saeed</name>
</author>
<author><name sortKey="Kn Bel, M" uniqKey="Kn Bel M">M Knäbel</name>
</author>
<author><name sortKey="Kim, Y" uniqKey="Kim Y">Y Kim</name>
</author>
<author><name sortKey="Troggio, M" uniqKey="Troggio M">M Troggio</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kumar, S" uniqKey="Kumar S">S Kumar</name>
</author>
<author><name sortKey="Chagne, D" uniqKey="Chagne D">D Chagné</name>
</author>
<author><name sortKey="Bink, Mcam" uniqKey="Bink M">MCAM Bink</name>
</author>
<author><name sortKey="Volz, Rk" uniqKey="Volz R">RK Volz</name>
</author>
<author><name sortKey="Whitworth, C" uniqKey="Whitworth C">C Whitworth</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kent, Wj" uniqKey="Kent W">WJ Kent</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Robertson, G" uniqKey="Robertson G">G Robertson</name>
</author>
<author><name sortKey="Schein, J" uniqKey="Schein J">J Schein</name>
</author>
<author><name sortKey="Chiu, R" uniqKey="Chiu R">R Chiu</name>
</author>
<author><name sortKey="Corbett, R" uniqKey="Corbett R">R Corbett</name>
</author>
<author><name sortKey="Field, M" uniqKey="Field M">M Field</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Altschul, Sf" uniqKey="Altschul S">SF Altschul</name>
</author>
<author><name sortKey="Madden, Tl" uniqKey="Madden T">TL Madden</name>
</author>
<author><name sortKey="Schaffer, Aa" uniqKey="Schaffer A">AA Schaffer</name>
</author>
<author><name sortKey="Zhang, Jh" uniqKey="Zhang J">JH Zhang</name>
</author>
<author><name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Birney, E" uniqKey="Birney E">E Birney</name>
</author>
<author><name sortKey="Clamp, M" uniqKey="Clamp M">M Clamp</name>
</author>
<author><name sortKey="Durbin, R" uniqKey="Durbin R">R Durbin</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct><analytic><author><name sortKey="Suzek, Be" uniqKey="Suzek B">BE Suzek</name>
</author>
<author><name sortKey="Huang, H" uniqKey="Huang H">H Huang</name>
</author>
<author><name sortKey="Mcgarvey, P" uniqKey="Mcgarvey P">P McGarvey</name>
</author>
<author><name sortKey="Mazumder, R" uniqKey="Mazumder R">R Mazumder</name>
</author>
<author><name sortKey="Wu, Ch" uniqKey="Wu C">CH Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Pruitt, Kd" uniqKey="Pruitt K">KD Pruitt</name>
</author>
<author><name sortKey="Tatusova, T" uniqKey="Tatusova T">T Tatusova</name>
</author>
<author><name sortKey="Brown, Gr" uniqKey="Brown G">GR Brown</name>
</author>
<author><name sortKey="Maglott, Dr" uniqKey="Maglott D">DR Maglott</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Mulder, N" uniqKey="Mulder N">N Mulder</name>
</author>
<author><name sortKey="Apweiler, R" uniqKey="Apweiler R">R Apweiler</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, L" uniqKey="Li L">L Li</name>
</author>
<author><name sortKey="Stoeckert, Cj" uniqKey="Stoeckert C">CJ Stoeckert</name>
</author>
<author><name sortKey="Roos, Ds" uniqKey="Roos D">DS Roos</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author><name sortKey="Darley, Cp" uniqKey="Darley C">CP Darley</name>
</author>
<author><name sortKey="Ongaro, V" uniqKey="Ongaro V">V Ongaro</name>
</author>
<author><name sortKey="Fleming, A" uniqKey="Fleming A">A Fleming</name>
</author>
<author><name sortKey="Schipper, O" uniqKey="Schipper O">O Schipper</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Price, Al" uniqKey="Price A">AL Price</name>
</author>
<author><name sortKey="Jones, Nc" uniqKey="Jones N">NC Jones</name>
</author>
<author><name sortKey="Pevzner, Pa" uniqKey="Pevzner P">PA Pevzner</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Abrusan, G" uniqKey="Abrusan G">G Abrusán</name>
</author>
<author><name sortKey="Grundmann, N" uniqKey="Grundmann N">N Grundmann</name>
</author>
<author><name sortKey="Demester, L" uniqKey="Demester L">L DeMester</name>
</author>
<author><name sortKey="Makalowski, W" uniqKey="Makalowski W">W Makalowski</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Li, Rq" uniqKey="Li R">RQ Li</name>
</author>
<author><name sortKey="Yu, C" uniqKey="Yu C">C Yu</name>
</author>
<author><name sortKey="Li, Yr" uniqKey="Li Y">YR Li</name>
</author>
<author><name sortKey="Lam, Tw" uniqKey="Lam T">TW Lam</name>
</author>
<author><name sortKey="Yiu, Sm" uniqKey="Yiu S">SM Yiu</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wang, J" uniqKey="Wang J">J Wang</name>
</author>
<author><name sortKey="Li, R" uniqKey="Li R">R Li</name>
</author>
<author><name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author><name sortKey="Fang, X" uniqKey="Fang X">X Fang</name>
</author>
<author><name sortKey="Feng, B" uniqKey="Feng B">B Feng</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Arumuganathan, K" uniqKey="Arumuganathan K">K Arumuganathan</name>
</author>
<author><name sortKey="Earle, E" uniqKey="Earle E">E Earle</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kende, H" uniqKey="Kende H">H Kende</name>
</author>
<author><name sortKey="Bradford, Kj" uniqKey="Bradford K">KJ Bradford</name>
</author>
<author><name sortKey="Brummell, Da" uniqKey="Brummell D">DA Brummell</name>
</author>
<author><name sortKey="Cho, Ht" uniqKey="Cho H">HT Cho</name>
</author>
<author><name sortKey="Cosgrove, Dj" uniqKey="Cosgrove D">DJ Cosgrove</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Schaffer, Rj" uniqKey="Schaffer R">RJ Schaffer</name>
</author>
<author><name sortKey="Ireland, Hs" uniqKey="Ireland H">HS Ireland</name>
</author>
<author><name sortKey="Ross, Jj" uniqKey="Ross J">JJ Ross</name>
</author>
<author><name sortKey="Ling, Tj" uniqKey="Ling T">TJ Ling</name>
</author>
<author><name sortKey="David, Km" uniqKey="David K">KM David</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Brummell, Da" uniqKey="Brummell D">DA Brummell</name>
</author>
<author><name sortKey="Harpster, Mh" uniqKey="Harpster M">MH Harpster</name>
</author>
<author><name sortKey="Civello, Pm" uniqKey="Civello P">PM Civello</name>
</author>
<author><name sortKey="Palys, Jm" uniqKey="Palys J">JM Palys</name>
</author>
<author><name sortKey="Bennett, Ab" uniqKey="Bennett A">AB Bennett</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hiwasa, K" uniqKey="Hiwasa K">K Hiwasa</name>
</author>
<author><name sortKey="Rose, Jkc" uniqKey="Rose J">JKC Rose</name>
</author>
<author><name sortKey="Nakano, R" uniqKey="Nakano R">R Nakano</name>
</author>
<author><name sortKey="Inaba, A" uniqKey="Inaba A">A Inaba</name>
</author>
<author><name sortKey="Kubo, Y" uniqKey="Kubo Y">Y Kubo</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wakasa, Y" uniqKey="Wakasa Y">Y Wakasa</name>
</author>
<author><name sortKey="Hatsuyama, Y" uniqKey="Hatsuyama Y">Y Hatsuyama</name>
</author>
<author><name sortKey="Takahashi, A" uniqKey="Takahashi A">A Takahashi</name>
</author>
<author><name sortKey="Sato, T" uniqKey="Sato T">T Sato</name>
</author>
<author><name sortKey="Niizeki, M" uniqKey="Niizeki M">M Niizeki</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fonseca, S" uniqKey="Fonseca S">S Fonseca</name>
</author>
<author><name sortKey="Monteiro, L" uniqKey="Monteiro L">L Monteiro</name>
</author>
<author><name sortKey="Barreiro, Mg" uniqKey="Barreiro M">MG Barreiro</name>
</author>
<author><name sortKey="Pais, Ms" uniqKey="Pais M">MS Pais</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Goulao, Lf" uniqKey="Goulao L">LF Goulao</name>
</author>
<author><name sortKey="Cosgrove, Dj" uniqKey="Cosgrove D">DJ Cosgrove</name>
</author>
<author><name sortKey="Oliveira, Cm" uniqKey="Oliveira C">CM Oliveira</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Trujillo, Di" uniqKey="Trujillo D">DI Trujillo</name>
</author>
<author><name sortKey="Mann, Hs" uniqKey="Mann H">HS Mann</name>
</author>
<author><name sortKey="Tong, Cbs" uniqKey="Tong C">CBS Tong</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Costa, F" uniqKey="Costa F">F Costa</name>
</author>
<author><name sortKey="Van De Weg, We" uniqKey="Van De Weg W">WE Van de Weg</name>
</author>
<author><name sortKey="Stella, S" uniqKey="Stella S">S Stella</name>
</author>
<author><name sortKey="Dondini, L" uniqKey="Dondini L">L Dondini</name>
</author>
<author><name sortKey="Pratesi, D" uniqKey="Pratesi D">D Pratesi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Verde, I" uniqKey="Verde I">I Verde</name>
</author>
<author><name sortKey="Bassil, N" uniqKey="Bassil N">N Bassil</name>
</author>
<author><name sortKey="Scalabrin, S" uniqKey="Scalabrin S">S Scalabrin</name>
</author>
<author><name sortKey="Gilmore, B" uniqKey="Gilmore B">B Gilmore</name>
</author>
<author><name sortKey="Lawley, Ct" uniqKey="Lawley C">CT Lawley</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Elshire, Rj" uniqKey="Elshire R">RJ Elshire</name>
</author>
<author><name sortKey="Glaubitz, Jc" uniqKey="Glaubitz J">JC Glaubitz</name>
</author>
<author><name sortKey="Sun, Q" uniqKey="Sun Q">Q Sun</name>
</author>
<author><name sortKey="Poland, Ja" uniqKey="Poland J">JA Poland</name>
</author>
<author><name sortKey="Kawamoto, K" uniqKey="Kawamoto K">K Kawamoto</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kumar, S" uniqKey="Kumar S">S Kumar</name>
</author>
<author><name sortKey="Bink, Mcam" uniqKey="Bink M">MCAM Bink</name>
</author>
<author><name sortKey="Volz, Rk" uniqKey="Volz R">RK Volz</name>
</author>
<author><name sortKey="Bus, Vgm" uniqKey="Bus V">VGM Bus</name>
</author>
<author><name sortKey="Chagne, D" uniqKey="Chagne D">D Chagné</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">PLoS One</journal-id>
<journal-id journal-id-type="iso-abbrev">PLoS ONE</journal-id>
<journal-id journal-id-type="publisher-id">plos</journal-id>
<journal-id journal-id-type="pmc">plosone</journal-id>
<journal-title-group><journal-title>PLoS ONE</journal-title>
</journal-title-group>
<issn pub-type="epub">1932-6203</issn>
<publisher><publisher-name>Public Library of Science</publisher-name>
<publisher-loc>San Francisco, USA</publisher-loc>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">24699266</article-id>
<article-id pub-id-type="pmc">3974708</article-id>
<article-id pub-id-type="publisher-id">PONE-D-13-16024</article-id>
<article-id pub-id-type="doi">10.1371/journal.pone.0092644</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Research Article</subject>
</subj-group>
<subj-group subj-group-type="Discipline-v2"><subject>Biology and Life Sciences</subject>
<subj-group><subject>Agriculture</subject>
<subj-group><subject>Agricultural Biotechnology</subject>
<subj-group><subject>Marker-Assisted Selection</subject>
</subj-group>
</subj-group>
<subj-group><subject>Crops</subject>
<subj-group><subject>Fruits</subject>
</subj-group>
</subj-group>
</subj-group>
<subj-group><subject>Computational Biology</subject>
<subj-group><subject>Genome Analysis</subject>
<subj-group><subject>Gene Prediction</subject>
<subject>Genomic Databases</subject>
</subj-group>
</subj-group>
<subj-group><subject>Comparative Genomics</subject>
<subject>Genome Evolution</subject>
</subj-group>
</subj-group>
<subj-group><subject>Evolutionary Biology</subject>
<subj-group><subject>Population Genetics</subject>
<subj-group><subject>Genetic Polymorphism</subject>
</subj-group>
</subj-group>
</subj-group>
<subj-group><subject>Genetics</subject>
<subj-group><subject>Genomics</subject>
</subj-group>
</subj-group>
<subj-group><subject>Molecular Biology</subject>
<subj-group><subject>Molecular Biology Techniques</subject>
<subj-group><subject>Sequencing Techniques</subject>
<subj-group><subject>Sequence Analysis</subject>
<subj-group><subject>Sequence Databases</subject>
</subj-group>
</subj-group>
<subj-group><subject>Genome Sequencing</subject>
</subj-group>
</subj-group>
</subj-group>
</subj-group>
</subj-group>
</article-categories>
<title-group><article-title>The Draft Genome Sequence of European Pear (<italic>Pyrus communis</italic>
L. ‘Bartlett’)</article-title>
<alt-title alt-title-type="running-head">A Draft Genome Sequence of European Pear</alt-title>
</title-group>
<contrib-group><contrib contrib-type="author" equal-contrib="yes"><name><surname>Chagné</surname>
<given-names>David</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
<xref ref-type="corresp" rid="cor1"><sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes"><name><surname>Crowhurst</surname>
<given-names>Ross N.</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Pindo</surname>
<given-names>Massimo</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Thrimawithana</surname>
<given-names>Amali</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Deng</surname>
<given-names>Cecilia</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Ireland</surname>
<given-names>Hilary</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Fiers</surname>
<given-names>Mark</given-names>
</name>
<xref ref-type="aff" rid="aff4"><sup>4</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Dzierzon</surname>
<given-names>Helge</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Cestaro</surname>
<given-names>Alessandro</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Fontana</surname>
<given-names>Paolo</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Bianco</surname>
<given-names>Luca</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Lu</surname>
<given-names>Ashley</given-names>
</name>
<xref ref-type="aff" rid="aff4"><sup>4</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Storey</surname>
<given-names>Roy</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Knäbel</surname>
<given-names>Mareike</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff5"><sup>5</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Saeed</surname>
<given-names>Munazza</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff6"><sup>6</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Montanari</surname>
<given-names>Sara</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff7"><sup>7</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Kim</surname>
<given-names>Yoon Kyeong</given-names>
</name>
<xref ref-type="aff" rid="aff8"><sup>8</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Nicolini</surname>
<given-names>Daniela</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Larger</surname>
<given-names>Simone</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Stefani</surname>
<given-names>Erika</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Allan</surname>
<given-names>Andrew C.</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff5"><sup>5</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Bowen</surname>
<given-names>Judith</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Harvey</surname>
<given-names>Isaac</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Johnston</surname>
<given-names>Jason</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Malnoy</surname>
<given-names>Mickael</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Troggio</surname>
<given-names>Michela</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Perchepied</surname>
<given-names>Laure</given-names>
</name>
<xref ref-type="aff" rid="aff7"><sup>7</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Sawyer</surname>
<given-names>Greg</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Wiedow</surname>
<given-names>Claudia</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Won</surname>
<given-names>Kyungho</given-names>
</name>
<xref ref-type="aff" rid="aff8"><sup>8</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Viola</surname>
<given-names>Roberto</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Hellens</surname>
<given-names>Roger P.</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Brewer</surname>
<given-names>Lester</given-names>
</name>
<xref ref-type="aff" rid="aff9"><sup>9</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Bus</surname>
<given-names>Vincent G. M.</given-names>
</name>
<xref ref-type="aff" rid="aff10"><sup>10</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Schaffer</surname>
<given-names>Robert J.</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff5"><sup>5</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Gardiner</surname>
<given-names>Susan E.</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Velasco</surname>
<given-names>Riccardo</given-names>
</name>
<xref ref-type="aff" rid="aff3"><sup>3</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label>
<addr-line>Palmerston North Research Centre, The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Palmerston North, New Zealand</addr-line>
</aff>
<aff id="aff2"><label>2</label>
<addr-line>Mount Albert Research Centre, Plant & Food Research, Auckland, New Zealand</addr-line>
</aff>
<aff id="aff3"><label>3</label>
<addr-line>Istituto Agrario San Michele all'Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach (FEM), San Michele all' Adige, Trento, Italy</addr-line>
</aff>
<aff id="aff4"><label>4</label>
<addr-line>Lincoln Research Centre, Plant & Food Research, Lincoln, New Zealand</addr-line>
</aff>
<aff id="aff5"><label>5</label>
<addr-line>School of Biological Sciences, University of Auckland, Auckland, New Zealand</addr-line>
</aff>
<aff id="aff6"><label>6</label>
<addr-line>Institute of Food, Nutrition and Human Health, Massey University, Palmerston North, New Zealand</addr-line>
</aff>
<aff id="aff7"><label>7</label>
<addr-line>Institut de Recherche en Horticulture et Semences (IRHS), Institut National en Recherche Agronomique (INRA), Angers, France</addr-line>
</aff>
<aff id="aff8"><label>8</label>
<addr-line>National Institute of Horticultural and Herbal Science (NIHHS), Rural Development Administration (RDA), Naju, Republic of Korea</addr-line>
</aff>
<aff id="aff9"><label>9</label>
<addr-line>Motueka Research Centre, Plant & Food Research, Motueka, New Zealand</addr-line>
</aff>
<aff id="aff10"><label>10</label>
<addr-line>Hawke's Bay Research Centre, Plant & Food Research, Havelock North, New Zealand</addr-line>
</aff>
<contrib-group><contrib contrib-type="editor"><name><surname>Tinker</surname>
<given-names>Nicholas A.</given-names>
</name>
<role>Editor</role>
<xref ref-type="aff" rid="edit1"></xref>
</contrib>
</contrib-group>
<aff id="edit1"><addr-line>Agriculture and Agri-Food Canada, Canada</addr-line>
</aff>
<author-notes><corresp id="cor1">* E-mail: <email>David.Chagne@plantandfood.co.nz</email>
</corresp>
<fn fn-type="conflict"><p><bold>Competing Interests: </bold>
DC received funding from The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research). There are no patents, products in development or marketed products to declare. DC, RNC, AT, CD, HI, MF, HD, AL, RS, MK, MS, SM, ACA, JB, IH, JJ, GS, CW, RPH, LB, VGMB, RJS and SEG are employed by Plant & Food Research, a New Zealand government-owned Crown-Research Institute. This does not alter the authors' adherence to all the PLoS ONE policies on sharing data and materials.</p>
</fn>
<fn fn-type="con"><p>Conceived and designed the experiments: DC RNC ACA RPH RJS SEG R. Velasco. Performed the experiments: DC MP HI IH JB DN SL ES. Analyzed the data: DC RNC AT CD HI IH MF HD AC PF L. Bianco AL RS MK MS SM YKK GS RJS. Contributed reagents/materials/analysis tools: ACA JB JJ MM MT LP CW KHW R. Viola RPH L. Brewer VGMB RJS SEG R. Velasco. Wrote the paper: DC RNC HI ACA RJS SEG.</p>
</fn>
</author-notes>
<pub-date pub-type="collection"><year>2014</year>
</pub-date>
<pub-date pub-type="epub"><day>3</day>
<month>4</month>
<year>2014</year>
</pub-date>
<volume>9</volume>
<issue>4</issue>
<elocation-id>e92644</elocation-id>
<history><date date-type="received"><day>21</day>
<month>4</month>
<year>2013</year>
</date>
<date date-type="accepted"><day>25</day>
<month>2</month>
<year>2014</year>
</date>
</history>
<permissions><copyright-year>2014</copyright-year>
<copyright-holder>Chagné et al</copyright-holder>
<license><license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>
, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
</license>
</permissions>
<abstract><p>We present a draft assembly of the genome of European pear (<italic>Pyrus communis</italic>
) ‘Bartlett’. Our assembly was developed employing second generation sequencing technology (Roche 454), from single-end, 2 kb, and 7 kb insert paired-end reads using Newbler (version 2.7). It contains 142,083 scaffolds greater than 499 bases (maximum scaffold length of 1.2 Mb) and covers a total of 577.3 Mb, representing most of the expected 600 Mb <italic>Pyrus</italic>
genome. A total of 829,823 putative single nucleotide polymorphisms (SNPs) were detected using re-sequencing of ‘Louise Bonne de Jersey’ and ‘Old Home’. A total of 2,279 genetically mapped SNP markers anchor 171 Mb of the assembled genome. <italic>Ab initio</italic>
gene prediction combined with prediction based on homology searching detected 43,419 putative gene models. Of these, 1219 proteins (556 clusters) are unique to European pear compared to 12 other sequenced plant genomes. Analysis of the expansin gene family provided an example of the quality of the gene prediction and an insight into the relationships among one class of cell wall related genes that control fruit softening in both European pear and apple (<italic>Malus</italic>
×<italic>domestica</italic>
). The ‘Bartlett’ genome assembly v1.0 (<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0">http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0</ext-link>
) is an invaluable tool for identifying the genetic control of key horticultural traits in pear and will enable the wide application of marker-assisted and genomic selection that will enhance the speed and efficiency of pear cultivar development.</p>
</abstract>
<funding-group><funding-statement>This project was supported by the research office of the Provincia autonoma di Trento, IASMA-FEM GMPF joint PhD school, a Plant & Food Research internal investment ‘Blue Skies’ project, New Zealand Ministry of Science and Innovation projects “Pipfruit: a juicy future” (Contract# CO6X0705), “Pipfruit Research Consortium 2” (Contract# 26015) and “HortGenomics” (Contract# CO6X0812), and NIHHS of RDA, Korea. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</funding-statement>
</funding-group>
<counts><page-count count="12"></page-count>
</counts>
</article-meta>
</front>
<body><sec id="s1"><title>Introduction</title>
<p>Pear (genus <italic>Pyrus</italic>
) is one of the oldest temperate tree fruit crops, having been grown since antiquity from both Europe to China. Homer described the pear in the ‘Odyssey’ as a “gift of the gods”. Pear production was approximately 23.9 MT worldwide in 2012 (<ext-link ext-link-type="uri" xlink:href="http://faostat3.fao.org/">http://faostat3.fao.org/</ext-link>
), with European pear (<italic>Pyrus communis</italic>
L.; 2<italic>n</italic>
= 34) making up about one third of total production. The genus <italic>Pyrus</italic>
is related to apple (<italic>Malus</italic>
) and quince (<italic>Cydonia</italic>
) within the tribe <italic>Pyreae</italic>
<xref rid="pone.0092644-Potter1" ref-type="bibr">[1]</xref>
, which all share the pome fruit structure. Pear has historically been less well researched than other members of the Rosaceae such as apple, peach and strawberry. Recently, whole-genome sequences have been developed for a range of economically important dicotyledonous plants, such as poplar, grape, papaya, cucumber, cocoa, potato, soybean, cannabis, melon and tomato <xref rid="pone.0092644-Argout1" ref-type="bibr">[2]</xref>
–<xref rid="pone.0092644-Xu2" ref-type="bibr">[15]</xref>
, including the rosaceous crops apple, strawberry, peach and Chinese pear (<italic>P. bretschneideri</italic>
) <xref rid="pone.0092644-Shulaev1" ref-type="bibr">[16]</xref>
–<xref rid="pone.0092644-Verde1" ref-type="bibr">[19]</xref>
. Low to medium density pear genetic maps enriched with apple microsatellite markers have enabled the alignment of genetic maps of European pear and apple and formulation of the hypothesis that apple and pear have collinear genomes <xref rid="pone.0092644-Celton1" ref-type="bibr">[20]</xref>
–<xref rid="pone.0092644-Yamamoto3" ref-type="bibr">[24]</xref>
. Although this hypothesis was based on few hundred orthologous markers only, the recent comparison of several sequenced rosaceous genomes indicates that even among the more distantly related genomes of apple, peach and strawberry <xref rid="pone.0092644-Illa1" ref-type="bibr">[25]</xref>
, <xref rid="pone.0092644-Jung1" ref-type="bibr">[26]</xref>
, synteny is conserved. It might be anticipated that the synteny between apple and pear should be higher than in these cases, as apple and pear are more closely related phylogenetically than apple is to peach and strawberry <xref rid="pone.0092644-Potter1" ref-type="bibr">[1]</xref>
. We have taken advantage of the current cost and effectiveness of genome sequencing technologies to develop the genome assembly of European pear, with the ultimate goal of developing an understanding of the traits that differentiate the more distantly related rosaceous crops, as well as those more closely related within the <italic>Pyreae</italic>
. European pear has several biological features that differentiate it from apple and Chinese pear, such as traits controlling melting fruit flesh versus crisp flesh, and species-specific susceptibility to pests and pathogens. We wish to compare the European pear genome with that of apple and Chinese pear, for the purpose of developing ultimately an understanding of the evolution of the core traits that differentiate apple and pear, as well as the control of the very different flesh types and flavours between European and Chinese pears.</p>
<p>We chose ‘Bartlett’ (also known as ‘William's Bon Chrétien’ or ‘William's pear’) for genome sequencing, not only because of its major role as a cultivar in Europe, but also because it is a founder of most <italic>P. communis</italic>
breeding programmes worldwide. The draft genome assembly of European pear was developed using Roche 454 sequencing technology and spans 577.3 Mb, containing 43,419 putative genes. We tested the integrity of the assembly by examining the expansin gene family, members of which are involved in fruit ripening of pome fruit, as an example of the type of insights into functional biology that can be achieved using this genome sequence.</p>
</sec>
<sec sec-type="methods" id="s2"><title>Methods</title>
<sec id="s2a"><title>Plant material and nucleic acid extraction</title>
<p>DNA was extracted from young leaves of <italic>P. communis</italic>
‘Bartlett’ grown at the Plant & Food Research (PFR) Motueka research orchard (New Zealand; 41°8′0″ South, 173°1′0″ East) and in Field 11.C of Maso Parti at Edmund Mach Foundation-Istituto Agrario di San Michele all'Adige (Italy; 46°12′ North, 11°8′ East) (no permission was required to collect these samples and they are not from endangered or protected species), using the QIAGEN DNeasy Plant Kit (QIAGEN GmbH, Hilden, Germany). DNA quality was assessed by agarose gel electrophoresis to ensure that DNA was not degraded. Expression analysis was undertaken on <italic>P. communis</italic>
‘Doyenne du Comice’ (‘Comice’) and <italic>P. pyrifolia</italic>
‘Nijisseiki’ pears grown at PFR, Motueka (New Zealand) harvested at standard commercial ripeness (‘Comice’: firmness <5.5 Kg.F, and partial starch clearance; ‘Nijisseiki’: total starch hydrolysis) and stored for 8 weeks at 0.5°C. Following cold storage, fruit were left at 20°C for 7 days, to allow the fruit to soften, before harvest into liquid N<sub>2</sub>
and storage prior to RNA extraction as described in <xref rid="pone.0092644-Schaffer1" ref-type="bibr">[27]</xref>
and cleaned with RNeasy cleanup columns (QIAGEN) following the manufacturer's instructions.</p>
</sec>
<sec id="s2b"><title>Libraries and 454 pyrosequencing</title>
<p>Two random shotgun ‘genomic’ libraries were generated via fragmentation of 500 ng each of pear genomic DNA employing the GS FLX+ <italic>Series</italic>
XL+ Rapid Library preparation kit, following the manufacturer's recommendations (Roche, Indianapolis, IN, USA). Three 2 kb and two 7 kb paired-end libraries were constructed from pear genomic DNA using the GS FLX+ <italic>Series</italic>
XLR70 Paired End Rapid Library preparation kit following the manufacturer's recommendations (Roche). Five and 15 µg of double-stranded genomic DNA was randomly fragmented via hydrodynamic shearing to an average size of 2,000 and 7,000 bp using the HydroShear apparatus (DigiLab, Marlborough, MA, USA). The libraries were quantified by quantitative PCR using the 454 Kapa Library Quantification Kit (Kapa Biosystems, Boston, MA, USA). Long sequencing reads from shotgun ‘genomic’ libraries and paired-end sequencing reads were produced by the GS FLX+ <italic>Series</italic>
, using the GS FLX Titanium Sequencing Kit XL+ (Roche), according to the manufacturer's recommendations.</p>
</sec>
<sec id="s2c"><title>mRNA-seq analysis</title>
<p>For each sample, ten micrograms of RNA was sequenced to a depth of ∼20M reads using Illumina Hi-Seq contracted through Macrogen (Seoul, Korea; <ext-link ext-link-type="uri" xlink:href="http://www.macrogen.com">www.macrogen.com</ext-link>
). Frequency counts were obtained using <italic>Bowtie2</italic>
<xref rid="pone.0092644-Langmead1" ref-type="bibr">[28]</xref>
to align reads to the predicted gene models detailed below. Reads Per Kilobase per Million (RPKM) mapped reads were extracted from the BAM files using the ‘DEseq’ library in Bioconductor (<ext-link ext-link-type="uri" xlink:href="http://www.bioconductor.org">www.bioconductor.org</ext-link>
) in the statistical software package ‘R’. Quantitative PCR (qPCR) was performed as described in <xref rid="pone.0092644-Tacken1" ref-type="bibr">[29]</xref>
, with <italic>Actin</italic>
as a control, using primers MdEXPA2F (<named-content content-type="gene">TTCCAAGACAGGGTGGCAAG</named-content>
) and MdEXPA2R (<named-content content-type="gene">TGCCCTCAAATGTTTGTCCG</named-content>
) for apple and PcEXP2F (<named-content content-type="gene">GGCAAGCCCTGTCAAGAAAT</named-content>
) and PcEXP2R (<named-content content-type="gene">GCCCTCAAATGTTTGTCCG</named-content>
) for pear.</p>
</sec>
<sec id="s2d"><title>Genome assembly</title>
<p>GS FLX+ reads were assembled with the Roche GS De Novo Assembler (version 2.7; <ext-link ext-link-type="uri" xlink:href="http://454.com/products/analysis-software/index.asp">http://454.com/products/analysis-software/index.asp</ext-link>
), using both the large and heterozygous genome modes and 8 CPUs. All other assembler configuration settings were left at their default settings. The completeness of the assembly was estimated by Core Eukaryotic Genes Mapping Approach (CEGMA) analysis (version 2.4.010312) <xref rid="pone.0092644-Parra1" ref-type="bibr">[30]</xref>
.</p>
</sec>
<sec id="s2e"><title>Genome anchoring</title>
<p>Four segregating populations of pear were genotyped using the apple and pear single nucleotide polymorphism (SNP) array <xref rid="pone.0092644-Chagn1" ref-type="bibr">[31]</xref>
, <xref rid="pone.0092644-Montanari1" ref-type="bibr">[32]</xref>
. The families consisted of one <italic>P. communis</italic>
intra-specific population and three inter-specific Asian×European pear populations: ‘Old Home’בLouise de Bonne Jersey’ (297 F1 individuals), NZSelection_pearT003בMoonglow’ (92 F1 individuals), NZSelection_pearT042×NZSelection_pearT081 (142 F1 individuals) and NZSelection_pearT052×NZSelection_pearT003 (91 F1 individuals) <xref rid="pone.0092644-Montanari1" ref-type="bibr">[32]</xref>
. The Asian parents (of complex Chinese and Japanese pear origin involving both <italic>P. bretschneideri</italic>
and <italic>P. pyrifolia</italic>
) and inter-specific hybrid populations were developed and maintained at PFR, Motueka. Three segregating populations of apple (PremA153×NZSelection_appleT031, ‘Fuji’×NZSelection_appleT051 and ‘Sciros’×NZSelection_appleT051) <xref rid="pone.0092644-Kumar1" ref-type="bibr">[33]</xref>
were used to construct the apple genetic maps. These were developed for each parent of the respective populations using Joinmap v3.0 (<ext-link ext-link-type="uri" xlink:href="http://www.kyazma.nl">www.kyazma.nl</ext-link>
). Markers were anchored to the ‘Bartlett’ genome assembly v1.0 (Bartlett v1.0) using BLAST-like alignment tool (BLAT) analysis <xref rid="pone.0092644-Kent1" ref-type="bibr">[34]</xref>
by searching for scaffolds with similarity to the flanking sequence of the pear and apple SNPs. <xref ref-type="supplementary-material" rid="pone.0092644.s001">Figure S1</xref>
outlines the strategy employed for genome anchoring.</p>
</sec>
<sec id="s2f"><title>Gene prediction and annotation</title>
<p><italic>De novo</italic>
assembly of ‘Comice’ transcripts was performed using trans-ABySS (v1.3.2) <xref rid="pone.0092644-Robertson1" ref-type="bibr">[35]</xref>
. Briefly, 58,026,953 Illumina HiSeq RNASeq reads were trimmed by 15 bases at their 5′ ends, filtered to remove reads containing ambiguities using an in-house PERL script. The RNASeq reads were subsequently trimmed to a minimum quality score of 20 using the program fastq-mcf from the ea-utils package (<ext-link ext-link-type="uri" xlink:href="http://code.google.com/p/ea-utils">http://code.google.com/p/ea-utils</ext-link>
). Transcript contigs resulting from <italic>de novo</italic>
assembly using every second kmer from 35 to 69 were then merged in to a single transcript set with the program abyss-rmdups-iterative from the trans-ABySS software distribution.</p>
<p>Gene prediction used a hybrid prediction approach, combining <italic>ab initio</italic>
gene prediction and homology searching. Specifically Augustus (Augustus 2.7) trained using the ‘Comice’ transcripts was employed for gene prediction <italic>ab initio</italic>
from European pear scaffolds. Augustus predictions were performed separately on unmasked and repeat masked scaffolds. RepeatMasker (version 4-0-3 <xref rid="pone.0092644-Smit1" ref-type="bibr">[36]</xref>
) was employed to mask known repeats in the genome scaffolds using the rosid clade of repeats from RepBase (Update 20120418, RM database version 20120418) and rmblastn version 2.2.27+ (<ext-link ext-link-type="ftp" xlink:href="ftp://ftp.ncbi.nlm.nih.gov/blast/executables/rmblast/2.2.27/">ftp://ftp.ncbi.nlm.nih.gov/blast/executables/rmblast/2.2.27/</ext-link>
). Homology searching was performed by comparison with predicted proteins from other Rosaceae. Predicted proteins were obtained for apple (<ext-link ext-link-type="uri" xlink:href="http://genomics.research.iasma.it/">http://genomics.research.iasma.it/</ext-link>
), Chinese pear (<ext-link ext-link-type="uri" xlink:href="http://peargenome.njau.edu.cn:8004/">http://peargenome.njau.edu.cn:8004/</ext-link>
), peach (<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/sites/default/files/peach_genome/Prunus_persica_v1.0_peptide.fa.gz">http://www.rosaceae.org/sites/default/files/peach_genome/Prunus_persica_v1.0_peptide.fa.gz</ext-link>
) and strawberry (<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/sites/www.rosaceae.org/files/strawberry/genome/v1.0/fvesca_v1.0_genemark_hybrid.faa.gz">http://www.rosaceae.org/sites/www.rosaceae.org/files/strawberry/genome/v1.0/fvesca_v1.0_genemark_hybrid.faa.gz</ext-link>
). These rosid protein sequences were compared to repeat-masked European Pear scaffolds using TBLASTN <xref rid="pone.0092644-Altschul1" ref-type="bibr">[37]</xref>
. Alignment results were filtered using a modified version of blast92gff3.pl (<ext-link ext-link-type="uri" xlink:href="http://iubio.bio.indiana.edu/gmod/tandy/perls/blast92gff3.pl">http://iubio.bio.indiana.edu/gmod/tandy/perls/blast92gff3.pl</ext-link>
), to identity sequences with greater than 79% identity and to mediate running GeneWise (wise-2.4.1; <xref rid="pone.0092644-Birney1" ref-type="bibr">[38]</xref>
) on the retrieved region, as well as 1000 bases upstream and downstream of the aligned regions. GeneWise predictions were assessed using evigene (<ext-link ext-link-type="uri" xlink:href="http://marmot.bio.indiana.edu/EvidentialGene/">http://marmot.bio.indiana.edu/EvidentialGene/</ext-link>
) and the best models (evigene's ‘okayset’) retained. Where a model from more than one approach was present at any locus, the model representing the cluster was selected on the basis of homology to proteins from Swissprot and rosid species, as well as prediction length. Models from predictions on the unmasked gene for which there was no supporting model from the GeneWise or masked genome predictions were excluded from the final gene model set. However, models from masked, unmasked and hybrid approach predictions were separately annotated using Plant & Food Research's in-house BioView Sequence Analysis and Annotation pipeline <xref rid="pone.0092644-Crowhurst1" ref-type="bibr">[39]</xref>
and results for each prediction set have been made available as a track in the genome browser (<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0">http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0</ext-link>
). BioView annotated the predicted gene models by searching the Swissprot, Uniref90 (<ext-link ext-link-type="uri" xlink:href="http://www.uniprot.org/downloads">http://www.uniprot.org/downloads</ext-link>
) <xref rid="pone.0092644-Suzek1" ref-type="bibr">[40]</xref>
, RefSeq (release 54) <xref rid="pone.0092644-Pruitt1" ref-type="bibr">[41]</xref>
, and <italic>Arabidopsis</italic>
proteins (TAIR 10) databases using BLASTX (version 2.2.25) <xref rid="pone.0092644-Altschul1" ref-type="bibr">[37]</xref>
. Searching against the NCBI non-redundant (NR) DNA database (<ext-link ext-link-type="ftp" xlink:href="ftp://ftp.ncbi.nlm.nih.gov/blast/db/">ftp://ftp.ncbi.nlm.nih.gov/blast/db/</ext-link>
) was performed using BLASTN (version 2.2.25) <xref rid="pone.0092644-Altschul1" ref-type="bibr">[37]</xref>
, while Gene Ontology terms were derived following motif searching based on InterproScan (version 4.8) <xref rid="pone.0092644-Mulder1" ref-type="bibr">[42]</xref>
and Interpro Release 38 (<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/interpro/">http://www.ebi.ac.uk/interpro/</ext-link>
). Comparison of metrics for European pear gene models to that for apple, Chinese pear and strawberry was performed as follows. Published GFF3 files describing gene models for apple and strawberry were obtained from the Genome Database for Rosaceae (GDR) (<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/">http://www.rosaceae.org/</ext-link>
) and those for Chinese pear from <ext-link ext-link-type="uri" xlink:href="http://peargenome.njau.edu.cn:8004">http://peargenome.njau.edu.cn:8004</ext-link>
. An in-house PERL script was used to parse the GFF3 files and extract metrics from each set. The extracted metrics will be influenced by the different gene model prediction methodologies used by the different authors and should be considered with this caveat in mind.</p>
</sec>
<sec id="s2g"><title>Comparative analysis of proteomes</title>
<p>The predicted European pear protein sequences were compared with those from apple v1.0 (<ext-link ext-link-type="uri" xlink:href="http://genomics.research.iasma.it/">http://genomics.research.iasma.it/</ext-link>
), Chinese pear v1.0 (<ext-link ext-link-type="uri" xlink:href="http://peargenome.njau.edu.cn:8004/">http://peargenome.njau.edu.cn:8004/</ext-link>
), strawberry v1.1 (<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/species/fragaria/fragaria_vesca/genome_v1.1">http://www.rosaceae.org/species/fragaria/fragaria_vesca/genome_v1.1</ext-link>
), grape v1.0 (<ext-link ext-link-type="uri" xlink:href="http://genomics.research.iasma.it/">http://genomics.research.iasma.it/</ext-link>
), kiwifruit (<ext-link ext-link-type="uri" xlink:href="http://bioinfo.bti.cornell.edu/cgi-bin/kiwi/download.cgi">http://bioinfo.bti.cornell.edu/cgi-bin/kiwi/download.cgi</ext-link>
), poplar v3.0 (<ext-link ext-link-type="ftp" xlink:href="ftp://ftp.jgi-psf.org/pub/JGI_data/phytozome/v8.0/early_release/Ptrichocarpa_v3.0/">ftp://ftp.jgi-psf.org/pub/JGI_data/phytozome/v8.0/early_release/Ptrichocarpa_v3.0/</ext-link>
), sweet orange v1.0 (<ext-link ext-link-type="uri" xlink:href="http://www.citrusgenomedb.org/">http://www.citrusgenomedb.org/</ext-link>
), mandarin v1.0 (<ext-link ext-link-type="uri" xlink:href="http://www.citrusgenomedb.org/">http://www.citrusgenomedb.org/</ext-link>
), papaya v1.0 (<ext-link ext-link-type="ftp" xlink:href="ftp://asgpb.hawaii.edu/papaya/">ftp://asgpb.hawaii.edu/papaya/</ext-link>
), tomato v1.0 (<ext-link ext-link-type="ftp" xlink:href="ftp://ftp.sgn.cornell.edu/genomes/Solanum_lycopersicum/assembly/current_build/">ftp://ftp.sgn.cornell.edu/genomes/Solanum_lycopersicum/assembly/current_build/</ext-link>
), potato v4.03 (<ext-link ext-link-type="uri" xlink:href="http://solanaceae.plantbiology.msu.edu/pgsc_download.shtml">http://solanaceae.plantbiology.msu.edu/pgsc_download.shtml</ext-link>
), and <italic>Arabidopsis</italic>
(TAIR 10; <ext-link ext-link-type="uri" xlink:href="http://www.arabidopsis.org/">http://www.arabidopsis.org/</ext-link>
), to identify ortholog gene clusters. These published datasets were developed using different genome annotation strategies, utilizing different tools. Although, each plant genome may hence contain biases of various types, we consider these data acceptable for application in our comparative study.</p>
<p>Protein sequences shorter than 10 amino acids and those containing more than 20% stop codons were excluded from the analysis. The remaining sequences were reciprocally blasted against each other using BLASTP with cut-off e value 1e-10. The similarity calculation, in-paralog and co-ortholog analyses were performed using Orthomcl-2.0.3 <xref rid="pone.0092644-Li1" ref-type="bibr">[43]</xref>
together with mcl-09-149 (<ext-link ext-link-type="uri" xlink:href="http://micans.org/mcl/">http://micans.org/mcl/</ext-link>
). A visualized summary of ortholog clusters between 13 plant species was generated with in-house PERL and R scripts.</p>
</sec>
<sec id="s2h"><title>Estimating phylogenetic relationships</title>
<p>Phylogenetic trees were constructed based on protein sequences of 83 “euKaryote Orthologous Genes” (KOGs). Multiple sequence alignments were performed using MUSCLE v3.8.31. Well-aligned regions were extracted with GBLOCKS 0.91b. The maximum-likelihood phylogenetic calculation was performed using PhyML with the Blosum62 amino acid substitution model and 100 rapid bootstrap partitions. The tree was visualized using Figtree 1.4.0.</p>
</sec>
<sec id="s2i"><title>Expansin gene family analysis</title>
<p>The expansin gene family was chosen for further analysis, to support the completeness of the gene predictions for European pear, as well as to examine the degree of similarity in the gene space between the apple and European pear genomes. Expansin protein sequences from apple and <italic>Arabidopsis</italic>
were used to perform a BLASTP search against the apple predicted peptide models, in order to identify putative expansins with a BLAST score >50. The corresponding expansin-like genes from apple were then used in a BLASTP search against the pear peptide models. Protein sequences were aligned in Geneious 6.1.6 (Biomatters Ltd, Auckland, NZ) using Geneious alignment with Blosum45 cost matrix. From this alignment, genes were further filtered by selecting those containing conserved expansin domains as classified by <xref rid="pone.0092644-Wang1" ref-type="bibr">[48]</xref>
with a conserved region of similarity corresponding to 313 residues and used to create a phylogenetic tree derived using the maximum likelihood Geneious plug-in, PhyML with the JTT substitution model and bootstrap analysis of 1000 data sets. <italic>DdEXP2</italic>
from the amoeba <italic>Dictyostelium discoideum</italic>
was used as an outgroup <xref rid="pone.0092644-Li2" ref-type="bibr">[44]</xref>
.</p>
</sec>
<sec id="s2j"><title><italic>De Novo</italic>
repeat annotation</title>
<p>The genomic scaffolds of the ‘Bartlett’ v1.0 and the primary assembly of ‘Golden Delicious’ were analysed using RepeatScout <xref rid="pone.0092644-Price1" ref-type="bibr">[45]</xref>
to provide <italic>de novo</italic>
a list of repetitive elements independent of repeats identified by repeat masking using RepeatMasker and RepBase. The list was further analysed for redundancy and classified into repeat classes using TEclass <xref rid="pone.0092644-Abrusn1" ref-type="bibr">[46]</xref>
.</p>
</sec>
<sec id="s2k"><title>SNP detection</title>
<p>The pipeline used for SNP discovery in European pear was similar to that described for apple <xref rid="pone.0092644-Chagn1" ref-type="bibr">[31]</xref>
. Genomic DNA was extracted from <italic>P. communis</italic>
cultivars ‘Louise Bonne de Jersey’ (LBJ) and ‘Old Home’ (OH) grown at PFR, Motueka (no permission was required to collect these samples and they are not from endangered or protected species) using the QIAGEN DNeasy Plant Kit (QIAGEN) and sequenced using one lane of Illumina® GA II with 75 cycles per read <xref rid="pone.0092644-Montanari1" ref-type="bibr">[32]</xref>
. Reads were aligned to Bartlett v1.0 scaffolds using Soap2.2.1 <xref rid="pone.0092644-Li3" ref-type="bibr">[47]</xref>
. SNPs were detected using SoapSNP (<ext-link ext-link-type="uri" xlink:href="http://soap.genomics.org.cn/soapsnp.html">http://soap.genomics.org.cn/soapsnp.html</ext-link>
) essentially as described in <xref rid="pone.0092644-Wang1" ref-type="bibr">[48]</xref>
. Genome partitioning of SNPs was based on the location of predicted gene models.</p>
</sec>
</sec>
<sec id="s3"><title>Results</title>
<sec id="s3a"><title>Genome sequencing and assembly of Bartlett v1.0</title>
<p>In total, 23,058,965 paired-end (43.7%) and non paired-end (56.3%) sequence reads yielded 8.2 Gigabases (Gb) of sequences (<xref ref-type="supplementary-material" rid="pone.0092644.s002">Table S1</xref>
) that were used to develop the <italic>P. communis</italic>
‘Bartlett’ genome assembly v1.0 (Bartlett v1.0) (<xref ref-type="table" rid="pone-0092644-t001">Table 1</xref>
). The estimated genome size based on flow cytometry <xref rid="pone.0092644-Arumuganathan1" ref-type="bibr">[49]</xref>
is approximately 600 Mb of haploid genome, and our data enable estimation of a 11.4× average coverage. The assembly gave 182,196 contigs of a cumulative length of 507.6 Mb. These contigs were assembled into scaffolds using a combination of Roche 454 2 kb and 7 kb insert library paired-end reads to obtain 142,083 Bartlett v1.0 scaffolds, covering a total of 577.3 Mb, and representing most of the haploid <italic>P. communis</italic>
genome. The longest scaffold was 1.2 Mb long and 50% of the assembled genome was contained in 1,442 scaffolds (L50), with the smallest L50 scaffold comprising 88,114 bp (N50). Only 12.1% of the scaffold sequences were unknown bases. The completeness of the draft genome assembly was tested by searching for 248 Core Eukaryotic Genes (CEGs; <xref rid="pone.0092644-Parra1" ref-type="bibr">[30]</xref>
). In total, 232 of 248 (93.5%) CEGs were completely present and 244 of 248 CEGs were completely or partially present (98.4%) (<xref ref-type="supplementary-material" rid="pone.0092644.s003">Table S2</xref>
).</p>
<table-wrap id="pone-0092644-t001" orientation="portrait" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0092644.t001</object-id>
<label>Table 1</label>
<caption><title>Basic statistics on the <italic>Pyrus communis</italic>
‘Bartlett’ genome sequence.</title>
</caption>
<alternatives><graphic id="pone-0092644-t001-1" xlink:href="pone.0092644.t001"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<tbody><tr><td align="left" rowspan="1" colspan="1"><bold>Sequencing data</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of bases used for assembly</td>
<td align="left" rowspan="1" colspan="1">8,204,442,728</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Sequenced reads used for assembly</td>
<td align="left" rowspan="1" colspan="1">23,058,965</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Non paired end</td>
<td align="left" rowspan="1" colspan="1">12,979,485</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Paired end</td>
<td align="left" rowspan="1" colspan="1">10,079,480</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Estimated average coverage<xref ref-type="table-fn" rid="nt102">*</xref>
</td>
<td align="left" rowspan="1" colspan="1">11.4×</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Contigs</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of contigs</td>
<td align="left" rowspan="1" colspan="1">182,196</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Total size of contigs (bp)</td>
<td align="left" rowspan="1" colspan="1">507,689,959</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">N50 contig length (bp)</td>
<td align="left" rowspan="1" colspan="1">6,569</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Longest contig (bp)</td>
<td align="left" rowspan="1" colspan="1">127,414</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Mean contig size (bp)</td>
<td align="left" rowspan="1" colspan="1">2,787</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Median contig size (bp)</td>
<td align="left" rowspan="1" colspan="1">1,188</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of contigs in scaffolds</td>
<td align="left" rowspan="1" colspan="1">47,404</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of contigs not in scaffolds</td>
<td align="left" rowspan="1" colspan="1">134,792</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Scaffolds</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of scaffolds</td>
<td align="left" rowspan="1" colspan="1">142,083</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Total size of scaffolds (bp)</td>
<td align="left" rowspan="1" colspan="1">577,335,413</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">N50 scaffold length (bp)</td>
<td align="left" rowspan="1" colspan="1">88,114</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Longest scaffold (bp)</td>
<td align="left" rowspan="1" colspan="1">1,291,680</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Shortest scaffold (bp)</td>
<td align="left" rowspan="1" colspan="1">501</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of scaffolds >1K bp</td>
<td align="left" rowspan="1" colspan="1">69,460</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of scaffolds >10K bp</td>
<td align="left" rowspan="1" colspan="1">4,916</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of scaffolds >100K bp</td>
<td align="left" rowspan="1" colspan="1">1,262</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of scaffolds >1M bp</td>
<td align="left" rowspan="1" colspan="1">4</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Number of scaffolds >10M bp</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Mean scaffold size (bp)</td>
<td align="left" rowspan="1" colspan="1">4,063</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Median scaffold size (bp)</td>
<td align="left" rowspan="1" colspan="1">983</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Scaffold %N</td>
<td align="left" rowspan="1" colspan="1">12.06%</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot><fn id="nt101"><label></label>
<p>Figures are given in bp.</p>
</fn>
<fn id="nt102"><label></label>
<p>*: the assumed genome size of pear is 600 Mb.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3b"><title>Genome anchoring to pear and apple genetic maps</title>
<p>The scaffolds of Bartlett v1.0 were anchored to high density genetic maps constructed for <italic>Pyrus</italic>
<xref rid="pone.0092644-Montanari1" ref-type="bibr">[32]</xref>
and <italic>Malus</italic>
segregating populations <xref rid="pone.0092644-Kumar1" ref-type="bibr">[33]</xref>
using SNP markers from the International RosBREED SNP Consortium (IRSC) apple and pear array <xref rid="pone.0092644-Chagn1" ref-type="bibr">[31]</xref>
, <xref rid="pone.0092644-Montanari1" ref-type="bibr">[32]</xref>
. The IRSC array contains 7,692 <italic>Malus</italic>
SNPs, as well as 1,096 SNPs developed from <italic>P. communis</italic>
. In total, 2,279 genetically mapped loci (1,391 and 888 apple and pear SNPs, respectively) yielded a significant BLAT hit to 868 unique scaffolds (<xref ref-type="table" rid="pone-0092644-t002">Table 2</xref>
), enabling the anchoring of a total of 171.3 Mb of the assembled genome to the 17 <italic>Pyreae</italic>
LGs (<xref ref-type="supplementary-material" rid="pone.0092644.s004">Table S3</xref>
). The largest LG was LG15 (17.6 Mb) and the median number of markers per scaffold was 2.0.</p>
<table-wrap id="pone-0092644-t002" orientation="portrait" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0092644.t002</object-id>
<label>Table 2</label>
<caption><title>Anchoring of the <italic>Pyrus communis</italic>
‘Bartlett’ assembly v1.0 genome sequence.</title>
</caption>
<alternatives><graphic id="pone-0092644-t002-2" xlink:href="pone.0092644.t002"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1">LG</td>
<td align="left" rowspan="1" colspan="1">Length anchored (bp)</td>
<td align="left" rowspan="1" colspan="1">Number of anchored scaffolds (unique)</td>
<td align="left" rowspan="1" colspan="1">Number of anchoring markers</td>
<td align="left" rowspan="1" colspan="1">Median number of markers per scaffold</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">8,550,412</td>
<td align="left" rowspan="1" colspan="1">46</td>
<td align="left" rowspan="1" colspan="1">115</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">11,234,491</td>
<td align="left" rowspan="1" colspan="1">58</td>
<td align="left" rowspan="1" colspan="1">194</td>
<td align="left" rowspan="1" colspan="1">3.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">12,642,036</td>
<td align="left" rowspan="1" colspan="1">69</td>
<td align="left" rowspan="1" colspan="1">163</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">4</td>
<td align="left" rowspan="1" colspan="1">8,044,179</td>
<td align="left" rowspan="1" colspan="1">40</td>
<td align="left" rowspan="1" colspan="1">105</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">10,949,710</td>
<td align="left" rowspan="1" colspan="1">57</td>
<td align="left" rowspan="1" colspan="1">159</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">6</td>
<td align="left" rowspan="1" colspan="1">8,104,341</td>
<td align="left" rowspan="1" colspan="1">45</td>
<td align="left" rowspan="1" colspan="1">117</td>
<td align="left" rowspan="1" colspan="1">1.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">7</td>
<td align="left" rowspan="1" colspan="1">8,833,777</td>
<td align="left" rowspan="1" colspan="1">53</td>
<td align="left" rowspan="1" colspan="1">102</td>
<td align="left" rowspan="1" colspan="1">1.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">8</td>
<td align="left" rowspan="1" colspan="1">8,189,737</td>
<td align="left" rowspan="1" colspan="1">36</td>
<td align="left" rowspan="1" colspan="1">92</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">9</td>
<td align="left" rowspan="1" colspan="1">10,984,512</td>
<td align="left" rowspan="1" colspan="1">53</td>
<td align="left" rowspan="1" colspan="1">145</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">10</td>
<td align="left" rowspan="1" colspan="1">9,331,439</td>
<td align="left" rowspan="1" colspan="1">54</td>
<td align="left" rowspan="1" colspan="1">113</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">11</td>
<td align="left" rowspan="1" colspan="1">10,224,161</td>
<td align="left" rowspan="1" colspan="1">53</td>
<td align="left" rowspan="1" colspan="1">134</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">12</td>
<td align="left" rowspan="1" colspan="1">8,857,939</td>
<td align="left" rowspan="1" colspan="1">44</td>
<td align="left" rowspan="1" colspan="1">122</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">13</td>
<td align="left" rowspan="1" colspan="1">10,282,711</td>
<td align="left" rowspan="1" colspan="1">38</td>
<td align="left" rowspan="1" colspan="1">127</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">14</td>
<td align="left" rowspan="1" colspan="1">10,094,382</td>
<td align="left" rowspan="1" colspan="1">51</td>
<td align="left" rowspan="1" colspan="1">117</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">15</td>
<td align="left" rowspan="1" colspan="1">17,650,274</td>
<td align="left" rowspan="1" colspan="1">75</td>
<td align="left" rowspan="1" colspan="1">222</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">16</td>
<td align="left" rowspan="1" colspan="1">8,177,493</td>
<td align="left" rowspan="1" colspan="1">44</td>
<td align="left" rowspan="1" colspan="1">124</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">17</td>
<td align="left" rowspan="1" colspan="1">9,204,799</td>
<td align="left" rowspan="1" colspan="1">52</td>
<td align="left" rowspan="1" colspan="1">128</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Total</td>
<td align="left" rowspan="1" colspan="1">171,356,393</td>
<td align="left" rowspan="1" colspan="1">868</td>
<td align="left" rowspan="1" colspan="1">2,279</td>
<td align="left" rowspan="1" colspan="1">2.0</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
</sec>
<sec id="s3c"><title>Gene prediction</title>
<p>Gene prediction using a combined <italic>ab initio</italic>
prediction and homology searching approach yielded 43,419 putative gene models (<xref ref-type="table" rid="pone-0092644-t003">Table 3</xref>
). The number of predicted genes is higher than for most plant species and ∼30% greater than in the strawberry genome (34,809 gene models), as might be expected due to the <italic>Pyreae</italic>
whole genome duplication <xref rid="pone.0092644-Velasco2" ref-type="bibr">[17]</xref>
. The average predicted coding region length (1,209 bp) was similar to that in Chinese pear, strawberry and apple (<xref ref-type="table" rid="pone-0092644-t003">Table 3</xref>
), as was the average predicted exon length between the predicted protein sets from these four rosaceous species. These similarities are observed in spite of the different gene model prediction methodologies utilized, and which should be taken into account when considering these observations. The number of single exon genes was similar between European and Chinese pears as well as apple, at about twice that of strawberry. The gene density in European pear was estimated to be 7.5 genes per 100 kb which is similar to that for Chinese pear, apple (<xref ref-type="table" rid="pone-0092644-t003">Table 3</xref>
), poplar (9.4 <xref rid="pone.0092644-Tuskan1" ref-type="bibr">[10]</xref>
), grape (6.6 <xref rid="pone.0092644-Velasco1" ref-type="bibr">[12]</xref>
) and melon (7.3 <xref rid="pone.0092644-GarciaMas1" ref-type="bibr">[3]</xref>
), but not as dense as observed for strawberry (14.5 <xref rid="pone.0092644-Shulaev1" ref-type="bibr">[16]</xref>
), notwithstanding the methodological difference in gene prediction employed for each species.</p>
<table-wrap id="pone-0092644-t003" orientation="portrait" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0092644.t003</object-id>
<label>Table 3</label>
<caption><title>Gene prediction summary for <italic>Pyrus communis</italic>
and comparison with <italic>P. bretschneideri</italic>
, <italic>Fragaria vesca</italic>
and <italic>Malus</italic>
×<italic>domestica</italic>
.</title>
</caption>
<alternatives><graphic id="pone-0092644-t003-3" xlink:href="pone.0092644.t003"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"><italic>Pyrus communis</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>Pyrus bretschneideri</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>Fragaria vesca</italic>
</td>
<td align="left" rowspan="1" colspan="1"><italic>Malus</italic>
×<italic>domestica</italic>
</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1">Predicted genes</td>
<td align="left" rowspan="1" colspan="1">43,419</td>
<td align="left" rowspan="1" colspan="1">42,812</td>
<td align="left" rowspan="1" colspan="1">34,809</td>
<td align="left" rowspan="1" colspan="1">54,921</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Average gene length (including introns)(nt)</td>
<td align="left" rowspan="1" colspan="1">3,320</td>
<td align="left" rowspan="1" colspan="1">2,776</td>
<td align="left" rowspan="1" colspan="1">2,792</td>
<td align="left" rowspan="1" colspan="1">2,802</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Average CDS length (nt)</td>
<td align="left" rowspan="1" colspan="1">1,209</td>
<td align="left" rowspan="1" colspan="1">1,172</td>
<td align="left" rowspan="1" colspan="1">1,160</td>
<td align="left" rowspan="1" colspan="1">1,155</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Exons</td>
<td align="left" rowspan="1" colspan="1">221,804</td>
<td align="left" rowspan="1" colspan="1">202,169</td>
<td align="left" rowspan="1" colspan="1">174,376</td>
<td align="left" rowspan="1" colspan="1">273,226</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Average exon length</td>
<td align="left" rowspan="1" colspan="1">237</td>
<td align="left" rowspan="1" colspan="1">248</td>
<td align="left" rowspan="1" colspan="1">232</td>
<td align="left" rowspan="1" colspan="1">273</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Single exon genes</td>
<td align="left" rowspan="1" colspan="1">10,909</td>
<td align="left" rowspan="1" colspan="1">12,310</td>
<td align="left" rowspan="1" colspan="1">5,915</td>
<td align="left" rowspan="1" colspan="1">10,378</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Introns</td>
<td align="left" rowspan="1" colspan="1">178,385</td>
<td align="left" rowspan="1" colspan="1">159,357</td>
<td align="left" rowspan="1" colspan="1">139,567</td>
<td align="left" rowspan="1" colspan="1">218,353</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Introns per gene (multi-exon genes only)</td>
<td align="left" rowspan="1" colspan="1">5.49</td>
<td align="left" rowspan="1" colspan="1">5.22</td>
<td align="left" rowspan="1" colspan="1">4.83</td>
<td align="left" rowspan="1" colspan="1">4.90</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Average intron length</td>
<td align="left" rowspan="1" colspan="1">398</td>
<td align="left" rowspan="1" colspan="1">386</td>
<td align="left" rowspan="1" colspan="1">409</td>
<td align="left" rowspan="1" colspan="1">491</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Genes per 100 Kb</td>
<td align="left" rowspan="1" colspan="1">7.5</td>
<td align="left" rowspan="1" colspan="1">8.4</td>
<td align="left" rowspan="1" colspan="1">14.5</td>
<td align="left" rowspan="1" colspan="1">7.3</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot><fn id="nt103"><label></label>
<p>Gene predictions were performed using Augustus for European pear and GeneMark-ES for strawberry. The apple gene models were estimated as the total number of gene predictions minus an estimation of duplications generated by contig overlaps. The redundancy was filtered out using similarity among predictions and positional considerations.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>A phylogenetic tree constructed with 83 euKaryote Orthologous Genes (KOGs) in six rosids, four malvids, and three asteroids (<xref ref-type="fig" rid="pone-0092644-g001">Figure 1</xref>
) confirmed that European pear is a close relative of Chinese pear and apple and is more distantly related to strawberry.</p>
<fig id="pone-0092644-g001" orientation="portrait" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0092644.g001</object-id>
<label>Figure 1</label>
<caption><title>Phylogenetic tree of six rosids, four malvids, and three asterids constructed with 83 euKaryote Orthologous Genes (KOGs).</title>
<p>Bootstrap values are listed on each branch. Nodes represent speciation events and branch length represents the degree of evolutional changes over time. The unit for the scale bar at the bottom is nucleotide substitutions per site. The high bootstrap values strongly support that the species in Rosaceae cluster together to the exclusion of any other, and that the European pear and Chinese pear separation event happened after apple speciation.</p>
</caption>
<graphic xlink:href="pone.0092644.g001"></graphic>
</fig>
</sec>
<sec id="s3d"><title>Comparative analysis of proteomes</title>
<p>A total of 5,350 protein clusters was observed as conserved across all 13 species proteomes, with 14,348 predicted European pear proteins (33% of the 43,419 total predicted protein set; <xref ref-type="fig" rid="pone-0092644-g002">Figure 2</xref>
). Only 82 protein clusters were not found in European pear compared with all other 12 species, a value less than the number of protein clusters absent from Chinese pear (298), apple (236), strawberry (192), <italic>Arabidopsis</italic>
(246), potato (437), papaya (424), grape (502) and kiwifruit (558), however similar to that of sweet orange (85), clementine (34), tomato (53) and poplar (45) (<xref ref-type="supplementary-material" rid="pone.0092644.s005">Table S4</xref>
). The proteome analysis demonstrates close genome relatedness between Chinese pear, European pear and apple; tomato and potato; sweet orange and Clementine, respectively. More protein clusters were shared between European and Chinese pear (1,771), than those between Chinese pear and apple (764) and between European pear and apple (1,018). There are 1,433 groups of orthologous protein clusters present in all the three species of the <italic>Pyreae</italic>
. These share the highest number of unique ortholog groups in our analysis (5,552 in total), followed by <italic>Solanaceae</italic>
with 3,044 clusters of 6,293 genes in potato and 4,035 genes in tomato, respectively, and by citrus (2,941 sweet orange genes and 2,991 clementine genes in 2,414 clusters). Finally, 556 clusters were unique to European pear and these corresponded to 1,219 proteins (2.8% of the 43,419 total predicted protein set; <xref ref-type="supplementary-material" rid="pone.0092644.s006">Table S5</xref>
).</p>
<fig id="pone-0092644-g002" orientation="portrait" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0092644.g002</object-id>
<label>Figure 2</label>
<caption><title>Protein-protein comparison between European pear and 12 other species: Chinese pear, apple, grape, strawberry, papaya, sweet orange, clementine, kiwifruit, tomato, potato, poplar and <italic>Arabidopsis</italic>
.</title>
<p>The figure shows every possible combination of species included in this proteome ortholog analysis, using concentric circles. Each ring represents a single plant species and is depicted in a unique colour. For the 13 species shown, there are hence a total of 2<sup>13</sup>
–1 combination cases, from 556 ortholog groups found in European pear only, 682 clades in Chinese pear only, to 5393 clusters present in all thirteen species. For each combination, the number of ortholog groups discovered is labelled outside the outermost ring and the number of proteins for a species inside a coloured, circular cell that represents the particular species. As the angular width of the cells for each case is drawn proportional to its number of groups, there is no labelling where the angular width is too small. A complete list of all combination cases with detected ortholog genes is provided in <xref ref-type="supplementary-material" rid="pone.0092644.s005">Table S4</xref>
.</p>
</caption>
<graphic xlink:href="pone.0092644.g002"></graphic>
</fig>
</sec>
<sec id="s3e"><title>Repeat analysis</title>
<p>A total of 199.4 Mb of repeated elements was identified in the unmasked Bartlett v1.0 genome scaffolds employing <italic>de novo</italic>
detection followed by a classification made using RepeatMasker (<xref ref-type="table" rid="pone-0092644-t004">Table 4</xref>
). The most common repeated elements were long terminal repeat (LTR)/<italic>Gypsy</italic>
(84.6 Mb; 14.1% of the assembled genome) and LTR/<italic>Copia</italic>
(42.8 Mb; 7.1% of the assembled genome), and the most common DNA transposable elements (TEs) were PIF-<italic>Harbinger</italic>
(10.2 Mb; 1.7% of the assembled genome) and <italic>hAT-Ac</italic>
(4.7 Mb; 0.8% of the assembled genome). These results are in agreement with the analysis of the <italic>P. bretschneideri</italic>
genome <xref rid="pone.0092644-Wu1" ref-type="bibr">[18]</xref>
. The classification of repeated elements using an homology-based search using the Rosaceae clade from RepBase (<xref ref-type="table" rid="pone-0092644-t005">Table 5</xref>
) confirms the results obtained by <italic>de novo</italic>
detection, as LTR/<italic>Gypsy</italic>
and LTR/<italic>Copia</italic>
were the most abundant classes of retroelements. In total, 194.8 Mb (32.5%) of the assembled Bartlett v1.0 genome comprised interspersed repeated elements according to the homology-based analysis.</p>
<table-wrap id="pone-0092644-t004" orientation="portrait" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0092644.t004</object-id>
<label>Table 4</label>
<caption><title>Comparison of <italic>de novo</italic>
predicted repeated elements between the European pear, Chinese pear and apple genomes. na: not available from <xref rid="pone.0092644-Wu1" ref-type="bibr">[18]</xref>
.</title>
</caption>
<alternatives><graphic id="pone-0092644-t004-4" xlink:href="pone.0092644.t004"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1"></td>
<td colspan="2" align="left" rowspan="1">European Pear</td>
<td align="left" rowspan="1" colspan="1">Chinese pear</td>
<td colspan="2" align="left" rowspan="1">Apple</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Class</td>
<td align="left" rowspan="1" colspan="1">Count</td>
<td align="left" rowspan="1" colspan="1">Size(bp)</td>
<td align="left" rowspan="1" colspan="1">Size (bp)</td>
<td align="left" rowspan="1" colspan="1">Count</td>
<td align="left" rowspan="1" colspan="1">Size(bp)</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1">DNA</td>
<td align="left" rowspan="1" colspan="1">87,258</td>
<td align="left" rowspan="1" colspan="1">16,034,061</td>
<td align="left" rowspan="1" colspan="1">19,622,007</td>
<td align="left" rowspan="1" colspan="1">62,032</td>
<td align="left" rowspan="1" colspan="1">12,036,031</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">DNA/CMC-EnSpm</td>
<td align="left" rowspan="1" colspan="1">5,245</td>
<td align="left" rowspan="1" colspan="1">2,498,065</td>
<td align="left" rowspan="1" colspan="1">1,994,298</td>
<td align="left" rowspan="1" colspan="1">3,238</td>
<td align="left" rowspan="1" colspan="1">1,651,963</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">DNA/MULE-MuDR</td>
<td align="left" rowspan="1" colspan="1">11,081</td>
<td align="left" rowspan="1" colspan="1">1,654,134</td>
<td align="left" rowspan="1" colspan="1">2,812,256</td>
<td align="left" rowspan="1" colspan="1">8,411</td>
<td align="left" rowspan="1" colspan="1">1,299,397</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">DNA/PIF-Harbinger</td>
<td align="left" rowspan="1" colspan="1">33,920</td>
<td align="left" rowspan="1" colspan="1">10,195,913</td>
<td align="left" rowspan="1" colspan="1">13,681,892</td>
<td align="left" rowspan="1" colspan="1">22,675</td>
<td align="left" rowspan="1" colspan="1">6,976,753</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">DNA/hAT-Ac</td>
<td align="left" rowspan="1" colspan="1">18,863</td>
<td align="left" rowspan="1" colspan="1">4,763,497</td>
<td align="left" rowspan="1" colspan="1">10,510,482</td>
<td align="left" rowspan="1" colspan="1">15,194</td>
<td align="left" rowspan="1" colspan="1">5,286,418</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">DNA/hAT-Tag1</td>
<td align="left" rowspan="1" colspan="1">8,271</td>
<td align="left" rowspan="1" colspan="1">1,973,418</td>
<td align="left" rowspan="1" colspan="1">2,689,092</td>
<td align="left" rowspan="1" colspan="1">10,877</td>
<td align="left" rowspan="1" colspan="1">3,050,698</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">DNA/hAT-Tip1</td>
<td align="left" rowspan="1" colspan="1">9,603</td>
<td align="left" rowspan="1" colspan="1">2,394,869</td>
<td align="left" rowspan="1" colspan="1">3,298,090</td>
<td align="left" rowspan="1" colspan="1">7,398</td>
<td align="left" rowspan="1" colspan="1">2,034,152</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LINE/L1</td>
<td align="left" rowspan="1" colspan="1">8,410</td>
<td align="left" rowspan="1" colspan="1">4,077,094</td>
<td align="left" rowspan="1" colspan="1">10,075,654</td>
<td align="left" rowspan="1" colspan="1">5,716</td>
<td align="left" rowspan="1" colspan="1">3,269,671</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LINE/RTE-BovB</td>
<td align="left" rowspan="1" colspan="1">7,697</td>
<td align="left" rowspan="1" colspan="1">2,200,632</td>
<td align="left" rowspan="1" colspan="1">4,408,634</td>
<td align="left" rowspan="1" colspan="1">12,750</td>
<td align="left" rowspan="1" colspan="1">10,996,014</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">SINE</td>
<td align="left" rowspan="1" colspan="1">425</td>
<td align="left" rowspan="1" colspan="1">124,106</td>
<td align="left" rowspan="1" colspan="1">208,975</td>
<td align="left" rowspan="1" colspan="1">2,191</td>
<td align="left" rowspan="1" colspan="1">359,108</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">SINE/tRNA</td>
<td align="left" rowspan="1" colspan="1">20,796</td>
<td align="left" rowspan="1" colspan="1">2,863,949</td>
<td align="left" rowspan="1" colspan="1">na</td>
<td align="left" rowspan="1" colspan="1">13,153</td>
<td align="left" rowspan="1" colspan="1">1,805,785</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LTR</td>
<td align="left" rowspan="1" colspan="1">37,405</td>
<td align="left" rowspan="1" colspan="1">9,249,657</td>
<td align="left" rowspan="1" colspan="1">38,166,045</td>
<td align="left" rowspan="1" colspan="1">20,479</td>
<td align="left" rowspan="1" colspan="1">6,282,994</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LTR/Caulimovirus</td>
<td align="left" rowspan="1" colspan="1">2,796</td>
<td align="left" rowspan="1" colspan="1">2,550,963</td>
<td align="left" rowspan="1" colspan="1">2,625,049</td>
<td align="left" rowspan="1" colspan="1">1,227</td>
<td align="left" rowspan="1" colspan="1">1,544,695</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LTR/Copia</td>
<td align="left" rowspan="1" colspan="1">73,727</td>
<td align="left" rowspan="1" colspan="1">42,805,711</td>
<td align="left" rowspan="1" colspan="1">86,429,855</td>
<td align="left" rowspan="1" colspan="1">46,798</td>
<td align="left" rowspan="1" colspan="1">35,591,207</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LTR/Copia-like</td>
<td align="left" rowspan="1" colspan="1">110</td>
<td align="left" rowspan="1" colspan="1">20,863</td>
<td align="left" rowspan="1" colspan="1">na</td>
<td align="left" rowspan="1" colspan="1">97</td>
<td align="left" rowspan="1" colspan="1">26,513</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LTR/Gypsy</td>
<td align="left" rowspan="1" colspan="1">145,766</td>
<td align="left" rowspan="1" colspan="1">84,633,023</td>
<td align="left" rowspan="1" colspan="1">130,449,009</td>
<td align="left" rowspan="1" colspan="1">94,218</td>
<td align="left" rowspan="1" colspan="1">68,540,726</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Low_complexity</td>
<td align="left" rowspan="1" colspan="1">121,061</td>
<td align="left" rowspan="1" colspan="1">5,222,319</td>
<td align="left" rowspan="1" colspan="1">na</td>
<td align="left" rowspan="1" colspan="1">84,700</td>
<td align="left" rowspan="1" colspan="1">3,780,221</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">RC/Helitron</td>
<td align="left" rowspan="1" colspan="1">6,851</td>
<td align="left" rowspan="1" colspan="1">2,104,677</td>
<td align="left" rowspan="1" colspan="1">na</td>
<td align="left" rowspan="1" colspan="1">5,036</td>
<td align="left" rowspan="1" colspan="1">1,448,948</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Satellite</td>
<td align="left" rowspan="1" colspan="1">207</td>
<td align="left" rowspan="1" colspan="1">30,594</td>
<td align="left" rowspan="1" colspan="1">350,647</td>
<td align="left" rowspan="1" colspan="1">178</td>
<td align="left" rowspan="1" colspan="1">40,455</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Simple_repeat</td>
<td align="left" rowspan="1" colspan="1">63,595</td>
<td align="left" rowspan="1" colspan="1">2,428,632</td>
<td align="left" rowspan="1" colspan="1">1,131,844</td>
<td align="left" rowspan="1" colspan="1">47,558</td>
<td align="left" rowspan="1" colspan="1">1,891,325</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Unknown</td>
<td align="left" rowspan="1" colspan="1">6,610</td>
<td align="left" rowspan="1" colspan="1">1,545,468</td>
<td align="left" rowspan="1" colspan="1">4,296,548</td>
<td align="left" rowspan="1" colspan="1">4,650</td>
<td align="left" rowspan="1" colspan="1">1,079,420</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">rRNA</td>
<td align="left" rowspan="1" colspan="1">351</td>
<td align="left" rowspan="1" colspan="1">100,288</td>
<td align="left" rowspan="1" colspan="1">na</td>
<td align="left" rowspan="1" colspan="1">158</td>
<td align="left" rowspan="1" colspan="1">31,199</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>TOTAL</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"><bold>199,471,933</bold>
</td>
<td align="left" rowspan="1" colspan="1"><bold>332,750,377</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"><bold>169,023,693</bold>
</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
<table-wrap id="pone-0092644-t005" orientation="portrait" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0092644.t005</object-id>
<label>Table 5</label>
<caption><title>Classification of repeated elements in European pear based on the ‘Rosaceae’ clade from RepBase.</title>
</caption>
<alternatives><graphic id="pone-0092644-t005-5" xlink:href="pone.0092644.t005"></graphic>
<table frame="hsides" rules="groups"><colgroup span="1"><col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead><tr><td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">Copies</td>
<td align="left" rowspan="1" colspan="1">Assembled (Mb)</td>
<td align="left" rowspan="1" colspan="1">Assembly %</td>
</tr>
</thead>
<tbody><tr><td align="left" rowspan="1" colspan="1"><bold>Retroelements</bold>
</td>
<td align="left" rowspan="1" colspan="1">241,316</td>
<td align="left" rowspan="1" colspan="1">149.345</td>
<td align="left" rowspan="1" colspan="1">25.87</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">SINEs</td>
<td align="left" rowspan="1" colspan="1">20,442</td>
<td align="left" rowspan="1" colspan="1">2.865</td>
<td align="left" rowspan="1" colspan="1">0.50</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LINE/RTE</td>
<td align="left" rowspan="1" colspan="1">6,669</td>
<td align="left" rowspan="1" colspan="1">1.724</td>
<td align="left" rowspan="1" colspan="1">0.30</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LINE/L1</td>
<td align="left" rowspan="1" colspan="1">7,851</td>
<td align="left" rowspan="1" colspan="1">4.300</td>
<td align="left" rowspan="1" colspan="1">0.74</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LTR/Ty1/Copia</td>
<td align="left" rowspan="1" colspan="1">56,724</td>
<td align="left" rowspan="1" colspan="1">44.240</td>
<td align="left" rowspan="1" colspan="1">7.66</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">LTR/Gypsy</td>
<td align="left" rowspan="1" colspan="1">114,127</td>
<td align="left" rowspan="1" colspan="1">85.382</td>
<td align="left" rowspan="1" colspan="1">14.79</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>DNA transposons</bold>
</td>
<td align="left" rowspan="1" colspan="1">173,387</td>
<td align="left" rowspan="1" colspan="1">42.058</td>
<td align="left" rowspan="1" colspan="1">7.28</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">hobo-Activator</td>
<td align="left" rowspan="1" colspan="1">36,417</td>
<td align="left" rowspan="1" colspan="1">10.007</td>
<td align="left" rowspan="1" colspan="1">1.73</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Tc1-IS630-Pogo</td>
<td align="left" rowspan="1" colspan="1">107</td>
<td align="left" rowspan="1" colspan="1">0.015</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">En-Spm</td>
<td align="left" rowspan="1" colspan="1">296</td>
<td align="left" rowspan="1" colspan="1">0.278</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1">Tourist/Harbinger</td>
<td align="left" rowspan="1" colspan="1">30,859</td>
<td align="left" rowspan="1" colspan="1">9.770</td>
<td align="left" rowspan="1" colspan="1">1.69</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Unclassified</bold>
</td>
<td align="left" rowspan="1" colspan="1">11,995</td>
<td align="left" rowspan="1" colspan="1">3.427</td>
<td align="left" rowspan="1" colspan="1">0.59</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Total interspersed repeats</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">194.830</td>
<td align="left" rowspan="1" colspan="1">33.75</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Small RNA</bold>
</td>
<td align="left" rowspan="1" colspan="1">20,415</td>
<td align="left" rowspan="1" colspan="1">2.873</td>
<td align="left" rowspan="1" colspan="1">0.50</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Satellites</bold>
</td>
<td align="left" rowspan="1" colspan="1">186</td>
<td align="left" rowspan="1" colspan="1">2.873</td>
<td align="left" rowspan="1" colspan="1">0.01</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Simple repeats</bold>
</td>
<td align="left" rowspan="1" colspan="1">2,497</td>
<td align="left" rowspan="1" colspan="1">0.021</td>
<td align="left" rowspan="1" colspan="1">0.04</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>Low complexity</bold>
</td>
<td align="left" rowspan="1" colspan="1">226</td>
<td align="left" rowspan="1" colspan="1">0.000</td>
<td align="left" rowspan="1" colspan="1">0.00</td>
</tr>
<tr><td align="left" rowspan="1" colspan="1"><bold>TOTAL</bold>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">197.724</td>
<td align="left" rowspan="1" colspan="1">34.14</td>
</tr>
</tbody>
</table>
</alternatives>
</table-wrap>
</sec>
<sec id="s3f"><title>SNP detection</title>
<p>Sequencing of LBJ and OH yielded 25,167,853 and 35,687,533 paired end reads, representing approximately 6.6× and 9.2× coverage per genotype, respectively. A total of 3,893,643 putative SNPs was identified following mapping of LBJ and OH low coverage sequencing data to the Bartlett v1.0 assembly scaffolds. Of these 829,823 (21.3%) passed the filtering condition for stage 1 detection defined in <xref rid="pone.0092644-Chagn1" ref-type="bibr">[31]</xref>
. The average SNP frequency of SNPs passing the filtering conditions was one per 674 bp with 146,585 (17.7%) predicted to be located within exons in the predicted gene models. A further 60,820 (7.53%) and 51,425 (6.37%) SNPs were located within 1,000 bases upstream or downstream of a predicted gene model, respectively.</p>
</sec>
<sec id="s3g"><title>Insight into the European pear annotated genome: example of the expansin gene family</title>
<p>In total, 49 and 41 apple and pear expansin-like genes were identified respectively in predicted gene sets, and were accepted or rejected for inclusion in the phylogenetic analysis based on previously published expansin classification criteria <xref rid="pone.0092644-Wang1" ref-type="bibr">[48]</xref>
(<xref ref-type="fig" rid="pone-0092644-g003">Figure 3</xref>
). Nine apple gene models did not have orthologous gene models in European pear and one additional pear gene model was identified with no apple ortholog (PCP008400). The predicted expansin and expansin-like genes from pear and apple grouped into four major clades, corresponding to the α- and β-expansins (EXPA and EXPB, respectively) and the two expansin-like families, EXPANSIN-LIKE A (EXLA) and EXPANSIN-LIKE B (EXLB) <xref rid="pone.0092644-Kende1" ref-type="bibr">[50]</xref>
(<xref ref-type="fig" rid="pone-0092644-g003">Figure 3A</xref>
; <xref ref-type="supplementary-material" rid="pone.0092644.s007">Table S6</xref>
). Homeologous genes derived from the <italic>Pyreae</italic>
whole genome duplication were identified for both apple and European pear. Expansin genes within sub-clades showed more similarity between apple and pear orthologs, than between homeologues of the same species, confirming that speciation happened after the genome duplication event (<xref ref-type="fig" rid="pone-0092644-g003">Figure 3B</xref>
).</p>
<fig id="pone-0092644-g003" orientation="portrait" position="float"><object-id pub-id-type="doi">10.1371/journal.pone.0092644.g003</object-id>
<label>Figure 3</label>
<caption><title>Phylogenetic and gene expression analysis of the expansin-like genes from apple and European pear.</title>
<p>A) Phylogenetic tree of predicted expansin-like genes from apple and European pear. Predicted expansin-like protein models from apple (MDP prefix) and European pear (PCP prefix) were aligned, and a conserved region of alignment of 313 residues was used to construct the phylogenetic tree Geneious 6.1.6 (Biomatters Ltd, Auckland, NZ). The linkage group (LG) of each model is shown where possible; some models are not anchored (LG-NA) to the genome. Models that represent the best hit for published expansins are labelled additionally as such. <italic>DdEXP2</italic>
from <italic>Dictyostelium discoideum</italic>
was used as an out-group. Bootstrap proportions for 100 trees were calculated and bootstrap values ≥50 are shown. Scale indicates 0.4 substitutions per site. EXPA, α-expansins; EXPB, β-expansins; EXLA, alpha-like expansins; EXLB, beta-like expansins <xref rid="pone.0092644-Kende1" ref-type="bibr">[50]</xref>
. mRNA-seq expression levels in ‘Comice’ melting pear (CM), ‘Nijisseki’ (NJ) crisp pear and ‘Royal Gala’ (RG) crisp apple, undergoing fruit ripening in storage show that one clade is strongly associated with fruit ripening (coloured green). The inserted graph shows the expression analysis by qPCR of <italic>EXP2</italic>
in fruit at harvest and during storage, which corresponds to the mRNA-seq data. Yellow bars: RG, red bars CM, orange bars NJ). RPKM: Reads Per Kilobase per Million mapped reads. Single arrow shows the apple expansin (MdEXPA7) mapped to a quantitative trait locus for fruit texture. B) Alignment of the first 170 bp of apple and pear homologues, demonstrating genome duplication preceded speciation.</p>
</caption>
<graphic xlink:href="pone.0092644.g003"></graphic>
</fig>
<p>For the rapidly softening European pear ‘Comice’ and crisp textured ‘Nijisseki’ (Japanese pear) 18.8M and 19.7M mRNA reads were obtained, respectively. Expression levels of the expansin class of genes determined in cold-stored ‘Comice’ and ‘Nijisseiki’ pears that were undergoing rapid softening were aligned to the phylogenetic clusters. These were compared to previously published mRNA-seq data mapped to the apple gene models <xref rid="pone.0092644-Velasco2" ref-type="bibr">[17]</xref>
from mature, ripening ‘Royal Gala’ apples <xref rid="pone.0092644-Schaffer2" ref-type="bibr">[51]</xref>
(<xref ref-type="fig" rid="pone-0092644-g003">Figure 3A</xref>
). It was observed that in most cases orthologous genes were expressed in both apple and pear during fruit ripening; however, the melting texture European ‘Comice’ pears exhibited a considerably higher level of expression than the crisp textured apples and ‘Nijisseiki’ Japanese pears, with some genes (such as <italic>EXP2</italic>
) showing over 20-fold higher expression in ‘Comice’ compared with apple and ‘Nijisseiki’. qPCR of <italic>EXP2</italic>
verified the mRNA-seq data and showed that at harvest and during storage, ‘Royal Gala’ exhibited consistently lower levels of <italic>EXP2</italic>
expression than the pear varieties (<xref ref-type="fig" rid="pone-0092644-g003">Figure 3A</xref>
).</p>
</sec>
</sec>
<sec id="s4"><title>Discussion</title>
<sec id="s4a"><title>The draft genome assembly of Pyrus communis and its applications</title>
<p>We have used Roche 454 shotgun sequencing to develop the first draft genome assembly of European pear. European pear (<italic>P. communis</italic>
) is the newest addition to the palette of whole genome sequences of Rosaceae fruit species, following apple (<italic>Malus</italic>
×<italic>domestica</italic>
; <xref rid="pone.0092644-Velasco2" ref-type="bibr">[17]</xref>
), strawberry (<italic>Fragaria vesca</italic>
; <xref rid="pone.0092644-Shulaev1" ref-type="bibr">[16]</xref>
), peach (<italic>Prunus persica</italic>
; <xref rid="pone.0092644-Verde1" ref-type="bibr">[19]</xref>
) and Chinese pear (<italic>P. bretschneideri</italic>
<xref rid="pone.0092644-Wu1" ref-type="bibr">[18]</xref>
). The Bartlett v1.0 draft genome spans most of the <italic>P. communis</italic>
genome and 171 Mb is anchored to high density genetic maps. A total of 829,823 SNPs passed filtering criteria, which corresponds to one SNP every 674 bp. This SNP frequency in <italic>P. communis</italic>
is lower than in apple (one SNP every 249 bp <xref rid="pone.0092644-Abrusn1" ref-type="bibr">[46]</xref>
), however, this may reflect the smaller set of cultivars used for SNP detection in European pear compared with apple. The development of a whole-genome sequence is a key milestone for research in any organism and the Bartlett v1.0 draft genome assembly will provide a springboard to explore the genetic control of key horticultural characters such as fruit quality, pest and disease resistance, and tree architecture. The genome assembly also enables the development of genetic markers for early selection of seedlings carrying alleles conferring these traits, from breeding germplasm. This genomic resource is now available to fruit researchers at the Genome Database for Rosaceae (<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0">http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0</ext-link>
). The number of predicted gene models (43,419), the high proportion of CEG retrieved (98.4%), and the comparison of apple and pear gene models of the expansin-like gene family demonstrate the quality and the completeness of the Bartlett v1.0 draft genome. A further valuable objective of developing a genome, beyond mining genes for sequence variants for linkage analysis, is to identify gene features such as open reading frames, introns and promoters for functional analysis. Although the Bartlett v1.0 draft genome sequence is fragmented, we have shown that it is sufficiently complete to enable functional characterisation of pear genes. Furthermore, our analysis of the Bartlett v1.0 draft genome indicated that European and Chinese pear have similar genome composition in terms of repeated elements, for example the LTR <italic>gypsy</italic>
and <italic>copia</italic>
elements are the most highly represented classes in both species. One striking feature of the pear genome is that it is smaller than that of apple, based on flow cytometry (600 Mb versus 750 Mb; <xref rid="pone.0092644-Arumuganathan1" ref-type="bibr">[49]</xref>
). The analysis of the Chinese pear genome <xref rid="pone.0092644-Wu1" ref-type="bibr">[18]</xref>
indicated that there may be significantly more repeated elements in the apple genome than in Chinese pear and our results in European pear validate this hypothesis.</p>
</sec>
<sec id="s4b"><title>Comparative genomics between European pear and other plant species</title>
<p>A comparison of the predicted proteins in European pear was performed against the predicted proteins from 12 other plant species, including two <italic>Rosaceae</italic>
pome fruit species: Chinese pear and apple. A caveat to interpretation of these results is that their precision depends both on that of the published proteomes and that of the predicted proteome of <italic>P. communis</italic>
, wherein a potential bias could be introduced into the comparative analysis as a result of the 13 plant genomes being assembled and annotated by differing methodologies, as reported by the respective authors.</p>
<p>In European pear, we identified a subset of 556 clusters containing 1,219 proteins that did not have orthologs detected in the other 12 species used in the analysis. Further analysis of these proteins using a wider array of species for comparison would be required to determine whether these proteins encode for traits specific to European pear. Furthermore, the set of 1,433 protein clusters present in both pear species (1,684 and 1,905 proteins in European and Chinese pear, respectively) and apple (1,963 proteins) but not detected in the remainder of the species may include products of genes determining the pome fruit character. Further investigation, including RNA-seq analysis of developing fruit should be performed, to elucidate the genetic control of development of this unique fruit type.</p>
</sec>
<sec id="s4c"><title>A tool for functional characterisation of fruit quality in pome fruit</title>
<p>The variation in fruit texture in pears is considerable, ranging from crisp in Chinese (<italic>P. bretschneideri</italic>
) and Japanese (<italic>P. pyrifolia</italic>
) pears, to melting in European pears. This melting texture does not occur in other pome fruit, such as apple and quince, which makes the study of comparative genomics of cell wall-related genes within the <italic>Pyreae</italic>
very important. The role of expansins in fruit ripening was first demonstrated in tomato, where suppression and over-expression of ripening-specific <italic>LeEXP1</italic>
was shown to result in increased fruit firmness and enhanced fruit softening, respectively <xref rid="pone.0092644-Brummell1" ref-type="bibr">[52]</xref>
. In apple and pear, the involvement of expansins in the determination of fruit texture has also been inferred from expression analysis of ripening-related members that correlate with changes in fruit firmness <xref rid="pone.0092644-Hiwasa1" ref-type="bibr">[53]</xref>
, <xref rid="pone.0092644-Wakasa1" ref-type="bibr">[54]</xref>
. Our analysis of the expansin-like gene family indicated that the European pear and apple expansin gene families are of similar size (41 and 49 genes, respectively), which suggests that clade expansion has not occurred within either species. Only a few α-expansins (EXPA clade) appear to be associated with fruit softening, with one clade containing <italic>PcEXP1</italic>
,<italic>2</italic>
and <italic>3</italic>
exhibiting high expression (<xref ref-type="fig" rid="pone-0092644-g003">Figure 3A</xref>
) The expression analysis presented here confirms previous studies where <italic>PcEXP1</italic>
to <italic>PcEXP6</italic>
, but not <italic>PcEXP7</italic>
, were highly expressed in cold-stored, ripening European pear <xref rid="pone.0092644-Hiwasa1" ref-type="bibr">[53]</xref>
, <xref rid="pone.0092644-Fonseca1" ref-type="bibr">[55]</xref>
, and where <italic>MdEXP3</italic>
was found to be the predominant, ripening-related expansin gene in apple <xref rid="pone.0092644-Wakasa1" ref-type="bibr">[54]</xref>
, <xref rid="pone.0092644-Goulao1" ref-type="bibr">[56]</xref>
, <xref rid="pone.0092644-Trujillo1" ref-type="bibr">[57]</xref>
. Surprisingly, quantitative trait locus analysis linked <italic>MdEXP7</italic>
to fruit softening in apple and pear <xref rid="pone.0092644-Costa1" ref-type="bibr">[58]</xref>
, although <italic>MdEXP7</italic>
expression was subsequently found to be undetectably low in a range of ripening apple genotypes <xref rid="pone.0092644-Trujillo1" ref-type="bibr">[57]</xref>
. Similarly in European pear, both in the current study and in <xref rid="pone.0092644-Hiwasa1" ref-type="bibr">[53]</xref>
, <italic>PcEXP7</italic>
was one of the members of the family with very low expression (<xref ref-type="fig" rid="pone-0092644-g002">Figure 2A</xref>
). Further examination of differences among the cultivars chosen for these different studies is required to further elucidate the role of expansins in fruit ripening in the <italic>Pyreae</italic>
.</p>
</sec>
<sec id="s4d"><title>The draft genome assembly of ‘Bartlett’ will contribute to faster delivery of new Pyrus cultivars</title>
<p>In the immediate future, the Bartlett v1.0 draft genome can be used as a reference for re-sequencing in <italic>Pyrus</italic>
germplasm, as has been performed for apple <xref rid="pone.0092644-Chagn1" ref-type="bibr">[31]</xref>
and peach <xref rid="pone.0092644-Verde2" ref-type="bibr">[59]</xref>
. Such germplasm re-sequencing will enable the development of high-throughput genetic marker screening tools for pear breeders, including SNP arrays and will also allow implementation of emerging technologies, such as genotyping by sequencing <xref rid="pone.0092644-Elshire1" ref-type="bibr">[60]</xref>
. Such technologies will in turn enable the implementation of association studies for determination of marker-trait associations, as well as genomic selection (GS). Recent evaluation of genomic selection for fruit quality traits in apple indicates that genetic gains achievable using GS for a combination of traits, will be faster and more efficient than achieved by classical breeding <xref rid="pone.0092644-Kumar1" ref-type="bibr">[33]</xref>
, <xref rid="pone.0092644-Kumar2" ref-type="bibr">[61]</xref>
. We predict that the availability of the ‘Bartlett’ draft genome sequence will enable the implementation of GS in pear cultivar breeding programmes internationally in the very near future.</p>
</sec>
</sec>
<sec sec-type="supplementary-material" id="s5"><title>Supporting Information</title>
<supplementary-material content-type="local-data" id="pone.0092644.s001"><label>Figure S1</label>
<caption><p>Strategy used for anchoring the Bartlett v1.0 genome sequence.</p>
<p>(PPTX)</p>
</caption>
<media xlink:href="pone.0092644.s001.ppt"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0092644.s002"><label>Table S1</label>
<caption><p>Raw 454 sequencing data used to construct the Bartlett v1.0 genome sequence.</p>
<p>(XLSX)</p>
</caption>
<media xlink:href="pone.0092644.s002.xlsx"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0092644.s003"><label>Table S2</label>
<caption><p>Analysis of the Core Eukaryotic Genes (CEGs; <xref rid="pone.0092644-Parra1" ref-type="bibr">[30]</xref>
) in the Bartlett v1.0 genome sequence.</p>
<p>(XLSX)</p>
</caption>
<media xlink:href="pone.0092644.s003.xlsx"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0092644.s004"><label>Table S3</label>
<caption><p>Number of ortholog groups and genes in 13 plant species.</p>
<p>(XLSX)</p>
</caption>
<media xlink:href="pone.0092644.s004.xlsx"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0092644.s005"><label>Table S4</label>
<caption><p>Anchoring of the Bartlett v1.0 genome sequence scaffolds on genetic maps constructed for apple and pear. Segregating populations used for genetic map construction: <italic>Pyrus communis</italic>
family: ‘Old Home’בLouise de Bonne Jersey’; inter-specific Asian×European pear populations: NZSelection_pearT003(b)בMoonglow’, NZSelection_pearT042×NZSelection_pearT081 and NZSelection_pearT052×NZSelection_pearT003(a); apple segregating populations: PremA153×NZSelection_appleT031, ‘Fuji’×NZSelection_appleT051 and ‘Sciros’×NZSelection_appleT051 <xref rid="pone.0092644-Kumar1" ref-type="bibr">[33]</xref>
. LG: Linkage Group.</p>
<p>(XLSX)</p>
</caption>
<media xlink:href="pone.0092644.s005.xlsx"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0092644.s006"><label>Table S5</label>
<caption><p>List of gene models unique to European pear and their putative function.</p>
<p>(XLSX)</p>
</caption>
<media xlink:href="pone.0092644.s006.xlsx"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="pone.0092644.s007"><label>Table S6</label>
<caption><p>Gene names and GenBank accession numbers for expansin gene models in European pear. LG: Linkage Group.</p>
<p>(DOCX)</p>
</caption>
<media xlink:href="pone.0092644.s007.docx"><caption><p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
</sec>
</body>
<back><ack><p>DC thanks Mr Jean-Max and Mr Jean-Pierre Drouilhet for giving him his first “<italic>poire William's</italic>
” job 20 years ago, Drs Tony Conner and Andrew Granger (Plant & Food Research) for originally supporting this project concept, and Drs Jeanne Jacobs, David Brummel (Plant & Food Research), Charles-Eric Durel (INRA) and Pr Francesco Salamini (FEM-IASMA) for comments on the manuscript. We thank Stephen Ficklin and Dorrie Main for making the Bartlett v1.0 data publically available at the Genome Database for Rosaceae (GDR).</p>
<p><bold>Resources</bold>
</p>
<p>A Genome Browser for Bartlett v1.0 is available through the Genome Database for Rosaceae at <ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/gb/gbrowse/pyrus_communis_v1.0/">http://www.rosaceae.org/gb/gbrowse/pyrus_communis_v1.0/</ext-link>
and the pear genome page with links to assembly data is at <ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0">http://www.rosaceae.org/species/pyrus/pyrus_communis/genome_v1.0</ext-link>
. Genome scaffolds, gene predictions, raw 454 genomic sequence data and RNA-seq data are available at NCBI-SRA under project PRJEB5264 (<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/ena/data/view/PRJEB6254">http://www.ebi.ac.uk/ena/data/view/PRJEB6254</ext-link>
).</p>
</ack>
<ref-list><title>References</title>
<ref id="pone.0092644-Potter1"><label>1</label>
<mixed-citation publication-type="journal"><name><surname>Potter</surname>
<given-names>D</given-names>
</name>
, <name><surname>Eriksson</surname>
<given-names>T</given-names>
</name>
, <name><surname>Evans</surname>
<given-names>RC</given-names>
</name>
, <name><surname>Oh</surname>
<given-names>S</given-names>
</name>
, <name><surname>Smedmark</surname>
<given-names>JEE</given-names>
</name>
, <etal>et al</etal>
(<year>2007</year>
) <article-title>Phylogeny and classification of Rosaceae</article-title>
. <source>Plant Systematics and Evolution</source>
<volume>266</volume>
: <fpage>5</fpage>
–<lpage>43</lpage>
</mixed-citation>
</ref>
<ref id="pone.0092644-Argout1"><label>2</label>
<mixed-citation publication-type="journal"><name><surname>Argout</surname>
<given-names>X</given-names>
</name>
, <name><surname>Salse</surname>
<given-names>J</given-names>
</name>
, <name><surname>Aury</surname>
<given-names>J-M</given-names>
</name>
, <name><surname>Guiltinan</surname>
<given-names>MJ</given-names>
</name>
, <name><surname>Droc</surname>
<given-names>G</given-names>
</name>
, <etal>et al</etal>
(<year>2011</year>
) <article-title>The genome of <italic>Theobroma cacao</italic>
</article-title>
. <source>Nature Genetics</source>
<volume>43</volume>
: <fpage>101</fpage>
–<lpage>108</lpage>
<pub-id pub-id-type="pmid">21186351</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-GarciaMas1"><label>3</label>
<mixed-citation publication-type="journal"><name><surname>Garcia-Mas</surname>
<given-names>J</given-names>
</name>
, <name><surname>Benjak</surname>
<given-names>A</given-names>
</name>
, <name><surname>Sanseverino</surname>
<given-names>W</given-names>
</name>
, <name><surname>Bourgeois</surname>
<given-names>M</given-names>
</name>
, <name><surname>Mir</surname>
<given-names>G</given-names>
</name>
, <etal>et al</etal>
(<year>2012</year>
) <article-title>The genome of melon (<italic>Cucumis melo</italic>
L.)</article-title>
. <source>Proceedings of the National Academy of Sciences of the United States of America</source>
<volume>109</volume>
: <fpage>11872</fpage>
–<lpage>11877</lpage>
<pub-id pub-id-type="pmid">22753475</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Huang1"><label>4</label>
<mixed-citation publication-type="journal"><name><surname>Huang</surname>
<given-names>S</given-names>
</name>
, <name><surname>Li</surname>
<given-names>R</given-names>
</name>
, <name><surname>Zhang</surname>
<given-names>Z</given-names>
</name>
, <name><surname>Li</surname>
<given-names>L</given-names>
</name>
, <name><surname>Gu</surname>
<given-names>X</given-names>
</name>
, <etal>et al</etal>
(<year>2009</year>
) <article-title>The genome of the cucumber, <italic>Cucumis sativus</italic>
L</article-title>
. <source>Nature Genetics</source>
<volume>41</volume>
: <fpage>1275</fpage>
–<lpage>U1229</lpage>
<pub-id pub-id-type="pmid">19881527</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Jaillon1"><label>5</label>
<mixed-citation publication-type="journal"><name><surname>Jaillon</surname>
<given-names>O</given-names>
</name>
, <name><surname>Aury</surname>
<given-names>J-M</given-names>
</name>
, <name><surname>Noel</surname>
<given-names>B</given-names>
</name>
, <name><surname>Policriti</surname>
<given-names>A</given-names>
</name>
, <name><surname>Clepet</surname>
<given-names>C</given-names>
</name>
, <etal>et al</etal>
(<year>2007</year>
) <article-title>The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla</article-title>
. <source>Nature</source>
<volume>449</volume>
: <fpage>463</fpage>
–<lpage>U465</lpage>
<pub-id pub-id-type="pmid">17721507</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Ming1"><label>6</label>
<mixed-citation publication-type="journal"><name><surname>Ming</surname>
<given-names>R</given-names>
</name>
, <name><surname>Hou</surname>
<given-names>S</given-names>
</name>
, <name><surname>Feng</surname>
<given-names>Y</given-names>
</name>
, <name><surname>Yu</surname>
<given-names>Q</given-names>
</name>
, <name><surname>Dionne-Laporte</surname>
<given-names>A</given-names>
</name>
, <etal>et al</etal>
(<year>2008</year>
) <article-title>The draft genome of the transgenic tropical fruit tree papaya (<italic>Carica papaya</italic>
Linnaeus)</article-title>
. <source>Nature</source>
<volume>452</volume>
: <fpage>991</fpage>
–<lpage>U997</lpage>
<pub-id pub-id-type="pmid">18432245</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Paterson1"><label>7</label>
<mixed-citation publication-type="journal"><name><surname>Paterson</surname>
<given-names>AH</given-names>
</name>
, <name><surname>Bowers</surname>
<given-names>JE</given-names>
</name>
, <name><surname>Bruggmann</surname>
<given-names>R</given-names>
</name>
, <name><surname>Dubchak</surname>
<given-names>I</given-names>
</name>
, <name><surname>Grimwood</surname>
<given-names>J</given-names>
</name>
, <etal>et al</etal>
(<year>2009</year>
) <article-title>The <italic>Sorghum bicolor</italic>
genome and the diversification of grasses</article-title>
. <source>Nature</source>
<volume>457</volume>
: <fpage>551</fpage>
–<lpage>556</lpage>
<pub-id pub-id-type="pmid">19189423</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Schmutz1"><label>8</label>
<mixed-citation publication-type="journal"><name><surname>Schmutz</surname>
<given-names>J</given-names>
</name>
, <name><surname>Cannon</surname>
<given-names>SB</given-names>
</name>
, <name><surname>Schlueter</surname>
<given-names>J</given-names>
</name>
, <name><surname>Ma</surname>
<given-names>J</given-names>
</name>
, <name><surname>Mitros</surname>
<given-names>T</given-names>
</name>
, <etal>et al</etal>
(<year>2010</year>
) <article-title>Genome sequence of the palaeopolyploid soybean</article-title>
. <source>Nature</source>
<volume>463</volume>
: <fpage>178</fpage>
–<lpage>183</lpage>
<pub-id pub-id-type="pmid">20075913</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-TomatoGenome1"><label>9</label>
<mixed-citation publication-type="journal"><name><surname>Tomato Genome</surname>
<given-names>C</given-names>
</name>
(<year>2012</year>
) <article-title>The tomato genome sequence provides insights into fleshy fruit evolution</article-title>
. <source>Nature</source>
<volume>485</volume>
: <fpage>635</fpage>
–<lpage>641</lpage>
<pub-id pub-id-type="pmid">22660326</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Tuskan1"><label>10</label>
<mixed-citation publication-type="journal"><name><surname>Tuskan</surname>
<given-names>GA</given-names>
</name>
, <name><surname>DiFazio</surname>
<given-names>S</given-names>
</name>
, <name><surname>Jansson</surname>
<given-names>S</given-names>
</name>
, <name><surname>Bohlmann</surname>
<given-names>J</given-names>
</name>
, <name><surname>Grigoriev</surname>
<given-names>I</given-names>
</name>
, <etal>et al</etal>
(<year>2006</year>
) <article-title>The genome of black cottonwood, <italic>Populus trichocarpa</italic>
(Torr. & Gray)</article-title>
. <source>Science</source>
<volume>313</volume>
: <fpage>1596</fpage>
–<lpage>1604</lpage>
<pub-id pub-id-type="pmid">16973872</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-vanBakel1"><label>11</label>
<mixed-citation publication-type="journal"><name><surname>van Bakel</surname>
<given-names>H</given-names>
</name>
, <name><surname>Stout</surname>
<given-names>JM</given-names>
</name>
, <name><surname>Cote</surname>
<given-names>AG</given-names>
</name>
, <name><surname>Tallon</surname>
<given-names>CM</given-names>
</name>
, <name><surname>Sharpe</surname>
<given-names>AG</given-names>
</name>
, <etal>et al</etal>
(<year>2011</year>
) <article-title>The draft genome and transcriptome of <italic>Cannabis sativa</italic>
</article-title>
. <source>Genome Biology</source>
<volume>12</volume>
</mixed-citation>
</ref>
<ref id="pone.0092644-Velasco1"><label>12</label>
<mixed-citation publication-type="journal"><name><surname>Velasco</surname>
<given-names>R</given-names>
</name>
, <name><surname>Zharkikh</surname>
<given-names>A</given-names>
</name>
, <name><surname>Troggio</surname>
<given-names>M</given-names>
</name>
, <name><surname>Cartwright</surname>
<given-names>DA</given-names>
</name>
, <name><surname>Cestaro</surname>
<given-names>A</given-names>
</name>
, <etal>et al</etal>
(<year>2007</year>
) <article-title>A high quality draft consensus sequence of the genome of a heterozygous grapevine variety</article-title>
. <source>PLoS One</source>
<volume>2</volume>
: <fpage>e1326</fpage>
<pub-id pub-id-type="pmid">18094749</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Xu1"><label>13</label>
<mixed-citation publication-type="journal"><name><surname>Xu</surname>
<given-names>X</given-names>
</name>
, <name><surname>Pan</surname>
<given-names>S</given-names>
</name>
, <name><surname>Cheng</surname>
<given-names>S</given-names>
</name>
, <name><surname>Zhang</surname>
<given-names>B</given-names>
</name>
, <name><surname>Mu</surname>
<given-names>D</given-names>
</name>
, <etal>et al</etal>
(<year>2011</year>
) <article-title>Genome sequence and analysis of the tuber crop potato</article-title>
. <source>Nature</source>
<volume>475</volume>
: <fpage>189</fpage>
–<lpage>U194</lpage>
<pub-id pub-id-type="pmid">21743474</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Guo1"><label>14</label>
<mixed-citation publication-type="journal"><name><surname>Guo</surname>
<given-names>S</given-names>
</name>
, <name><surname>Zhang</surname>
<given-names>J</given-names>
</name>
, <name><surname>Sun</surname>
<given-names>H</given-names>
</name>
, <name><surname>Salse</surname>
<given-names>J</given-names>
</name>
, <name><surname>Lucas</surname>
<given-names>WJ</given-names>
</name>
, <etal>et al</etal>
(<year>2012</year>
) <article-title>The draft genome of watermelon (<italic>Citrullus lanatus</italic>
) and resequencing of 20 diverse accessions</article-title>
. <source>Nature Genetics advance online publication</source>
</mixed-citation>
</ref>
<ref id="pone.0092644-Xu2"><label>15</label>
<mixed-citation publication-type="journal"><name><surname>Xu</surname>
<given-names>Q</given-names>
</name>
, <name><surname>Chen</surname>
<given-names>L-L</given-names>
</name>
, <name><surname>Ruan</surname>
<given-names>X</given-names>
</name>
, <name><surname>Chen</surname>
<given-names>D</given-names>
</name>
, <name><surname>Zhu</surname>
<given-names>A</given-names>
</name>
, <etal>et al</etal>
(<year>2012</year>
) <article-title>The draft genome of sweet orange (<italic>Citrus sinensis</italic>
)</article-title>
. <source>Nature Genetics advance online publication</source>
</mixed-citation>
</ref>
<ref id="pone.0092644-Shulaev1"><label>16</label>
<mixed-citation publication-type="journal"><name><surname>Shulaev</surname>
<given-names>V</given-names>
</name>
, <name><surname>Sargent</surname>
<given-names>DJ</given-names>
</name>
, <name><surname>Crowhurst</surname>
<given-names>RN</given-names>
</name>
, <name><surname>Mockler</surname>
<given-names>TC</given-names>
</name>
, <name><surname>Folkerts</surname>
<given-names>O</given-names>
</name>
, <etal>et al</etal>
(<year>2011</year>
) <article-title>The genome of woodland strawberry (<italic>Fragaria vesca</italic>
)</article-title>
. <source>Nature Genetics</source>
<volume>43</volume>
: <fpage>109</fpage>
–<lpage>U151</lpage>
<pub-id pub-id-type="pmid">21186353</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Velasco2"><label>17</label>
<mixed-citation publication-type="journal"><name><surname>Velasco</surname>
<given-names>R</given-names>
</name>
, <name><surname>Zharkikh</surname>
<given-names>A</given-names>
</name>
, <name><surname>Affourtit</surname>
<given-names>J</given-names>
</name>
, <name><surname>Dhingra</surname>
<given-names>A</given-names>
</name>
, <name><surname>Cestaro</surname>
<given-names>A</given-names>
</name>
, <etal>et al</etal>
(<year>2010</year>
) <article-title>The genome of the domesticated apple (<italic>Malus</italic>
×<italic>domestica</italic>
Borkh.)</article-title>
. <source>Nature Genetics</source>
<volume>42</volume>
: <fpage>833</fpage>
–<lpage>+</lpage>
<pub-id pub-id-type="pmid">20802477</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Wu1"><label>18</label>
<mixed-citation publication-type="journal"><name><surname>Wu</surname>
<given-names>J</given-names>
</name>
, <name><surname>Wang</surname>
<given-names>Z</given-names>
</name>
, <name><surname>Shi</surname>
<given-names>Z</given-names>
</name>
, <name><surname>Zhang</surname>
<given-names>S</given-names>
</name>
, <name><surname>Ming</surname>
<given-names>R</given-names>
</name>
, <etal>et al</etal>
(<year>2012</year>
) <article-title>The genome of pear (<italic>Pyrus bretschneideri</italic>
Rehd.)</article-title>
. <source>Genome Research</source>
</mixed-citation>
</ref>
<ref id="pone.0092644-Verde1"><label>19</label>
<mixed-citation publication-type="journal"><name><surname>Verde</surname>
<given-names>I</given-names>
</name>
, <name><surname>Abbott</surname>
<given-names>AG</given-names>
</name>
, <name><surname>Scalabrin</surname>
<given-names>S</given-names>
</name>
, <name><surname>Jung</surname>
<given-names>S</given-names>
</name>
, <name><surname>Shu</surname>
<given-names>S</given-names>
</name>
, <etal>et al</etal>
(<year>2013</year>
) <article-title>The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution</article-title>
. <source>Nat Genet advance online publication</source>
</mixed-citation>
</ref>
<ref id="pone.0092644-Celton1"><label>20</label>
<mixed-citation publication-type="journal"><name><surname>Celton</surname>
<given-names>J-M</given-names>
</name>
, <name><surname>Chagné</surname>
<given-names>D</given-names>
</name>
, <name><surname>Tustin</surname>
<given-names>SD</given-names>
</name>
, <name><surname>Terakami</surname>
<given-names>S</given-names>
</name>
, <name><surname>Nishitani</surname>
<given-names>C</given-names>
</name>
, <etal>et al</etal>
(<year>2009</year>
) <article-title>Update on comparative genome mapping between <italic>Malus</italic>
and <italic>Pyrus</italic>
</article-title>
. <source>BMC research notes</source>
<volume>2</volume>
: <fpage>182</fpage>
–<lpage>182</lpage>
<pub-id pub-id-type="pmid">19747407</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Terakami1"><label>21</label>
<mixed-citation publication-type="journal"><name><surname>Terakami</surname>
<given-names>S</given-names>
</name>
, <name><surname>Shoda</surname>
<given-names>M</given-names>
</name>
, <name><surname>Adachi</surname>
<given-names>Y</given-names>
</name>
, <name><surname>Gonai</surname>
<given-names>T</given-names>
</name>
, <name><surname>Kasumi</surname>
<given-names>M</given-names>
</name>
, <etal>et al</etal>
(<year>2006</year>
) <article-title>Genetic mapping of the pear scab resistance gene <italic>Vnk</italic>
of Japanese pear cultivar Kinchaku</article-title>
. <source>Theoretical and Applied Genetics</source>
<volume>113</volume>
: <fpage>743</fpage>
–<lpage>752</lpage>
<pub-id pub-id-type="pmid">16838137</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Yamamoto1"><label>22</label>
<mixed-citation publication-type="journal"><name><surname>Yamamoto</surname>
<given-names>T</given-names>
</name>
, <name><surname>Kimura</surname>
<given-names>T</given-names>
</name>
, <name><surname>Sawamura</surname>
<given-names>Y</given-names>
</name>
, <name><surname>Manabe</surname>
<given-names>T</given-names>
</name>
, <name><surname>Kotobuki</surname>
<given-names>K</given-names>
</name>
, <etal>et al</etal>
(<year>2002</year>
) <article-title>Simple sequence repeats for genetic analysis in pear</article-title>
. <source>Euphytica</source>
<volume>124</volume>
: <fpage>129</fpage>
–<lpage>137</lpage>
</mixed-citation>
</ref>
<ref id="pone.0092644-Yamamoto2"><label>23</label>
<mixed-citation publication-type="journal"><name><surname>Yamamoto</surname>
<given-names>T</given-names>
</name>
, <name><surname>Kimura</surname>
<given-names>T</given-names>
</name>
, <name><surname>Shoda</surname>
<given-names>M</given-names>
</name>
, <name><surname>Imai</surname>
<given-names>T</given-names>
</name>
, <name><surname>Saito</surname>
<given-names>T</given-names>
</name>
, <etal>et al</etal>
(<year>2002</year>
) <article-title>Genetic linkage maps constructed by using an interspecific cross between Japanese and European pears</article-title>
. <source>Theoretical and Applied Genetics</source>
<volume>106</volume>
: <fpage>9</fpage>
–<lpage>18</lpage>
<pub-id pub-id-type="pmid">12582866</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Yamamoto3"><label>24</label>
<mixed-citation publication-type="journal"><name><surname>Yamamoto</surname>
<given-names>T</given-names>
</name>
, <name><surname>Kimura</surname>
<given-names>T</given-names>
</name>
, <name><surname>Terakami</surname>
<given-names>S</given-names>
</name>
, <name><surname>Nishitani</surname>
<given-names>C</given-names>
</name>
, <name><surname>Sawamura</surname>
<given-names>Y</given-names>
</name>
, <etal>et al</etal>
(<year>2007</year>
) <article-title>Integrated reference genetic linkage maps of pear based on SSR and AFLP markers</article-title>
. <source>Breeding Science</source>
<volume>57</volume>
: <fpage>321</fpage>
–<lpage>329</lpage>
</mixed-citation>
</ref>
<ref id="pone.0092644-Illa1"><label>25</label>
<mixed-citation publication-type="journal"><name><surname>Illa</surname>
<given-names>E</given-names>
</name>
, <name><surname>Sargent</surname>
<given-names>DJ</given-names>
</name>
, <name><surname>Girona</surname>
<given-names>EL</given-names>
</name>
, <name><surname>Bushakra</surname>
<given-names>J</given-names>
</name>
, <name><surname>Cestaro</surname>
<given-names>A</given-names>
</name>
, <etal>et al</etal>
(<year>2011</year>
) <article-title>Comparative analysis of rosaceous genomes and the reconstruction of a putative ancestral genome for the family</article-title>
. <source>BMC Evolutionary Biology</source>
<volume>11</volume>
</mixed-citation>
</ref>
<ref id="pone.0092644-Jung1"><label>26</label>
<mixed-citation publication-type="journal"><name><surname>Jung</surname>
<given-names>S</given-names>
</name>
, <name><surname>Cestaro</surname>
<given-names>A</given-names>
</name>
, <name><surname>Troggio</surname>
<given-names>M</given-names>
</name>
, <name><surname>Main</surname>
<given-names>D</given-names>
</name>
, <name><surname>Zheng</surname>
<given-names>P</given-names>
</name>
, <etal>et al</etal>
(<year>2012</year>
) <article-title>Whole genome comparisons of <italic>Fragaria</italic>
, <italic>Prunus</italic>
and <italic>Malus</italic>
reveal different modes of evolution between Rosaceous subfamilies</article-title>
. <source>BMC Genomics</source>
<volume>13</volume>
</mixed-citation>
</ref>
<ref id="pone.0092644-Schaffer1"><label>27</label>
<mixed-citation publication-type="journal"><name><surname>Schaffer</surname>
<given-names>RJ</given-names>
</name>
, <name><surname>Friel</surname>
<given-names>EN</given-names>
</name>
, <name><surname>Souleyre</surname>
<given-names>EJF</given-names>
</name>
, <name><surname>Bolitho</surname>
<given-names>K</given-names>
</name>
, <name><surname>Thodey</surname>
<given-names>K</given-names>
</name>
, <etal>et al</etal>
(<year>2007</year>
) <article-title>A Genomics approach reveals that aroma production in apple is controlled by ethylene predominantly at the final step in each biosynthetic pathway</article-title>
. <source>Plant Physiology</source>
<volume>144</volume>
: <fpage>1899</fpage>
–<lpage>1912</lpage>
<pub-id pub-id-type="pmid">17556515</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Langmead1"><label>28</label>
<mixed-citation publication-type="journal"><name><surname>Langmead</surname>
<given-names>B</given-names>
</name>
, <name><surname>Salzberg</surname>
<given-names>SL</given-names>
</name>
(<year>2012</year>
) <article-title>Fast gapped-read alignment with Bowtie 2</article-title>
. <source>Nature Methods</source>
<volume>9</volume>
: <fpage>357</fpage>
–<lpage>U354</lpage>
<pub-id pub-id-type="pmid">22388286</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Tacken1"><label>29</label>
<mixed-citation publication-type="journal"><name><surname>Tacken</surname>
<given-names>E</given-names>
</name>
, <name><surname>Ireland</surname>
<given-names>H</given-names>
</name>
, <name><surname>Gunaseelan</surname>
<given-names>K</given-names>
</name>
, <name><surname>Karunairetnam</surname>
<given-names>S</given-names>
</name>
, <name><surname>Wang</surname>
<given-names>D</given-names>
</name>
, <etal>et al</etal>
(<year>2010</year>
) <article-title>The Role of Ethylene and Cold Temperature in the Regulation of the Apple POLYGALACTURONASE1 Gene and Fruit Softening</article-title>
. <source>Plant Physiology</source>
<volume>153</volume>
: <fpage>294</fpage>
–<lpage>305</lpage>
<pub-id pub-id-type="pmid">20237022</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Parra1"><label>30</label>
<mixed-citation publication-type="journal"><name><surname>Parra</surname>
<given-names>G</given-names>
</name>
, <name><surname>Bradnam</surname>
<given-names>K</given-names>
</name>
, <name><surname>Korf</surname>
<given-names>I</given-names>
</name>
(<year>2007</year>
) <article-title>CEGMA: a pipeline to accurately annotate core genes in eukaryotic genornes</article-title>
. <source>Bioinformatics</source>
<volume>23</volume>
: <fpage>1061</fpage>
–<lpage>1067</lpage>
<pub-id pub-id-type="pmid">17332020</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Chagn1"><label>31</label>
<mixed-citation publication-type="journal"><name><surname>Chagné</surname>
<given-names>D</given-names>
</name>
, <name><surname>Crowhurst</surname>
<given-names>RN</given-names>
</name>
, <name><surname>Troggio</surname>
<given-names>M</given-names>
</name>
, <name><surname>Davey</surname>
<given-names>MW</given-names>
</name>
, <name><surname>Gilmore</surname>
<given-names>B</given-names>
</name>
, <etal>et al</etal>
(<year>2012</year>
) <article-title>Genome-wide SNP detection, validation, and development of an 8K SNP array for apple</article-title>
. <source>PLoS One</source>
<volume>7</volume>
</mixed-citation>
</ref>
<ref id="pone.0092644-Montanari1"><label>32</label>
<mixed-citation publication-type="journal"><name><surname>Montanari</surname>
<given-names>S</given-names>
</name>
, <name><surname>Saeed</surname>
<given-names>M</given-names>
</name>
, <name><surname>Knäbel</surname>
<given-names>M</given-names>
</name>
, <name><surname>Kim</surname>
<given-names>Y</given-names>
</name>
, <name><surname>Troggio</surname>
<given-names>M</given-names>
</name>
, <etal>et al</etal>
(<year>2013</year>
) <article-title>Identification of <italic>Pyrus</italic>
single nucleotide polymorphisms (SNPs) and evaluation for genetic mapping in European pear and interspecific <italic>Pyrus</italic>
hybrids</article-title>
. <source>PLoS One</source>
<volume>8</volume>
: <fpage>e77022</fpage>
<pub-id pub-id-type="pmid">24155917</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Kumar1"><label>33</label>
<mixed-citation publication-type="journal"><name><surname>Kumar</surname>
<given-names>S</given-names>
</name>
, <name><surname>Chagné</surname>
<given-names>D</given-names>
</name>
, <name><surname>Bink</surname>
<given-names>MCAM</given-names>
</name>
, <name><surname>Volz</surname>
<given-names>RK</given-names>
</name>
, <name><surname>Whitworth</surname>
<given-names>C</given-names>
</name>
, <etal>et al</etal>
(<year>2012</year>
) <article-title>Genomic selection for fruit quality traits in apple (<italic>Malus</italic>
×<italic>domestica</italic>
Borkh.)</article-title>
. <source>PLoS One</source>
<volume>7</volume>
</mixed-citation>
</ref>
<ref id="pone.0092644-Kent1"><label>34</label>
<mixed-citation publication-type="journal"><name><surname>Kent</surname>
<given-names>WJ</given-names>
</name>
(<year>2002</year>
) <article-title>BLAT - The BLAST-like alignment tool</article-title>
. <source>Genome Research</source>
<volume>12</volume>
: <fpage>656</fpage>
–<lpage>664</lpage>
<pub-id pub-id-type="pmid">11932250</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Robertson1"><label>35</label>
<mixed-citation publication-type="journal"><name><surname>Robertson</surname>
<given-names>G</given-names>
</name>
, <name><surname>Schein</surname>
<given-names>J</given-names>
</name>
, <name><surname>Chiu</surname>
<given-names>R</given-names>
</name>
, <name><surname>Corbett</surname>
<given-names>R</given-names>
</name>
, <name><surname>Field</surname>
<given-names>M</given-names>
</name>
, <etal>et al</etal>
(<year>2010</year>
) <article-title>De novo assembly and analysis of RNA-seq data</article-title>
. <source>Nature Methods</source>
<volume>7</volume>
: <fpage>909</fpage>
–<lpage>U962</lpage>
<pub-id pub-id-type="pmid">20935650</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Smit1"><label>36</label>
<mixed-citation publication-type="other">Smit A, Hubley R, Green P (1996–2010) RepeatMasker Open-3.0. <ext-link ext-link-type="uri" xlink:href="http://www.repeatmasker.org">http://www.repeatmasker.org</ext-link>
Accessed 2013 September 1.</mixed-citation>
</ref>
<ref id="pone.0092644-Altschul1"><label>37</label>
<mixed-citation publication-type="journal"><name><surname>Altschul</surname>
<given-names>SF</given-names>
</name>
, <name><surname>Madden</surname>
<given-names>TL</given-names>
</name>
, <name><surname>Schaffer</surname>
<given-names>AA</given-names>
</name>
, <name><surname>Zhang</surname>
<given-names>JH</given-names>
</name>
, <name><surname>Zhang</surname>
<given-names>Z</given-names>
</name>
, <etal>et al</etal>
(<year>1997</year>
) <article-title>Gapped BLAST and PSI-BLAST: a new generation of protein database search programs</article-title>
. <source>Nucleic Acids Research</source>
<volume>25</volume>
: <fpage>3389</fpage>
–<lpage>3402</lpage>
<pub-id pub-id-type="pmid">9254694</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Birney1"><label>38</label>
<mixed-citation publication-type="journal"><name><surname>Birney</surname>
<given-names>E</given-names>
</name>
, <name><surname>Clamp</surname>
<given-names>M</given-names>
</name>
, <name><surname>Durbin</surname>
<given-names>R</given-names>
</name>
(<year>2004</year>
) <article-title>GeneWise and genomewise</article-title>
. <source>Genome Research</source>
<volume>14</volume>
: <fpage>988</fpage>
–<lpage>995</lpage>
<pub-id pub-id-type="pmid">15123596</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Crowhurst1"><label>39</label>
<mixed-citation publication-type="other">Crowhurst RN, Davy M, Deng C (2006) BioView - an enterprise bioinformatics system for automated analysis and annotation of non-genomic DNA sequence. In: Gardiner S, editor; Napier, New Zealand.</mixed-citation>
</ref>
<ref id="pone.0092644-Suzek1"><label>40</label>
<mixed-citation publication-type="journal"><name><surname>Suzek</surname>
<given-names>BE</given-names>
</name>
, <name><surname>Huang</surname>
<given-names>H</given-names>
</name>
, <name><surname>McGarvey</surname>
<given-names>P</given-names>
</name>
, <name><surname>Mazumder</surname>
<given-names>R</given-names>
</name>
, <name><surname>Wu</surname>
<given-names>CH</given-names>
</name>
(<year>2007</year>
) <article-title>UniRef: comprehensive and non-redundant UniProt reference clusters</article-title>
. <source>Bioinformatics</source>
<volume>23</volume>
: <fpage>1282</fpage>
–<lpage>1288</lpage>
<pub-id pub-id-type="pmid">17379688</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Pruitt1"><label>41</label>
<mixed-citation publication-type="journal"><name><surname>Pruitt</surname>
<given-names>KD</given-names>
</name>
, <name><surname>Tatusova</surname>
<given-names>T</given-names>
</name>
, <name><surname>Brown</surname>
<given-names>GR</given-names>
</name>
, <name><surname>Maglott</surname>
<given-names>DR</given-names>
</name>
(<year>2012</year>
) <article-title>NCBI Reference Sequences (RefSeq): current status, new features and genome annotation policy</article-title>
. <source>Nucleic Acids Research</source>
<volume>40</volume>
: <fpage>D130</fpage>
–<lpage>D135</lpage>
<pub-id pub-id-type="pmid">22121212</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Mulder1"><label>42</label>
<mixed-citation publication-type="journal"><name><surname>Mulder</surname>
<given-names>N</given-names>
</name>
, <name><surname>Apweiler</surname>
<given-names>R</given-names>
</name>
(<year>2007</year>
) <article-title>InterPro and InterProScan: tools for protein sequence classification and comparison</article-title>
. <source>Methods in molecular biology (Clifton, NJ)</source>
<volume>396</volume>
: <fpage>59</fpage>
–<lpage>70</lpage>
</mixed-citation>
</ref>
<ref id="pone.0092644-Li1"><label>43</label>
<mixed-citation publication-type="journal"><name><surname>Li</surname>
<given-names>L</given-names>
</name>
, <name><surname>Stoeckert</surname>
<given-names>CJ</given-names>
</name>
, <name><surname>Roos</surname>
<given-names>DS</given-names>
</name>
(<year>2003</year>
) <article-title>OrthoMCL: Identification of ortholog groups for eukaryotic genomes</article-title>
. <source>Genome Research</source>
<volume>13</volume>
: <fpage>2178</fpage>
–<lpage>2189</lpage>
<pub-id pub-id-type="pmid">12952885</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Li2"><label>44</label>
<mixed-citation publication-type="journal"><name><surname>Li</surname>
<given-names>Y</given-names>
</name>
, <name><surname>Darley</surname>
<given-names>CP</given-names>
</name>
, <name><surname>Ongaro</surname>
<given-names>V</given-names>
</name>
, <name><surname>Fleming</surname>
<given-names>A</given-names>
</name>
, <name><surname>Schipper</surname>
<given-names>O</given-names>
</name>
, <etal>et al</etal>
(<year>2002</year>
) <article-title>Plant expansins are a complex multigene family with an ancient evolutionary origin</article-title>
. <source>Plant Physiol</source>
<volume>128</volume>
: <fpage>854</fpage>
–<lpage>864</lpage>
<pub-id pub-id-type="pmid">11891242</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Price1"><label>45</label>
<mixed-citation publication-type="journal"><name><surname>Price</surname>
<given-names>AL</given-names>
</name>
, <name><surname>Jones</surname>
<given-names>NC</given-names>
</name>
, <name><surname>Pevzner</surname>
<given-names>PA</given-names>
</name>
(<year>2005</year>
) <article-title>De novo identification of repeat families in large genomes</article-title>
. <source>Bioinformatics</source>
<volume>21</volume>
: <fpage>i351</fpage>
–<lpage>i358</lpage>
<pub-id pub-id-type="pmid">15961478</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Abrusn1"><label>46</label>
<mixed-citation publication-type="journal"><name><surname>Abrusán</surname>
<given-names>G</given-names>
</name>
, <name><surname>Grundmann</surname>
<given-names>N</given-names>
</name>
, <name><surname>DeMester</surname>
<given-names>L</given-names>
</name>
, <name><surname>Makalowski</surname>
<given-names>W</given-names>
</name>
(<year>2009</year>
) <article-title>TEclass—a tool for automated classification of unknown eukaryotic transposable elements</article-title>
. <source>Bioinformatics</source>
<volume>25</volume>
: <fpage>1329</fpage>
–<lpage>1330</lpage>
<pub-id pub-id-type="pmid">19349283</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Li3"><label>47</label>
<mixed-citation publication-type="journal"><name><surname>Li</surname>
<given-names>RQ</given-names>
</name>
, <name><surname>Yu</surname>
<given-names>C</given-names>
</name>
, <name><surname>Li</surname>
<given-names>YR</given-names>
</name>
, <name><surname>Lam</surname>
<given-names>TW</given-names>
</name>
, <name><surname>Yiu</surname>
<given-names>SM</given-names>
</name>
, <etal>et al</etal>
(<year>2009</year>
) <article-title>SOAP2: an improved ultrafast tool for short read alignment</article-title>
. <source>Bioinformatics</source>
<volume>25</volume>
: <fpage>1966</fpage>
–<lpage>1967</lpage>
<pub-id pub-id-type="pmid">19497933</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Wang1"><label>48</label>
<mixed-citation publication-type="journal"><name><surname>Wang</surname>
<given-names>J</given-names>
</name>
, <name><surname>Li</surname>
<given-names>R</given-names>
</name>
, <name><surname>Li</surname>
<given-names>Y</given-names>
</name>
, <name><surname>Fang</surname>
<given-names>X</given-names>
</name>
, <name><surname>Feng</surname>
<given-names>B</given-names>
</name>
, <etal>et al</etal>
(<year>2008</year>
) <article-title>Genome resequencing and identification of variations by Illumina Genome Analyzer Reads</article-title>
. <source>Protocol Exchange</source>
</mixed-citation>
</ref>
<ref id="pone.0092644-Arumuganathan1"><label>49</label>
<mixed-citation publication-type="journal"><name><surname>Arumuganathan</surname>
<given-names>K</given-names>
</name>
, <name><surname>Earle</surname>
<given-names>E</given-names>
</name>
(<year>1991</year>
) <article-title>Nuclear DNA content of some important plant species</article-title>
. <source>Plant Molecular Biology Reporter</source>
<volume>9</volume>
: <fpage>208</fpage>
–<lpage>218</lpage>
</mixed-citation>
</ref>
<ref id="pone.0092644-Kende1"><label>50</label>
<mixed-citation publication-type="journal"><name><surname>Kende</surname>
<given-names>H</given-names>
</name>
, <name><surname>Bradford</surname>
<given-names>KJ</given-names>
</name>
, <name><surname>Brummell</surname>
<given-names>DA</given-names>
</name>
, <name><surname>Cho</surname>
<given-names>HT</given-names>
</name>
, <name><surname>Cosgrove</surname>
<given-names>DJ</given-names>
</name>
, <etal>et al</etal>
(<year>2004</year>
) <article-title>Nomenclature for members of the expansin superfamily of genes and proteins</article-title>
. <source>Plant Molecular Biology</source>
<volume>55</volume>
: <fpage>311</fpage>
–<lpage>314</lpage>
<pub-id pub-id-type="pmid">15604683</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Schaffer2"><label>51</label>
<mixed-citation publication-type="journal"><name><surname>Schaffer</surname>
<given-names>RJ</given-names>
</name>
, <name><surname>Ireland</surname>
<given-names>HS</given-names>
</name>
, <name><surname>Ross</surname>
<given-names>JJ</given-names>
</name>
, <name><surname>Ling</surname>
<given-names>TJ</given-names>
</name>
, <name><surname>David</surname>
<given-names>KM</given-names>
</name>
(<year>2012</year>
) <article-title>SEPALLATA1/2-suppressed mature apples have high auxin and reduced transcription of ripening-related genes</article-title>
. <source>Annals of Botany Plants</source>
</mixed-citation>
</ref>
<ref id="pone.0092644-Brummell1"><label>52</label>
<mixed-citation publication-type="journal"><name><surname>Brummell</surname>
<given-names>DA</given-names>
</name>
, <name><surname>Harpster</surname>
<given-names>MH</given-names>
</name>
, <name><surname>Civello</surname>
<given-names>PM</given-names>
</name>
, <name><surname>Palys</surname>
<given-names>JM</given-names>
</name>
, <name><surname>Bennett</surname>
<given-names>AB</given-names>
</name>
, <etal>et al</etal>
(<year>1999</year>
) <article-title>Modification of expansin protein abundance in tomato fruit alters softening and cell wall polymer metabolism during ripening</article-title>
. <source>Plant Cell</source>
<volume>11</volume>
: <fpage>2203</fpage>
–<lpage>2216</lpage>
<pub-id pub-id-type="pmid">10559444</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Hiwasa1"><label>53</label>
<mixed-citation publication-type="journal"><name><surname>Hiwasa</surname>
<given-names>K</given-names>
</name>
, <name><surname>Rose</surname>
<given-names>JKC</given-names>
</name>
, <name><surname>Nakano</surname>
<given-names>R</given-names>
</name>
, <name><surname>Inaba</surname>
<given-names>A</given-names>
</name>
, <name><surname>Kubo</surname>
<given-names>Y</given-names>
</name>
(<year>2003</year>
) <article-title>Differential expression of seven alpha-expansin genes during growth and ripening of pear fruit</article-title>
. <source>Physiologia Plantarum</source>
<volume>117</volume>
: <fpage>564</fpage>
–<lpage>572</lpage>
<pub-id pub-id-type="pmid">12675747</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Wakasa1"><label>54</label>
<mixed-citation publication-type="journal"><name><surname>Wakasa</surname>
<given-names>Y</given-names>
</name>
, <name><surname>Hatsuyama</surname>
<given-names>Y</given-names>
</name>
, <name><surname>Takahashi</surname>
<given-names>A</given-names>
</name>
, <name><surname>Sato</surname>
<given-names>T</given-names>
</name>
, <name><surname>Niizeki</surname>
<given-names>M</given-names>
</name>
, <etal>et al</etal>
(<year>2003</year>
) <article-title>Divergent expression of six expansin genes during apple fruit ontogeny</article-title>
. <source>European Journal of Horticultural Science</source>
<volume>68</volume>
: <fpage>253</fpage>
–<lpage>259</lpage>
</mixed-citation>
</ref>
<ref id="pone.0092644-Fonseca1"><label>55</label>
<mixed-citation publication-type="journal"><name><surname>Fonseca</surname>
<given-names>S</given-names>
</name>
, <name><surname>Monteiro</surname>
<given-names>L</given-names>
</name>
, <name><surname>Barreiro</surname>
<given-names>MG</given-names>
</name>
, <name><surname>Pais</surname>
<given-names>MS</given-names>
</name>
(<year>2005</year>
) <article-title>Expression of genes encoding cell wall modifying enzymes is induced by cold storage and reflects changes in pear fruit texture</article-title>
. <source>Journal of Experimental Botany</source>
<volume>56</volume>
: <fpage>2029</fpage>
–<lpage>2036</lpage>
<pub-id pub-id-type="pmid">15955791</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0092644-Goulao1"><label>56</label>
<mixed-citation publication-type="journal"><name><surname>Goulao</surname>
<given-names>LF</given-names>
</name>
, <name><surname>Cosgrove</surname>
<given-names>DJ</given-names>
</name>
, <name><surname>Oliveira</surname>
<given-names>CM</given-names>
</name>
(<year>2008</year>
) <article-title>Cloning, characterisation and expression analyses of cDNA clones encoding cell wall-modifying enzymes isolated from ripe apples</article-title>
. <source>Postharvest Biology and Technology</source>
<volume>48</volume>
: <fpage>37</fpage>
–<lpage>51</lpage>
</mixed-citation>
</ref>
<ref id="pone.0092644-Trujillo1"><label>57</label>
<mixed-citation publication-type="journal"><name><surname>Trujillo</surname>
<given-names>DI</given-names>
</name>
, <name><surname>Mann</surname>
<given-names>HS</given-names>
</name>
, <name><surname>Tong</surname>
<given-names>CBS</given-names>
</name>
(<year>2012</year>
) <article-title>Examination of expansin genes as related to apple fruit crispness</article-title>
. <source>Tree Genetics & Genomes</source>
<volume>8</volume>
: <fpage>27</fpage>
–<lpage>38</lpage>
</mixed-citation>
</ref>
<ref id="pone.0092644-Costa1"><label>58</label>
<mixed-citation publication-type="journal"><name><surname>Costa</surname>
<given-names>F</given-names>
</name>
, <name><surname>Van de Weg</surname>
<given-names>WE</given-names>
</name>
, <name><surname>Stella</surname>
<given-names>S</given-names>
</name>
, <name><surname>Dondini</surname>
<given-names>L</given-names>
</name>
, <name><surname>Pratesi</surname>
<given-names>D</given-names>
</name>
, <etal>et al</etal>
(<year>2008</year>
) <article-title>Map position and functional allelic diversity of <italic>Md-Exp7</italic>
, a new putative expansin gene associated with fruit softening in apple (<italic>Malus</italic>
×<italic>domestica</italic>
Borkh.) and pear (<italic>Pyrus communis</italic>
)</article-title>
. <source>Tree Genetics & Genomes</source>
<volume>4</volume>
: <fpage>575</fpage>
–<lpage>586</lpage>
</mixed-citation>
</ref>
<ref id="pone.0092644-Verde2"><label>59</label>
<mixed-citation publication-type="journal"><name><surname>Verde</surname>
<given-names>I</given-names>
</name>
, <name><surname>Bassil</surname>
<given-names>N</given-names>
</name>
, <name><surname>Scalabrin</surname>
<given-names>S</given-names>
</name>
, <name><surname>Gilmore</surname>
<given-names>B</given-names>
</name>
, <name><surname>Lawley</surname>
<given-names>CT</given-names>
</name>
, <etal>et al</etal>
(<year>2012</year>
) <article-title>Development and evaluation of a 9K SNP array for peach by internationally coordinated SNP detection and validation in breeding germplasm</article-title>
. <source>PLoS One</source>
<volume>7</volume>
</mixed-citation>
</ref>
<ref id="pone.0092644-Elshire1"><label>60</label>
<mixed-citation publication-type="journal"><name><surname>Elshire</surname>
<given-names>RJ</given-names>
</name>
, <name><surname>Glaubitz</surname>
<given-names>JC</given-names>
</name>
, <name><surname>Sun</surname>
<given-names>Q</given-names>
</name>
, <name><surname>Poland</surname>
<given-names>JA</given-names>
</name>
, <name><surname>Kawamoto</surname>
<given-names>K</given-names>
</name>
, <etal>et al</etal>
(<year>2011</year>
) <article-title>A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species</article-title>
. <source>PLoS One</source>
<volume>6</volume>
</mixed-citation>
</ref>
<ref id="pone.0092644-Kumar2"><label>61</label>
<mixed-citation publication-type="journal"><name><surname>Kumar</surname>
<given-names>S</given-names>
</name>
, <name><surname>Bink</surname>
<given-names>MCAM</given-names>
</name>
, <name><surname>Volz</surname>
<given-names>RK</given-names>
</name>
, <name><surname>Bus</surname>
<given-names>VGM</given-names>
</name>
, <name><surname>Chagné</surname>
<given-names>D</given-names>
</name>
(<year>2012</year>
) <article-title>Towards genomic selection in apple (<italic>Malus</italic>
×<italic>domestica</italic>
Borkh.) breeding programmes: Prospects, challenges and strategies</article-title>
. <source>Tree Genetics & Genomes</source>
<volume>8</volume>
: <fpage>1</fpage>
–<lpage>14</lpage>
</mixed-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 001195 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 001195 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Bois |area= OrangerV1 |flux= Pmc |étape= Corpus |type= RBID |clé= |texte= }}
![]() | This area was generated with Dilib version V0.6.25. | ![]() |