Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 001127 ( Pmc/Corpus ); précédent : 0011269; suivant : 0011280 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">A Dark Incubation Period Is Important for
<italic>Agrobacterium</italic>
-Mediated Transformation of Mature Internode Explants of Sweet Orange, Grapefruit, Citron, and a Citrange Rootstock</title>
<author>
<name sortKey="Marutani Hert, Mizuri" sort="Marutani Hert, Mizuri" uniqKey="Marutani Hert M" first="Mizuri" last="Marutani-Hert">Mizuri Marutani-Hert</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bowman, Kim D" sort="Bowman, Kim D" uniqKey="Bowman K" first="Kim D." last="Bowman">Kim D. Bowman</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mccollum, Greg T" sort="Mccollum, Greg T" uniqKey="Mccollum G" first="Greg T." last="Mccollum">Greg T. Mccollum</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mirkov, T Erik" sort="Mirkov, T Erik" uniqKey="Mirkov T" first="T. Erik" last="Mirkov">T. Erik Mirkov</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Department of Plant Pathology and Microbiology, Texas A&M University, Texas AgriLIFE Research, Weslaco, Texas, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Evens, Terence J" sort="Evens, Terence J" uniqKey="Evens T" first="Terence J." last="Evens">Terence J. Evens</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Niedz, Randall P" sort="Niedz, Randall P" uniqKey="Niedz R" first="Randall P." last="Niedz">Randall P. Niedz</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">23082165</idno>
<idno type="pmc">3474820</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3474820</idno>
<idno type="RBID">PMC:3474820</idno>
<idno type="doi">10.1371/journal.pone.0047426</idno>
<date when="2012">2012</date>
<idno type="wicri:Area/Pmc/Corpus">001127</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">A Dark Incubation Period Is Important for
<italic>Agrobacterium</italic>
-Mediated Transformation of Mature Internode Explants of Sweet Orange, Grapefruit, Citron, and a Citrange Rootstock</title>
<author>
<name sortKey="Marutani Hert, Mizuri" sort="Marutani Hert, Mizuri" uniqKey="Marutani Hert M" first="Mizuri" last="Marutani-Hert">Mizuri Marutani-Hert</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bowman, Kim D" sort="Bowman, Kim D" uniqKey="Bowman K" first="Kim D." last="Bowman">Kim D. Bowman</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mccollum, Greg T" sort="Mccollum, Greg T" uniqKey="Mccollum G" first="Greg T." last="Mccollum">Greg T. Mccollum</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Mirkov, T Erik" sort="Mirkov, T Erik" uniqKey="Mirkov T" first="T. Erik" last="Mirkov">T. Erik Mirkov</name>
<affiliation>
<nlm:aff id="aff2">
<addr-line>Department of Plant Pathology and Microbiology, Texas A&M University, Texas AgriLIFE Research, Weslaco, Texas, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Evens, Terence J" sort="Evens, Terence J" uniqKey="Evens T" first="Terence J." last="Evens">Terence J. Evens</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Niedz, Randall P" sort="Niedz, Randall P" uniqKey="Niedz R" first="Randall P." last="Niedz">Randall P. Niedz</name>
<affiliation>
<nlm:aff id="aff1">
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">PLoS ONE</title>
<idno type="eISSN">1932-6203</idno>
<imprint>
<date when="2012">2012</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>Citrus has an extended juvenile phase and trees can take 2–20 years to transition to the adult reproductive phase and produce fruit. For citrus variety development this substantially prolongs the time before adult traits, such as fruit yield and quality, can be evaluated. Methods to transform tissue from mature citrus trees would shorten the evaluation period via the direct production of adult phase transgenic citrus trees.</p>
</sec>
<sec>
<title>Methodology/Principal Findings</title>
<p>Factors important for promoting shoot regeneration from internode explants from adult phase citrus trees were identified and included a dark incubation period and the use of the cytokinin zeatin riboside. Transgenic trees were produced from four citrus types including sweet orange, citron, grapefruit, and a trifoliate hybrid using the identified factors and factor settings.</p>
</sec>
<sec>
<title>Significance</title>
<p>The critical importance of a dark incubation period for shoot regeneration was established. These results confirm previous reports on the feasibility of transforming mature tissue from sweet orange and are the first to document the transformation of mature tissue from grapefruit, citron, and a trifoliate hybrid.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Bove, Jm" uniqKey="Bove J">JM Bové</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hidaka, T" uniqKey="Hidaka T">T Hidaka</name>
</author>
<author>
<name sortKey="Omura, M" uniqKey="Omura M">M Omura</name>
</author>
<author>
<name sortKey="Ugaki, M" uniqKey="Ugaki M">M Ugaki</name>
</author>
<author>
<name sortKey="Tomiyama, M" uniqKey="Tomiyama M">M Tomiyama</name>
</author>
<author>
<name sortKey="Kato, A" uniqKey="Kato A">A Kato</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moore, Ga" uniqKey="Moore G">GA Moore</name>
</author>
<author>
<name sortKey="Jacono, Cc" uniqKey="Jacono C">CC Jacono</name>
</author>
<author>
<name sortKey="Neidigh, Jl" uniqKey="Neidigh J">JL Neidigh</name>
</author>
<author>
<name sortKey="Lawrence, Sd" uniqKey="Lawrence S">SD Lawrence</name>
</author>
<author>
<name sortKey="Cline, K" uniqKey="Cline K">K Cline</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="He, Y" uniqKey="He Y">Y He</name>
</author>
<author>
<name sortKey="Chen, S" uniqKey="Chen S">S Chen</name>
</author>
<author>
<name sortKey="Peng, A" uniqKey="Peng A">A Peng</name>
</author>
<author>
<name sortKey="Zou, X" uniqKey="Zou X">X Zou</name>
</author>
<author>
<name sortKey="Xu, L" uniqKey="Xu L">L Xu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xu, Sx" uniqKey="Xu S">SX Xu</name>
</author>
<author>
<name sortKey="Cai, Xd" uniqKey="Cai X">XD Cai</name>
</author>
<author>
<name sortKey="Tan, B" uniqKey="Tan B">B Tan</name>
</author>
<author>
<name sortKey="Guo, Ww" uniqKey="Guo W">WW Guo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, L" uniqKey="Yang L">L Yang</name>
</author>
<author>
<name sortKey="Hu, C" uniqKey="Hu C">C Hu</name>
</author>
<author>
<name sortKey="Li, N" uniqKey="Li N">N Li</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J Zhang</name>
</author>
<author>
<name sortKey="Yan, J" uniqKey="Yan J">J Yan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fu, Xz" uniqKey="Fu X">XZ Fu</name>
</author>
<author>
<name sortKey="Chen, Cw" uniqKey="Chen C">CW Chen</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author>
<name sortKey="Liu, Jh" uniqKey="Liu J">JH Liu</name>
</author>
<author>
<name sortKey="Moriguchi, T" uniqKey="Moriguchi T">T Moriguchi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Khawale, Rn" uniqKey="Khawale R">RN Khawale</name>
</author>
<author>
<name sortKey="Singh, Sk" uniqKey="Singh S">SK Singh</name>
</author>
<author>
<name sortKey="Garg, G" uniqKey="Garg G">G Garg</name>
</author>
<author>
<name sortKey="Baranwal, Vk" uniqKey="Baranwal V">VK Baranwal</name>
</author>
<author>
<name sortKey="Ajirlo, Sa" uniqKey="Ajirlo S">SA Ajirlo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cervera, M" uniqKey="Cervera M">M Cervera</name>
</author>
<author>
<name sortKey="Navarro, A" uniqKey="Navarro A">A Navarro</name>
</author>
<author>
<name sortKey="Navarro, L" uniqKey="Navarro L">L Navarro</name>
</author>
<author>
<name sortKey="Pe A, L" uniqKey="Pe A L">L Peña</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Luth, D" uniqKey="Luth D">D Luth</name>
</author>
<author>
<name sortKey="Moore, G" uniqKey="Moore G">G Moore</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, Zn" uniqKey="Yang Z">ZN Yang</name>
</author>
<author>
<name sortKey="Ingelbrecht, Il" uniqKey="Ingelbrecht I">IL Ingelbrecht</name>
</author>
<author>
<name sortKey="Louzada, E" uniqKey="Louzada E">E Louzada</name>
</author>
<author>
<name sortKey="Skaria, M" uniqKey="Skaria M">M Skaria</name>
</author>
<author>
<name sortKey="Mirkov, Te" uniqKey="Mirkov T">TE Mirkov</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ananthakrishnan, G" uniqKey="Ananthakrishnan G">G Ananthakrishnan</name>
</author>
<author>
<name sortKey="Orbovic, V" uniqKey="Orbovic V">V Orbovic</name>
</author>
<author>
<name sortKey="Pasquali, G" uniqKey="Pasquali G">G Pasquali</name>
</author>
<author>
<name sortKey="Calovic, M" uniqKey="Calovic M">M Calovic</name>
</author>
<author>
<name sortKey="Grosser, Jw" uniqKey="Grosser J">JW Grosser</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Loeza Kuk, E" uniqKey="Loeza Kuk E">E Loeza-Kuk</name>
</author>
<author>
<name sortKey="Gutierrez Espinosa, Ma" uniqKey="Gutierrez Espinosa M">MA Gutiérrez-Espinosa</name>
</author>
<author>
<name sortKey="Ochoa Martinez, Dl" uniqKey="Ochoa Martinez D">DL Ochoa-Martínez</name>
</author>
<author>
<name sortKey="Villegas Monter, A" uniqKey="Villegas Monter A">A Villegas-Monter</name>
</author>
<author>
<name sortKey="Mora Aguilera, G" uniqKey="Mora Aguilera G">G Mora-Aguilera</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ghorbel, R" uniqKey="Ghorbel R">R Ghorbel</name>
</author>
<author>
<name sortKey="La Malfa, S" uniqKey="La Malfa S">S La-Malfa</name>
</author>
<author>
<name sortKey="Lopez, Mm" uniqKey="Lopez M">MM Lopez</name>
</author>
<author>
<name sortKey="Petit, A" uniqKey="Petit A">A Petit</name>
</author>
<author>
<name sortKey="Navarro, L" uniqKey="Navarro L">L Navarro</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Enrique, R" uniqKey="Enrique R">R Enrique</name>
</author>
<author>
<name sortKey="Siciliano, F" uniqKey="Siciliano F">F Siciliano</name>
</author>
<author>
<name sortKey="Favaro, Ma" uniqKey="Favaro M">MA Favaro</name>
</author>
<author>
<name sortKey="Gerhardt, N" uniqKey="Gerhardt N">N Gerhardt</name>
</author>
<author>
<name sortKey="Roeschlin, R" uniqKey="Roeschlin R">R Roeschlin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pe A, L" uniqKey="Pe A L">L Peña</name>
</author>
<author>
<name sortKey="Cervera, M" uniqKey="Cervera M">M Cervera</name>
</author>
<author>
<name sortKey="Juarez, J" uniqKey="Juarez J">J Juárez</name>
</author>
<author>
<name sortKey="Navarro, A" uniqKey="Navarro A">A Navarro</name>
</author>
<author>
<name sortKey="Pina, Ja" uniqKey="Pina J">JA Pina</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dutt, M" uniqKey="Dutt M">M Dutt</name>
</author>
<author>
<name sortKey="Vasconcellos, M" uniqKey="Vasconcellos M">M Vasconcellos</name>
</author>
<author>
<name sortKey="Grosser, Jw" uniqKey="Grosser J">JW Grosser</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kaneyoshi, J" uniqKey="Kaneyoshi J">J Kaneyoshi</name>
</author>
<author>
<name sortKey="Kobayashi, S" uniqKey="Kobayashi S">S Kobayashi</name>
</author>
<author>
<name sortKey="Nakamura, Y" uniqKey="Nakamura Y">Y Nakamura</name>
</author>
<author>
<name sortKey="Shigemoto, N" uniqKey="Shigemoto N">N Shigemoto</name>
</author>
<author>
<name sortKey="Doi, Y" uniqKey="Doi Y">Y Doi</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Molinari, Hbc" uniqKey="Molinari H">HBC Molinari</name>
</author>
<author>
<name sortKey="Bespalhok, Jc" uniqKey="Bespalhok J">JC Bespalhok</name>
</author>
<author>
<name sortKey="Kobayashi, Ak" uniqKey="Kobayashi A">AK Kobayashi</name>
</author>
<author>
<name sortKey="Pereira, Lfp" uniqKey="Pereira L">LFP Pereira</name>
</author>
<author>
<name sortKey="Vieira, Lge" uniqKey="Vieira L">LGE Vieira</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cervera, M" uniqKey="Cervera M">M Cervera</name>
</author>
<author>
<name sortKey="Juarez, J" uniqKey="Juarez J">J Juarez</name>
</author>
<author>
<name sortKey="Navarro, A" uniqKey="Navarro A">A Navarro</name>
</author>
<author>
<name sortKey="Pina, Ja" uniqKey="Pina J">JA Pina</name>
</author>
<author>
<name sortKey="Duran Vila, N" uniqKey="Duran Vila N">N Duran-Vila</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Almeida, Wab" uniqKey="Almeida W">WAB Almeida</name>
</author>
<author>
<name sortKey="Mourao Filhoa, Faa" uniqKey="Mourao Filhoa F">FAA Mourão Filhoa</name>
</author>
<author>
<name sortKey="Pinoa, Le" uniqKey="Pinoa L">LE Pinoa</name>
</author>
<author>
<name sortKey="Boscariol, Rl" uniqKey="Boscariol R">RL Boscariol</name>
</author>
<author>
<name sortKey="Rodriguez, Apm" uniqKey="Rodriguez A">APM Rodriguez</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rodriguez, A" uniqKey="Rodriguez A">A Rodríguez</name>
</author>
<author>
<name sortKey="Cervera, M" uniqKey="Cervera M">M Cervera</name>
</author>
<author>
<name sortKey="Peris, Je" uniqKey="Peris J">JE Peris</name>
</author>
<author>
<name sortKey="Pe A, L" uniqKey="Pe A L">L Peña</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Marutani Hert, M" uniqKey="Marutani Hert M">M Marutani-Hert</name>
</author>
<author>
<name sortKey="Evens, Tj" uniqKey="Evens T">TJ Evens</name>
</author>
<author>
<name sortKey="Mccollum, Gt" uniqKey="Mccollum G">GT McCollum</name>
</author>
<author>
<name sortKey="Niedz, Rp" uniqKey="Niedz R">RP Niedz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Murashige, T" uniqKey="Murashige T">T Murashige</name>
</author>
<author>
<name sortKey="Skoog, F" uniqKey="Skoog F">F Skoog</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hood, Ee" uniqKey="Hood E">EE Hood</name>
</author>
<author>
<name sortKey="Gelvin, Sb" uniqKey="Gelvin S">SB Gelvin</name>
</author>
<author>
<name sortKey="Melchers, Ls" uniqKey="Melchers L">LS Melchers</name>
</author>
<author>
<name sortKey="Hoekema, A" uniqKey="Hoekema A">A Hoekema</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vancanneyt, G" uniqKey="Vancanneyt G">G Vancanneyt</name>
</author>
<author>
<name sortKey="Schmidt, R" uniqKey="Schmidt R">R Schmidt</name>
</author>
<author>
<name sortKey="O Onner Sanchez, A" uniqKey="O Onner Sanchez A">A O’Conner-Sanchez</name>
</author>
<author>
<name sortKey="Willmitzer, L" uniqKey="Willmitzer L">L Willmitzer</name>
</author>
<author>
<name sortKey="Ro Cha Sosa, M" uniqKey="Ro Cha Sosa M">M Ro-cha-Sosa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bowman, Kd" uniqKey="Bowman K">KD Bowman</name>
</author>
<author>
<name sortKey="Rouse, Re" uniqKey="Rouse R">RE Rouse</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jefferson, Ra" uniqKey="Jefferson R">RA Jefferson</name>
</author>
<author>
<name sortKey="Kavanagh, Ta" uniqKey="Kavanagh T">TA Kavanagh</name>
</author>
<author>
<name sortKey="Bevan, Mw" uniqKey="Bevan M">MW Bevan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Franche, C" uniqKey="Franche C">C Franche</name>
</author>
<author>
<name sortKey="Diouf, D" uniqKey="Diouf D">D Diouf</name>
</author>
<author>
<name sortKey="Le, Qv" uniqKey="Le Q">QV Le</name>
</author>
<author>
<name sortKey="Bogusz, D" uniqKey="Bogusz D">D Bogusz</name>
</author>
<author>
<name sortKey="N Diaye, A" uniqKey="N Diaye A">A N'Diaye</name>
</author>
<author>
<name sortKey="Gherbi, H" uniqKey="Gherbi H">H Gherbi</name>
</author>
<author>
<name sortKey="Gobe, C" uniqKey="Gobe C">C Gobe</name>
</author>
<author>
<name sortKey="Duhoux, E" uniqKey="Duhoux E">E Duhoux</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dellaporta, J" uniqKey="Dellaporta J">J DellaPorta</name>
</author>
<author>
<name sortKey="Wood, J" uniqKey="Wood J">J Wood</name>
</author>
<author>
<name sortKey="Hicks, Jb" uniqKey="Hicks J">JB Hicks</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Niedz, Rp" uniqKey="Niedz R">RP Niedz</name>
</author>
<author>
<name sortKey="Evens, Tj" uniqKey="Evens T">TJ Evens</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Duran Vila, N" uniqKey="Duran Vila N">N Duran-Vila</name>
</author>
<author>
<name sortKey="Gogorcena, Y" uniqKey="Gogorcena Y">Y Gogorcena</name>
</author>
<author>
<name sortKey="Ortega, V" uniqKey="Ortega V">V Ortega</name>
</author>
<author>
<name sortKey="Ortiz, J" uniqKey="Ortiz J">J Ortiz</name>
</author>
<author>
<name sortKey="Navarro, L" uniqKey="Navarro L">L Navarro</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moreira Dias, Jm" uniqKey="Moreira Dias J">JM Moreira-Dias</name>
</author>
<author>
<name sortKey="Molina, Rv" uniqKey="Molina R">RV Molina</name>
</author>
<author>
<name sortKey="Bord N, Y" uniqKey="Bord N Y">Y Bordón</name>
</author>
<author>
<name sortKey="Guadiola, Jl" uniqKey="Guadiola J">JL Guadiola</name>
</author>
<author>
<name sortKey="Garcia Luis, A" uniqKey="Garcia Luis A">A García-Luis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kobayashi, Ak" uniqKey="Kobayashi A">AK Kobayashi</name>
</author>
<author>
<name sortKey="Bespalhok, Jc" uniqKey="Bespalhok J">JC Bespalhok</name>
</author>
<author>
<name sortKey="Pereira, Lep" uniqKey="Pereira L">LEP Pereira</name>
</author>
<author>
<name sortKey="Vieira, Lge" uniqKey="Vieira L">LGE Vieira</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Oliveira Mlp, De" uniqKey="Oliveira Mlp D">de Oliveira MLP</name>
</author>
<author>
<name sortKey="Costa, Mgc" uniqKey="Costa M">MGC Costa</name>
</author>
<author>
<name sortKey="Silva Cv, Da" uniqKey="Silva Cv D">da Silva CV</name>
</author>
<author>
<name sortKey="Otoni, Wc" uniqKey="Otoni W">WC Otoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bassan, Mm" uniqKey="Bassan M">MM Bassan</name>
</author>
<author>
<name sortKey="Filho F De, Aam" uniqKey="Filho F De A">AAM Filho F de</name>
</author>
<author>
<name sortKey="Miyata, Ly" uniqKey="Miyata L">LY Miyata</name>
</author>
<author>
<name sortKey="Mendes, Bmj" uniqKey="Mendes B">BMJ Mendes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Curtis, Is" uniqKey="Curtis I">IS Curtis</name>
</author>
<author>
<name sortKey="Mirkov, Te" uniqKey="Mirkov T">TE Mirkov</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cruz De Carvalho, Mh" uniqKey="Cruz De Carvalho M">MH Cruz de Carvalho</name>
</author>
<author>
<name sortKey="Le, Bv" uniqKey="Le B">BV Le</name>
</author>
<author>
<name sortKey="Zuily Fodil, Y" uniqKey="Zuily Fodil Y">Y Zuily-Fodil</name>
</author>
<author>
<name sortKey="Pham Thi, At" uniqKey="Pham Thi A">AT Pham Thi</name>
</author>
<author>
<name sortKey="Thanh Van, Kt" uniqKey="Thanh Van K">KT Thanh Van</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Uliaie, Ed" uniqKey="Uliaie E">ED Uliaie</name>
</author>
<author>
<name sortKey="Farsi, M" uniqKey="Farsi M">M Farsi</name>
</author>
<author>
<name sortKey="Ghreyazie, B" uniqKey="Ghreyazie B">B Ghreyazie</name>
</author>
<author>
<name sortKey="Imani, J" uniqKey="Imani J">J Imani</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Naik, Sk" uniqKey="Naik S">SK Naik</name>
</author>
<author>
<name sortKey="Chand, Pk" uniqKey="Chand P">PK Chand</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Geekiyanage, S" uniqKey="Geekiyanage S">S Geekiyanage</name>
</author>
<author>
<name sortKey="Takase, T" uniqKey="Takase T">T Takase</name>
</author>
<author>
<name sortKey="Watanabe, S" uniqKey="Watanabe S">S Watanabe</name>
</author>
<author>
<name sortKey="Fukai, S" uniqKey="Fukai S">S Fukai</name>
</author>
<author>
<name sortKey="Kiyosue, T" uniqKey="Kiyosue T">T Kiyosue</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Saini, Hk" uniqKey="Saini H">HK Saini</name>
</author>
<author>
<name sortKey="Gill, Ms" uniqKey="Gill M">MS Gill</name>
</author>
<author>
<name sortKey="Gill, Mis" uniqKey="Gill M">MIS Gill</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Perez Tornero, O" uniqKey="Perez Tornero O">O Perez-Tornero</name>
</author>
<author>
<name sortKey="Tallon, Ci" uniqKey="Tallon C">CI Tallon</name>
</author>
<author>
<name sortKey="Porras, I" uniqKey="Porras I">I Porras</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Peixoto De Oliveira, Ml" uniqKey="Peixoto De Oliveira M">ML Peixoto de Oliveira</name>
</author>
<author>
<name sortKey="Costa, Mgc" uniqKey="Costa M">MGC Costa</name>
</author>
<author>
<name sortKey="Viana Da Silva, C" uniqKey="Viana Da Silva C">C Viana da Silva</name>
</author>
<author>
<name sortKey="Otoni, Wc" uniqKey="Otoni W">WC Otoni</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">PLoS One</journal-id>
<journal-id journal-id-type="iso-abbrev">PLoS ONE</journal-id>
<journal-id journal-id-type="publisher-id">plos</journal-id>
<journal-id journal-id-type="pmc">plosone</journal-id>
<journal-title-group>
<journal-title>PLoS ONE</journal-title>
</journal-title-group>
<issn pub-type="epub">1932-6203</issn>
<publisher>
<publisher-name>Public Library of Science</publisher-name>
<publisher-loc>San Francisco, USA</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">23082165</article-id>
<article-id pub-id-type="pmc">3474820</article-id>
<article-id pub-id-type="publisher-id">PONE-D-11-18768</article-id>
<article-id pub-id-type="doi">10.1371/journal.pone.0047426</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research Article</subject>
</subj-group>
<subj-group subj-group-type="Discipline-v2">
<subject>Agriculture</subject>
<subj-group>
<subject>Agricultural Biotechnology</subject>
<subj-group>
<subject>Genetically Modified Organisms</subject>
</subj-group>
</subj-group>
<subj-group>
<subject>Crops</subject>
<subj-group>
<subject>Fruits</subject>
</subj-group>
</subj-group>
</subj-group>
<subj-group subj-group-type="Discipline-v2">
<subject>Biology</subject>
<subj-group>
<subject>Biotechnology</subject>
<subj-group>
<subject>Plant Biotechnology</subject>
<subj-group>
<subject>Transgenic Plants</subject>
</subj-group>
</subj-group>
</subj-group>
<subj-group>
<subject>Developmental Biology</subject>
<subj-group>
<subject>Plant Growth and Development</subject>
</subj-group>
</subj-group>
<subj-group>
<subject>Plant Science</subject>
<subj-group>
<subject>Plant Biotechnology</subject>
<subj-group>
<subject>Transgenic Plants</subject>
</subj-group>
</subj-group>
<subj-group>
<subject>Plants</subject>
<subj-group>
<subject>Fruits</subject>
<subject>Trees</subject>
</subj-group>
</subj-group>
<subj-group>
<subject>Plant Growth and Development</subject>
</subj-group>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>A Dark Incubation Period Is Important for
<italic>Agrobacterium</italic>
-Mediated Transformation of Mature Internode Explants of Sweet Orange, Grapefruit, Citron, and a Citrange Rootstock</article-title>
<alt-title alt-title-type="running-head">Mature Tissue Transformation of Citrus</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Marutani-Hert</surname>
<given-names>Mizuri</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bowman</surname>
<given-names>Kim D.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>McCollum</surname>
<given-names>Greg T.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Mirkov</surname>
<given-names>T. Erik</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Evens</surname>
<given-names>Terence J.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Niedz</surname>
<given-names>Randall P.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="cor1">
<sup>*</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<addr-line>U.S. Horticultural Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Ft. Pierce, Florida, United States of America</addr-line>
</aff>
<aff id="aff2">
<label>2</label>
<addr-line>Department of Plant Pathology and Microbiology, Texas A&M University, Texas AgriLIFE Research, Weslaco, Texas, United States of America</addr-line>
</aff>
<contrib-group>
<contrib contrib-type="editor">
<name>
<surname>Park</surname>
<given-names>Sunghun</given-names>
</name>
<role>Editor</role>
<xref ref-type="aff" rid="edit1"></xref>
</contrib>
</contrib-group>
<aff id="edit1">
<addr-line>Kansas State University, United States of America</addr-line>
</aff>
<author-notes>
<corresp id="cor1">* E-mail:
<email>randall.niedz@ars.usda.gov</email>
</corresp>
<fn fn-type="conflict">
<p>
<bold>Competing Interests: </bold>
The authors have declared that no competing interests exist.</p>
</fn>
<fn fn-type="con">
<p>Conceived and designed the experiments: MMH TJE TEM RPN. Performed the experiments: MMH KDB GM RPN. Analyzed the data: MMH TJE GM RPN. Contributed reagents/materials/analysis tools: MMH KDB GTM TJE RPN. Wrote the paper: MMH KDB GTM TEM TJE RPN.</p>
</fn>
</author-notes>
<pub-date pub-type="collection">
<year>2012</year>
</pub-date>
<pub-date pub-type="epub">
<day>17</day>
<month>10</month>
<year>2012</year>
</pub-date>
<volume>7</volume>
<issue>10</issue>
<elocation-id>e47426</elocation-id>
<history>
<date date-type="received">
<day>23</day>
<month>9</month>
<year>2011</year>
</date>
<date date-type="accepted">
<day>17</day>
<month>9</month>
<year>2012</year>
</date>
</history>
<permissions>
<copyright-year>2012</copyright-year>
<license>
<license-p>This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Citrus has an extended juvenile phase and trees can take 2–20 years to transition to the adult reproductive phase and produce fruit. For citrus variety development this substantially prolongs the time before adult traits, such as fruit yield and quality, can be evaluated. Methods to transform tissue from mature citrus trees would shorten the evaluation period via the direct production of adult phase transgenic citrus trees.</p>
</sec>
<sec>
<title>Methodology/Principal Findings</title>
<p>Factors important for promoting shoot regeneration from internode explants from adult phase citrus trees were identified and included a dark incubation period and the use of the cytokinin zeatin riboside. Transgenic trees were produced from four citrus types including sweet orange, citron, grapefruit, and a trifoliate hybrid using the identified factors and factor settings.</p>
</sec>
<sec>
<title>Significance</title>
<p>The critical importance of a dark incubation period for shoot regeneration was established. These results confirm previous reports on the feasibility of transforming mature tissue from sweet orange and are the first to document the transformation of mature tissue from grapefruit, citron, and a trifoliate hybrid.</p>
</sec>
</abstract>
<funding-group>
<funding-statement>Research funded by the Citrus Research and Development Foundation (
<ext-link ext-link-type="uri" xlink:href="http://www.citrusrdf.org/blog/">http://www.citrusrdf.org/blog/</ext-link>
) under project #144 - Agrobacterium-mediated Genetic Transformation of Mature Citrus Tissue. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</funding-statement>
</funding-group>
<counts>
<page-count count="11"></page-count>
</counts>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>Citrus is grown worldwide, is consumed both fresh and processed, and is one of the most economically important fruit crops. Broadly viewed, new citrus rootstock and scion varieties are developed for three general reasons: 1) improve resistance to pest, disease, and environmental problems to which current commercial rootstock and scion cultivars are susceptible; 2) increase fruit/juice yield to improve profitability to growers; and 3) improve fruit/juice quality to remain competitive in the marketplace. The development of new citrus rootstock and scion varieties takes several decades and can span the careers of multiple researchers. One of the reasons for the long development time is an extended juvenile phase in citrus that typically requires at least 5–10 years before flowering. Another reason is that a new selection is tested at multiple field locations, with multiple rootstocks or scions, and over at least four years of fruit production to provide an estimate of productivity.</p>
<p>Plant breeders develop new varieties by introducing genetic variability, generally through controlled hybridizations, into a crop and selecting individuals with useful characteristics. However, there are some serious barriers in citrus biology that must be overcome before progress can be made, and include: the difficulties and expense of working with a tree crop, a long juvenile phase, and many citrus exhibit apomixis and inbreeding depression. These barriers, taken together, make citrus one of the most difficult crops to breed. Genetic engineering is one method to introduce genetic variability into citrus that can potentially address those problems in citrus that have no known viable long-term solution. For example, Huanglongbing (HLB) or citrus greening disease is considered the most serious citrus disease in the world
<xref ref-type="bibr" rid="pone.0047426-Bov1">[1]</xref>
. However, because there is little natural resistance to HLB, it will be difficult to develop resistant varieties through conventional plant breeding methods. Recombinant DNA approaches provide a potential solution for developing citrus trees resistant to HLB and, more generally, many of the serious problems that either threaten or seriously limit citrus production and that have no management or conventional breeding solutions.</p>
<fig id="pone-0047426-g001" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.g001</object-id>
<label>Figure 1</label>
<caption>
<title>Four populations of greenhouse-grown adult phase citrus trees were used: Valencia sweet orange, Ruby Red grapefruit, US942 citrange rootstock, and Etrog citron.</title>
<p>Ruby Red grapefruit trees with fruit are shown.</p>
</caption>
<graphic xlink:href="pone.0047426.g001"></graphic>
</fig>
<fig id="pone-0047426-g002" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.g002</object-id>
<label>Figure 2</label>
<caption>
<title>Internode explants.</title>
<p>A) The source of internode explants were new fully expanded shoots approximately 30 cm in length. Leaves were removed prior to disinfestation. Internode explants were excised as 7 mm segments. B) Internode explants were inserted into the culture media vertically for shoot regeneration experiments and horizontally for transformation experiments.</p>
</caption>
<graphic xlink:href="pone.0047426.g002"></graphic>
</fig>
<p>Genetic transformation of citrus rootstock and scion varieties is an active area of research and methods to transform citrus have been reported for many of the major citrus types, including sweet orange
<xref ref-type="bibr" rid="pone.0047426-Hidaka1">[2]</xref>
<xref ref-type="bibr" rid="pone.0047426-Fu1">[7]</xref>
, mandarin
<xref ref-type="bibr" rid="pone.0047426-Khawale1">[8]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Cervera1">[9]</xref>
, grapefruit
<xref ref-type="bibr" rid="pone.0047426-Luth1">[10]</xref>
<xref ref-type="bibr" rid="pone.0047426-LoezaKuk1">[13]</xref>
, lemon
<xref ref-type="bibr" rid="pone.0047426-Ghorbel1">[14]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Enrique1">[15]</xref>
, lime
<xref ref-type="bibr" rid="pone.0047426-Pea1">[16]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Dutt1">[17]</xref>
, and important rootstock types
<xref ref-type="bibr" rid="pone.0047426-Kaneyoshi1">[18]</xref>
<xref ref-type="bibr" rid="pone.0047426-Molinari1">[20]</xref>
. However, because the primary methods used to transform citrus use juvenile tissue, seedlings or embryogenic cell lines, transgenic citrus trees have the same long juvenile phase as trees grown from seed. To circumvent the juvenile phase requires the transformation of tissue from mature trees.</p>
<p>Mature tissue transformation in citrus has been reported for sweet orange
<xref ref-type="bibr" rid="pone.0047426-He1">[4]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Cervera2">[21]</xref>
<xref ref-type="bibr" rid="pone.0047426-Rodrguez1">[23]</xref>
and mandarin
<xref ref-type="bibr" rid="pone.0047426-Cervera1">[9]</xref>
. In these studies, factors examined for their effect on mature tissue transformation included flush,
<italic>Agrobacterium</italic>
strain, and feeder plates
<xref ref-type="bibr" rid="pone.0047426-Cervera2">[21]</xref>
; BAP singly or in combination with NAA
<xref ref-type="bibr" rid="pone.0047426-Cervera1">[9]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Almeida1">[22]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Rodrguez1">[23]</xref>
, variety of sweet orange
<xref ref-type="bibr" rid="pone.0047426-Almeida1">[22]</xref>
, the use of a helper plasmid containing additional copies of virG, virE1, and virE2 genes
<xref ref-type="bibr" rid="pone.0047426-Cervera1">[9]</xref>
, the concentration of 2,4-D in the co-cultivation medium and the length of co-cultivation
<xref ref-type="bibr" rid="pone.0047426-Cervera1">[9]</xref>
.</p>
<table-wrap id="pone-0047426-t001" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.t001</object-id>
<label>Table 1</label>
<caption>
<title>Design points for the AgNO
<sub>3</sub>
-GA-PGR-Basal media experiment.</title>
</caption>
<alternatives>
<graphic id="pone-0047426-t001-1" xlink:href="pone.0047426.t001"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Design Points</td>
<td colspan="4" align="left" rowspan="1">Factors</td>
<td align="left" rowspan="1" colspan="1">Response</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">AgNO
<sub>3</sub>
mg/L</td>
<td align="left" rowspan="1" colspan="1">GA µM</td>
<td align="left" rowspan="1" colspan="1">PGR</td>
<td align="left" rowspan="1" colspan="1">Basal media</td>
<td align="left" rowspan="1" colspan="1">Shoot number</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">1.625</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
<td align="left" rowspan="1" colspan="1">1.25</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">7.5</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">4</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">6</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">0.143</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">7</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">4.5</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">8</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">0.625</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">9</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">9.667</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">10</td>
<td align="left" rowspan="1" colspan="1">1.25</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">11</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">12</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
<td align="left" rowspan="1" colspan="1">1.25</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">1</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">13</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">14</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">0.125</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">15</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">1.125</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">16</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">6.25</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">17</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">18</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">0.125</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">19</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">0.25</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">20</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">15 µM BA +10 µM NAA</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">21</td>
<td align="left" rowspan="1" colspan="1">1.25</td>
<td align="left" rowspan="1" colspan="1">2.5</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">4.5</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">22</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">WPM</td>
<td align="left" rowspan="1" colspan="1">1.75</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">23</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">10 µM ZR</td>
<td align="left" rowspan="1" colspan="1">MS</td>
<td align="left" rowspan="1" colspan="1">8.5</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt101">
<p>The experiment is a 4-factor response surface design with sufficient points for a quadratic model. Shoot number is the mean response from eight culture dishes, each containing a single internode explant. Replicated points included #11/#22, #17/#20, #9/#23, #3/#16, and #6/#13. ANOVA presented in
<xref ref-type="table" rid="pone-0047426-t003">Table 3</xref>
.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>For plant breeding applications, genetic transformation systems should be 1) sufficiently efficient to produce the required numbers of independent transgenics per transgene to alter the phenotype of the targeted trait(s) while retaining the integrity of the variety and, 2) applicable to a broad range of types, commercial and breeding, within the crop. Our objectives were twofold – first, to determine the effects of factors potentially important (dark incubation, AgNO
<sub>3</sub>
, GA, basal medium, and growth regulators) for shoot regeneration from mature tissue, a necessary prerequisite for improving the efficiency of mature tissue transformation and, second, to broaden the range of citrus types transformable from mature tissue by including three citrus types not previously transformed including grapefruit, citron, a trifoliate hybrid rootstock, and a high quality and important sweet orange variety (Valencia) not previously reported.</p>
<table-wrap id="pone-0047426-t002" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.t002</object-id>
<label>Table 2</label>
<caption>
<title>Effect of dark incubation on the number of shoots regenerated from sweet orange, grapefruit, and US-942 internode explants.</title>
</caption>
<alternatives>
<graphic id="pone-0047426-t002-2" xlink:href="pone.0047426.t002"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Source</td>
<td align="left" rowspan="1" colspan="1">Sweet orange</td>
<td align="left" rowspan="1" colspan="1">Grapefruit</td>
<td align="left" rowspan="1" colspan="1">US-942</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">Prob > F</td>
<td align="left" rowspan="1" colspan="1">Prob > F</td>
<td align="left" rowspan="1" colspan="1">Prob > F</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>Weeks in the dark</italic>
</td>
<td align="left" rowspan="1" colspan="1"><0.0001</td>
<td align="left" rowspan="1" colspan="1"><0.0001</td>
<td align="left" rowspan="1" colspan="1">0.0007</td>
</tr>
<tr>
<td colspan="4" align="left" rowspan="1">
<underline>One Sample T-Test</underline>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>0 Weeks = 0</italic>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>1 Weeks = 0</italic>
</td>
<td align="left" rowspan="1" colspan="1">0.0610</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">(0.47±0.51)</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>2 Weeks = 0</italic>
</td>
<td align="left" rowspan="1" colspan="1"><0.0001</td>
<td align="left" rowspan="1" colspan="1">0.0003</td>
<td align="left" rowspan="1" colspan="1">0.0100</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">(9.04±5.48)</td>
<td align="left" rowspan="1" colspan="1">(5.29±3.12)</td>
<td align="left" rowspan="1" colspan="1">(1.99±0.10)</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>3 Weeks = 0</italic>
</td>
<td align="left" rowspan="1" colspan="1"><0.0001</td>
<td align="left" rowspan="1" colspan="1"><0.0001</td>
<td align="left" rowspan="1" colspan="1">n/a
<xref ref-type="table-fn" rid="nt103">a</xref>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">(2.85±0.44)</td>
<td align="left" rowspan="1" colspan="1">(4.18±1.16)</td>
<td align="left" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>4 Weeks = 0</italic>
</td>
<td align="left" rowspan="1" colspan="1">0.0085</td>
<td align="left" rowspan="1" colspan="1">0.0010</td>
<td align="left" rowspan="1" colspan="1">0.0013</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">(0.44±0.15)</td>
<td align="left" rowspan="1" colspan="1">(2.29±1.71)</td>
<td align="left" rowspan="1" colspan="1">(1.22±0.87)</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>6 Weeks = 0</italic>
</td>
<td align="left" rowspan="1" colspan="1">0.1834</td>
<td align="left" rowspan="1" colspan="1">0.0003</td>
<td align="left" rowspan="1" colspan="1">0.0023</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">(0.27±0.38)</td>
<td align="left" rowspan="1" colspan="1">(2.57±1.24)</td>
<td align="left" rowspan="1" colspan="1">(1.05±0.43)</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">
<italic>8 Weeks = 0</italic>
</td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">0.0034</td>
<td align="left" rowspan="1" colspan="1">0.0012</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1"></td>
<td align="left" rowspan="1" colspan="1">(0.75±0.35)</td>
<td align="left" rowspan="1" colspan="1">(1.58±1.43)</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt102">
<p>ANOVA p-values (Prob. > F) for the effect of dark incubation on shoot regeneration in sweet orange, grapefruit, and US-942. One sample t-tests p-values that compared each dark incubation period mean for each citrus type was compared to zero. The number of shoots is presented as the mean ± standard deviation from two experiments that included 9−17 internode explants. Cells with no p-value were all zero (i.e., zero variance) and could not be tested.</p>
</fn>
<fn id="nt103">
<label>a</label>
<p>US-942 did not include a three week test.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<fig id="pone-0047426-g003" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.g003</object-id>
<label>Figure 3</label>
<caption>
<title>Bar graphs of the effect of the dark incubation period on the number of shoots regenerated from sweet orange, grapefruit, and US942 internode explants.</title>
<p>Explants were incubated in the dark for 0 to 8 weeks prior to culture in a 16/8 photoperiod for three weeks. Data are presented as mean ± standard deviation. US942 did not include a three week dark treatment.</p>
</caption>
<graphic xlink:href="pone.0047426.g003"></graphic>
</fig>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and Methods</title>
<sec id="s2a">
<title>Source Plants and Explant Preparation</title>
<p>
<italic>Citrus paradisi</italic>
Macf. Ruby Red (grapefruit),
<italic>C. sinensis</italic>
(L.) Osbeck Valencia (sweet orange),
<italic>C. medica</italic>
(L.) Etrog (citron), and US-942
<xref ref-type="bibr" rid="pone.0047426-United1">[24]</xref>
rootstock (
<italic>C. reticulata</italic>
Sunki×
<italic>Poncirus trifoliata</italic>
Flying Dragon) adult phase trees (i.e., had produced flowers) maintained under greenhouse conditions were used as the source of internode explants (
<xref ref-type="fig" rid="pone-0047426-g001">Figure 1</xref>
). New fully expanded shoots (30 cm long) were used as the source of internodes. After removing the leaves, the shoots were surface sterilized by the following sequence – washed in running water for 5 mins, immersed for 15 min in 5 g/L Alconox® (Alconox, Inc. White Plains, NY) soapy water, 30 sec in 70% ethanol, 30 min in 1% sodium hypochlorite solution and Tween 20 (3 drops/L), and then three rinses in sterile distilled water
<xref ref-type="bibr" rid="pone.0047426-MarutaniHert1">[25]</xref>
. Explants approximately 7 mm in length were prepared from the internodes (
<xref ref-type="fig" rid="pone-0047426-g002">Figure 2A</xref>
) using sterile garden scissors. Internode explants prepared in this manner were used in the dark incubation, shoot regeneration, and
<italic>Agrobacterium</italic>
-mediated transformation experiments.</p>
<table-wrap id="pone-0047426-t003" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.t003</object-id>
<label>Table 3</label>
<caption>
<title>Effect of AgNO
<sub>3</sub>
, GA, PGR, and basal medium on numbers of shoots regenerated from mature intermodal explants of US-942.</title>
</caption>
<alternatives>
<graphic id="pone-0047426-t003-3" xlink:href="pone.0047426.t003"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Effects</td>
<td align="left" rowspan="1" colspan="1">df</td>
<td align="left" rowspan="1" colspan="1">F Value</td>
<td align="left" rowspan="1" colspan="1">p-values</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">Model</td>
<td align="left" rowspan="1" colspan="1">8</td>
<td align="left" rowspan="1" colspan="1">88.95</td>
<td align="left" rowspan="1" colspan="1"><0.0001</td>
</tr>
<tr>
<td colspan="4" align="left" rowspan="1">
<italic>
<underline>Main effects</underline>
</italic>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">AgNO
<sub>3</sub>
</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">0.35</td>
<td align="left" rowspan="1" colspan="1">0.564</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">GA</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">0.14</td>
<td align="left" rowspan="1" colspan="1">0.7173</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">PGR</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">382.17</td>
<td align="left" rowspan="1" colspan="1"><0.0001</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Media</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">66.9</td>
<td align="left" rowspan="1" colspan="1"><0.0001</td>
</tr>
<tr>
<td colspan="4" align="left" rowspan="1">
<italic>
<underline>2-way interaction effects</underline>
</italic>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">GA×Media</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">10.78</td>
<td align="left" rowspan="1" colspan="1">0.0054</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">PGR×Media</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">18.63</td>
<td align="left" rowspan="1" colspan="1">0.0007</td>
</tr>
<tr>
<td colspan="4" align="left" rowspan="1">
<italic>
<underline>Curvature effects</underline>
</italic>
</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">AgNO
<sub>3</sub>
<sup>2</sup>
</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">3.83</td>
<td align="left" rowspan="1" colspan="1">0.0705</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">GA
<sup>2</sup>
</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">12.39</td>
<td align="left" rowspan="1" colspan="1">0.0034</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Lack of Fit</td>
<td colspan="3" align="left" rowspan="1">p = 0.7198</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">R
<sup>2</sup>
</td>
<td colspan="3" align="left" rowspan="1">0.98</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">R
<sup>2</sup>
adjusted</td>
<td colspan="3" align="left" rowspan="1">0.97</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">R
<sup>2</sup>
predicted</td>
<td colspan="3" align="left" rowspan="1">0.95</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Model type
<sup>a</sup>
</td>
<td colspan="3" align="left" rowspan="1">reduced quadratic</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Transformation
<xref ref-type="table-fn" rid="nt106">b</xref>
</td>
<td colspan="3" align="left" rowspan="1">Log
<sub>10</sub>
</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt104">
<p>ANOVA p-values (Prob. > F) and summary statistics for the experimental design and data from
<xref ref-type="table" rid="pone-0047426-t001">Table 1</xref>
.</p>
</fn>
<fn id="nt105">
<p>aModel reduction by backward elimination.</p>
</fn>
<fn id="nt106">
<label>b</label>
<p>Data log10 transformed per Box Cox analysis. Log
<sub>10</sub>
(Shoot # +0.097).</p>
</fn>
</table-wrap-foot>
</table-wrap>
<fig id="pone-0047426-g004" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.g004</object-id>
<label>Figure 4</label>
<caption>
<title>Shoot regeneration from US942 internode explant–design point #3/#16 (MS +10 µM ZR +5 mg/L AgNO3+5 µM GA).</title>
</caption>
<graphic xlink:href="pone.0047426.g004"></graphic>
</fig>
</sec>
<sec id="s2b">
<title>Dark Incubation Experiment</title>
<p>The effect of a dark incubation period on shoot regeneration from internodes of sweet orange, grapefruit, and US-942 was determined. The experiment was designed as a single factor design. Each internode explant was inserted vertically (
<xref ref-type="fig" rid="pone-0047426-g002">Figure 2B</xref>
) into a Falcon #351007 60×15 mm polystyrene dish (Becton Dickinson Labware, NJ, USA) containing 10 mL shoot induction medium (SIM) composed of MS salts
<xref ref-type="bibr" rid="pone.0047426-Murashige1">[26]</xref>
(PhytoTechnology Laboratories®, Shawnee Mission, KS, USA), glycine (1 mg/L), thiamine-HCl (1 mg/L), pyridoxine-HCl (1 mg/L), nicotinic acid (1 mg/L), zeatin riboside (10 µM) (Gold Biotechnology, St. Louis, MO, USA), 0.8% (w/v) agar (USB Corporation, OH), and the pH reading adjusted to 5.7 with NaOH. Internode explant cultures from sweet orange, grapefruit, and US-942 were incubated in a dark chamber (27°C) for 0, 1, 2, 3, 4, 6, or 8 weeks, then transferred to 16/8 h photoperiod, 35 µmol m
<sup>−2</sup>
s
<sup>−1</sup>
at 27°C for 21 days, and then data were collected (buds/shoots counted). The experiment was repeated and the response at each treatment point was estimated from 9–17 internode explants per replicate. The number of buds/shoots produced was counted and the data analyzed by one-way ANOVA for each citrus type followed by a one-sample t-test that compared the mean of each treatment to 0 (i.e., no buds/shoots produced).</p>
<table-wrap id="pone-0047426-t004" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.t004</object-id>
<label>Table 4</label>
<caption>
<title>Individual experiment and summary statistics for US-942 regeneration and transformation results.</title>
</caption>
<alternatives>
<graphic id="pone-0047426-t004-4" xlink:href="pone.0047426.t004"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Citrus type</td>
<td align="left" rowspan="1" colspan="1">Number of internodes cultured</td>
<td align="left" rowspan="1" colspan="1">Number of shoots regenerated</td>
<td align="left" rowspan="1" colspan="1">Number of GUS
<sup>+</sup>
shoots</td>
<td align="left" rowspan="1" colspan="1">Regeneration (%)</td>
<td align="left" rowspan="1" colspan="1">Transformation efficiency (%)
<xref ref-type="table-fn" rid="nt107">a</xref>
</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">US-942</td>
<td align="left" rowspan="1" colspan="1">20</td>
<td align="left" rowspan="1" colspan="1">16</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">80.00</td>
<td align="left" rowspan="1" colspan="1">5.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">US-942</td>
<td align="left" rowspan="1" colspan="1">62</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">8.06</td>
<td align="left" rowspan="1" colspan="1">3.23</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">US-942</td>
<td align="left" rowspan="1" colspan="1">65</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">7.69</td>
<td align="left" rowspan="1" colspan="1">3.08</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">US-942</td>
<td align="left" rowspan="1" colspan="1">202</td>
<td align="left" rowspan="1" colspan="1">31</td>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">15.35</td>
<td align="left" rowspan="1" colspan="1">1.49</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">US-942</td>
<td align="left" rowspan="1" colspan="1">100</td>
<td align="left" rowspan="1" colspan="1">36</td>
<td align="left" rowspan="1" colspan="1">7</td>
<td align="left" rowspan="1" colspan="1">36.00</td>
<td align="left" rowspan="1" colspan="1">7.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Summary
<xref ref-type="table-fn" rid="nt108">b</xref>
</td>
<td align="left" rowspan="1" colspan="1">449</td>
<td align="left" rowspan="1" colspan="1">93</td>
<td align="left" rowspan="1" colspan="1">15</td>
<td align="left" rowspan="1" colspan="1">29.42±30.53</td>
<td align="left" rowspan="1" colspan="1">3.96±2.11</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt107">
<label>a</label>
<p>Transformation efficiency was calculated as the number of GUS positive plants/number of internode explants.</p>
</fn>
<fn id="nt108">
<label>b</label>
<p>Presented as totals or mean ± standard deviation.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<fig id="pone-0047426-g005" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.g005</object-id>
<label>Figure 5</label>
<caption>
<title>Transition from
<italic>in vitro</italic>
to
<italic>ex vitro</italic>
growth.</title>
<p>A)
<italic>In vitro</italic>
shoots from
<italic>Agrobacterium</italic>
-treated internode explants were micrografted on to
<italic>ex vitro</italic>
grown seedling rootstock, B) micrografted shoots were covered with a plastic bag and grown in a growth chamber (27°C, 55 µmol m-2 s-1, 16-h photoperiod) for two weeks, and then C) moved to the greenhouse. Vigorously growing plants were tested for GUS activity by X-Gluc histochemical staining circular explants punched out from the midrib of a leaf – D) GUS negative, E) GUS positive.</p>
</caption>
<graphic xlink:href="pone.0047426.g005"></graphic>
</fig>
</sec>
<sec id="s2c">
<title>AgNO
<sub>3</sub>
-GA-PGR-Basal Media Experiment</title>
<p>Four factors considered important or potentially important in shoot regeneration were examined using US-942 and included AgNO
<sub>3</sub>
(0 to 5 mg/L), GA (0 to 5 µM), PGR (10 µM ZR or 15 µM BA and 10 µM NAA), and basal medium (MS or WPM). A four-factor response surface design was constructed that included two numeric factors, AgNO
<sub>3</sub>
and GA, and two categorical factors, PGR and basal medium. Design points were selected using D-optimal criterion, modified to include lack-of-fit points, sufficient to estimate a quadratic polynomial. The experimental design included 13 model points, 5 lack-of-fit points, and 5 points to estimate pure error, i.e. 23 design points. The design points are listed in
<xref ref-type="table" rid="pone-0047426-t001">Table 1</xref>
. The number of shoots regenerated at each design point was estimated from eight 60×15 mm culture dishes (184 total), each containing a single internode explant inserted vertically (
<xref ref-type="fig" rid="pone-0047426-g002">Figure 2B</xref>
) into SIM modified per the specified treatment. Internode explant cultures were incubated in a dark chamber (27°C) for 2 weeks, then transferred to 16/8 h photoperiod, 35 µmol m
<sup>−2</sup>
s
<sup>−1</sup>
at 27°C for 21 days, and then data were collected (buds/shoots counted). Data were analyzed by analysis of variance (ANOVA).</p>
<table-wrap id="pone-0047426-t005" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.t005</object-id>
<label>Table 5</label>
<caption>
<title>Individual experiment and summary statistics for Valencia sweet orange regeneration and transformation results.</title>
</caption>
<alternatives>
<graphic id="pone-0047426-t005-5" xlink:href="pone.0047426.t005"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Citrus type</td>
<td align="left" rowspan="1" colspan="1">Number of internodes cultured</td>
<td align="left" rowspan="1" colspan="1">Number of shoots regenerated</td>
<td align="left" rowspan="1" colspan="1">Number of GUS
<sup>+</sup>
shoots</td>
<td align="left" rowspan="1" colspan="1">Regeneration (%)</td>
<td align="left" rowspan="1" colspan="1">Transformation efficiency (%)
<xref ref-type="table-fn" rid="nt109">a</xref>
</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">sweet orange</td>
<td align="left" rowspan="1" colspan="1">22</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">sweet orange</td>
<td align="left" rowspan="1" colspan="1">118</td>
<td align="left" rowspan="1" colspan="1">19</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">16.10</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">sweet orange</td>
<td align="left" rowspan="1" colspan="1">240</td>
<td align="left" rowspan="1" colspan="1">18</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">7.50</td>
<td align="left" rowspan="1" colspan="1">0.42</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">sweet orange</td>
<td align="left" rowspan="1" colspan="1">100</td>
<td align="left" rowspan="1" colspan="1">9</td>
<td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">9.00</td>
<td align="left" rowspan="1" colspan="1">2.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">sweet orange</td>
<td align="left" rowspan="1" colspan="1">100</td>
<td align="left" rowspan="1" colspan="1">13</td>
<td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">13.00</td>
<td align="left" rowspan="1" colspan="1">2.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Summary
<xref ref-type="table-fn" rid="nt110">b</xref>
</td>
<td align="left" rowspan="1" colspan="1">580</td>
<td align="left" rowspan="1" colspan="1">59</td>
<td align="left" rowspan="1" colspan="1">5</td>
<td align="left" rowspan="1" colspan="1">9.12±6.12</td>
<td align="left" rowspan="1" colspan="1">0.88±1.03</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt109">
<label>a</label>
<p>Transformation efficiency was calculated as the number of GUS positive plants/number of internode explants.</p>
</fn>
<fn id="nt110">
<label>b</label>
<p>Presented as totals or mean ± standard deviation.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<fig id="pone-0047426-g006" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.g006</object-id>
<label>Figure 6</label>
<caption>
<title>PCR gel (top image) and Southern blot (bottom image) analyses of 10 independent GUS-positive citrus transformants.</title>
<p>Lane 1– molecular weight markers; Lane 2– Binary plasmid p35S GUS INT
<xref ref-type="bibr" rid="pone.0047426-Vancanneyt1">[28]</xref>
used in transformation experiments; Lanes 3 and 4– transgenic ‘Valencia’ sweet orange; Lanes 5–8– transgenic ‘Etrog’ citron; Lanes 9–12– transgenic US-942 rootstock (
<italic>C. reticulata</italic>
’Sunki’ ×
<italic>Poncirus trifoliata</italic>
‘Flying Dragon’); Lane 13– Untransformed ‘Etrog’ citron; Lane 14– Untransformed ‘Valencia’ sweet orange; Lane 15– Untransformed US-942. Lane 16– molecular weight markers.</p>
</caption>
<graphic xlink:href="pone.0047426.g006"></graphic>
</fig>
</sec>
<sec id="s2d">
<title>Agrobacterium-mediated Transformation</title>
<p>
<italic>Agrobacterium tumefaciens</italic>
strain EHA-105 strain
<xref ref-type="bibr" rid="pone.0047426-Hood1">[27]</xref>
carrying the p35S GUS INT binary plasmid
<xref ref-type="bibr" rid="pone.0047426-Vancanneyt1">[28]</xref>
carrying the marker gene β-glucuronidase (GUS) was used in all experiments. Bacterial cultures were made by selecting a single colony from a streaked YEP plate (10 g/L peptone, 5 g/L NaCl, 10 g/L yeast extract, 10 g/L agar, and pH 7), and inoculating a 125 ml flask containing 50 mL of liquid YEP + kanamycin (1 mg/ml) + acetosyringone (40 µM), and culturing on a rotary shaker (225 rpm) at 27°C until the culture achieved an OD
<sub>600</sub>
of 1.3 to 1.5. The
<italic>Agrobacterium</italic>
inoculation solution was prepared by diluting the
<italic>Agrobacterium</italic>
culture with SIM to a final OD
<sub>600</sub>
of 0.5, and then adding acetosyringone to 40 µM.</p>
<table-wrap id="pone-0047426-t006" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.t006</object-id>
<label>Table 6</label>
<caption>
<title>Individual experiment and summary statistics for Etrog citron regeneration and transformation results.</title>
</caption>
<alternatives>
<graphic id="pone-0047426-t006-6" xlink:href="pone.0047426.t006"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Citrus type</td>
<td align="left" rowspan="1" colspan="1">Number of internodes cultured</td>
<td align="left" rowspan="1" colspan="1">Number of shoots regenerated</td>
<td align="left" rowspan="1" colspan="1">Number of GUS
<sup>+</sup>
shoots</td>
<td align="left" rowspan="1" colspan="1">Regeneration (%)</td>
<td align="left" rowspan="1" colspan="1">Transformation efficiency (%)
<xref ref-type="table-fn" rid="nt111">a</xref>
</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">citron</td>
<td align="left" rowspan="1" colspan="1">25</td>
<td align="left" rowspan="1" colspan="1">4</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">16.00</td>
<td align="left" rowspan="1" colspan="1">0.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">citron</td>
<td align="left" rowspan="1" colspan="1">44</td>
<td align="left" rowspan="1" colspan="1">4</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">9.09</td>
<td align="left" rowspan="1" colspan="1">0.00</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">citron</td>
<td align="left" rowspan="1" colspan="1">121</td>
<td align="left" rowspan="1" colspan="1">18</td>
<td align="left" rowspan="1" colspan="1">7</td>
<td align="left" rowspan="1" colspan="1">14.88</td>
<td align="left" rowspan="1" colspan="1">5.79</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">citron</td>
<td align="left" rowspan="1" colspan="1">121</td>
<td align="left" rowspan="1" colspan="1">6</td>
<td align="left" rowspan="1" colspan="1">2</td>
<td align="left" rowspan="1" colspan="1">4.96</td>
<td align="left" rowspan="1" colspan="1">1.65</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">citron</td>
<td align="left" rowspan="1" colspan="1">120</td>
<td align="left" rowspan="1" colspan="1">3</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">2.50</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Summary</td>
<td align="left" rowspan="1" colspan="1">431</td>
<td align="left" rowspan="1" colspan="1">35</td>
<td align="left" rowspan="1" colspan="1">9</td>
<td align="left" rowspan="1" colspan="1">9.49±5.94</td>
<td align="left" rowspan="1" colspan="1">1.49±2.51</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt111">
<label>a</label>
<p>Transformation efficiency was calculated as the number of GUS positive plants/number of internode explants.</p>
</fn>
<fn id="nt112">
<label>b</label>
<p>Presented as totals or mean ± standard deviation.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="pone-0047426-t007" orientation="portrait" position="float">
<object-id pub-id-type="doi">10.1371/journal.pone.0047426.t007</object-id>
<label>Table 7</label>
<caption>
<title>Individual experiment and summary statistics for Ruby Red grapefruit regeneration and transformation results.</title>
</caption>
<alternatives>
<graphic id="pone-0047426-t007-7" xlink:href="pone.0047426.t007"></graphic>
<table frame="hsides" rules="groups">
<colgroup span="1">
<col align="left" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
<col align="center" span="1"></col>
</colgroup>
<thead>
<tr>
<td align="left" rowspan="1" colspan="1">Citrus type</td>
<td align="left" rowspan="1" colspan="1">Number of internodes cultured</td>
<td align="left" rowspan="1" colspan="1">Number of shoots regenerated</td>
<td align="left" rowspan="1" colspan="1">Number of GUS
<sup>+</sup>
shoots</td>
<td align="left" rowspan="1" colspan="1">Regeneration (%)</td>
<td align="left" rowspan="1" colspan="1">Transformation efficiency (%)
<xref ref-type="table-fn" rid="nt113">a</xref>
</td>
</tr>
</thead>
<tbody>
<tr>
<td align="left" rowspan="1" colspan="1">grapefruit</td>
<td align="left" rowspan="1" colspan="1">19</td>
<td align="left" rowspan="1" colspan="1">6</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">31.58</td>
<td align="left" rowspan="1" colspan="1">5.26</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">grapefruit</td>
<td align="left" rowspan="1" colspan="1">50</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">2.00</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">grapefruit</td>
<td align="left" rowspan="1" colspan="1">104</td>
<td align="left" rowspan="1" colspan="1">6</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">5.77</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">grapefruit</td>
<td align="left" rowspan="1" colspan="1">87</td>
<td align="left" rowspan="1" colspan="1">6</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">6.90</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">grapefruit</td>
<td align="left" rowspan="1" colspan="1">124</td>
<td align="left" rowspan="1" colspan="1">9</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">7.26</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">grapefruit</td>
<td align="left" rowspan="1" colspan="1">100</td>
<td align="left" rowspan="1" colspan="1">7</td>
<td align="left" rowspan="1" colspan="1">0</td>
<td align="left" rowspan="1" colspan="1">7.00</td>
<td align="left" rowspan="1" colspan="1">0</td>
</tr>
<tr>
<td align="left" rowspan="1" colspan="1">Summary
<xref ref-type="table-fn" rid="nt114">b</xref>
</td>
<td align="left" rowspan="1" colspan="1">484</td>
<td align="left" rowspan="1" colspan="1">35</td>
<td align="left" rowspan="1" colspan="1">1</td>
<td align="left" rowspan="1" colspan="1">10.70±11.86</td>
<td align="left" rowspan="1" colspan="1">1.05±2.35</td>
</tr>
</tbody>
</table>
</alternatives>
<table-wrap-foot>
<fn id="nt113">
<label>a</label>
<p>Transformation efficiency was calculated as the number of GUS positive plants/number of internode explants.</p>
</fn>
<fn id="nt114">
<label>b</label>
<p>Presented as totals or mean ± standard deviation.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>Approximately one hundred internode explants were prepared at a time. As internode explants were excised they were placed into SIM liquid medium. Once the explants were prepared the SIM medium was discarded and replaced with
<italic>Agrobacterium</italic>
inoculation solution for 15 minutes, after which the explants were blotted dry with paper towels. Internode explants were inserted horizontally (
<xref ref-type="fig" rid="pone-0047426-g002">Figure 2B</xref>
) into 100 x 20 mm culture dishes, 20 explants per dish, containing co-culture medium composed of SIM medium with 40 µM acetosyringone, and incubated at 24°C in the dark for three days.</p>
<p>Following co-culture, explants were removed and triple rinsed with water in a 500 mL glass bottle and then blotted dry with paper towels. Explants were then placed, one explant per dish, into 60 ×15 mm culture dishes containing SIM +5 µM GA + antibiotics (100 mg/L kanamycin, 250 mg/L vancomycin, and 250 mg/L cefotaxime), incubated in the dark at 27°C for two weeks, transferred to 16/8 h photoperiod, 35 µmol m
<sup>−2</sup>
s
<sup>−1</sup>
at 27°C for 30 days for 3–4 weeks, and subcultured monthly thereafter.</p>
</sec>
<sec id="s2e">
<title>Micro-grafting of GUS (β-glururonidase) Positive Shoots</title>
<p>Regenerated shoots >2 mm were grafted onto rootstock seedlings. Valencia, Ruby Red, and Etrog were grafted onto US-812
<xref ref-type="bibr" rid="pone.0047426-Bowman1">[29]</xref>
citrus rootstock (
<italic>C. reticulata</italic>
’Sunki’ ×
<italic>Poncirus trifoliata</italic>
Benecke) and regenerated shoots of US-942 were grafted onto
<italic>C. volkameriana</italic>
Ten. & Pasq. (Volkamer).</p>
<sec id="s2e1">
<title>Rootstock preparation</title>
<p>A rootstock seed was planted in PRO MIX BX soil (Premier tech Horticulture, Quakertown, PA) in a 164 ml Ray Leach Cone-tainer cell SC10 (Stuewe & Sons, Inc, Tangent, OR). PRO MIX BX soil was steamed at 71°C for 2 h 15 min before use. Rootstocks were grown etiolated at 27°C in the greenhouse for a month. When the rootstock seedlings were approximately 10 cm tall, they were used for micro-grafting with transformed shoots. Before grafting, the seedlings were fed with ¼ Basal Salt Mixture (Murashige & Skoog, PhytoTechnology Laboratories, Shawnee Mission, KS) and also given two eye droplets to each pot of a solution of Sequestrene 138, Iron Chelate Mix, 1.2 g/L (Becker Underwood, Inc., Ames, IA.).</p>
<p>
<bold>GUS assay.</bold>
Regenerated shoots >2 mm were excised from internode explants and the bottom 1–2 mm of the base of the shoot was excised for assay for GUS activity. The basal sample was placed into a 1.5 microcentrifuge tube containing 200 µL GUS assay buffer
<xref ref-type="bibr" rid="pone.0047426-Jefferson1">[30]</xref>
and incubated overnight at 37°C. The shoot was inserted into a 100×20 mm culture dish containing SIM. Shoots where the basal sample turned blue via the X-gluc histochemical assay were then micrografted.</p>
</sec>
<sec id="s2e2">
<title>Micrografting procedure</title>
<p>Regenerated shoots >2 mm were shaped to look like the alphabet “V” at the base of the shoot. Rootstocks were cut under the cotyledon and sliced vertically in the middle of the stem with a Double Edge Carbon Steel Breakable Razor Blade (Electron Microscopy Sciences, Hatfield, PA). Trimmed shoots were inserted into the vertical incision. Immediately after grafting, the Cone-tainer pot was covered with a plastic bag and sealed with a rubber band to retain moisture. Grafted plants were incubated for one week in a growth chamber programmed to a 16/8 photoperiod and 27°C and then transferred to the greenhouse.</p>
</sec>
</sec>
<sec id="s2f">
<title>PCR Analysis and Southern Hybridizations</title>
<sec id="s2f1">
<title>PCR analysis</title>
<p>DNA was extracted from transformed GUS
<sup>+</sup>
trees and GUS
<sup></sup>
nontransformed trees using DNase Plant Mini Kits (Qiagen, Valencia, CA, USA) per the manufacturer’s directions. The
<italic>uidA</italic>
gene was amplified with 5′GAATGGTGATTACCGACGAAA3′ and 5′CCAGTCGAGCATCTCTTCAGC3′ designed to amplify a 574 bp fragment
<xref ref-type="bibr" rid="pone.0047426-Franche1">[31]</xref>
. PCR was performed in a MJ Research thermocycler and included 34 cycles of denaturation at 94°C for 1 min, annealing at 65°C for 1 min, and extension at 72°C for 2 min. Each sample included 60 ng of DNA and was separated by 100 volt electrophoresis in 1.0% agarose gels, and visualized by ethidium bromide staining.</p>
</sec>
<sec id="s2f2">
<title>Southern hybridizations</title>
<p>Total DNA was extracted from leaf tissue following the method of Dellaporta
<xref ref-type="bibr" rid="pone.0047426-DellaPorta1">[32]</xref>
. DNA extracts were treated with RNase, phenol-chloroform extracted, and ethanol precipitated; pellets were dissolved in Tris-EDTA and DNA was quantified using a nanodrop spectrophotometer (Thermo Scientific, Wilmington, DE). Each DNA extract was digested with EcoRI; 5 µg of each EcoRI-digested DNA extract was separated by electrophoresis in 0.8% agarose and subsequently transferred to a nylon membrane (Roche Applied Science, Indianapolis, IN) following the manufacturer’s instructions. A PCR product was generated using the transformation vector (p35S GUS INT) as template along with the same primers used for confirmation of
<italic>uidA</italic>
transgene insertion. The GUS PCR product served as template for the preparation of a DIG-labeled hybridization probe using the DIG DNA Labeling Kit (Roche Applied Science) following the manufacturer’s instructions. All subsequent hybridization, stringency washes, and detection steps were carried out using the DIG detection kit (Roche Applied Science) following the manufacturer’s instructions.</p>
</sec>
</sec>
</sec>
<sec id="s3">
<title>Results</title>
<sec id="s3a">
<title>Dark Incubation Experiment</title>
<p>The effect of a dark incubation period on the number of shoots regenerated was determined for sweet orange, grapefruit, and US-942; citron was not tested. For all three citrus types shoots were only observed with a dark incubation period; no shoots were observed for the 0 week dark treatment. The SIM medium used was based on results from prior experimentation that determined the effects of various cytokinins and auxins on shoot regeneration from juvenile epicotyl explants of sweet orange and grapefruit
<xref ref-type="bibr" rid="pone.0047426-Niedz1">[33]</xref>
. Shoots were counted three weeks after the explants were moved from dark to light. An ANOVA was conducted for each citrus type and showed that the effect of a dark incubation period on the number of shoots regenerated was significant (
<xref ref-type="table" rid="pone-0047426-t002">Table 2</xref>
); the means ± S.D. are shown in
<xref ref-type="table" rid="pone-0047426-t002">Table 2</xref>
and
<xref ref-type="fig" rid="pone-0047426-g003">Figure 3</xref>
. A one sample t-test was used to determine which dark incubation treatments for each citrus type had shoot numbers greater than 0. The one sample t-test and 0 values were used because no shoots were regenerated in the 0 week dark treatment. For sweet orange, 2–4 weeks in the dark produced a significantly greater number of shoots than 0; for grapefruit and US-942 it was 2–8 weeks. The three week treatment was not run with US-942.</p>
</sec>
<sec id="s3b">
<title>AgNO
<sub>3</sub>
-GA-PGR-Basal Medium Experiment</title>
<p>The number of shoots was counted three weeks after the explants were moved to light. Shoot number for US-942 ranged from 0 to 9.6 (
<xref ref-type="table" rid="pone-0047426-t001">Table 1</xref>
) and indicated that AgNO
<sub>3</sub>
, GA, PGR, and basal medium affected shoot number (
<xref ref-type="fig" rid="pone-0047426-g004">Figure 4</xref>
). A summary of the ANOVA, lack-of-fit test and three R
<sup>2</sup>
statistics for quality are presented in
<xref ref-type="table" rid="pone-0047426-t003">Table 3</xref>
. A reduced quadratic polynomial model was selected (p<0.0001). Data was transformed with a log10 function as the Box Cox plot identified a violation of the normality assumption. Residual and model diagnostics were within acceptable limits. The lack-of-fit test was not significant (p = 0.7198) and indicated that additional variation in the residuals could not be removed with a better model. R
<sup>2</sup>
, R
<sup>2</sup>
<sub>adj</sub>
and R
<sup>2</sup>
<sub>pred</sub>
statistics ranged from 0.98–0.95. Main effects were the primary affecters of shoot regeneration. PGR had the single largest effect on the number of shoots regenerated (F Value = 382; p<0.0001) and was due to the large positive effect of zeatin riboside. The type of basal medium was also highly significant (F Value = 67; p<0.0001), though much less so than PGR, with more shoots regenerated on MS medium than WPM. The two-way interaction effects of GA and PGR with basal medium were significant. Quadratic effects (i.e., curvature of the response) were significant for GA. Based on these results the treatment selected for use in the transformation experiment was MS +5 µM GA +10 µM ZR (replicated design point #9/#23).</p>
</sec>
<sec id="s3c">
<title>Transformation Experiments</title>
<p>Twenty-one transformation experiments were conducted with the four citrus types (
<xref ref-type="table" rid="pone-0047426-t004">Tables 4</xref>
<xref ref-type="table" rid="pone-0047426-t007">7</xref>
) and resulted in a total of 30 transgenic shoots identified by GUS staining, including 15 US-942, 5 Valencia sweet orange, 9 Etrog citron, and 1 Ruby Red grapefruit. Transformed trees were obtained by micrografting (
<xref ref-type="fig" rid="pone-0047426-g005">Figure 5</xref>
) from sweet orange, citron and US-942– the grapefruit graft was lost. Transgenic plants obtained from micrografting were reconfirmed by the expression of GUS in leaf discs (
<xref ref-type="fig" rid="pone-0047426-g005">Figure 5</xref>
), PCR amplification of the
<italic>uidA</italic>
gene fragment and Southern blot analysis using a
<italic>uidA</italic>
gene fragment probe (
<xref ref-type="fig" rid="pone-0047426-g006">Figure 6</xref>
).</p>
</sec>
</sec>
<sec id="s4">
<title>Discussion</title>
<p>Because shoot regeneration is an essential prerequisite for
<italic>Agrobacterium</italic>
-mediated transformation experiments, the basic approach was to first identify factors important for promoting shoot regeneration from internode explants from adult phase citrus trees, and then to produce transgenic trees using the identified factors and factor levels for inducing shoots. To a large extent, the citrus types and numbers of explants used in the various experiments was subject to the type and quantity of plant material available at the time. Internode explants were inserted vertically for the shoot regeneration experiments for convenience; because shoots only developed on the upper surface, their formation and development were more easily monitored than explants placed horizontally. Horizontal placement was required for transformation experiments to expose tissue to the selective antibiotic kanamycin.</p>
<p>Extensive preliminary experiments on the effects of various growth regulators on shoot regeneration resulted in a small number of internode explants developing small shoot primordia that never developed into shoots (unpublished data). Because these experiments utilized only a 16/8 photoperiod (i.e., no dark incubation), the effect of a dark incubation period was considered. For juvenile citrus tissue, a dark incubation period enhanced shoot regeneration in sweet orange
<xref ref-type="bibr" rid="pone.0047426-DuranVila1">[34]</xref>
and lime
<xref ref-type="bibr" rid="pone.0047426-Pea1">[16]</xref>
, but was inhibitory in citrange
<xref ref-type="bibr" rid="pone.0047426-MoreiraDias1">[35]</xref>
. For mature citrus tissue, the effect of a dark incubation period has not been determined. Of the five studies that report transformation of mature citrus tissue, four included a dark incubation period
<xref ref-type="bibr" rid="pone.0047426-Cervera1">[9]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Cervera2">[21]</xref>
<xref ref-type="bibr" rid="pone.0047426-Rodrguez1">[23]</xref>
as part of the protocol. The single study that did not include a dark incubation period
<xref ref-type="bibr" rid="pone.0047426-He1">[4]</xref>
utilized adventitious buds that formed directly from the wounded regions on seedlings where the growing tip and axillary buds were removed. Of the four studies that report shoot regeneration from mature citrus tissue, three include dark incubation
<xref ref-type="bibr" rid="pone.0047426-Kobayashi1">[36]</xref>
<xref ref-type="bibr" rid="pone.0047426-Bassan1">[38]</xref>
and one did not
<xref ref-type="bibr" rid="pone.0047426-Curtis1">[39]</xref>
. Though a dark incubation period is often included in transformation and shoot regeneration protocols, the periods are variable and range from 15
<xref ref-type="bibr" rid="pone.0047426-Cervera2">[21]</xref>
to 50 days
<xref ref-type="bibr" rid="pone.0047426-Bassan1">[38]</xref>
. These results suggested genotype or condition-specific effects and, therefore the importance of testing a dark incubation period under local conditions when initiating a citrus tissue culture project. We observed that a dark incubation period was essential for shoot regeneration from sweet orange, grapefruit, and US-942; citron was not tested. When internode explants were incubated in the dark, they developed numerous buds and shoots; no shoots were regenerated from any of the citrus types without a dark incubation period. We also observed that shoot regeneration generally declined after a 2 week dark period, but this may not be true for transformation. Cervera et al.
<xref ref-type="bibr" rid="pone.0047426-Cervera1">[9]</xref>
extended the dark incubation period from 2–4 weeks to 5–6 weeks to promote more callus formation, with the intent of improving transformation efficiency; however, the specific effect of this change on transformation was not determined. The cytokinin zeatin riboside was used in these dark experiments as it was the most effective cytokinin for shoot regeneration from juvenile epicotyl explants of ‘Valencia’ sweet orange and worked well for ‘Duncan’ grapefruit
<xref ref-type="bibr" rid="pone.0047426-Niedz1">[33]</xref>
; it was selected on the assumption that it might also work well with mature tissue. To the best of our knowledge, all citrus mature tissue shoot regeneration and transformation experiments utilize BAP alone or in combination with NAA to induce shoots.</p>
<p>To further improve shoot regeneration, the individual and combined effects of four additional factors identified as potentially important were determined. The protocol for this experiment included a two week dark incubation period per the results from the dark incubation study. AgNO
<sub>3</sub>
, an ethylene inhibitor, was selected because it can sometimes enhance shoot regeneration
<xref ref-type="bibr" rid="pone.0047426-CruzdeCarvalho1">[40]</xref>
<xref ref-type="bibr" rid="pone.0047426-Uliaie1">[41]</xref>
. Because its effect on shoot regeneration was weak, AgNO
<sub>3</sub>
was not included in the shoot regeneration medium used for transformation. GA was selected as a potential enhancer of shoot regeneration and growth
<xref ref-type="bibr" rid="pone.0047426-Kobayashi1">[36]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Geekiyanage1">[43]</xref>
<xref ref-type="bibr" rid="pone.0047426-PerezTornero1">[45]</xref>
and, because its effect was small but positive on shoot regeneration, GA was included in the shoot regeneration medium used for transformation. BA + NAA was compared to ZR as BA + NAA are two growth regulators commonly used together to regenerate shoots from mature citrus explants
<xref ref-type="bibr" rid="pone.0047426-Cervera1">[9]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Almeida1">[22]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Rodrguez1">[23]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-PeixotodeOliveira1">[46]</xref>
. MS and WPM were selected as they have both been used in citrus tissue culture
<xref ref-type="bibr" rid="pone.0047426-Cervera1">[9]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-Kobayashi1">[36]</xref>
,
<xref ref-type="bibr" rid="pone.0047426-PeixotodeOliveira1">[46]</xref>
. The use of ZR was the most important factor that affected shoot regeneration and indicates the importance of using the appropriate cytokinin. The level of ZR used in this experiment was 10 µM, a level found to be useful for juvenile explants
<xref ref-type="bibr" rid="pone.0047426-Niedz1">[33]</xref>
and therefore potentially not optimal for mature internode shoot regeneration. In addition, because the growth regulator treatments were fixed concentrations, their effects on mature tissue shoot regeneration over a range of proportions and concentrations could not be determined. To fully explore these effects would require a 3-component (ZR-BA-NAA) mixture-amount experimental design. Given the large effect of ZR, additional research to optimize growth regulator types, proportions, and concentration for mature tissue may provide further improvements. This argument also applies to the comparison of MS and WPM where little is learned, apart from which formulation works better, about the proportions and concentrations of specific mineral nutrients and their effects on shoot regeneration.</p>
<p>Transgenic plants were obtained by
<italic>Agrobacterium</italic>
-mediated transformation of internode explants from mature greenhouse grown trees of sweet orange, grapefruit, citron, and a trifoliate hybrid rootstock. The results confirm previous reports on the feasibility of transforming mature tissue from sweet orange and are the first to document the transformation of mature tissue from grapefruit, citron, and a trifoliate hybrid. Variability was high and was presumably due to the various relatively uncontrolled environmental and physiological effects. For example, the transformation experiments were conducted over an eight-month period where plant material was harvested from greenhouse-grown trees exposed to light levels and seasonal temperatures that varied widely. Also, the type and condition of the shoot flush can affect regeneration frequencies
<xref ref-type="bibr" rid="pone.0047426-Cervera2">[21]</xref>
; internode explants were taken from stems harvested from trees from which shoot flushes were previously harvested. These factors and their interaction on transformation efficiency are essentially unknown, not accounted for, and therefore part of the observed variability.</p>
<p>Transformation efficiency was greatest for US-942. This may be because trifoliate hybrids are some of the most transformable citrus types. However, the AgNO
<sub>3</sub>
-GA-PGR-Basal medium experiment was conducted only on US-942 and the identified conditions for good shoot regeneration were then applied to all the citrus types. To what extent this effect was due to the inherent responsiveness of trifoliate hybrids vs. using conditions specifically optimized for US-942 is unknown.</p>
<p>In this study we have quantified the effects of a dark incubation period and the medium components AgNO
<sub>3</sub>
, GA, type of PGR, and basal medium on shoot regeneration from internode explants from adult phase greenhouse-grown citrus trees. Under our conditions, a dark incubation period was essential and GA, zeatin riboside, and MS basal medium enhanced shoot regeneration. The assumption that treatments that enhanced shoot regeneration would also enhance transformation was made and four diverse citrus were transformed using a single protocol. Because transgenic plants were obtained from these four citrus types, with little control of the initial physiological status of the trees, suggests 1) the potential importance of optimizing protocols to local conditions and, 2) that further improvements in transformation efficiencies across a broad range of citrus types are likely.</p>
</sec>
</body>
<back>
<ack>
<p>We thank Marjory Faulkner, Dave Lindsey, and Diane Helseth for horticultural maintenance and care of the greenhouse grown citrus trees. We thank Eldridge Wynn, Jessica Dennis, and Kathryn Hovey for providing plant tissue culture technical assistance, advice, and laboratory maintenance. We thank Lori Hutchinson for micro-grafting technical assistance. We thank Angela Ledger for the PCR and Southern blot hybridization.</p>
<p>The use or mention of a trademark or proprietary product does not constitute an endorsement, guarantee, or warranty of the product by the U.S. Department of Agriculture and does not imply its approval to the exclusion of other suitable products.</p>
</ack>
<ref-list>
<title>References</title>
<ref id="pone.0047426-Bov1">
<label>1</label>
<mixed-citation publication-type="journal">
<name>
<surname>Bové</surname>
<given-names>JM</given-names>
</name>
(
<year>2006</year>
)
<article-title>Huanglongbing: A destructive, newly-emerging, century-old disease of citrus</article-title>
.
<source>J Plant Pathol</source>
<volume>88</volume>
:
<fpage>7</fpage>
<lpage>37</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Hidaka1">
<label>2</label>
<mixed-citation publication-type="journal">
<name>
<surname>Hidaka</surname>
<given-names>T</given-names>
</name>
,
<name>
<surname>Omura</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Ugaki</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Tomiyama</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Kato</surname>
<given-names>A</given-names>
</name>
,
<etal>et al</etal>
(
<year>1990</year>
)
<article-title>
<italic>Agrobacterium</italic>
-mediated transformation and regeneration of Citrus spp. from suspension cells</article-title>
.
<source>Japan J Breeding</source>
<volume>40</volume>
:
<fpage>199</fpage>
<lpage>207</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Moore1">
<label>3</label>
<mixed-citation publication-type="journal">
<name>
<surname>Moore</surname>
<given-names>GA</given-names>
</name>
,
<name>
<surname>Jacono</surname>
<given-names>CC</given-names>
</name>
,
<name>
<surname>Neidigh</surname>
<given-names>JL</given-names>
</name>
,
<name>
<surname>Lawrence</surname>
<given-names>SD</given-names>
</name>
,
<name>
<surname>Cline</surname>
<given-names>K</given-names>
</name>
(
<year>1992</year>
)
<article-title>
<italic>Agrobacterium</italic>
-mediated transformation of
<italic>Citrus</italic>
stem segments and regeneration of transgenic plants</article-title>
.
<source>Plant Cell Rep</source>
<volume>11</volume>
:
<fpage>238</fpage>
<lpage>242</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-He1">
<label>4</label>
<mixed-citation publication-type="journal">
<name>
<surname>He</surname>
<given-names>Y</given-names>
</name>
,
<name>
<surname>Chen</surname>
<given-names>S</given-names>
</name>
,
<name>
<surname>Peng</surname>
<given-names>A</given-names>
</name>
,
<name>
<surname>Zou</surname>
<given-names>X</given-names>
</name>
,
<name>
<surname>Xu</surname>
<given-names>L</given-names>
</name>
,
<etal>et al</etal>
(
<year>2011</year>
)
<article-title>Production and evaluation of transgenic sweet orange (
<italic>Citrus sinensis</italic>
Osbeck) containing bivalent antibacterial peptide genes (Shiva A and Cecropin B) via a novel
<italic>Agrobacterium</italic>
-mediated transformation of mature axillary buds</article-title>
.
<source>Sci Hortic</source>
<volume>128</volume>
:
<fpage>99</fpage>
<lpage>107</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Xu1">
<label>5</label>
<mixed-citation publication-type="journal">
<name>
<surname>Xu</surname>
<given-names>SX</given-names>
</name>
,
<name>
<surname>Cai</surname>
<given-names>XD</given-names>
</name>
,
<name>
<surname>Tan</surname>
<given-names>B</given-names>
</name>
,
<name>
<surname>Guo</surname>
<given-names>WW</given-names>
</name>
(
<year>2011</year>
)
<article-title>Comparison of expression of three different sub-cellular targeted GFPs in transgenic Valencia sweet orange by confocal laser scanning microscopy</article-title>
.
<source>Plant Cell Tissue Organ Cult</source>
<volume>104</volume>
:
<fpage>199</fpage>
<lpage>207</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Yang1">
<label>6</label>
<mixed-citation publication-type="journal">
<name>
<surname>Yang</surname>
<given-names>L</given-names>
</name>
,
<name>
<surname>Hu</surname>
<given-names>C</given-names>
</name>
,
<name>
<surname>Li</surname>
<given-names>N</given-names>
</name>
,
<name>
<surname>Zhang</surname>
<given-names>J</given-names>
</name>
,
<name>
<surname>Yan</surname>
<given-names>J</given-names>
</name>
,
<etal>et al</etal>
(
<year>2011</year>
)
<article-title>Transformation of sweet orange [
<italic>Citrus sinensis</italic>
(L.) Osbeck] with
<italic>pth</italic>
A-
<italic>nls</italic>
for acquiring resistance to citrus canker disease</article-title>
.
<source>Plant Mol Biol</source>
<volume>75</volume>
:
<fpage>11</fpage>
<lpage>23</lpage>
<pub-id pub-id-type="pmid">20972821</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0047426-Fu1">
<label>7</label>
<mixed-citation publication-type="journal">
<name>
<surname>Fu</surname>
<given-names>XZ</given-names>
</name>
,
<name>
<surname>Chen</surname>
<given-names>CW</given-names>
</name>
,
<name>
<surname>Wang</surname>
<given-names>Y</given-names>
</name>
,
<name>
<surname>Liu</surname>
<given-names>JH</given-names>
</name>
,
<name>
<surname>Moriguchi</surname>
<given-names>T</given-names>
</name>
(
<year>2011</year>
)
<article-title>Ectopic expression of MdSPDS1 in sweet orange (
<italic>Citrus sinensis</italic>
Osbeck) reduces canker susceptibility: involvement of H
<sub>2</sub>
O
<sub>2</sub>
production and transcriptional alteration</article-title>
.
<source>BMC Plant Biol</source>
<volume>11</volume>
:
<fpage>55</fpage>
<pub-id pub-id-type="pmid">21439092</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0047426-Khawale1">
<label>8</label>
<mixed-citation publication-type="journal">
<name>
<surname>Khawale</surname>
<given-names>RN</given-names>
</name>
,
<name>
<surname>Singh</surname>
<given-names>SK</given-names>
</name>
,
<name>
<surname>Garg</surname>
<given-names>G</given-names>
</name>
,
<name>
<surname>Baranwal</surname>
<given-names>VK</given-names>
</name>
,
<name>
<surname>Ajirlo</surname>
<given-names>SA</given-names>
</name>
(
<year>2006</year>
)
<article-title>
<italic>Agrobacterium</italic>
- mediated genetic transformation of Nagpur mandarin (
<italic>Citrus reticulata</italic>
Blanco)</article-title>
.
<source>Curr Sci</source>
<volume>91</volume>
:
<fpage>1700</fpage>
<lpage>1705</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Cervera1">
<label>9</label>
<mixed-citation publication-type="journal">
<name>
<surname>Cervera</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Navarro</surname>
<given-names>A</given-names>
</name>
,
<name>
<surname>Navarro</surname>
<given-names>L</given-names>
</name>
,
<name>
<surname>Peña</surname>
<given-names>L</given-names>
</name>
(
<year>2008</year>
)
<article-title>Production of transgenic adult plants from clementine mandarin by enhancing cell competence for transformation and regeneration</article-title>
.
<source>Tree Physiol</source>
<volume>28</volume>
:
<fpage>55</fpage>
<lpage>66</lpage>
<pub-id pub-id-type="pmid">17938114</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0047426-Luth1">
<label>10</label>
<mixed-citation publication-type="journal">
<name>
<surname>Luth</surname>
<given-names>D</given-names>
</name>
,
<name>
<surname>Moore</surname>
<given-names>G</given-names>
</name>
(
<year>1999</year>
)
<article-title>Transgenic grapefruit plants obtained by
<italic>Agrobacterium tumefaciens</italic>
-mediated transformation</article-title>
.
<source>Plant Cell Tissue Organ Cult</source>
<volume>57</volume>
:
<fpage>219</fpage>
<lpage>222</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Yang2">
<label>11</label>
<mixed-citation publication-type="journal">
<name>
<surname>Yang</surname>
<given-names>ZN</given-names>
</name>
,
<name>
<surname>Ingelbrecht</surname>
<given-names>IL</given-names>
</name>
,
<name>
<surname>Louzada</surname>
<given-names>E</given-names>
</name>
,
<name>
<surname>Skaria</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Mirkov</surname>
<given-names>TE</given-names>
</name>
(
<year>2000</year>
)
<article-title>
<italic>Agrobacterium</italic>
-mediated transformation of the commercially important grapefruit cultivar Rio Red (
<italic>Citrus paradisi</italic>
Macf.)</article-title>
.
<source>Plant Cell Rep</source>
<volume>19</volume>
:
<fpage>1203</fpage>
<lpage>1211</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Ananthakrishnan1">
<label>12</label>
<mixed-citation publication-type="journal">
<name>
<surname>Ananthakrishnan</surname>
<given-names>G</given-names>
</name>
,
<name>
<surname>Orbovic</surname>
<given-names>V</given-names>
</name>
,
<name>
<surname>Pasquali</surname>
<given-names>G</given-names>
</name>
,
<name>
<surname>Calovic</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Grosser</surname>
<given-names>JW</given-names>
</name>
(
<year>2007</year>
)
<article-title>Transfer of citrus tristeza virus (CTV)-derived resistance candidate sequences to four grapefruit cultivars through
<italic>Agrobacterium</italic>
-mediated transformation</article-title>
.
<source>In Vitro Dev Biol Plant</source>
<volume>43</volume>
:
<fpage>593</fpage>
<lpage>601</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-LoezaKuk1">
<label>13</label>
<mixed-citation publication-type="journal">
<name>
<surname>Loeza-Kuk</surname>
<given-names>E</given-names>
</name>
,
<name>
<surname>Gutiérrez-Espinosa</surname>
<given-names>MA</given-names>
</name>
,
<name>
<surname>Ochoa-Martínez</surname>
<given-names>DL</given-names>
</name>
,
<name>
<surname>Villegas-Monter</surname>
<given-names>A</given-names>
</name>
,
<name>
<surname>Mora-Aguilera</surname>
<given-names>G</given-names>
</name>
,
<etal>et al</etal>
(
<year>2011</year>
)
<article-title>Resistance analysis in grapefruit and Mexican lime transformed with the p25 Citrus tristeza virus gen</article-title>
.
<source>Agrociencia</source>
<volume>45</volume>
:
<fpage>55</fpage>
<lpage>65</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Ghorbel1">
<label>14</label>
<mixed-citation publication-type="journal">
<name>
<surname>Ghorbel</surname>
<given-names>R</given-names>
</name>
,
<name>
<surname>La-Malfa</surname>
<given-names>S</given-names>
</name>
,
<name>
<surname>Lopez</surname>
<given-names>MM</given-names>
</name>
,
<name>
<surname>Petit</surname>
<given-names>A</given-names>
</name>
,
<name>
<surname>Navarro</surname>
<given-names>L</given-names>
</name>
,
<etal>et al</etal>
(
<year>2001</year>
)
<article-title>Additional copies of
<italic>virG</italic>
from pTiBo542 provide a super-transformation ability to
<italic>Agrobacterium tumefaciens</italic>
in citrus</article-title>
.
<source>Physiol Mol Plant Pathol</source>
<volume>58</volume>
:
<fpage>103</fpage>
<lpage>110</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Enrique1">
<label>15</label>
<mixed-citation publication-type="journal">
<name>
<surname>Enrique</surname>
<given-names>R</given-names>
</name>
,
<name>
<surname>Siciliano</surname>
<given-names>F</given-names>
</name>
,
<name>
<surname>Favaro</surname>
<given-names>MA</given-names>
</name>
,
<name>
<surname>Gerhardt</surname>
<given-names>N</given-names>
</name>
,
<name>
<surname>Roeschlin</surname>
<given-names>R</given-names>
</name>
,
<etal>et al</etal>
(
<year>2011</year>
)
<article-title>Novel demonstration of RNAi in citrus reveals importance of citrus callose synthase in defence against
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
</article-title>
.
<source>Plant Biotechnol J</source>
<volume>9</volume>
:
<fpage>394</fpage>
<lpage>407</lpage>
<pub-id pub-id-type="pmid">20809929</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0047426-Pea1">
<label>16</label>
<mixed-citation publication-type="journal">
<name>
<surname>Peña</surname>
<given-names>L</given-names>
</name>
,
<name>
<surname>Cervera</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Juárez</surname>
<given-names>J</given-names>
</name>
,
<name>
<surname>Navarro</surname>
<given-names>A</given-names>
</name>
,
<name>
<surname>Pina</surname>
<given-names>JA</given-names>
</name>
,
<etal>et al</etal>
(
<year>1997</year>
)
<article-title>Genetic transformation of lime (
<italic>Citrus aurantifolia</italic>
Swing.): factors affecting transformation and regeneration</article-title>
.
<source>Plant Cell Rep</source>
<volume>16</volume>
:
<fpage>731</fpage>
<lpage>737</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Dutt1">
<label>17</label>
<mixed-citation publication-type="journal">
<name>
<surname>Dutt</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Vasconcellos</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Grosser</surname>
<given-names>JW</given-names>
</name>
(
<year>2011</year>
)
<article-title>Effects of antioxidants on
<italic>Agrobacterium</italic>
-mediated transformation and accelerated production of transgenic plants of Mexican lime (
<italic>Citrus aurantifolia</italic>
Swingle)</article-title>
.
<source>Plant Cell Tissue Organ Cult</source>
<volume>107</volume>
:
<fpage>79</fpage>
<lpage>89</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Kaneyoshi1">
<label>18</label>
<mixed-citation publication-type="journal">
<name>
<surname>Kaneyoshi</surname>
<given-names>J</given-names>
</name>
,
<name>
<surname>Kobayashi</surname>
<given-names>S</given-names>
</name>
,
<name>
<surname>Nakamura</surname>
<given-names>Y</given-names>
</name>
,
<name>
<surname>Shigemoto</surname>
<given-names>N</given-names>
</name>
,
<name>
<surname>Doi</surname>
<given-names>Y</given-names>
</name>
(
<year>1994</year>
)
<article-title>A simple and efficient gene transfer system of trifoliate orange (
<italic>Poncirus trifoliata</italic>
Raf.)</article-title>
.
<source>Plant Cell Rep</source>
<volume>13</volume>
:
<fpage>541</fpage>
<lpage>545</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Pea2">
<label>19</label>
<mixed-citation publication-type="journal">
<article-title>Peña L, Cervera M, Juárez J, Ortega C, Pina JA, et al. (l995). High efficiency
<italic>Agrobacterium</italic>
-mediated transformation and regeneration of citrus</article-title>
.
<source>Plant Sci</source>
<volume>104</volume>
:
<fpage>183</fpage>
<lpage>191</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Molinari1">
<label>20</label>
<mixed-citation publication-type="journal">
<name>
<surname>Molinari</surname>
<given-names>HBC</given-names>
</name>
,
<name>
<surname>Bespalhok</surname>
<given-names>JC</given-names>
</name>
,
<name>
<surname>Kobayashi</surname>
<given-names>AK</given-names>
</name>
,
<name>
<surname>Pereira</surname>
<given-names>LFP</given-names>
</name>
,
<name>
<surname>Vieira</surname>
<given-names>LGE</given-names>
</name>
(
<year>2004</year>
)
<article-title>
<italic>Agrobacterium tumefaciens</italic>
-mediated transformation of Swingle citrumelo (
<italic>Citrus paradisi</italic>
Macf.×
<italic>Poncirus trifoliata</italic>
L. Raf.) using thin epicotyl sections</article-title>
.
<source>Sci Hortic</source>
<volume>99</volume>
:
<fpage>379</fpage>
<lpage>385</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Cervera2">
<label>21</label>
<mixed-citation publication-type="journal">
<name>
<surname>Cervera</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Juarez</surname>
<given-names>J</given-names>
</name>
,
<name>
<surname>Navarro</surname>
<given-names>A</given-names>
</name>
,
<name>
<surname>Pina</surname>
<given-names>JA</given-names>
</name>
,
<name>
<surname>Duran-Vila</surname>
<given-names>N</given-names>
</name>
,
<etal>et al</etal>
(
<year>1998</year>
)
<article-title>Genetic transformation and regeneration of mature tissues of woody fruit plants bypassing the juvenile stage</article-title>
.
<source>Transgenic Res</source>
<volume>7</volume>
:
<fpage>51</fpage>
<lpage>59</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Almeida1">
<label>22</label>
<mixed-citation publication-type="journal">
<name>
<surname>Almeida</surname>
<given-names>WAB</given-names>
</name>
,
<name>
<surname>Mourão Filhoa</surname>
<given-names>FAA</given-names>
</name>
,
<name>
<surname>Pinoa</surname>
<given-names>LE</given-names>
</name>
,
<name>
<surname>Boscariol</surname>
<given-names>RL</given-names>
</name>
,
<name>
<surname>Rodriguez</surname>
<given-names>APM</given-names>
</name>
,
<etal>et al</etal>
(
<year>2003</year>
)
<article-title>Genetic transformation and plant recovery from mature tissues of
<italic>Citrus sinensis</italic>
L. Osbeck</article-title>
.
<source>Plant Sci</source>
<volume>164</volume>
:
<fpage>203</fpage>
<lpage>211</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Rodrguez1">
<label>23</label>
<mixed-citation publication-type="journal">
<name>
<surname>Rodríguez</surname>
<given-names>A</given-names>
</name>
,
<name>
<surname>Cervera</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Peris</surname>
<given-names>JE</given-names>
</name>
,
<name>
<surname>Peña</surname>
<given-names>L</given-names>
</name>
(
<year>2008</year>
)
<article-title>The same treatment for transgenic shoot regeneration elicits the opposite effect in mature explants from two closely related sweet orange (
<italic>Citrus sinensis</italic>
(L.) Osb.) genotypes</article-title>
.
<source>Plant Cell Tissue Organ Cult</source>
<volume>93</volume>
:
<fpage>97</fpage>
<lpage>106</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-United1">
<label>24</label>
<mixed-citation publication-type="other">United States Department of Agriculture. Notice to fruit growers and nurserymen relative to the naming and release of the US-942 citrus rootstock. Washington: Agricultural Research Service, 2010.</mixed-citation>
</ref>
<ref id="pone.0047426-MarutaniHert1">
<label>25</label>
<mixed-citation publication-type="journal">
<name>
<surname>Marutani-Hert</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Evens</surname>
<given-names>TJ</given-names>
</name>
,
<name>
<surname>McCollum</surname>
<given-names>GT</given-names>
</name>
,
<name>
<surname>Niedz</surname>
<given-names>RP</given-names>
</name>
(
<year>2011</year>
)
<article-title>Bud emergence and shoot growth from mature citrus nodal stem segments</article-title>
.
<source>Plant Cell Tissue Organ Cult</source>
<volume>106</volume>
:
<fpage>81</fpage>
<lpage>91</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Murashige1">
<label>26</label>
<mixed-citation publication-type="journal">
<name>
<surname>Murashige</surname>
<given-names>T</given-names>
</name>
,
<name>
<surname>Skoog</surname>
<given-names>F</given-names>
</name>
(
<year>1962</year>
)
<article-title>A revised medium for rapid growth and bioassays with tobacco tissue culture</article-title>
.
<source>Physiol Plant</source>
<volume>15</volume>
:
<fpage>473</fpage>
<lpage>497</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Hood1">
<label>27</label>
<mixed-citation publication-type="journal">
<name>
<surname>Hood</surname>
<given-names>EE</given-names>
</name>
,
<name>
<surname>Gelvin</surname>
<given-names>SB</given-names>
</name>
,
<name>
<surname>Melchers</surname>
<given-names>LS</given-names>
</name>
,
<name>
<surname>Hoekema</surname>
<given-names>A</given-names>
</name>
(
<year>1993</year>
)
<article-title>New
<italic>Agrobacterium</italic>
helper plasmids for gene transfer to plants</article-title>
.
<source>Transgenic Res</source>
<volume>2</volume>
:
<fpage>208</fpage>
<lpage>218</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Vancanneyt1">
<label>28</label>
<mixed-citation publication-type="journal">
<name>
<surname>Vancanneyt</surname>
<given-names>G</given-names>
</name>
,
<name>
<surname>Schmidt</surname>
<given-names>R</given-names>
</name>
,
<name>
<surname>O’Conner-Sanchez</surname>
<given-names>A</given-names>
</name>
,
<name>
<surname>Willmitzer</surname>
<given-names>L</given-names>
</name>
,
<name>
<surname>Ro-cha-Sosa</surname>
<given-names>M</given-names>
</name>
(
<year>1990</year>
)
<article-title>Construction of an intron-containing marker gene: Splicing of the intron in transgenic plants and its use in monitoring early events in
<italic>Agrobacterium</italic>
-mediated plant transformation</article-title>
.
<source>Mol Gen Genet</source>
<volume>220</volume>
:
<fpage>245</fpage>
<lpage>250</lpage>
<pub-id pub-id-type="pmid">2325623</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0047426-Bowman1">
<label>29</label>
<mixed-citation publication-type="journal">
<name>
<surname>Bowman</surname>
<given-names>KD</given-names>
</name>
,
<name>
<surname>Rouse</surname>
<given-names>RE</given-names>
</name>
(
<year>2006</year>
)
<article-title>US-812 citrus rootstock</article-title>
.
<source>Hortscience</source>
<volume>41</volume>
:
<fpage>832</fpage>
<lpage>836</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Jefferson1">
<label>30</label>
<mixed-citation publication-type="journal">
<name>
<surname>Jefferson</surname>
<given-names>RA</given-names>
</name>
,
<name>
<surname>Kavanagh</surname>
<given-names>TA</given-names>
</name>
,
<name>
<surname>Bevan</surname>
<given-names>MW</given-names>
</name>
(
<year>1987</year>
)
<article-title>GUS fusions, β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants</article-title>
.
<source>EMBO J</source>
<volume>6</volume>
:
<fpage>3901</fpage>
<lpage>3908</lpage>
<pub-id pub-id-type="pmid">3327686</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0047426-Franche1">
<label>31</label>
<mixed-citation publication-type="journal">
<name>
<surname>Franche</surname>
<given-names>C</given-names>
</name>
,
<name>
<surname>Diouf</surname>
<given-names>D</given-names>
</name>
,
<name>
<surname>Le</surname>
<given-names>QV</given-names>
</name>
,
<name>
<surname>Bogusz</surname>
<given-names>D</given-names>
</name>
,
<name>
<surname>N'Diaye</surname>
<given-names>A</given-names>
</name>
,
<name>
<surname>Gherbi</surname>
<given-names>H</given-names>
</name>
,
<name>
<surname>Gobe</surname>
<given-names>C</given-names>
</name>
,
<name>
<surname>Duhoux</surname>
<given-names>E</given-names>
</name>
(
<year>1997</year>
)
<article-title>Genetic transformation of the actinorhizal tree
<italic>Allocasuarina verticillata</italic>
by
<italic>Agrobacterium tumefaciens</italic>
</article-title>
.
<source>Plant J</source>
<volume>11</volume>
:
<fpage>897</fpage>
<lpage>904</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-DellaPorta1">
<label>32</label>
<mixed-citation publication-type="journal">
<name>
<surname>DellaPorta</surname>
<given-names>J</given-names>
</name>
,
<name>
<surname>Wood</surname>
<given-names>J</given-names>
</name>
,
<name>
<surname>Hicks</surname>
<given-names>JB</given-names>
</name>
(
<year>1983</year>
)
<article-title>A plant DNA minipreperation: version II</article-title>
.
<source>Plant Mol Biol Rep</source>
<volume>1</volume>
:
<fpage>19</fpage>
<lpage>21</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Niedz1">
<label>33</label>
<mixed-citation publication-type="journal">
<name>
<surname>Niedz</surname>
<given-names>RP</given-names>
</name>
,
<name>
<surname>Evens</surname>
<given-names>TJ</given-names>
</name>
(
<year>2011</year>
)
<article-title>Mixture screening and mixture-amount designs to determine plant growth regulator effects on shoot regeneration from grapefruit (
<italic>Citrus paradisi</italic>
macf.) epicotyls</article-title>
.
<source>In Vitro Cell Dev Biol Plant</source>
<volume>47</volume>
:
<fpage>682</fpage>
<lpage>694</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-DuranVila1">
<label>34</label>
<mixed-citation publication-type="journal">
<name>
<surname>Duran-Vila</surname>
<given-names>N</given-names>
</name>
,
<name>
<surname>Gogorcena</surname>
<given-names>Y</given-names>
</name>
,
<name>
<surname>Ortega</surname>
<given-names>V</given-names>
</name>
,
<name>
<surname>Ortiz</surname>
<given-names>J</given-names>
</name>
,
<name>
<surname>Navarro</surname>
<given-names>L</given-names>
</name>
(
<year>1992</year>
)
<article-title>Morphogenesis and tissue-culture of sweet orange [
<italic>Citrus sinensis</italic>
(L.) Osb.] – Effect of temperature and photosynthetic radiation</article-title>
.
<source>Plant Cell Tissue Organ Cult</source>
<volume>29</volume>
:
<fpage>11</fpage>
<lpage>18</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-MoreiraDias1">
<label>35</label>
<mixed-citation publication-type="journal">
<name>
<surname>Moreira-Dias</surname>
<given-names>JM</given-names>
</name>
,
<name>
<surname>Molina</surname>
<given-names>RV</given-names>
</name>
,
<name>
<surname>Bordón</surname>
<given-names>Y</given-names>
</name>
,
<name>
<surname>Guadiola</surname>
<given-names>JL</given-names>
</name>
,
<name>
<surname>García-Luis</surname>
<given-names>A</given-names>
</name>
(
<year>2000</year>
)
<article-title>Direct and indirect shoot organogenic pathways in epicotyl cuttings of Troyer citrange differ in hormone requirements and in their response to light</article-title>
.
<source>Ann Bot</source>
<volume>85</volume>
:
<fpage>103</fpage>
<lpage>110</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Kobayashi1">
<label>36</label>
<mixed-citation publication-type="journal">
<name>
<surname>Kobayashi</surname>
<given-names>AK</given-names>
</name>
,
<name>
<surname>Bespalhok</surname>
<given-names>JC</given-names>
</name>
,
<name>
<surname>Pereira</surname>
<given-names>LEP</given-names>
</name>
,
<name>
<surname>Vieira</surname>
<given-names>LGE</given-names>
</name>
(
<year>2003</year>
)
<article-title>Plant regeneration of sweet orange (
<italic>Citrus sinensis</italic>
) from thin sections of mature stem segments</article-title>
.
<source>Plant Cell Tissue Organ Cult</source>
<volume>74</volume>
:
<fpage>99</fpage>
<lpage>102</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-OliveiraMLP1">
<label>37</label>
<mixed-citation publication-type="journal">
<name>
<surname>Oliveira MLP</surname>
<given-names>de</given-names>
</name>
,
<name>
<surname>Costa</surname>
<given-names>MGC</given-names>
</name>
,
<name>
<surname>Silva CV</surname>
<given-names>da</given-names>
</name>
,
<name>
<surname>Otoni</surname>
<given-names>WC</given-names>
</name>
(
<year>2010</year>
)
<article-title>Growth regulators, culture media and antibiotics in the in vitro shoot regeneration from mature tissue of citrus cultivars</article-title>
.
<source>Pesqui Agropecu Bras</source>
<volume>45</volume>
:
<fpage>654</fpage>
<lpage>660</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Bassan1">
<label>38</label>
<mixed-citation publication-type="journal">
<name>
<surname>Bassan</surname>
<given-names>MM</given-names>
</name>
,
<name>
<surname>Filho F de</surname>
<given-names>AAM</given-names>
</name>
,
<name>
<surname>Miyata</surname>
<given-names>LY</given-names>
</name>
,
<name>
<surname>Mendes</surname>
<given-names>BMJ</given-names>
</name>
(
<year>2011</year>
)
<article-title>In vitro organogenesis from internodal segments of adult sweet orange plants</article-title>
.
<source>Pesqui Agropecu Bras</source>
<volume>46</volume>
:
<fpage>672</fpage>
<lpage>674</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Curtis1">
<label>39</label>
<mixed-citation publication-type="journal">
<name>
<surname>Curtis</surname>
<given-names>IS</given-names>
</name>
,
<name>
<surname>Mirkov</surname>
<given-names>TE</given-names>
</name>
(
<year>2012</year>
)
<article-title>Influence of surfactants on growth and regeneration from mature internodal stem segments of sweet orange (
<italic>Citrus sinensis</italic>
) cv. Hamlin</article-title>
.
<source>Plant Cell Tissue Organ Cult</source>
<volume>108</volume>
:
<fpage>345</fpage>
<lpage>352</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-CruzdeCarvalho1">
<label>40</label>
<mixed-citation publication-type="journal">
<name>
<surname>Cruz de Carvalho</surname>
<given-names>MH</given-names>
</name>
,
<name>
<surname>Le</surname>
<given-names>BV</given-names>
</name>
,
<name>
<surname>Zuily-Fodil</surname>
<given-names>Y</given-names>
</name>
,
<name>
<surname>Pham Thi</surname>
<given-names>AT</given-names>
</name>
,
<name>
<surname>Thanh Van</surname>
<given-names>KT</given-names>
</name>
(
<year>2000</year>
)
<article-title>Efficient whole plant regeneration of common bean (
<italic>Phaseolus vulgaris</italic>
L.) using thin-cell-layer culture and silver nitrate</article-title>
.
<source>Plant Sci</source>
<volume>159</volume>
:
<fpage>223</fpage>
<lpage>232</lpage>
<pub-id pub-id-type="pmid">11074275</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0047426-Uliaie1">
<label>41</label>
<mixed-citation publication-type="journal">
<name>
<surname>Uliaie</surname>
<given-names>ED</given-names>
</name>
,
<name>
<surname>Farsi</surname>
<given-names>M</given-names>
</name>
,
<name>
<surname>Ghreyazie</surname>
<given-names>B</given-names>
</name>
,
<name>
<surname>Imani</surname>
<given-names>J</given-names>
</name>
(
<year>2008</year>
)
<article-title>Effects of genotype and AgNO
<sub>3</sub>
on shoot regeneration in winter cultivars of rapeseed (
<italic>Brassica napus</italic>
)</article-title>
.
<source>Pak J Biol Sci</source>
<volume>11</volume>
:
<fpage>2040</fpage>
<lpage>2043</lpage>
<pub-id pub-id-type="pmid">19266914</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0047426-Naik1">
<label>42</label>
<mixed-citation publication-type="journal">
<name>
<surname>Naik</surname>
<given-names>SK</given-names>
</name>
,
<name>
<surname>Chand</surname>
<given-names>PK</given-names>
</name>
(
<year>2003</year>
)
<article-title>Silver nitrate and aminoethoxyvinylglycine promote in vitro adventitious shoot regeneration of pomegranate (
<italic>Punica granatum</italic>
L.)</article-title>
.
<source>J Plant Physiol</source>
<volume>160</volume>
:
<fpage>423</fpage>
<lpage>30</lpage>
<pub-id pub-id-type="pmid">12756923</pub-id>
</mixed-citation>
</ref>
<ref id="pone.0047426-Geekiyanage1">
<label>43</label>
<mixed-citation publication-type="journal">
<name>
<surname>Geekiyanage</surname>
<given-names>S</given-names>
</name>
,
<name>
<surname>Takase</surname>
<given-names>T</given-names>
</name>
,
<name>
<surname>Watanabe</surname>
<given-names>S</given-names>
</name>
,
<name>
<surname>Fukai</surname>
<given-names>S</given-names>
</name>
,
<name>
<surname>Kiyosue</surname>
<given-names>T</given-names>
</name>
(
<year>2006</year>
)
<article-title>The combined effect of photoperiod, light intensity and GA
<sub>3</sub>
on adventitious shoot regeneration from cotyledons of spinach (
<italic>Spinacia oleracea</italic>
L.)</article-title>
.
<source>Plant Biotechnol J</source>
<volume>23</volume>
:
<fpage>431</fpage>
<lpage>435</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-Saini1">
<label>44</label>
<mixed-citation publication-type="journal">
<name>
<surname>Saini</surname>
<given-names>HK</given-names>
</name>
,
<name>
<surname>Gill</surname>
<given-names>MS</given-names>
</name>
,
<name>
<surname>Gill</surname>
<given-names>MIS</given-names>
</name>
(
<year>2010</year>
)
<article-title>Direct shoot organogenesis and plant regeneration in rough lemon (
<italic>Citrus jambhiri</italic>
Lush.)</article-title>
.
<source>Indian J Biotechnol</source>
<volume>9</volume>
:
<fpage>419</fpage>
<lpage>423</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-PerezTornero1">
<label>45</label>
<mixed-citation publication-type="journal">
<name>
<surname>Perez-Tornero</surname>
<given-names>O</given-names>
</name>
,
<name>
<surname>Tallon</surname>
<given-names>CI</given-names>
</name>
,
<name>
<surname>Porras</surname>
<given-names>I</given-names>
</name>
(
<year>2009</year>
)
<article-title>An efficient protocol for micropropagation of lemon (
<italic>Citrus limon</italic>
) from mature nodal segments</article-title>
.
<source>Plant Cell Tissue Organ Cult</source>
<volume>100</volume>
:
<fpage>263</fpage>
<lpage>271</lpage>
</mixed-citation>
</ref>
<ref id="pone.0047426-PeixotodeOliveira1">
<label>46</label>
<mixed-citation publication-type="journal">
<name>
<surname>Peixoto de Oliveira</surname>
<given-names>ML</given-names>
</name>
,
<name>
<surname>Costa</surname>
<given-names>MGC</given-names>
</name>
,
<name>
<surname>Viana da Silva</surname>
<given-names>C</given-names>
</name>
,
<name>
<surname>Otoni</surname>
<given-names>WC</given-names>
</name>
(
<year>2010</year>
)
<article-title>Growth regulators, culture media and antibiotics in the in vitro shoot regeneration from mature tissue of citrus cultivars</article-title>
.
<source>Pesqui Agropecu Bras</source>
<volume>45</volume>
:
<fpage>654</fpage>
<lpage>660</lpage>
</mixed-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 001127  | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 001127  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024