Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 000F310 ( Pmc/Corpus ); précédent : 000F309; suivant : 000F311 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Citrus
<italic>PH</italic>
5-like H
<sup>+</sup>
-ATPase genes: identification and transcript analysis to investigate their possible relationship with citrate accumulation in fruits</title>
<author>
<name sortKey="Shi, Cai Yun" sort="Shi, Cai Yun" uniqKey="Shi C" first="Cai-Yun" last="Shi">Cai-Yun Shi</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Song, Rui Qin" sort="Song, Rui Qin" uniqKey="Song R" first="Rui-Qin" last="Song">Rui-Qin Song</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hu, Xiao Mei" sort="Hu, Xiao Mei" uniqKey="Hu X" first="Xiao-Mei" last="Hu">Xiao-Mei Hu</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Liu, Xiao" sort="Liu, Xiao" uniqKey="Liu X" first="Xiao" last="Liu">Xiao Liu</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Jin, Long Fei" sort="Jin, Long Fei" uniqKey="Jin L" first="Long-Fei" last="Jin">Long-Fei Jin</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Liu, Yong Zhong" sort="Liu, Yong Zhong" uniqKey="Liu Y" first="Yong-Zhong" last="Liu">Yong-Zhong Liu</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">25806039</idno>
<idno type="pmc">4353184</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4353184</idno>
<idno type="RBID">PMC:4353184</idno>
<idno type="doi">10.3389/fpls.2015.00135</idno>
<date when="2015">2015</date>
<idno type="wicri:Area/Pmc/Corpus">000F31</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Citrus
<italic>PH</italic>
5-like H
<sup>+</sup>
-ATPase genes: identification and transcript analysis to investigate their possible relationship with citrate accumulation in fruits</title>
<author>
<name sortKey="Shi, Cai Yun" sort="Shi, Cai Yun" uniqKey="Shi C" first="Cai-Yun" last="Shi">Cai-Yun Shi</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Song, Rui Qin" sort="Song, Rui Qin" uniqKey="Song R" first="Rui-Qin" last="Song">Rui-Qin Song</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Hu, Xiao Mei" sort="Hu, Xiao Mei" uniqKey="Hu X" first="Xiao-Mei" last="Hu">Xiao-Mei Hu</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Liu, Xiao" sort="Liu, Xiao" uniqKey="Liu X" first="Xiao" last="Liu">Xiao Liu</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Jin, Long Fei" sort="Jin, Long Fei" uniqKey="Jin L" first="Long-Fei" last="Jin">Long-Fei Jin</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Liu, Yong Zhong" sort="Liu, Yong Zhong" uniqKey="Liu Y" first="Yong-Zhong" last="Liu">Yong-Zhong Liu</name>
<affiliation>
<nlm:aff id="aff1">
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="aff2">
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Frontiers in Plant Science</title>
<idno type="eISSN">1664-462X</idno>
<imprint>
<date when="2015">2015</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>
<italic>PH</italic>
5 is a petunia gene that encodes a plasma membrane H
<sup>+</sup>
-ATPase and determines the vacuolar pH. The citrate content of fruit cell vacuoles influences citrus organoleptic qualities. Although citrus could have
<italic>PH</italic>
5-like homologs that are involved in citrate accumulation, the details are still unknown. In this study, extensive data-mining with the
<italic>PH</italic>
5 sequence and PCR amplification confirmed that there are at least eight
<italic>PH</italic>
5-like genes (
<italic>CsPH</italic>
1-8) in the citrus genome. CsPHs have a molecular mass of approximately 100 kDa, and they have high similarity to PhPH5, AtAHA10 or AtAHA2 (from 64.6 to 80.9%). They contain 13–21 exons and 12–20 introns and were evenly distributed into four subgroups of the P3A-subfamily (
<italic>CsPH</italic>
1,
<italic>CsPH</italic>
2, and
<italic>CsPH</italic>
3 in Group I,
<italic>CsPH</italic>
4 and
<italic>CsPH</italic>
5 in Group II,
<italic>CsPH</italic>
6 in Group IV, and
<italic>CsPH</italic>
7 and
<italic>CsPH</italic>
8 in Group III together with
<italic>PhPH</italic>
5). A transcript analysis showed that
<italic>CsPH</italic>
1, 3, and 4 were predominantly expressed in mature leaves, whereas
<italic>CsPH</italic>
2 and 7 were predominantly expressed in roots,
<italic>CsPH</italic>
5 and 6 were predominantly expressed in flowers, and
<italic>CsPH</italic>
8 was predominantly expressed in fruit juice sacs (JS). Moreover, the
<italic>CsPH</italic>
transcript profiles differed between orange and pummelo, as well as between high-acid and low-acid cultivars. The low-acid orange “Honganliu” exhibits low transcript levels of
<italic>CsPH</italic>
3,
<italic>CsPH</italic>
4,
<italic>CsPH</italic>
5, and
<italic>CsPH</italic>
8, whereas the acid-free pummelo (AFP) has only a low transcript level of
<italic>CsPH</italic>
8. In addition, ABA injection increased the citrate content significantly, which was accompanied by the obvious induction of
<italic>CsPH</italic>
2, 6, 7, and 8 transcript levels. Taken together, we suggest that
<italic>CsPH</italic>
8 seems likely to regulate citrate accumulation in the citrus fruit vacuole.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Amemiya, T" uniqKey="Amemiya T">T. Amemiya</name>
</author>
<author>
<name sortKey="Kawai, Y" uniqKey="Kawai Y">Y. Kawai</name>
</author>
<author>
<name sortKey="Yamaki, S" uniqKey="Yamaki S">S. Yamaki</name>
</author>
<author>
<name sortKey="Shiratake, K" uniqKey="Shiratake K">K. Shiratake</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Aprile, A" uniqKey="Aprile A">A. Aprile</name>
</author>
<author>
<name sortKey="Federici, C" uniqKey="Federici C">C. Federici</name>
</author>
<author>
<name sortKey="Close, T" uniqKey="Close T">T. Close</name>
</author>
<author>
<name sortKey="Bellis, L" uniqKey="Bellis L">L. Bellis</name>
</author>
<author>
<name sortKey="Cattivelli, L" uniqKey="Cattivelli L">L. Cattivelli</name>
</author>
<author>
<name sortKey="Roose, M" uniqKey="Roose M">M. Roose</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arango, M" uniqKey="Arango M">M. Arango</name>
</author>
<author>
<name sortKey="Gevaudant, F" uniqKey="Gevaudant F">F. Gévaudant</name>
</author>
<author>
<name sortKey="Oufattole, M" uniqKey="Oufattole M">M. Oufattole</name>
</author>
<author>
<name sortKey="Boutry, M" uniqKey="Boutry M">M. Boutry</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Axelsen, K B" uniqKey="Axelsen K">K. B. Axelsen</name>
</author>
<author>
<name sortKey="Palmgren, M G" uniqKey="Palmgren M">M. G. Palmgren</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Axelsen, K B" uniqKey="Axelsen K">K. B. Axelsen</name>
</author>
<author>
<name sortKey="Venema, K" uniqKey="Venema K">K. Venema</name>
</author>
<author>
<name sortKey="Jahn, T" uniqKey="Jahn T">T. Jahn</name>
</author>
<author>
<name sortKey="Baunsgaard, L" uniqKey="Baunsgaard L">L. Baunsgaard</name>
</author>
<author>
<name sortKey="Palmgren, M G" uniqKey="Palmgren M">M. G. Palmgren</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baldwin, E A" uniqKey="Baldwin E">E. A. Baldwin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Barkla, B J" uniqKey="Barkla B">B. J. Barkla</name>
</author>
<author>
<name sortKey="Vera Estrella, R" uniqKey="Vera Estrella R">R. Vera-Estrella</name>
</author>
<author>
<name sortKey="Maldonado Gama, M" uniqKey="Maldonado Gama M">M. Maldonado-Gama</name>
</author>
<author>
<name sortKey="Pantoja, O" uniqKey="Pantoja O">O. Pantoja</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bartolozzi, F" uniqKey="Bartolozzi F">F. Bartolozzi</name>
</author>
<author>
<name sortKey="Bertazza, G" uniqKey="Bertazza G">G. Bertazza</name>
</author>
<author>
<name sortKey="Bassi, D" uniqKey="Bassi D">D. Bassi</name>
</author>
<author>
<name sortKey="Cristoferi, G" uniqKey="Cristoferi G">G. Cristoferi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bastias, A" uniqKey="Bastias A">A. Bastías</name>
</author>
<author>
<name sortKey="L Pez Climent, M" uniqKey="L Pez Climent M">M. López-Climent</name>
</author>
<author>
<name sortKey="Valcarcel, M" uniqKey="Valcarcel M">M. Valcárcel</name>
</author>
<author>
<name sortKey="Rosello, S" uniqKey="Rosello S">S. Rosello</name>
</author>
<author>
<name sortKey="G Mez Cadenas, A" uniqKey="G Mez Cadenas A">A. Gómez-Cadenas</name>
</author>
<author>
<name sortKey="Casaretto, J A" uniqKey="Casaretto J">J. A. Casaretto</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baxter, I" uniqKey="Baxter I">I. Baxter</name>
</author>
<author>
<name sortKey="Tchieu, J" uniqKey="Tchieu J">J. Tchieu</name>
</author>
<author>
<name sortKey="Sussman, M R" uniqKey="Sussman M">M. R. Sussman</name>
</author>
<author>
<name sortKey="Boutry, M" uniqKey="Boutry M">M. Boutry</name>
</author>
<author>
<name sortKey="Palmgren, M G" uniqKey="Palmgren M">M. G. Palmgren</name>
</author>
<author>
<name sortKey="Gribskov, M" uniqKey="Gribskov M">M. Gribskov</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baxter, I R" uniqKey="Baxter I">I. R. Baxter</name>
</author>
<author>
<name sortKey="Young, J C" uniqKey="Young J">J. C. Young</name>
</author>
<author>
<name sortKey="Armstrong, G" uniqKey="Armstrong G">G. Armstrong</name>
</author>
<author>
<name sortKey="Foster, N" uniqKey="Foster N">N. Foster</name>
</author>
<author>
<name sortKey="Bogenschutz, N" uniqKey="Bogenschutz N">N. Bogenschutz</name>
</author>
<author>
<name sortKey="Cordova, T" uniqKey="Cordova T">T. Cordova</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bogin, E" uniqKey="Bogin E">E. Bogin</name>
</author>
<author>
<name sortKey="Wallace, A" uniqKey="Wallace A">A. Wallace</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Brune, A" uniqKey="Brune A">A. Brune</name>
</author>
<author>
<name sortKey="Muller, M" uniqKey="Muller M">M. Muller</name>
</author>
<author>
<name sortKey="Taiz, L" uniqKey="Taiz L">L. Taiz</name>
</author>
<author>
<name sortKey="Gonzalez, P" uniqKey="Gonzalez P">P. Gonzalez</name>
</author>
<author>
<name sortKey="Etxeberria, E" uniqKey="Etxeberria E">E. Etxeberria</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cerc S, M" uniqKey="Cerc S M">M. Cercós</name>
</author>
<author>
<name sortKey="Soler, G" uniqKey="Soler G">G. Soler</name>
</author>
<author>
<name sortKey="Iglesias, D" uniqKey="Iglesias D">D. Iglesias</name>
</author>
<author>
<name sortKey="Gadea, J" uniqKey="Gadea J">J. Gadea</name>
</author>
<author>
<name sortKey="Forment, J" uniqKey="Forment J">J. Forment</name>
</author>
<author>
<name sortKey="Tal N, M" uniqKey="Tal N M">M. Talón</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cohen, S" uniqKey="Cohen S">S. Cohen</name>
</author>
<author>
<name sortKey="Itkin, M" uniqKey="Itkin M">M. Itkin</name>
</author>
<author>
<name sortKey="Yeselson, Y" uniqKey="Yeselson Y">Y. Yeselson</name>
</author>
<author>
<name sortKey="Tzuri, G" uniqKey="Tzuri G">G. Tzuri</name>
</author>
<author>
<name sortKey="Portnoy, V" uniqKey="Portnoy V">V. Portnoy</name>
</author>
<author>
<name sortKey="Harel Baja, R" uniqKey="Harel Baja R">R. Harel-Baja</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Coker, J S" uniqKey="Coker J">J. S. Coker</name>
</author>
<author>
<name sortKey="Jones, D" uniqKey="Jones D">D. Jones</name>
</author>
<author>
<name sortKey="Davies, E" uniqKey="Davies E">E. Davies</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Degu, A" uniqKey="Degu A">A. Degu</name>
</author>
<author>
<name sortKey="Hatew, B" uniqKey="Hatew B">B. Hatew</name>
</author>
<author>
<name sortKey="Nunes Nesi, A" uniqKey="Nunes Nesi A">A. Nunes-Nesi</name>
</author>
<author>
<name sortKey="Shlizerman, L" uniqKey="Shlizerman L">L. Shlizerman</name>
</author>
<author>
<name sortKey="Zur, N" uniqKey="Zur N">N. Zur</name>
</author>
<author>
<name sortKey="Katz, E" uniqKey="Katz E">E. Katz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Duby, G" uniqKey="Duby G">G. Duby</name>
</author>
<author>
<name sortKey="Boutry, M" uniqKey="Boutry M">M. Boutry</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eisenach, C" uniqKey="Eisenach C">C. Eisenach</name>
</author>
<author>
<name sortKey="Baetz, U" uniqKey="Baetz U">U. Baetz</name>
</author>
<author>
<name sortKey="Martinoia, E" uniqKey="Martinoia E">E. Martinoia</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Etienne, A" uniqKey="Etienne A">A. Etienne</name>
</author>
<author>
<name sortKey="Genard, M" uniqKey="Genard M">M. Génard</name>
</author>
<author>
<name sortKey="Lobit, P" uniqKey="Lobit P">P. Lobit</name>
</author>
<author>
<name sortKey="Mbeguie A Mbeguie, D" uniqKey="Mbeguie A Mbeguie D">D. Mbeguié-a-Mbéguié</name>
</author>
<author>
<name sortKey="Bugaud, C" uniqKey="Bugaud C">C. Bugaud</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Faraco, M" uniqKey="Faraco M">M. Faraco</name>
</author>
<author>
<name sortKey="Spelt, C" uniqKey="Spelt C">C. Spelt</name>
</author>
<author>
<name sortKey="Bliek, M" uniqKey="Bliek M">M. Bliek</name>
</author>
<author>
<name sortKey="Verweij, W" uniqKey="Verweij W">W. Verweij</name>
</author>
<author>
<name sortKey="Hoshino, A" uniqKey="Hoshino A">A. Hoshino</name>
</author>
<author>
<name sortKey="Espen, L" uniqKey="Espen L">L. Espen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fuglsang, A T" uniqKey="Fuglsang A">A. T. Fuglsang</name>
</author>
<author>
<name sortKey="Visconti, S" uniqKey="Visconti S">S. Visconti</name>
</author>
<author>
<name sortKey="Drumm, K" uniqKey="Drumm K">K. Drumm</name>
</author>
<author>
<name sortKey="Jahn, T" uniqKey="Jahn T">T. Jahn</name>
</author>
<author>
<name sortKey="Stensballe, A" uniqKey="Stensballe A">A. Stensballe</name>
</author>
<author>
<name sortKey="Mattei, B" uniqKey="Mattei B">B. Mattei</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gaxiola, R A" uniqKey="Gaxiola R">R. A. Gaxiola</name>
</author>
<author>
<name sortKey="Palmgren, M G" uniqKey="Palmgren M">M. G. Palmgren</name>
</author>
<author>
<name sortKey="Schumacher, K" uniqKey="Schumacher K">K. Schumacher</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guo, A Y" uniqKey="Guo A">A.-Y. Guo</name>
</author>
<author>
<name sortKey="Zhu, Q H" uniqKey="Zhu Q">Q.-H. Zhu</name>
</author>
<author>
<name sortKey="Chen, X" uniqKey="Chen X">X. Chen</name>
</author>
<author>
<name sortKey="Luo, J C" uniqKey="Luo J">J.-C. Luo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hu, X M" uniqKey="Hu X">X.-M. Hu</name>
</author>
<author>
<name sortKey="Shi, C Y" uniqKey="Shi C">C.-Y. Shi</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X. Liu</name>
</author>
<author>
<name sortKey="Jin, L F" uniqKey="Jin L">L.-F. Jin</name>
</author>
<author>
<name sortKey="Liu, Y Z" uniqKey="Liu Y">Y.-Z. Liu</name>
</author>
<author>
<name sortKey="Peng, S A" uniqKey="Peng S">S.-A. Peng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Katz, E" uniqKey="Katz E">E. Katz</name>
</author>
<author>
<name sortKey="Fon, M" uniqKey="Fon M">M. Fon</name>
</author>
<author>
<name sortKey="Lee, Y J" uniqKey="Lee Y">Y. J. Lee</name>
</author>
<author>
<name sortKey="Phinney, B S" uniqKey="Phinney B">B. S. Phinney</name>
</author>
<author>
<name sortKey="Sadka, A" uniqKey="Sadka A">A. Sadka</name>
</author>
<author>
<name sortKey="Blumwald, E" uniqKey="Blumwald E">E. Blumwald</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kempa, S" uniqKey="Kempa S">S. Kempa</name>
</author>
<author>
<name sortKey="Krasensky, J" uniqKey="Krasensky J">J. Krasensky</name>
</author>
<author>
<name sortKey="Dal Santo, S" uniqKey="Dal Santo S">S. Dal Santo</name>
</author>
<author>
<name sortKey="Kopka, J" uniqKey="Kopka J">J. Kopka</name>
</author>
<author>
<name sortKey="Jonak, C" uniqKey="Jonak C">C. Jonak</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kobashi, K" uniqKey="Kobashi K">K. Kobashi</name>
</author>
<author>
<name sortKey="Sugaya, S" uniqKey="Sugaya S">S. Sugaya</name>
</author>
<author>
<name sortKey="Gemma, H" uniqKey="Gemma H">H. Gemma</name>
</author>
<author>
<name sortKey="Iwahori, S" uniqKey="Iwahori S">S. Iwahori</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kojima, K" uniqKey="Kojima K">K. Kojima</name>
</author>
<author>
<name sortKey="Yamada, Y" uniqKey="Yamada Y">Y. Yamada</name>
</author>
<author>
<name sortKey="Yamamoto, M" uniqKey="Yamamoto M">M. Yamamoto</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Koressaar, T" uniqKey="Koressaar T">T. Koressaar</name>
</author>
<author>
<name sortKey="Remm, M" uniqKey="Remm M">M. Remm</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Q" uniqKey="Liu Q">Q. Liu</name>
</author>
<author>
<name sortKey="Xu, J" uniqKey="Xu J">J. Xu</name>
</author>
<author>
<name sortKey="Liu, Y Z" uniqKey="Liu Y">Y. Z. Liu</name>
</author>
<author>
<name sortKey="Zhao, X L" uniqKey="Zhao X">X. L. Zhao</name>
</author>
<author>
<name sortKey="Deng, X X" uniqKey="Deng X">X. X. Deng</name>
</author>
<author>
<name sortKey="Guo, L L" uniqKey="Guo L">L. L. Guo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X. Liu</name>
</author>
<author>
<name sortKey="Hu, X M" uniqKey="Hu X">X.-M. Hu</name>
</author>
<author>
<name sortKey="Jin, L F" uniqKey="Jin L">L.-F. Jin</name>
</author>
<author>
<name sortKey="Shi, C Y" uniqKey="Shi C">C.-Y. Shi</name>
</author>
<author>
<name sortKey="Liu, Y Z" uniqKey="Liu Y">Y.-Z. Liu</name>
</author>
<author>
<name sortKey="Peng, S A" uniqKey="Peng S">S.-A. Peng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Y Z" uniqKey="Liu Y">Y. Z. Liu</name>
</author>
<author>
<name sortKey="Liu, Q" uniqKey="Liu Q">Q. Liu</name>
</author>
<author>
<name sortKey="Tao, N G" uniqKey="Tao N">N. G. Tao</name>
</author>
<author>
<name sortKey="Deng, X X" uniqKey="Deng X">X. X. Deng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Livak, K J" uniqKey="Livak K">K. J. Livak</name>
</author>
<author>
<name sortKey="Schmittigen, T D" uniqKey="Schmittigen T">T. D. Schmittigen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Michelet, B" uniqKey="Michelet B">B. Michelet</name>
</author>
<author>
<name sortKey="Boutry, M" uniqKey="Boutry M">M. Boutry</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Muller, M L" uniqKey="Muller M">M. L. Müller</name>
</author>
<author>
<name sortKey="Irkenskiesecker, U" uniqKey="Irkenskiesecker U">U. Irkenskiesecker</name>
</author>
<author>
<name sortKey="Rubinstein, B" uniqKey="Rubinstein B">B. Rubinstein</name>
</author>
<author>
<name sortKey="Taiz, L" uniqKey="Taiz L">L. Taiz</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Palmgren, M G" uniqKey="Palmgren M">M. G. Palmgren</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pedersen, B P" uniqKey="Pedersen B">B. P. Pedersen</name>
</author>
<author>
<name sortKey="Buch Pedersen, M J" uniqKey="Buch Pedersen M">M. J. Buch-Pedersen</name>
</author>
<author>
<name sortKey="Preben Morth, J" uniqKey="Preben Morth J">J. Preben Morth</name>
</author>
<author>
<name sortKey="Palmgren, M G" uniqKey="Palmgren M">M. G. Palmgren</name>
</author>
<author>
<name sortKey="Nissen, P" uniqKey="Nissen P">P. Nissen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pedersen, C N S" uniqKey="Pedersen C">C. N. S. Pedersen</name>
</author>
<author>
<name sortKey="Axelsen, K B" uniqKey="Axelsen K">K. B. Axelsen</name>
</author>
<author>
<name sortKey="Harper, J F" uniqKey="Harper J">J. F. Harper</name>
</author>
<author>
<name sortKey="Palmgren, M G" uniqKey="Palmgren M">M. G. Palmgren</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Perzov, N" uniqKey="Perzov N">N. Perzov</name>
</author>
<author>
<name sortKey="Padler Karavani, V" uniqKey="Padler Karavani V">V. Padler-Karavani</name>
</author>
<author>
<name sortKey="Nelson, H" uniqKey="Nelson H">H. Nelson</name>
</author>
<author>
<name sortKey="Nelson, N" uniqKey="Nelson N">N. Nelson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Popova, T N" uniqKey="Popova T">T. N. Popova</name>
</author>
<author>
<name sortKey="Pinheiro De Carvalho, M A" uniqKey="Pinheiro De Carvalho M">M. A. Pinheiro De Carvalho</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sadka, A" uniqKey="Sadka A">A. Sadka</name>
</author>
<author>
<name sortKey="Dahan, E" uniqKey="Dahan E">E. Dahan</name>
</author>
<author>
<name sortKey="Cohen, L" uniqKey="Cohen L">L. Cohen</name>
</author>
<author>
<name sortKey="Marsh, K B" uniqKey="Marsh K">K. B. Marsh</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schumacher, K" uniqKey="Schumacher K">K. Schumacher</name>
</author>
<author>
<name sortKey="Krebs, M" uniqKey="Krebs M">M. Krebs</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tamura, K" uniqKey="Tamura K">K. Tamura</name>
</author>
<author>
<name sortKey="Peterson, D" uniqKey="Peterson D">D. Peterson</name>
</author>
<author>
<name sortKey="Peterson, N" uniqKey="Peterson N">N. Peterson</name>
</author>
<author>
<name sortKey="Stecher, G" uniqKey="Stecher G">G. Stecher</name>
</author>
<author>
<name sortKey="Nei, M" uniqKey="Nei M">M. Nei</name>
</author>
<author>
<name sortKey="Kumar, S" uniqKey="Kumar S">S. Kumar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Terol, J" uniqKey="Terol J">J. Terol</name>
</author>
<author>
<name sortKey="Soler, G" uniqKey="Soler G">G. Soler</name>
</author>
<author>
<name sortKey="Talon, M" uniqKey="Talon M">M. Talon</name>
</author>
<author>
<name sortKey="Cercos, M" uniqKey="Cercos M">M. Cercos</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Umezawa, T" uniqKey="Umezawa T">T. Umezawa</name>
</author>
<author>
<name sortKey="Nakashima, K" uniqKey="Nakashima K">K. Nakashima</name>
</author>
<author>
<name sortKey="Miyakawa, T" uniqKey="Miyakawa T">T. Miyakawa</name>
</author>
<author>
<name sortKey="Kuromori, T" uniqKey="Kuromori T">T. Kuromori</name>
</author>
<author>
<name sortKey="Tanokura, M" uniqKey="Tanokura M">M. Tanokura</name>
</author>
<author>
<name sortKey="Shinozaki, K" uniqKey="Shinozaki K">K. Shinozaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Verweij, W" uniqKey="Verweij W">W. Verweij</name>
</author>
<author>
<name sortKey="Spelt, C" uniqKey="Spelt C">C. Spelt</name>
</author>
<author>
<name sortKey="Di Sansebastiano, G P" uniqKey="Di Sansebastiano G">G.-P. Di Sansebastiano</name>
</author>
<author>
<name sortKey="Vermeer, J" uniqKey="Vermeer J">J. Vermeer</name>
</author>
<author>
<name sortKey="Reale, L" uniqKey="Reale L">L. Reale</name>
</author>
<author>
<name sortKey="Ferranti, F" uniqKey="Ferranti F">F. Ferranti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xu, Q" uniqKey="Xu Q">Q. Xu</name>
</author>
<author>
<name sortKey="Chen, L L" uniqKey="Chen L">L. L. Chen</name>
</author>
<author>
<name sortKey="Ruan, X" uniqKey="Ruan X">X. Ruan</name>
</author>
<author>
<name sortKey="Chen, D" uniqKey="Chen D">D. Chen</name>
</author>
<author>
<name sortKey="Zhu, A" uniqKey="Zhu A">A. Zhu</name>
</author>
<author>
<name sortKey="Chen, C" uniqKey="Chen C">C. Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhou, G F" uniqKey="Zhou G">G. F. Zhou</name>
</author>
<author>
<name sortKey="Peng, S A" uniqKey="Peng S">S. A. Peng</name>
</author>
<author>
<name sortKey="Liu, Y Z" uniqKey="Liu Y">Y. Z. Liu</name>
</author>
<author>
<name sortKey="Wei, Q J" uniqKey="Wei Q">Q. J. Wei</name>
</author>
<author>
<name sortKey="Han, J" uniqKey="Han J">J. Han</name>
</author>
<author>
<name sortKey="Islam, M Z" uniqKey="Islam M">M. Z. Islam</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Front Plant Sci</journal-id>
<journal-id journal-id-type="iso-abbrev">Front Plant Sci</journal-id>
<journal-id journal-id-type="publisher-id">Front. Plant Sci.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Plant Science</journal-title>
</journal-title-group>
<issn pub-type="epub">1664-462X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">25806039</article-id>
<article-id pub-id-type="pmc">4353184</article-id>
<article-id pub-id-type="doi">10.3389/fpls.2015.00135</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Plant Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Citrus
<italic>PH</italic>
5-like H
<sup>+</sup>
-ATPase genes: identification and transcript analysis to investigate their possible relationship with citrate accumulation in fruits</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Shi</surname>
<given-names>Cai-Yun</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Song</surname>
<given-names>Rui-Qin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hu</surname>
<given-names>Xiao-Mei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Xiao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jin</surname>
<given-names>Long-Fei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:type="simple" xlink:href="http://community.frontiersin.org/people/u/215724"></uri>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Yong-Zhong</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:type="simple" xlink:href="http://community.frontiersin.org/people/u/203463"></uri>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University</institution>
<country>Wuhan, China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Key Laboratory of Horticultural Crop Biology and Genetic Improvement (Central Region), Ministry of Education</institution>
<country>Wuhan, China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Jean-Philippe Vielle-Calzada, CINVESTAV, Mexico</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Gerardo Acosta-Garcia, Instituto Tecnologico de Celaya, Mexico; Melanie Hand, CSIRO, Australia</p>
</fn>
<corresp id="fn001">*Correspondence: Yong-Zhong Liu, Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University, Shizishan Road 1#, Wuhan 430070, China
<email xlink:type="simple">liuyongzhong@mail.hzau.edu.cn</email>
</corresp>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Plant Genetics and Genomics, a section of the journal Frontiers in Plant Science</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>09</day>
<month>3</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="collection">
<year>2015</year>
</pub-date>
<volume>6</volume>
<elocation-id>135</elocation-id>
<history>
<date date-type="received">
<day>11</day>
<month>1</month>
<year>2015</year>
</date>
<date date-type="accepted">
<day>19</day>
<month>2</month>
<year>2015</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright © 2015 Shi, Song, Hu, Liu, Jin and Liu.</copyright-statement>
<copyright-year>2015</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/4.0/">
<license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<p>
<italic>PH</italic>
5 is a petunia gene that encodes a plasma membrane H
<sup>+</sup>
-ATPase and determines the vacuolar pH. The citrate content of fruit cell vacuoles influences citrus organoleptic qualities. Although citrus could have
<italic>PH</italic>
5-like homologs that are involved in citrate accumulation, the details are still unknown. In this study, extensive data-mining with the
<italic>PH</italic>
5 sequence and PCR amplification confirmed that there are at least eight
<italic>PH</italic>
5-like genes (
<italic>CsPH</italic>
1-8) in the citrus genome. CsPHs have a molecular mass of approximately 100 kDa, and they have high similarity to PhPH5, AtAHA10 or AtAHA2 (from 64.6 to 80.9%). They contain 13–21 exons and 12–20 introns and were evenly distributed into four subgroups of the P3A-subfamily (
<italic>CsPH</italic>
1,
<italic>CsPH</italic>
2, and
<italic>CsPH</italic>
3 in Group I,
<italic>CsPH</italic>
4 and
<italic>CsPH</italic>
5 in Group II,
<italic>CsPH</italic>
6 in Group IV, and
<italic>CsPH</italic>
7 and
<italic>CsPH</italic>
8 in Group III together with
<italic>PhPH</italic>
5). A transcript analysis showed that
<italic>CsPH</italic>
1, 3, and 4 were predominantly expressed in mature leaves, whereas
<italic>CsPH</italic>
2 and 7 were predominantly expressed in roots,
<italic>CsPH</italic>
5 and 6 were predominantly expressed in flowers, and
<italic>CsPH</italic>
8 was predominantly expressed in fruit juice sacs (JS). Moreover, the
<italic>CsPH</italic>
transcript profiles differed between orange and pummelo, as well as between high-acid and low-acid cultivars. The low-acid orange “Honganliu” exhibits low transcript levels of
<italic>CsPH</italic>
3,
<italic>CsPH</italic>
4,
<italic>CsPH</italic>
5, and
<italic>CsPH</italic>
8, whereas the acid-free pummelo (AFP) has only a low transcript level of
<italic>CsPH</italic>
8. In addition, ABA injection increased the citrate content significantly, which was accompanied by the obvious induction of
<italic>CsPH</italic>
2, 6, 7, and 8 transcript levels. Taken together, we suggest that
<italic>CsPH</italic>
8 seems likely to regulate citrate accumulation in the citrus fruit vacuole.</p>
</abstract>
<kwd-group>
<kwd>abscisic acid</kwd>
<kwd>citrus</kwd>
<kwd>citrate accumulation</kwd>
<kwd>fruit development</kwd>
<kwd>plasma membrane H
<sup>+</sup>
-ATPase</kwd>
</kwd-group>
<counts>
<fig-count count="6"></fig-count>
<table-count count="1"></table-count>
<equation-count count="0"></equation-count>
<ref-count count="49"></ref-count>
<page-count count="11"></page-count>
<word-count count="7367"></word-count>
</counts>
</article-meta>
</front>
<body>
<sec>
<title>Introduction</title>
<p>
<italic>PH</italic>
5 is a petunia gene that encodes a plasma membrane H
<sup>+</sup>
-ATPase (P-type ATPase) and has a demonstrated function in determining the vacuolar pH (Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
; Faraco et al.,
<xref rid="B21" ref-type="bibr">2014</xref>
). P-type ATPases are integral membrane proteins that are generally divided into five major and evolutionarily related subfamilies, including heavy-metal ATPases (P
<sub>1B</sub>
), Ca
<sup>2+</sup>
-ATPases [endoplasmic reticulum-type Ca
<sup>2+</sup>
-ATPase and autoinhibited Ca
<sup>2+</sup>
-ATPase (P
<sub>2A</sub>
) and P
<sub>2B</sub>
], H
<sup>+</sup>
-ATPases [autoinhibited H
<sup>+</sup>
-ATPase (P
<sub>3A</sub>
), P
<sub>3B</sub>
], putative aminophospholipid ATPases (ALA, P4), and a branch with unknown specificity (P5) (Axelsen and Palmgren,
<xref rid="B4" ref-type="bibr">2001</xref>
; Baxter et al.,
<xref rid="B10" ref-type="bibr">2003</xref>
; Pedersen et al.,
<xref rid="B39" ref-type="bibr">2012</xref>
). P-type ATPases commonly reside in the plasma membrane and act as a primary transporter for pumping protons out of the cell, thereby creating pH and electrical potential differences across the plasmalemma (Michelet and Boutry,
<xref rid="B35" ref-type="bibr">1995</xref>
).
<italic>PH</italic>
5 belongs to the P
<sub>3A</sub>
subfamily of P-type ATPases, and however, it resides in the vacuolar membrane (Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
). Clearly, P-type ATPases are involved in many physiological functions such as the activation of secondary transport, cellular nutrient uptake, cell expansion, stress adaptation, and plant growth and development (Michelet and Boutry,
<xref rid="B35" ref-type="bibr">1995</xref>
; Palmgren,
<xref rid="B37" ref-type="bibr">2001</xref>
; Gaxiola et al.,
<xref rid="B23" ref-type="bibr">2007</xref>
; Duby and Boutry,
<xref rid="B18" ref-type="bibr">2009</xref>
; Schumacher and Krebs,
<xref rid="B43" ref-type="bibr">2010</xref>
). Moreover, they are also involved in intracellular pH regulation (Michelet and Boutry,
<xref rid="B35" ref-type="bibr">1995</xref>
) and have a central role in vacuole acidification (Brune et al.,
<xref rid="B13" ref-type="bibr">2002</xref>
; Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
; Faraco et al.,
<xref rid="B21" ref-type="bibr">2014</xref>
).</p>
<p>The acidity of fleshy fruit is an important component of the fruit organoleptic quality. Acidity in the citrus juice cell or other fruit species such as strawberry and pineapple is largely related to the accumulation of citrate in the cell vacuole (Etienne et al.,
<xref rid="B20" ref-type="bibr">2013</xref>
). Citrate in the citrus fruit sarcocarp is synthesized in the mitochondria via the tricarboxylic acid cycle, and it is stored in the vacuole of juice cells (Baldwin,
<xref rid="B6" ref-type="bibr">1993</xref>
). Specifically, citrate synthase catalyzes acetyl-CoA and oxaloacetate to form citrate (citric acid) in the mitochondria (Popova and Pinheiro De Carvalho,
<xref rid="B41" ref-type="bibr">1998</xref>
); some citrate is then transported into the cytosol when the mitochondrial aconitase activity is partially blocked (Sadka et al.,
<xref rid="B42" ref-type="bibr">2000</xref>
); in the cytosol, most citrate will be transported into the cell vacuole and be stored there, which is accompanied by a large influx of protons mediated primarily by the vacuolar H
<sup>+</sup>
-ATPase (Müller et al.,
<xref rid="B36" ref-type="bibr">1996</xref>
; Brune et al.,
<xref rid="B13" ref-type="bibr">2002</xref>
). As the fruit matures, the vacuolar citrate enters the cytosol again and is consumed through the aconitase-γ-aminobutyrate pathway (Sadka et al.,
<xref rid="B42" ref-type="bibr">2000</xref>
; Cercós et al.,
<xref rid="B14" ref-type="bibr">2006</xref>
; Degu et al.,
<xref rid="B17" ref-type="bibr">2011</xref>
) and ATP-citrate lyase pathway (Katz et al.,
<xref rid="B26" ref-type="bibr">2007</xref>
; Hu et al.,
<xref rid="B25" ref-type="bibr">2015</xref>
). Clearly, the modulation of citrate accumulation is very important for fruit quality improvement. Most studies have shown that aconitase and H
<sup>+</sup>
-ATPase play important roles in regulating citrate accumulation in the vacuole (Bogin and Wallace,
<xref rid="B12" ref-type="bibr">1966</xref>
; Müller et al.,
<xref rid="B36" ref-type="bibr">1996</xref>
; Sadka et al.,
<xref rid="B42" ref-type="bibr">2000</xref>
; Brune et al.,
<xref rid="B13" ref-type="bibr">2002</xref>
; Cercós et al.,
<xref rid="B14" ref-type="bibr">2006</xref>
; Terol et al.,
<xref rid="B45" ref-type="bibr">2010</xref>
; Aprile et al.,
<xref rid="B2" ref-type="bibr">2011</xref>
; Degu et al.,
<xref rid="B17" ref-type="bibr">2011</xref>
). Compared with the aconitase, however, the H
<sup>+</sup>
-ATPase characteristics and functions in regulating citrate accumulation, especially at the gene level, were still lacking.</p>
<p>P-type ATPase is encoded by a multigene family (Baxter et al.,
<xref rid="B10" ref-type="bibr">2003</xref>
), and to date, H
<sup>+</sup>
- ATPase genes from many plants such as
<italic>Arabidopsis thaliana</italic>
(Palmgren,
<xref rid="B37" ref-type="bibr">2001</xref>
) and
<italic>Oryza sativa</italic>
(Arango et al.,
<xref rid="B3" ref-type="bibr">2003</xref>
) have been identified as their genome sequences were published (Pedersen et al.,
<xref rid="B39" ref-type="bibr">2012</xref>
). Moreover, some of these enzymes have been suggested or shown to play a pivotal role in regulating pH homeostasis (Baxter et al.,
<xref rid="B11" ref-type="bibr">2005</xref>
; Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
; Cohen et al.,
<xref rid="B15" ref-type="bibr">2014</xref>
; Faraco et al.,
<xref rid="B21" ref-type="bibr">2014</xref>
). For example, in
<italic>Arabidopsis</italic>
, the H
<sup>+</sup>
-ATPase gene
<italic>AtAHA10</italic>
exhibited a role in vacuole acidification with effects on the vacuole morphology (Baxter et al.,
<xref rid="B11" ref-type="bibr">2005</xref>
); in petunia, the mutation of P
<sub>3A</sub>
-ATPase gene
<italic>PH</italic>
5, which resides in the vacuolar membrane, resulted in a petunia with a blue flower color and high petal pH (Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
). Moreover, Faraco et al. (
<xref rid="B21" ref-type="bibr">2014</xref>
) reported on a P3B-ATPase gene called
<italic>PH</italic>
1, which also resides in the vacuolar membrane, and it is required for physical interactions with
<italic>PH</italic>
5 to hyperacidify the vacuoles. In citrus, Aprile et al. (
<xref rid="B2" ref-type="bibr">2011</xref>
) also found an
<italic>AtAHA10</italic>
homolog, which was not expressed in Faris sweet lemon, but it was highly expressed in sour lemons and was suggested to have an association with citrate accumulation in lemon juice sac cells. However, the information on acid-related H
<sup>+</sup>
-ATPase genes in citrus fruits is still scarce, although three citrus genome sequences have been published (Xu et al.,
<xref rid="B48" ref-type="bibr">2012</xref>
) (
<ext-link ext-link-type="uri" xlink:href="http://www.phytozome.net">www.phytozome.net</ext-link>
).</p>
<p>H
<sup>+</sup>
-ATPase genes play important roles in many physiological processes, and some genes have exhibited special roles in vacuolar acidification (Baxter et al.,
<xref rid="B11" ref-type="bibr">2005</xref>
; Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
; Faraco et al.,
<xref rid="B21" ref-type="bibr">2014</xref>
). Hence, we can hypothesize that there should be H
<sup>+</sup>
-ATPase genes in the citrus genome that are involved in the modulation of vacuolar acidification. In this study, eight
<italic>PH5</italic>
-like H
<sup>+</sup>
-ATPase genes were successfully identified using the
<italic>PhPH5</italic>
or
<italic>AtAHA10</italic>
sequence to query the citrus genome databases. Their transcript characteristics were investigated in the fruits of two pairs of citrus cultivars, which differ greatly in terms of citrate accumulation, to explore which gene is possibly involved in acid accumulation. Moreover, we also investigated their responses to ABA injection since the increase of ABA enhanced citrate accumulation (Liu et al.,
<xref rid="B32" ref-type="bibr">2014</xref>
; Hu et al.,
<xref rid="B25" ref-type="bibr">2015</xref>
), and some H
<sup>+</sup>
-ATPase gene expression profiles were affected by ABA (Barkla et al.,
<xref rid="B7" ref-type="bibr">1999</xref>
; Amemiya et al.,
<xref rid="B1" ref-type="bibr">2005</xref>
).</p>
</sec>
<sec sec-type="materials|methods" id="s1">
<title>Materials and methods</title>
<sec>
<title>Plant materials</title>
<p>“Anliu” orange (AL,
<italic>Citrus sinensis</italic>
cv. Anliu) was selected for gene organ/tissue-specific expression analysis. Samples were collected as described before (Hu et al.,
<xref rid="B25" ref-type="bibr">2015</xref>
). “Anliu” flowers (full opened, FL) and mature leaves (ML) were collected from “Anliu” trees at the inflorescence stage, fruit juice sacs (JS) were collected from “Anliu” fruits at 123 days after flowering (DAF), and fibrous roots (RT) were harvested from “Anliu” seedlings when the seedling height was over 10 cm. The seedlings were propagated as described by Zhou et al. (
<xref rid="B49" ref-type="bibr">2014</xref>
). All the samples were treated immediately with liquid nitrogen and stored at −80°C.</p>
<p>In addition, fruits from the AL and “Honganliu” orange (HAL,
<italic>C. sinensis</italic>
cv. Honganliu), “HB pummelo” (HBP,
<italic>C. grandis</italic>
Osbeck cv. HB pummelo) and acid-free pummelo (AFP) from a citrus germplasm orchard in Huazhong Agricultural University (Hubei province, China) were used in the present study. AL and HAL Fruits were harvested at 170 and 220 DAF. HBP and AFP Fruits were harvested at 133 and 183 DAF. Three to five healthy fruits were randomly harvested from the tree's outer crown at each time for each cultivar. Fruit JS were separated from each fruit and mixed together. They were then ground into granules in liquid nitrogen and stored at −80°C for use.</p>
</sec>
<sec>
<title>ABA injection</title>
<p>A 15-year old “Owari” Satsuma mandarin (
<italic>C. unshiu</italic>
cv. Owari) tree that was grafted onto a
<italic>Poncirus trifoliata</italic>
was selected for ABA treatment. The experimental design, time, sample collection and ABA injection were the same as in previous studies (Liu et al.,
<xref rid="B32" ref-type="bibr">2014</xref>
; Hu et al.,
<xref rid="B25" ref-type="bibr">2015</xref>
). The fruits were harvested 3 days after the last injection. The fruit JS was separated, frozen in liquid nitrogen immediately, and then stored at −80°C for further use.</p>
</sec>
<sec>
<title>Citrate determination</title>
<p>The citrate in the fruit JS was measured by gas-liquid chromatography (Bartolozzi et al.,
<xref rid="B8" ref-type="bibr">1997</xref>
).</p>
</sec>
<sec>
<title>Gene isolation and sequence analysis</title>
<p>The sequence for
<italic>PhPH</italic>
5 (ABC59935) or
<italic>AtAHA10</italic>
(AAB32310) was used to query the three citrus genome databases [the orange genome database is from Huazhong Agricultural University (HZAU), Wuhan, China (Xu et al.,
<xref rid="B48" ref-type="bibr">2012</xref>
); another orange genome database and a clementine genome database are found in phytozome (
<ext-link ext-link-type="uri" xlink:href="http://phytozome.jgi.doe.gov/pz/portal.html">http://phytozome.jgi.doe.gov/pz/portal.html</ext-link>
)] using the embedded BLAST tools. The filter criteria were set with an expected
<italic>E</italic>
-value threshold of E-30, and the function annotation was the plasma membrane ATPase in the HZAU orange genome database or the KOG function annotation is the plasma membrane H
<sup>+</sup>
-transporting ATPase in phytozome. Total RNA was isolated from “Anliu” JS by following the procedure described by Liu et al. (
<xref rid="B33" ref-type="bibr">2006</xref>
). One microgram of high-quality total RNA was used for first-strand cDNA synthesis using a PrimeScript RT Reagent kit with gDNA Eraser (TaKaRa, DALIAN, China). Gene-specific primers (Table
<xref ref-type="table" rid="T1">1</xref>
, Tables
<xref ref-type="supplementary-material" rid="SM2">S2</xref>
,
<xref ref-type="supplementary-material" rid="SM4">S4</xref>
) were designed by primer 3.0 (Koressaar and Remm,
<xref rid="B30" ref-type="bibr">2007</xref>
) based on the queried genomic sequences. The open reading frame (ORF), molecular weight and isoelectric point (pI) were predicted using the EditSeq program in Lasergene software (DNASTAR, USA). Gene intron/exon structures were analyzed by the Gene Structure Display Server (GSDS, gsds.cbi.pku.edu.cn) (Guo et al.,
<xref rid="B24" ref-type="bibr">2007</xref>
). The sequence similarities of amino acid sequences were calculated using the MegAlign program in Lasergene software. The alignment of multiple sequences was conducted using the CLUSTAL X (version 1.83) program. The phylogenetic tree was constructed by MEGA4 with the neighbor-joining method (Tamura et al.,
<xref rid="B44" ref-type="bibr">2011</xref>
).</p>
<table-wrap id="T1" position="float">
<label>Table 1</label>
<caption>
<p>
<bold>Citrus putative
<italic>PH</italic>
5-like gene sequences and their corresponding primers for quantitative real-time PCR</bold>
.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th valign="top" align="left" rowspan="1" colspan="1">
<bold>Gene name</bold>
</th>
<th valign="top" align="left" rowspan="1" colspan="1">
<bold>Sequence ID</bold>
</th>
<th valign="top" align="center" rowspan="1" colspan="1">
<bold>ORF amino acid length</bold>
</th>
<th valign="top" align="center" rowspan="1" colspan="1">
<bold>Mol. Wt (KDa)</bold>
</th>
<th valign="top" align="center" rowspan="1" colspan="1">
<bold>pI</bold>
</th>
<th valign="top" align="center" rowspan="1" colspan="1">
<bold>Primer name</bold>
</th>
<th valign="top" align="center" colspan="2" rowspan="1">
<bold>Sequence (5′–3′)</bold>
</th>
<th valign="top" align="center" rowspan="1" colspan="1">
<bold>Amplicon size (bp)</bold>
</th>
</tr>
<tr>
<th rowspan="1" colspan="1"></th>
<th rowspan="1" colspan="1"></th>
<th rowspan="1" colspan="1"></th>
<th rowspan="1" colspan="1"></th>
<th rowspan="1" colspan="1"></th>
<th rowspan="1" colspan="1"></th>
<th valign="top" align="center" rowspan="1" colspan="1">
<bold>Forward primer</bold>
</th>
<th valign="top" align="center" rowspan="1" colspan="1">
<bold>Reverse primer</bold>
</th>
<th rowspan="1" colspan="1"></th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>CsPH1</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">Cs5g04360.1</td>
<td valign="top" align="center" rowspan="1" colspan="1">955</td>
<td valign="top" align="center" rowspan="1" colspan="1">105.098</td>
<td valign="top" align="center" rowspan="1" colspan="1">6.24</td>
<td valign="top" align="center" rowspan="1" colspan="1">PH1</td>
<td valign="top" align="left" rowspan="1" colspan="1">GCTCTCACAGATTTGGTGGT</td>
<td valign="top" align="left" rowspan="1" colspan="1">CACAGCCTCCAAAACTTCCT</td>
<td valign="top" align="center" rowspan="1" colspan="1">165</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>CsPH2</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">Cs6g20570.1</td>
<td valign="top" align="center" rowspan="1" colspan="1">957</td>
<td valign="top" align="center" rowspan="1" colspan="1">105.299</td>
<td valign="top" align="center" rowspan="1" colspan="1">6.16</td>
<td valign="top" align="center" rowspan="1" colspan="1">PH2</td>
<td valign="top" align="left" rowspan="1" colspan="1">GAGGCAGTGTTGAAGGAAGC</td>
<td valign="top" align="left" rowspan="1" colspan="1">GGTTCCACATAAACCCCAAA</td>
<td valign="top" align="center" rowspan="1" colspan="1">190</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>CsPH3</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">Ciclev10013498m</td>
<td valign="top" align="center" rowspan="1" colspan="1">936</td>
<td valign="top" align="center" rowspan="1" colspan="1">103.237</td>
<td valign="top" align="center" rowspan="1" colspan="1">7.68</td>
<td valign="top" align="center" rowspan="1" colspan="1">PH3</td>
<td valign="top" align="left" rowspan="1" colspan="1">ACGAAGCAGTTACGGAGAAC</td>
<td valign="top" align="left" rowspan="1" colspan="1">AGTGATTCGACGTGCCCTTT</td>
<td valign="top" align="center" rowspan="1" colspan="1">108</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>CsPH4</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">Cs7g07300.1</td>
<td valign="top" align="center" rowspan="1" colspan="1">955</td>
<td valign="top" align="center" rowspan="1" colspan="1">105.024</td>
<td valign="top" align="center" rowspan="1" colspan="1">6.73</td>
<td valign="top" align="center" rowspan="1" colspan="1">PH4</td>
<td valign="top" align="left" rowspan="1" colspan="1">GTCTTCAACCACCCGAAACA</td>
<td valign="top" align="left" rowspan="1" colspan="1">AGCTTCACCACCGATTCAAC</td>
<td valign="top" align="center" rowspan="1" colspan="1">154</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>CsPH5</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">orange1.1g002208m</td>
<td valign="top" align="center" rowspan="1" colspan="1">954</td>
<td valign="top" align="center" rowspan="1" colspan="1">104.949</td>
<td valign="top" align="center" rowspan="1" colspan="1">6.66</td>
<td valign="top" align="center" rowspan="1" colspan="1">PH5</td>
<td valign="top" align="left" rowspan="1" colspan="1">ACCCTTCATGGGCTTCAAC</td>
<td valign="top" align="left" rowspan="1" colspan="1">GCTTCACCACTGACTCGACA</td>
<td valign="top" align="center" rowspan="1" colspan="1">163</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>CsPH6</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">Cs4g01370.1</td>
<td valign="top" align="center" rowspan="1" colspan="1">950</td>
<td valign="top" align="center" rowspan="1" colspan="1">104.428</td>
<td valign="top" align="center" rowspan="1" colspan="1">6.29</td>
<td valign="top" align="center" rowspan="1" colspan="1">PH6</td>
<td valign="top" align="left" rowspan="1" colspan="1">CAGGGTTGAAAACCAGGATG</td>
<td valign="top" align="left" rowspan="1" colspan="1">TCCATTGCTGTCGATGTAGG</td>
<td valign="top" align="center" rowspan="1" colspan="1">151</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>CsPH7</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">Ciclev10024879m</td>
<td valign="top" align="center" rowspan="1" colspan="1">860</td>
<td valign="top" align="center" rowspan="1" colspan="1">94.177</td>
<td valign="top" align="center" rowspan="1" colspan="1">5.33</td>
<td valign="top" align="center" rowspan="1" colspan="1">PH7</td>
<td valign="top" align="left" rowspan="1" colspan="1">ACAGGCTGTCTCAGCAAGGT</td>
<td valign="top" align="left" rowspan="1" colspan="1">GATCTTTCTCCACCCCCTTC</td>
<td valign="top" align="center" rowspan="1" colspan="1">165</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>CsPH8</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">Cs1g16150.1</td>
<td valign="top" align="center" rowspan="1" colspan="1">953</td>
<td valign="top" align="center" rowspan="1" colspan="1">104.923</td>
<td valign="top" align="center" rowspan="1" colspan="1">5.89</td>
<td valign="top" align="center" rowspan="1" colspan="1">PH8</td>
<td valign="top" align="left" rowspan="1" colspan="1">CCGTGAAGGAATTGATTTGG</td>
<td valign="top" align="left" rowspan="1" colspan="1">CCATGACAATGGATTCCACA</td>
<td valign="top" align="center" rowspan="1" colspan="1">190</td>
</tr>
<tr>
<td valign="top" align="left" rowspan="1" colspan="1">
<italic>Actin</italic>
</td>
<td valign="top" align="left" rowspan="1" colspan="1">XM_006464503</td>
<td valign="top" align="center" rowspan="1" colspan="1"></td>
<td valign="top" align="center" rowspan="1" colspan="1"></td>
<td valign="top" align="center" rowspan="1" colspan="1"></td>
<td valign="top" align="center" rowspan="1" colspan="1">actin</td>
<td valign="top" align="left" rowspan="1" colspan="1">CCGACCGTATGAGCAAGGAAA</td>
<td valign="top" align="left" rowspan="1" colspan="1">TTCCTGTGGACAATGGATGGA</td>
<td valign="top" align="center" rowspan="1" colspan="1">200</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec>
<title>Quantitative real-time PCR</title>
<p>The total RNA of all samples was isolated according to the protocol described before (Liu et al.,
<xref rid="B33" ref-type="bibr">2006</xref>
). The first-strand cDNAs were synthesized as mentioned above. Specific primers for the targeted genes and actin gene were designed with Primer 3.0 (Koressaar and Remm,
<xref rid="B30" ref-type="bibr">2007</xref>
) and are listed in Table
<xref ref-type="table" rid="T1">1</xref>
. Additionally, before quantitative Real-Time PCR (qRT-PCR), the amplification products from each primer pair of the other three cultivars were sequenced, and it was confirmed that no nucleotide difference was found among them. qRT-PCR was performed in a 10 μL reaction volume using SYBR
<italic>Premix Ex Taq</italic>
(TaKaRa, DALIAN, China) on a LightCycler 480 Real-Time System according to the manufacturer's protocol. qRT-PCR was conducted in three biological replicates. Each biological replicate was run with two technical replicates. The reactions were started with an initial incubation at 50°C for 2 min and then 95°C for 10 min, and then subjected to 40 cycles of 95°C for 15 s and 60°C for 60 s. The Livak method (Livak and Schmittigen,
<xref rid="B34" ref-type="bibr">2001</xref>
) was employed to calculate the relative gene expression level.</p>
</sec>
<sec>
<title>Statistical analysis</title>
<p>A significance test among or between samples was evaluated by Duncan's multiple range test or Student's
<italic>t</italic>
-test in the ANOVA program of SAS (SAS Institute, Cary, USA). Differences were considered significant at
<italic>P</italic>
< 0.05.</p>
</sec>
</sec>
<sec sec-type="results" id="s2">
<title>Results</title>
<sec>
<title>Data mining, identification and molecular characterization of citrus PH5-like H
<sup>+</sup>
-ATPase genes</title>
<p>An extensive search was performed in three citrus genome databases using the
<italic>Petunia PH5</italic>
(ABC59935) or
<italic>Arabidopsis AHA10</italic>
(AAB32310) sequence. Queries with either
<italic>PhPH5</italic>
or
<italic>AtAHA10</italic>
produced the same results and showed that there were at least 11
<italic>PH5</italic>
-like homologs in the HZAU orange database, 9 homologs in the Phytozome orange database, and 12 homologs in the Phytozome clementine database. Moreover, each gene in the HZAU orange genome database contains 1–4 theoretical transcripts (Table
<xref ref-type="supplementary-material" rid="SM1">S1</xref>
). Based on their nucleotide sequences, we could divide them into 10 groups by CLUSTAL X analysis and MEGA4 performance (Figure
<xref ref-type="supplementary-material" rid="SM7">S1</xref>
). Specific primers (Table
<xref ref-type="supplementary-material" rid="SM2">S2</xref>
) were then designed based on the consensus sequence among the genes in each group for PCR confirmation. In the end, we successfully amplified bands of expected sizes from eight groups and failed to amplify specific bands from group I and VIII (Figure
<xref ref-type="supplementary-material" rid="SM8">S2</xref>
). Because of an obvious difference in which some pairwise identities were lower than 95% that was found among the genes of some putative
<italic>PH5</italic>
-like gene groups (Table
<xref ref-type="supplementary-material" rid="SM3">S3</xref>
), we subsequently designed other specific primers (Table
<xref ref-type="supplementary-material" rid="SM4">S4</xref>
) based on the consensus sequence in the CDS (coding DNA sequence) region to screen the target gene sequence. After reduplicative PCR amplification and sequencing, we finally confirmed that the target gene sequences in groups II, III, IV, V, VI, VII, IX, and X were highly similar to those of Cs5g04360.1, Cs6g20570.1, Ciclev10013498m, Cs7g07300.1, orange1.1g002208m, Cs4g01370.1, Ciclev10024879m, and Cs1g16150.1, respectively. The identities of the amplified sequences with their corresponding genome database sequences were over 99.0%. Therefore, the corresponding genome database sequences were used in the following sequence analysis.</p>
<p>The eight
<italic>PH5</italic>
-like H
<sup>+</sup>
-ATPase genes were named
<italic>CsPH</italic>
1 to 8; the corresponding genome sequence ID and basic molecular information are listed in Table
<xref ref-type="table" rid="T1">1</xref>
. The peptide sequences of these eight putative
<italic>PH5</italic>
-like H
<sup>+</sup>
-ATPase genes contain 860–957 amino acids, 5.33–7.68 predicted pIs, and molecular weights from 94.177 to 105.299 kDa. They had high shared identities (Figure
<xref ref-type="fig" rid="F1">1</xref>
), and the identities between CsPHs were from 63.4 (between CsPH3 and CsPH7) to 90.8% (between CsPH1 and CsPH2) at the amino acid sequence level; the CsPHs also shared high similarities with PhPH5, AtAHA10, or AtAHA2, and the identities shared with PhPH5 were from 67.8 (CsPH3) to 86.6% (CsPH8), with AtAHA10 from 64.6 (CsPH3) to 80.9% (CsPH8), and for AtAHA2, they were from 70.5 (CsPH3) to 88.7% (CsPH5) (Table
<xref ref-type="supplementary-material" rid="SM5">S5</xref>
). Moreover, all CsPHs except for CsPH7, in which the C-terminal was truncated, contained two putative autoinhibitory sequences, namely Region I and Region II (Axelsen et al.,
<xref rid="B5" ref-type="bibr">1999</xref>
), and a 14-3-3 binding site (Fuglsang et al.,
<xref rid="B22" ref-type="bibr">1999</xref>
). Four residues (N
<sub>106</sub>
, I
<sub>282</sub>
, R
<sub>655</sub>
, and R
<sub>684</sub>
), which were possibly used for proton coordination and pumping (Pedersen et al.,
<xref rid="B38" ref-type="bibr">2007</xref>
), were found in all the CsPHs (Figure
<xref ref-type="fig" rid="F1">1</xref>
).</p>
<fig id="F1" position="float">
<label>Figure 1</label>
<caption>
<p>
<bold>Multiple alignment of the deduced amino acid sequence for CsPHs with the deduced amino acid residues of AtAHA2, AtAHA10, and PhPH5</bold>
. The alignment results for predicted transmembrane segments and putative autoinhibitory regions in P3A H
<sup>+</sup>
-ATPases are shown here. Asterisks mark the residues of potential importance for proton coordination and pumping based on evidence from mutagenesis and an analysis of an AtAHA2 crystal structure (Pedersen et al.,
<xref rid="B38" ref-type="bibr">2007</xref>
). The number of amino acid residues in AtAHA2 is indicated above each asterisk. R655 seems important for controlling the back flow of H
<sup>+</sup>
at high electro-chemical gradients (Pedersen et al.,
<xref rid="B38" ref-type="bibr">2007</xref>
). The two putative autoinhibitory sequences, RegionI and RegionII, were identified by Axelsen et al. (
<xref rid="B5" ref-type="bibr">1999</xref>
), and a 14-3-3 binding site (Fuglsang et al.,
<xref rid="B22" ref-type="bibr">1999</xref>
) is shown in the C-terminal region.</p>
</caption>
<graphic xlink:href="fpls-06-00135-g0001"></graphic>
</fig>
<p>The full-length cDNA and gDNA sequences of the
<italic>PH5</italic>
-like H
<sup>+</sup>
-ATPase genes were downloaded from their respective genome databases. A gene structure analysis showed that the eight CsPH genes contain 13–21 exons and 12–20 introns. Specifically,
<italic>CsPH</italic>
1, 2, and 8 contain 21 exons and 20 introns;
<italic>CsPH</italic>
3 contains 20 exons and 19 introns;
<italic>CsPH</italic>
4 and
<italic>CsPH</italic>
5 contain 16 exons and 15 introns;
<italic>CsPH</italic>
6 contains 13 exons and 12 introns; and
<italic>CsPH</italic>
7 contains 19 exons and 18 introns. Moreover, most exon sizes were conserved among the CsPH genes (Figure
<xref ref-type="fig" rid="F2">2</xref>
).</p>
<fig id="F2" position="float">
<label>Figure 2</label>
<caption>
<p>
<bold>Schematic gene structure of eight
<italic>PH5</italic>
-like H
<sup>+</sup>
-ATPases in citrus</bold>
. The boxes indicate the exon. The single line between the boxes indicates the intron. The numbers on the boxes indicate the exon length.</p>
</caption>
<graphic xlink:href="fpls-06-00135-g0002"></graphic>
</fig>
<p>To investigate the relationship between the
<italic>CsPH</italic>
genes and other P-type ATPase genes, another 28 sequences that belonged to the P
<sub>3A</sub>
-ATPase subfamily from
<italic>A. thaliana, Nicotiana plumbaginifolia, O. sativa</italic>
, and
<italic>Petumia hybrida</italic>
, and two sequences (PhPH1 and EcMgtA) belonging to the P
<sub>3B</sub>
-ATPase subfamily from
<italic>P. hybrida</italic>
and
<italic>Escherichia coli</italic>
were used to construct a phylogenetic tree. As shown in Figure
<xref ref-type="fig" rid="F3">3</xref>
, all the sequences were divided into two clusters, namely P
<sub>3A</sub>
-ATPase and P
<sub>3B</sub>
-ATPase. Of these sequences, the P
<sub>3A</sub>
-ATPase could be divided into five sub-groups (Group I to V), and PhPH1 and EcMgtA were clustered together into P
<sub>3B</sub>
-ATPase. The eight CsPHs were distributed among P
<sub>3A</sub>
-ATPase clusters. Specifically,
<italic>CsPH</italic>
1,
<italic>CsPH</italic>
2, and
<italic>CsPH</italic>
3 were clustered into Group I;
<italic>CsPH</italic>
4 and
<italic>CsPH</italic>
5 were clustered into Group II;
<italic>CsPH</italic>
6 was clustered into Group IV; and
<italic>CsPH</italic>
7 and
<italic>CsPH</italic>
8 were clustered into Group III, which contained PhPH5 and AtAHA10 (Figure
<xref ref-type="fig" rid="F3">3</xref>
).</p>
<fig id="F3" position="float">
<label>Figure 3</label>
<caption>
<p>
<bold>Phylogenetic analysis of the CsPH polypeptide sequences and other P
<sub>3A</sub>
-ATPases from
<italic>Arabidopsis</italic>
(At),
<italic>Nicotiana plumbaginifolia</italic>
(Np), rice (Os), and petunia (Ph)</bold>
. The phylogenetic tree was constructed using the MEGA 4.0 program with the neighbor-joining method. The plasma membrane H
<sup>+</sup>
-ATPase gene accession numbers are listed in Table
<xref ref-type="supplementary-material" rid="SM6">S6</xref>
. The numbers at the branch points indicate bootstrap support (1000 replicates). The black triangle shows the position of eight CsPH isoforms. The EcMgtA and PhPH1 belonging to P
<sub>3B</sub>
-ATPases were used here as outgroups.</p>
</caption>
<graphic xlink:href="fpls-06-00135-g0003"></graphic>
</fig>
</sec>
<sec>
<title>Spatial expression analysis of
<italic>PH</italic>
5-like H
<sup>+</sup>
-ATPase genes</title>
<p>Expression profiles of citrus
<italic>PH5</italic>
-like H
<sup>+</sup>
-ATPase genes (
<italic>CsPH</italic>
1-8) were examined in different organs/tissues including the fruit JS of 123 DAF, FL, ML, and seedling RTs (Figure
<xref ref-type="fig" rid="F4">4</xref>
).
<italic>CsPH1</italic>
(Figure
<xref ref-type="fig" rid="F4">4A</xref>
),
<italic>CsPH3</italic>
(Figure
<xref ref-type="fig" rid="F4">4C</xref>
), and
<italic>CsPH4</italic>
(Figure
<xref ref-type="fig" rid="F4">4D</xref>
) were predominantly expressed in ML. Out of all these genes, the
<italic>CsPH1</italic>
transcript level in ML was over 4.5-, 58-, and 200- times higher than those of RT, FL, and JS, respectively (Figure
<xref ref-type="fig" rid="F4">4A</xref>
); the
<italic>CsPH</italic>
3 transcript level in ML was over 2.5-, 10-, and 15- times higher than those of RT, FL, and JS, respectively (Figure
<xref ref-type="fig" rid="F4">4C</xref>
); and the
<italic>CsPH4</italic>
transcript level in ML was over 60-, 10-, and 800- times higher than those of RT, FL, and JS, respectively (Figure
<xref ref-type="fig" rid="F4">4D</xref>
). On the other hand,
<italic>CsPH2</italic>
(Figure
<xref ref-type="fig" rid="F4">4B</xref>
) and
<italic>CsPH7</italic>
(Figure
<xref ref-type="fig" rid="F4">4G</xref>
) were expressed predominantly in the RT in which the
<italic>CsPH2</italic>
transcript level was over 9.5-, 76-, and 74- times higher than those of ML, FL, and JS, respectively (Figure
<xref ref-type="fig" rid="F4">4B</xref>
), and the
<italic>CsPH7</italic>
transcript level was over 5.5-, 7.5-, and 95- times higher than those of ML, FL, and JS, respectively (Figure
<xref ref-type="fig" rid="F4">4G</xref>
). In addition,
<italic>CsPH5</italic>
(Figure
<xref ref-type="fig" rid="F4">4E</xref>
) and
<italic>CsPH6</italic>
(Figure
<xref ref-type="fig" rid="F4">4F</xref>
) were predominantly expressed in FL. Unlike other citrus
<italic>PH5-like</italic>
H
<sup>+</sup>
-ATPase genes, which exhibited the lowest transcript level in JS,
<italic>CsPH8</italic>
was predominantly expressed in JS and was over 580-, 21-, and 9500- times higher than those of RT, ML, and FL, respectively (Figure
<xref ref-type="fig" rid="F4">4H</xref>
).</p>
<fig id="F4" position="float">
<label>Figure 4</label>
<caption>
<p>
<bold>Relative transcript levels of eight
<italic>CsPH</italic>
genes in different citrus tissues or organs</bold>
. All qRT-PCR values are the average ± Se of three replicates. Different lower-case letters on the error bar in each gene indicate significant differences at
<italic>P</italic>
< 0.05 in Duncan's multiple range test.</p>
</caption>
<graphic xlink:href="fpls-06-00135-g0004"></graphic>
</fig>
</sec>
<sec>
<title>Expression analysis of
<italic>PH</italic>
5-like H
<sup>+</sup>
-ATPase genes in the fruits from two pairs of cultivars with different citrate contents</title>
<p>The citrate content and transcript levels of citrus
<italic>PH5-like</italic>
H
<sup>+</sup>
-ATPase genes (
<italic>CsPHs</italic>
) were assayed in fruit JS at two fruit developmental stages from two pairs of cultivars, namely AL and HAL and HBP and AFP (Figure
<xref ref-type="fig" rid="F5">5</xref>
). HAL is a bud mutant of AL with low acidity during fruit development and ripening (Liu et al.,
<xref rid="B31" ref-type="bibr">2007</xref>
). Although their citrate contents decreased as the fruit developed, the HAL citrate content was approximately one-tenth that of AL at 170 DAF, and it was undetectable at 220 DAF (Figure
<xref ref-type="fig" rid="F5">5A1</xref>
). However, AFP is a low-acidity pumello and might be a pumello mutant, but its wild type is not clear. Here, we chose HBP, a relatively high-acid pumello, as a control. The HBP maintained a relatively constant acidity as the fruit developed, and the AFP citrate content decreased as the fruit developed and was undetectable at 188 DAF (Figure
<xref ref-type="fig" rid="F5">5B1</xref>
), similar to that of HAL.</p>
<fig id="F5" position="float">
<label>Figure 5</label>
<caption>
<p>
<bold>Comparative analysis of citrate concentration (A1 and B1) and relative transcript levels of eight CsPH genes in fruit juice sacs from Anliu orange (AL), Honganliu orange (HAL), HB pummelo (HBP), and acid-free pummelo (AFP) at two developmental stages</bold>
.
<bold>A2–9</bold>
or
<bold>B2–9</bold>
refers to
<italic>CsPH</italic>
1-8. The values are the average ± Se of three replicates. Different lower-case letters on the error bar in each graph indicate a significant difference at
<italic>P</italic>
< 0.05 in Duncan's multiple range test.</p>
</caption>
<graphic xlink:href="fpls-06-00135-g0005"></graphic>
</fig>
<p>With respect to the expression profiles of
<italic>CsPHs</italic>
in these fruits,
<italic>CsPH</italic>
1 and 2 exhibited similar expression patterns during the fruit development of AL and HAL; namely, their transcript levels decreased significantly as the AL fruit developed and increased significantly as HAL fruit developed; moreover, the
<italic>CsPH</italic>
1 or 2 transcript levels in HAL was approximately one-sixth of that in AL at 170 DAF and over three times higher than that in AL at 220 DAF (Figures
<xref ref-type="fig" rid="F5">5A2,A3</xref>
). Unlike AL and HAL,
<italic>CsPH</italic>
1 and 2 increased significantly in both HBP and AFP as their fruits developed; the
<italic>CsPH</italic>
1 and 2 transcript levels in AFP were significantly or slightly higher than they were in HBP at both 133 and 188 DAF (Figures
<xref ref-type="fig" rid="F5">5B2,B3</xref>
).
<italic>CsPH</italic>
3 and
<italic>CsPH</italic>
8 also showed similar expression patterns during fruit development in AL and HAL. As in
<italic>CsPH</italic>
1 and 2 (Figures
<xref ref-type="fig" rid="F5">5A2,A3</xref>
), the
<italic>CsPH</italic>
3 and 8 transcript levels clearly decreased during AL fruit development (Figures
<xref ref-type="fig" rid="F5">5A4,A9</xref>
); however, their transcript levels were significantly lower in HAL than those in AL and remained constant during HAL fruit development (Figures
<xref ref-type="fig" rid="F5">5A4,A9</xref>
), unlike
<italic>CsPH</italic>
1 and 2, which showed increasing expression patterns (Figures
<xref ref-type="fig" rid="F5">5A2,A3</xref>
). In HBP and AFP,
<italic>CsPH</italic>
3 and 8 showed different expression patterns from AL and HAL. The
<italic>CsPH</italic>
3 transcript level increased significantly in the high-acidity pumello (HBP) and increased slightly in the low-acidity pumello (AFP) as the fruit developed; moreover, the
<italic>CsPH</italic>
3 transcript level was obviously higher in AFP than that in HBP (Figure
<xref ref-type="fig" rid="F5">5B4</xref>
). The
<italic>CsPH</italic>
8 transcript level was over 10 times higher in HBP than it was in AFP at either 133 or 188 DAF; it increased slightly during HBP fruit development and remained constant during AFP fruit development (Figure
<xref ref-type="fig" rid="F5">5B9</xref>
).
<italic>CsPH</italic>
4 (Figures
<xref ref-type="fig" rid="F5">5A5,B5</xref>
) and
<italic>CsPH</italic>
5 (Figures
<xref ref-type="fig" rid="F5">5A6,B6</xref>
) showed similar transcript profiles during the development of high-acid cultivars including AL and HBP, for which the transcript levels increased significantly as the fruit developed. However, in the low-acid cultivars, the
<italic>CsPH</italic>
4 transcript level increased significantly in HAL (Figure
<xref ref-type="fig" rid="F5">5A5</xref>
) and remained constant in AFP (Figure
<xref ref-type="fig" rid="F5">5B5</xref>
), and the
<italic>CsPH</italic>
5 transcript level almost stayed constant in both HAL (Figure
<xref ref-type="fig" rid="F5">5A6</xref>
) and AFP (Figure
<xref ref-type="fig" rid="F5">5B6</xref>
). Moreover, the transcript levels of
<italic>CsPH</italic>
4 (Figure
<xref ref-type="fig" rid="F5">5A5</xref>
) and
<italic>CsPH</italic>
5 (Figure
<xref ref-type="fig" rid="F5">5A6</xref>
) in HAL were significantly lower than those in AL at both 170 DAF and 220 DAF, and they were significantly lower in AFP than in HBP at only 188 DAF (Figures
<xref ref-type="fig" rid="F5">5B5,B6</xref>
). The
<italic>CsPH</italic>
6 transcript level exhibited a distinct increase in both AL and HAL as fruit developed, although it was significantly lower in AL than in HAL at both 170 and 220 DAF (Figure
<xref ref-type="fig" rid="F5">5A7</xref>
). By contrast, the
<italic>CsPH</italic>
6 transcript level almost remained constant in HBP and clearly increased in AFP as the fruits developed (Figure
<xref ref-type="fig" rid="F5">5B7</xref>
). With respect to
<italic>CsPH</italic>
7, the transcript remained constant in AL and increased clearly in HAL as the fruits developed (Figure
<xref ref-type="fig" rid="F5">5A8</xref>
). In HBP and AFP, however, the
<italic>CsPH</italic>
7 transcript levels clearly increased as the fruits developed (Figure
<xref ref-type="fig" rid="F5">5B8</xref>
).</p>
</sec>
<sec>
<title>Responses of the citrate content and
<italic>PH</italic>
5-like H
<sup>+</sup>
-ATPase gene expression to ABA injection</title>
<p>The citrate content and eight
<italic>CsPH</italic>
gene transcripts were assayed in the ABA-injected fruits (Figure
<xref ref-type="fig" rid="F6">6</xref>
). In comparison with the control fruit in which the citrate content was 16.8 mg.g
<sup>−1</sup>
, the ABA injection significantly increased the citrate content to 21.5 mg.g
<sup>−1</sup>
(Figure
<xref ref-type="fig" rid="F6">6A</xref>
). Moreover, the transcript levels of
<italic>CsPH</italic>
2,
<italic>CsPH</italic>
6,
<italic>CsPH</italic>
7, and
<italic>CsPH</italic>
8 were significantly induced by ABA injection, which were at least twice as high as their respective controls; however, the transcript levels of
<italic>CsPH</italic>
1,
<italic>CsPH</italic>
3,
<italic>CsPH</italic>
4, and
<italic>CsPH</italic>
5 showed no obvious response to ABA injection (Figure
<xref ref-type="fig" rid="F6">6B</xref>
).</p>
<fig id="F6" position="float">
<label>Figure 6</label>
<caption>
<p>
<bold>Comparative analysis of citric acid content (A) and
<italic>CsPH1</italic>
-8 transcript levels (B) in juice sacs between ABA-injected fruits and control fruits</bold>
. The asterisk (*) on the bars indicates significant differences between the ABA treatment and control (Con) for citric acid or each gene at
<italic>P</italic>
< 0.05 based on Student's
<italic>t</italic>
-test (LSD).</p>
</caption>
<graphic xlink:href="fpls-06-00135-g0006"></graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s3">
<title>Discussion</title>
<p>Plants have at least three distinct proton pumps, that is, a P-type ATPase, a vacuolar-type proton pump [including vacuolar H
<sup>+</sup>
-pyrophosphatase (V-PPase) and vacuolar H
<sup>+</sup>
-ATPase (V-ATPase)], and an F-type ATPase. In general, the P-type ATPase pumps protons from the cytoplasm through the cell membrane, whereas V-PPase and V-ATPase acidify the intracellular compartments including the vacuole, and the F-type ATPase is evolutionarily and functionally related to V-ATPase but is confined to only the mitochondrion and chloroplast and is primarily an ATP synthase. Moreover, the P-type ATPase and V-PPase consist of a single polypeptide whereas the V- and F- ATPases are complex arrays of subunits (Perzov et al.,
<xref rid="B40" ref-type="bibr">2001</xref>
; Coker et al.,
<xref rid="B16" ref-type="bibr">2003</xref>
; Gaxiola et al.,
<xref rid="B23" ref-type="bibr">2007</xref>
; Eisenach et al.,
<xref rid="B19" ref-type="bibr">2014</xref>
).</p>
<p>The pH of plant endomembrane compartments is known to be regulated by V-ATPase and V-PPase, whereas the P-type ATPase controls the cytoplasm pH and energizes the plasma membrane (Gaxiola et al.,
<xref rid="B23" ref-type="bibr">2007</xref>
; Eisenach et al.,
<xref rid="B19" ref-type="bibr">2014</xref>
). However, recent research indicated that the P-type ATPase also had a role in vacuolar acidification (Baxter et al.,
<xref rid="B11" ref-type="bibr">2005</xref>
; Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
; Aprile et al.,
<xref rid="B2" ref-type="bibr">2011</xref>
; Cohen et al.,
<xref rid="B15" ref-type="bibr">2014</xref>
; Faraco et al.,
<xref rid="B21" ref-type="bibr">2014</xref>
). This finding is especially true for petunia
<italic>PH5</italic>
, and Verweij et al. (
<xref rid="B47" ref-type="bibr">2008</xref>
) demonstrated that it encodes a P
<sub>3A</sub>
-ATPase proton pump, resides in the vacuolar membrane, and determines the vacuolar pH. In the present study, we searched the current three citrus genome databases using the petunia
<italic>PH5</italic>
sequence and finally identified eight
<italic>PH5</italic>
-like genes (
<italic>CsPH</italic>
1-8) from
<italic>C. sinensis</italic>
fruits (Table
<xref ref-type="table" rid="T1">1</xref>
and Figure
<xref ref-type="supplementary-material" rid="SM8">S2</xref>
). These proteins have a molecular mass of approximately 100 kDa (Table
<xref ref-type="table" rid="T1">1</xref>
), which is consistent with other plant P-type ATPases, and they showed relatively high similarities to PhPH5, AtAHA2, and AtAHA10 (Table
<xref ref-type="supplementary-material" rid="SM5">S5</xref>
). Moreover, a crystal structure analysis of AtAHA2 by Pedersen et al. (
<xref rid="B38" ref-type="bibr">2007</xref>
) showed that they have the following four conserved residues: H
<sup>+</sup>
acceptor/donor Asp684, proposed gate-keeper residue Asn106, Arg655, which was proposed to prevent H
<sup>+</sup>
backflow, and Ile282, which is important for H
<sup>+</sup>
transport. In addition, two clusters of autoinhibitory sequences, namely Region I and Region II (Axelsen et al.,
<xref rid="B5" ref-type="bibr">1999</xref>
), and a 14-3-3 binding site (Fuglsang et al.,
<xref rid="B22" ref-type="bibr">1999</xref>
) have been identified in the C-terminal end of P-type ATPases. Here, an alignment showed that the eight CsPHs except for CsPH7 contain the two autoinhibitory regions and a 14-3-3 binding site (Figure
<xref ref-type="fig" rid="F1">1</xref>
), which indicated that the eight putative P-type ATPases could have a function in the H
<sup>+</sup>
transport in cell compartments.</p>
<p>The P-type ATPase is encoded by a multigene family (Pedersen et al.,
<xref rid="B39" ref-type="bibr">2012</xref>
). Extensive searches of cDNA and genomic libraries showed that there are 9, 12, and 10 P-type ATPases in
<italic>N. plumbaginifolia, A. thaliana</italic>
, and
<italic>O. sativa</italic>
, respectively (Baxter et al.,
<xref rid="B10" ref-type="bibr">2003</xref>
). All the P-type ATPase genes can be generally divided into five major evolutionarily related subfamilies (Palmgren,
<xref rid="B37" ref-type="bibr">2001</xref>
; Arango et al.,
<xref rid="B3" ref-type="bibr">2003</xref>
; Baxter et al.,
<xref rid="B10" ref-type="bibr">2003</xref>
; Pedersen et al.,
<xref rid="B39" ref-type="bibr">2012</xref>
). Moreover, the P
<sub>3A</sub>
, though considered to be the least divergent branch of the P-Type ATPases superfamily, could be subdivided into five subfamilies (Arango et al.,
<xref rid="B3" ref-type="bibr">2003</xref>
). In this study, we found at least 11
<italic>PH5</italic>
-like homologs in the HZAU orange database, with 9 homologs in the Phytozome orange database, and 12 homologs in the Phytozome clementine database (Table
<xref ref-type="supplementary-material" rid="SM1">S1</xref>
). However, only eight CsPHs were successfully amplified from citrus fruit (Figure
<xref ref-type="supplementary-material" rid="SM8">S2</xref>
). Previous reports indicated that not all P-type ATPase genes are expressed in all tissues (Arango et al.,
<xref rid="B3" ref-type="bibr">2003</xref>
). In fact, a spatial analysis from the present study showed that only
<italic>CsPH8</italic>
was predominantly expressed more highly in JS against RT, ML, and FL (Figure
<xref ref-type="fig" rid="F4">4H</xref>
). Hence, we suggest that the failure to amplify other sequences may be explained by the fact that they were not expressed in the fruits or the transcript levels are instantaneous. A comprehensive analysis of the gene structure for the successfully amplified genes subsequently showed that the numbers of exons and introns varied among the CsPHs (Figure
<xref ref-type="fig" rid="F2">2</xref>
). Moreover, a phylogenetic analysis showed that the eight CsPHs were distributed into four subgroups (Figure
<xref ref-type="fig" rid="F3">3</xref>
), which were consistent with the previous reports in other plants (Arango et al.,
<xref rid="B3" ref-type="bibr">2003</xref>
; Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
), which is indicative of CsPH reliability.</p>
<p>The P-type ATPase has been suggested to be involved in various physiological processes (Duby and Boutry,
<xref rid="B18" ref-type="bibr">2009</xref>
). Although typical P-type ATPases manipulate the cytoplasm pH and energize the plasma membrane, the vacuolar pH is regulated by V-ATPases together with V-PPase in plants (Gaxiola et al.,
<xref rid="B23" ref-type="bibr">2007</xref>
; Eisenach et al.,
<xref rid="B19" ref-type="bibr">2014</xref>
). Some P-type ATPases, for example
<italic>PhPH</italic>
5 (Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
; Faraco et al.,
<xref rid="B21" ref-type="bibr">2014</xref>
), were unlike other P-type ATPases and were related to vacuolar acid homeostasis (Aprile et al.,
<xref rid="B2" ref-type="bibr">2011</xref>
; Cohen et al.,
<xref rid="B15" ref-type="bibr">2014</xref>
; Faraco et al.,
<xref rid="B21" ref-type="bibr">2014</xref>
). Here, we detected eight CsPH gene transcript levels in the fruit JS of high-citrate cultivars (AL and HBP) and low-citrate cultivars (HAL and AFP). The
<italic>CsPH</italic>
transcript levels differed between orange and pummelo, and between high-acid and low-acid cultivars (Figure
<xref ref-type="fig" rid="F5">5</xref>
). Regarding the AL and HAL pair, the low-acid HAL orange is accompanied by low transcript levels of
<italic>CsPH</italic>
3 (Figure
<xref ref-type="fig" rid="F5">5A4</xref>
),
<italic>CsPH</italic>
4 (Figure
<xref ref-type="fig" rid="F5">5A5</xref>
),
<italic>CsPH</italic>
5 (Figure
<xref ref-type="fig" rid="F5">5A6</xref>
), and
<italic>CsPH</italic>
8 (Figure
<xref ref-type="fig" rid="F5">5A9</xref>
). However, only the transcript levels of
<italic>CsPH</italic>
3 (Figure
<xref ref-type="fig" rid="F5">5A4</xref>
) and
<italic>CsPH</italic>
8 (Figure
<xref ref-type="fig" rid="F5">5A9</xref>
) decreased as the fruit ripened, which is consistent with the citrate decrease in AL fruits (Figure
<xref ref-type="fig" rid="F5">5A1</xref>
). As for the HBP and AFP pair, the AFP citrate content was less than one-tenth of the HBP citrate content, which was high and constant between 133 and 188 DAF (Figure
<xref ref-type="fig" rid="F5">5B1</xref>
). However, only the change in
<italic>CsPH</italic>
8 transcript levels were consistent with citrate content changes in AFP and HBP; the
<italic>CsPH</italic>
8 transcript level in AFP was significantly lower than that of HBP, and it remained constant as the HBP fruit ripened (Figure
<xref ref-type="fig" rid="F5">5B9</xref>
). In considering the relation between the
<italic>CsPH</italic>
transcript levels and the citrate content, we could suggest that the transcript decrease in
<italic>CsPH</italic>
3 and/or
<italic>CsPH</italic>
8 reduced the citrate influx into the vacuole of citrus fruits, participating in the decreased citrate accumulation as the citrus fruit ripens. Conversely, the low transcript level of
<italic>CsPH</italic>
8 could be attributed to the low citrate content in HAL and AFP because it is the only one that was predominantly expressed in JS (Figure
<xref ref-type="fig" rid="F4">4H</xref>
), which is promising for further study.</p>
<p>ABA has been implicated as a key component in abiotic stress responses, including those triggered by drought, NaCl, and low-temperature stress (Umezawa et al.,
<xref rid="B46" ref-type="bibr">2010</xref>
). The endogenous ABA level is always increased by abiotic stresses. Notably, ABA treatment can increase fruit sugar accumulation (Kobashi et al.,
<xref rid="B28" ref-type="bibr">2001</xref>
; Kempa et al.,
<xref rid="B27" ref-type="bibr">2008</xref>
) in addition to citrate accumulation (Kojima et al.,
<xref rid="B29" ref-type="bibr">1995</xref>
; Bastías et al.,
<xref rid="B9" ref-type="bibr">2011</xref>
; Hu et al.,
<xref rid="B25" ref-type="bibr">2015</xref>
). Interestingly, V-ATPase activity was also meditated by ABA (Barkla et al.,
<xref rid="B7" ref-type="bibr">1999</xref>
). Here, we found that ABA injection increased the citrate content significantly (Figure
<xref ref-type="fig" rid="F6">6A</xref>
) and the transcript levels of
<italic>CsPH</italic>
2, 6, 7, and 8, and it had no obvious effect on the transcript levels of
<italic>CsPH</italic>
1, 3, 4, and 5 (Figure
<xref ref-type="fig" rid="F6">6B</xref>
). Out of all these genes, the
<italic>CsPH</italic>
2, 7, and 8 transcript levels were increased over two times in comparison with the control, indicating that the citrate increase in the fruit JS is possibly related to the increased acid-related P-type ATPase activity, for which the latter is conducive to the influx of citrate into the vacuole. However, when combined with their spatio-temporal expression and their relation to citrate accumulation (Figures
<xref ref-type="fig" rid="F4">4</xref>
,
<xref ref-type="fig" rid="F5">5</xref>
), the transcript response analysis to ABA injection confirmed that
<italic>CsPH</italic>
8 seems likely to regulate citrate accumulation in the citrus fruit vacuole.</p>
<p>In conclusion, although the past acid-accumulation model in citrus fruit (Sadka et al.,
<xref rid="B42" ref-type="bibr">2000</xref>
) hypothesized that the driving force for cytosol citrate influx into cell vacuoles is mediated primarily by V-ATPase (Müller et al.,
<xref rid="B36" ref-type="bibr">1996</xref>
; Brune et al.,
<xref rid="B13" ref-type="bibr">2002</xref>
), a P-type
<italic>AtAHA10</italic>
-like gene is possibly associated with citric acid accumulation in lemon juice sac cells (Aprile et al.,
<xref rid="B2" ref-type="bibr">2011</xref>
). However, the exact information for this gene is still lacking. Because a P-type gene called the petunia
<italic>PH</italic>
5 gene has been experimentally confirmed to modulate the flower vacuole pH, we isolated eight citrus
<italic>PH5</italic>
-like genes using the
<italic>PhPH</italic>
5 sequence to query the citrus genome database. We found that only
<italic>CsPH</italic>
8 was predominately expressed in fruit JS; the low citrate content in HAL and AFP may be caused by low
<italic>CsPH</italic>
8 expression profiles. In addition, the current research provided an alternative possibility that P-type ATPases, such as
<italic>CsPH</italic>
8, may have a function in driving the citrate influx into the citrus fruit vacuole, similar to that of petunias (Verweij et al.,
<xref rid="B47" ref-type="bibr">2008</xref>
).</p>
<sec>
<title>Conflict of interest statement</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
</sec>
</body>
<back>
<ack>
<p>This work was supported by the National Natural Science Foundation of China (No. 31372012).</p>
</ack>
<sec sec-type="supplementary-material" id="s4">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at:
<ext-link ext-link-type="uri" xlink:href="http://www.frontiersin.org/journal/10.3389/fpls.2015.00135/abstract">http://www.frontiersin.org/journal/10.3389/fpls.2015.00135/abstract</ext-link>
</p>
<supplementary-material content-type="local-data" id="SM1">
<media xlink:href="Table1.DOC">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SM2">
<media xlink:href="Table2.DOC">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SM3">
<media xlink:href="Table3.DOC">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SM4">
<media xlink:href="Table4.DOC">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SM5">
<media xlink:href="Table5.DOC">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SM6">
<media xlink:href="Table6.XLS">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SM7">
<media xlink:href="Image1.PDF">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="SM8">
<media xlink:href="Image2.PDF">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Amemiya</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kawai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yamaki</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Shiratake</surname>
<given-names>K.</given-names>
</name>
</person-group>
(
<year>2005</year>
).
<article-title>Enhancement of vacuolar H
<sup>+</sup>
-ATPase and H+-pyrophosphatase expression by phytohormones in pear fruit</article-title>
.
<source>J. Jpn. Soc. Hort. Sci</source>
.
<volume>74</volume>
,
<fpage>353</fpage>
<lpage>360</lpage>
<pub-id pub-id-type="doi">10.2503/jjshs.74.353</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aprile</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Federici</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Close</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Bellis</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Cattivelli</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Roose</surname>
<given-names>M.</given-names>
</name>
</person-group>
(
<year>2011</year>
).
<article-title>Expression of the H
<sup>+</sup>
-ATPase AHA10 proton pump is associated with citric acid accumulation in lemon juice sac cells</article-title>
.
<source>Funct. Integr. Genomics</source>
<volume>11</volume>
,
<fpage>551</fpage>
<lpage>563</lpage>
.
<pub-id pub-id-type="doi">10.1007/s10142-011-0226-3</pub-id>
<pub-id pub-id-type="pmid">21556928</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arango</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Gévaudant</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Oufattole</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Boutry</surname>
<given-names>M.</given-names>
</name>
</person-group>
(
<year>2003</year>
).
<article-title>The plasma membrane proton pump ATPase: the significance of gene subfamilies</article-title>
.
<source>Planta</source>
<volume>216</volume>
,
<fpage>355</fpage>
<lpage>365</lpage>
.
<pub-id pub-id-type="doi">10.1007/s00425-002-0856-8</pub-id>
<pub-id pub-id-type="pmid">12520326</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Axelsen</surname>
<given-names>K. B.</given-names>
</name>
<name>
<surname>Palmgren</surname>
<given-names>M. G.</given-names>
</name>
</person-group>
(
<year>2001</year>
).
<article-title>Inventory of the superfamily of P-type ion pumps in Arabidopsis</article-title>
.
<source>Plant Physiol</source>
.
<volume>126</volume>
,
<fpage>696</fpage>
<lpage>706</lpage>
.
<pub-id pub-id-type="doi">10.1104/pp.126.2.696</pub-id>
<pub-id pub-id-type="pmid">11402198</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Axelsen</surname>
<given-names>K. B.</given-names>
</name>
<name>
<surname>Venema</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Jahn</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Baunsgaard</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Palmgren</surname>
<given-names>M. G.</given-names>
</name>
</person-group>
(
<year>1999</year>
).
<article-title>Molecular dissection of the C-terminal regulatory domain of the plant plasma membrane H
<sup>+</sup>
-ATPase AHA2: mapping of residues that when altered give rise to an activated enzyme</article-title>
.
<source>Biochemistry</source>
<volume>38</volume>
,
<fpage>7227</fpage>
<lpage>7234</lpage>
.
<pub-id pub-id-type="doi">10.1021/bi982482l</pub-id>
<pub-id pub-id-type="pmid">10353834</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Baldwin</surname>
<given-names>E. A.</given-names>
</name>
</person-group>
(
<year>1993</year>
).
<article-title>Citrus fruit</article-title>
, in
<source>Biochemistry of Fruit Ripening</source>
, eds
<person-group person-group-type="editor">
<name>
<surname>Seymour</surname>
<given-names>G. B.</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>J. E.</given-names>
</name>
<name>
<surname>Tucker</surname>
<given-names>G. A.</given-names>
</name>
</person-group>
(
<publisher-loc>London, UK</publisher-loc>
:
<publisher-name>Chapman & Hall</publisher-name>
),
<fpage>107</fpage>
<lpage>149</lpage>
.</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barkla</surname>
<given-names>B. J.</given-names>
</name>
<name>
<surname>Vera-Estrella</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Maldonado-Gama</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Pantoja</surname>
<given-names>O.</given-names>
</name>
</person-group>
(
<year>1999</year>
).
<article-title>Abscisic acid induction of vacuolar H+-ATPase activity in
<italic>Mesembryanthemum crystallinum</italic>
is developmentally regulated</article-title>
.
<source>Plant Physiol</source>
.
<volume>120</volume>
,
<fpage>811</fpage>
<lpage>820</lpage>
.
<pub-id pub-id-type="doi">10.1104/pp.120.3.811</pub-id>
<pub-id pub-id-type="pmid">10398716</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bartolozzi</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Bertazza</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Bassi</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Cristoferi</surname>
<given-names>G.</given-names>
</name>
</person-group>
(
<year>1997</year>
).
<article-title>Simultaneous determination of soluble sugars and organic acids as their trimethylsilyl derivatives in apricot fruits by gas-liquid chromatography</article-title>
.
<source>J. Chromatogr. A</source>
<volume>758</volume>
,
<fpage>99</fpage>
<lpage>107</lpage>
.
<pub-id pub-id-type="doi">10.1016/S0021-9673(96)00709-1</pub-id>
<pub-id pub-id-type="pmid">9035387</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bastías</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>López-Climent</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Valcárcel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rosello</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Gómez-Cadenas</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Casaretto</surname>
<given-names>J. A.</given-names>
</name>
</person-group>
(
<year>2011</year>
).
<article-title>Modulation of organic acids and sugar content in tomato fruits by an abscisic acid-regulated transcription factor</article-title>
.
<source>Physiol. Plant</source>
.
<volume>141</volume>
,
<fpage>215</fpage>
<lpage>226</lpage>
.
<pub-id pub-id-type="doi">10.1111/j.1399-3054.2010.01435.x</pub-id>
<pub-id pub-id-type="pmid">21128945</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baxter</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Tchieu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Sussman</surname>
<given-names>M. R.</given-names>
</name>
<name>
<surname>Boutry</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Palmgren</surname>
<given-names>M. G.</given-names>
</name>
<name>
<surname>Gribskov</surname>
<given-names>M.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>2003</year>
).
<article-title>Genomic comparison of P-Type ATPase Ion pumps in arabidopsis and rice</article-title>
.
<source>Plant Physiol</source>
.
<volume>132</volume>
,
<fpage>618</fpage>
<lpage>628</lpage>
.
<pub-id pub-id-type="doi">10.1104/pp.103.021923</pub-id>
<pub-id pub-id-type="pmid">12805592</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baxter</surname>
<given-names>I. R.</given-names>
</name>
<name>
<surname>Young</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Armstrong</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Foster</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Bogenschutz</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Cordova</surname>
<given-names>T.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>2005</year>
).
<article-title>A plasma membrane H
<sup>+</sup>
-ATPase is required for the formation of proanthocyanidins in the seed coat endothelium of Arabidopsis thaliana</article-title>
.
<source>Proc. Nat. Acad. Sci. U.S.A</source>
.
<volume>102</volume>
,
<fpage>2649</fpage>
<lpage>2654</lpage>
.
<pub-id pub-id-type="doi">10.1073/pnas.0406377102</pub-id>
<pub-id pub-id-type="pmid">15695592</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bogin</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Wallace</surname>
<given-names>A.</given-names>
</name>
</person-group>
(
<year>1966</year>
).
<article-title>Organic acid synthesis and accumulation in sweet and sour lemon fruit</article-title>
.
<source>J. Am. Soc. Hort. Sci</source>
.
<volume>89</volume>
,
<fpage>182</fpage>
<lpage>194</lpage>
.</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brune</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Muller</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Taiz</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Gonzalez</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Etxeberria</surname>
<given-names>E.</given-names>
</name>
</person-group>
(
<year>2002</year>
).
<article-title>Vacuolar acidification in citrus fruit: comparison between acid lime (
<italic>Citrus aurantifolia</italic>
) and sweet lime (
<italic>Citrus limmetioides</italic>
) juice cells</article-title>
.
<source>J. Am. Soc. Hort. Sci</source>
.
<volume>127</volume>
,
<fpage>171</fpage>
<lpage>177</lpage>
.</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cercós</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Soler</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Iglesias</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Gadea</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Forment</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Talón</surname>
<given-names>M.</given-names>
</name>
</person-group>
(
<year>2006</year>
).
<article-title>Global analysis of gene expression during development and ripening of citrus fruit flesh. A proposed mechanism for citric acid utilization</article-title>
.
<source>Plant Mol. Biol</source>
.
<volume>62</volume>
,
<fpage>513</fpage>
<lpage>527</lpage>
.
<pub-id pub-id-type="doi">10.1007/s11103-006-9037-7</pub-id>
<pub-id pub-id-type="pmid">16897468</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cohen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Itkin</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Yeselson</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Tzuri</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Portnoy</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Harel-Baja</surname>
<given-names>R.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>2014</year>
).
<article-title>The PH gene determines fruit acidity and contributes to the evolution of sweet melons</article-title>
.
<source>Nat. Commun</source>
.
<volume>5</volume>
:
<fpage>4026</fpage>
.
<pub-id pub-id-type="doi">10.1038/ncomms5026</pub-id>
<pub-id pub-id-type="pmid">24898284</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Coker</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Jones</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Davies</surname>
<given-names>E.</given-names>
</name>
</person-group>
(
<year>2003</year>
).
<article-title>Identification, conservation, and relative expression of V-ATPase cDNAs in tomato plants</article-title>
.
<source>Plant Mol. Biol. Report</source>
.
<volume>21</volume>
,
<fpage>145</fpage>
<lpage>158</lpage>
<pub-id pub-id-type="doi">10.1007/BF02774241</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Degu</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Hatew</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Nunes-Nesi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Shlizerman</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zur</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Katz</surname>
<given-names>E.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>2011</year>
).
<article-title>Inhibition of aconitase in citrus fruit callus results in a metabolic shift towards amino acid biosynthesis</article-title>
.
<source>Planta (Berlin)</source>
<volume>234</volume>
,
<fpage>501</fpage>
<lpage>513</lpage>
.
<pub-id pub-id-type="doi">10.1007/s00425-011-1411-2</pub-id>
<pub-id pub-id-type="pmid">21528417</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Duby</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Boutry</surname>
<given-names>M.</given-names>
</name>
</person-group>
(
<year>2009</year>
).
<article-title>The plant plasma membrane proton pump ATPase: a highly regulated P-type ATPase with multiple physiological roles</article-title>
.
<source>Pflug. Arch. Eur. J. Phys</source>
.
<volume>457</volume>
,
<fpage>645</fpage>
<lpage>655</lpage>
.
<pub-id pub-id-type="doi">10.1007/s00424-008-0457-x</pub-id>
<pub-id pub-id-type="pmid">18228034</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eisenach</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Baetz</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Martinoia</surname>
<given-names>E.</given-names>
</name>
</person-group>
(
<year>2014</year>
).
<article-title>Vacuolar proton pumping: more than the sum of its parts?</article-title>
<source>Trends Plant Sci</source>
.
<volume>19</volume>
,
<fpage>344</fpage>
<lpage>346</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.tplants.2014.03.008</pub-id>
<pub-id pub-id-type="pmid">24703550</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Etienne</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Génard</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Lobit</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Mbeguié-a-Mbéguié</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Bugaud</surname>
<given-names>C.</given-names>
</name>
</person-group>
(
<year>2013</year>
).
<article-title>What controls fleshy fruit acidity? A review of malate and citrate accumulation in fruit cells</article-title>
.
<source>J. Exp. Bot</source>
.
<volume>64</volume>
,
<fpage>1451</fpage>
<lpage>1469</lpage>
.
<pub-id pub-id-type="doi">10.1093/jxb/ert035</pub-id>
<pub-id pub-id-type="pmid">23408829</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Faraco</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Spelt</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Bliek</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Verweij</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Hoshino</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Espen</surname>
<given-names>L.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>2014</year>
).
<article-title>Hyperacidification of vacuoles by the combined action of two different P-ATPases in the tonoplast determines flower color</article-title>
.
<source>Cell Rep</source>
.
<volume>6</volume>
,
<fpage>32</fpage>
<lpage>43</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.celrep.2013.12.009</pub-id>
<pub-id pub-id-type="pmid">24388746</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fuglsang</surname>
<given-names>A. T.</given-names>
</name>
<name>
<surname>Visconti</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Drumm</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Jahn</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Stensballe</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Mattei</surname>
<given-names>B.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>1999</year>
).
<article-title>Binding of 14-3-3 protein to the plasma membrane H(+)-ATPase AHA2 involves the three C-terminal residues Tyr(946)-Thr-Val and requires phosphorylation of Thr(947)</article-title>
.
<source>J. Biol. Chem</source>
.
<volume>274</volume>
,
<fpage>36774</fpage>
<lpage>36780</lpage>
.
<pub-id pub-id-type="doi">10.1074/jbc.274.51.36774</pub-id>
<pub-id pub-id-type="pmid">10593986</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gaxiola</surname>
<given-names>R. A.</given-names>
</name>
<name>
<surname>Palmgren</surname>
<given-names>M. G.</given-names>
</name>
<name>
<surname>Schumacher</surname>
<given-names>K.</given-names>
</name>
</person-group>
(
<year>2007</year>
).
<article-title>Plant proton pumps</article-title>
.
<source>FEBS Lett</source>
.
<volume>581</volume>
,
<fpage>2204</fpage>
<lpage>2214</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.febslet.2007.03.050</pub-id>
<pub-id pub-id-type="pmid">17412324</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname>
<given-names>A.-Y.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>Q.-H.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>J.-C.</given-names>
</name>
</person-group>
(
<year>2007</year>
).
<article-title>GSDS: a gene structure display server</article-title>
.
<source>Yi Chuan</source>
<volume>29</volume>
:
<fpage>1023</fpage>
.
<pub-id pub-id-type="doi">10.1360/yc-007-1023</pub-id>
<pub-id pub-id-type="pmid">17681935</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hu</surname>
<given-names>X.-M.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>C.-Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>L.-F.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.-Z.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>S.-A.</given-names>
</name>
</person-group>
(
<year>2015</year>
).
<article-title>Genome-wide identification of citrus ATP-citrate lyase genes and their transcript analysis in fruits reveals their possible role in citrate utilization</article-title>
.
<source>Mol. Genet. Genomics</source>
<volume>290</volume>
,
<fpage>29</fpage>
<lpage>38</lpage>
.
<pub-id pub-id-type="doi">10.1007/s00438-014-0897-2</pub-id>
<pub-id pub-id-type="pmid">25120169</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Katz</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Fon</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>Y. J.</given-names>
</name>
<name>
<surname>Phinney</surname>
<given-names>B. S.</given-names>
</name>
<name>
<surname>Sadka</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Blumwald</surname>
<given-names>E.</given-names>
</name>
</person-group>
(
<year>2007</year>
).
<article-title>The citrus fruit proteome: insights into citrus fruit metabolism</article-title>
.
<source>Planta</source>
<volume>226</volume>
,
<fpage>989</fpage>
<lpage>1005</lpage>
.
<pub-id pub-id-type="doi">10.1007/s00425-007-0545-8</pub-id>
<pub-id pub-id-type="pmid">17541628</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kempa</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Krasensky</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Dal Santo</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kopka</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jonak</surname>
<given-names>C.</given-names>
</name>
</person-group>
(
<year>2008</year>
).
<article-title>A central role of abscisic acid in stress-regulated carbohydrate metabolism</article-title>
.
<source>PLoS ONE</source>
<volume>3</volume>
:
<fpage>e3935</fpage>
.
<pub-id pub-id-type="doi">10.1371/journal.pone.0003935</pub-id>
<pub-id pub-id-type="pmid">19081841</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kobashi</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Sugaya</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Gemma</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Iwahori</surname>
<given-names>S.</given-names>
</name>
</person-group>
(
<year>2001</year>
).
<article-title>Effect of abscisic acid (ABA) on sugar accumulation in the flesh tissue of peach fruit at the start of the maturation stage</article-title>
.
<source>Plant Growth Regul</source>
.
<volume>35</volume>
,
<fpage>215</fpage>
<lpage>223</lpage>
<pub-id pub-id-type="doi">10.1023/A:1014421712254</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kojima</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Yamada</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yamamoto</surname>
<given-names>M.</given-names>
</name>
</person-group>
(
<year>1995</year>
).
<article-title>Effects of abscisic acid injection on sugar and organic acid contents of citrus fruit</article-title>
.
<source>J. Jpn. Soc. Hort. Sci</source>
.
<volume>64</volume>
,
<fpage>17</fpage>
<lpage>21</lpage>
<pub-id pub-id-type="doi">10.2503/jjshs.64.17</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koressaar</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Remm</surname>
<given-names>M.</given-names>
</name>
</person-group>
(
<year>2007</year>
).
<article-title>Enhancements and modifications of primer design program Primer3</article-title>
.
<source>Bioinformatics</source>
<volume>23</volume>
,
<fpage>1289</fpage>
<lpage>1291</lpage>
.
<pub-id pub-id-type="doi">10.1093/bioinformatics/btm091</pub-id>
<pub-id pub-id-type="pmid">17379693</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y. Z.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>X. L.</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>X. X.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>L. L.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>2007</year>
).
<article-title>A novel bud mutation that confers abnormal patterns of lycopene accumulation in sweet orange fruit (
<italic>Citrus sinensis</italic>
L</article-title>
.
<source>Osbeck). J. Exp. Bot</source>
.
<volume>58</volume>
,
<fpage>4161</fpage>
<lpage>4171</lpage>
.
<pub-id pub-id-type="doi">10.1093/jxb/erm273</pub-id>
<pub-id pub-id-type="pmid">18182424</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>X.-M.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>L.-F.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>C.-Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.-Z.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>S.-A.</given-names>
</name>
</person-group>
(
<year>2014</year>
).
<article-title>Identification and transcript analysis of two glutamate decarboxylase genes, CsGAD1 and CsGAD2, reveal the strong relationship between CsGAD1 and citrate utilization in citrus fruit</article-title>
.
<source>Mol. Biol. Rep</source>
.
<volume>41</volume>
,
<fpage>6253</fpage>
<lpage>6262</lpage>
.
<pub-id pub-id-type="doi">10.1007/s11033-014-3506-x</pub-id>
<pub-id pub-id-type="pmid">24976574</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Y. Z.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Tao</surname>
<given-names>N. G.</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>X. X.</given-names>
</name>
</person-group>
(
<year>2006</year>
).
<article-title>Efficient isolation of RNA from fruit peel and pulp of ripening navel orange (
<italic>Citrus sinensis</italic>
Osbeck)</article-title>
.
<source>J. Huazhong Agric. Univ</source>
.
<volume>25</volume>
,
<fpage>300</fpage>
<lpage>304</lpage>
.</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname>
<given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittigen</surname>
<given-names>T. D.</given-names>
</name>
</person-group>
(
<year>2001</year>
).
<article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method</article-title>
.
<source>Methods</source>
<volume>25</volume>
,
<fpage>402</fpage>
<lpage>408</lpage>
.
<pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
<pub-id pub-id-type="pmid">11846609</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Michelet</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Boutry</surname>
<given-names>M.</given-names>
</name>
</person-group>
(
<year>1995</year>
).
<article-title>The Plasma Membrane H
<sup>+</sup>
-ATPase</article-title>
.
<source>Plant Physiol</source>
.
<volume>108</volume>
,
<fpage>1</fpage>
<lpage>6</lpage>
.
<pub-id pub-id-type="pmid">12228449</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Müller</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>Irkenskiesecker</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Rubinstein</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Taiz</surname>
<given-names>L.</given-names>
</name>
</person-group>
(
<year>1996</year>
).
<article-title>On the mechanism of hyperacidification in lemon. Comparison of the vacuolar H(+)-ATPase activities of fruits and epicotyls</article-title>
.
<source>J. Biol. Chem</source>
.
<volume>271</volume>
,
<fpage>1916</fpage>
<lpage>1924</lpage>
.
<pub-id pub-id-type="pmid">8567639</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Palmgren</surname>
<given-names>M. G.</given-names>
</name>
</person-group>
(
<year>2001</year>
).
<article-title>Plant plasma membrane H
<sup>+</sup>
-ATPases: powerhouses for nutrient uptake</article-title>
.
<source>Annu. Rev. Plant Physiol. Plant Mol. Biol</source>
.
<volume>52</volume>
,
<fpage>817</fpage>
<lpage>845</lpage>
.
<pub-id pub-id-type="doi">10.1146/annurev.arplant.52.1.817</pub-id>
<pub-id pub-id-type="pmid">11337417</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pedersen</surname>
<given-names>B. P.</given-names>
</name>
<name>
<surname>Buch-Pedersen</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Preben Morth</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Palmgren</surname>
<given-names>M. G.</given-names>
</name>
<name>
<surname>Nissen</surname>
<given-names>P.</given-names>
</name>
</person-group>
(
<year>2007</year>
).
<article-title>Crystal structure of the plasma membrane proton pump</article-title>
.
<source>Nature</source>
<volume>450</volume>
,
<fpage>1111</fpage>
<lpage>1114</lpage>
.
<pub-id pub-id-type="doi">10.1038/nature06417</pub-id>
<pub-id pub-id-type="pmid">18075595</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pedersen</surname>
<given-names>C. N. S.</given-names>
</name>
<name>
<surname>Axelsen</surname>
<given-names>K. B.</given-names>
</name>
<name>
<surname>Harper</surname>
<given-names>J. F.</given-names>
</name>
<name>
<surname>Palmgren</surname>
<given-names>M. G.</given-names>
</name>
</person-group>
(
<year>2012</year>
).
<article-title>Evolution of plant P-type ATPases</article-title>
.
<source>Front. Plant Sci</source>
.
<volume>3</volume>
:
<issue>31</issue>
.
<pub-id pub-id-type="doi">10.3389/fpls.2012.00031</pub-id>
<pub-id pub-id-type="pmid">22629273</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Perzov</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Padler-Karavani</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Nelson</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Nelson</surname>
<given-names>N.</given-names>
</name>
</person-group>
(
<year>2001</year>
).
<article-title>Features of V-ATPases that distinguish them from F-ATPases</article-title>
.
<source>FEBS Lett</source>
.
<volume>504</volume>
,
<fpage>223</fpage>
<lpage>228</lpage>
.
<pub-id pub-id-type="doi">10.1016/S0014-5793(01)02709-0</pub-id>
<pub-id pub-id-type="pmid">11532458</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Popova</surname>
<given-names>T. N.</given-names>
</name>
<name>
<surname>Pinheiro De Carvalho</surname>
<given-names>M. A.</given-names>
</name>
</person-group>
(
<year>1998</year>
).
<article-title>Citrate and isocitrate in plant metabolism</article-title>
.
<source>Biochim. Biophys. Acta</source>
<volume>1364</volume>
,
<fpage>307</fpage>
<lpage>325</lpage>
.
<pub-id pub-id-type="doi">10.1016/S0005-2728(98)00008-5</pub-id>
<pub-id pub-id-type="pmid">9630693</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sadka</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Dahan</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Cohen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Marsh</surname>
<given-names>K. B.</given-names>
</name>
</person-group>
(
<year>2000</year>
).
<article-title>Aconitase activity and expression during the development of lemon fruit</article-title>
.
<source>Physiol. Plant</source>
.
<volume>108</volume>
,
<fpage>255</fpage>
<lpage>262</lpage>
<pub-id pub-id-type="doi">10.1034/j.1399-3054.2000.108003255.x</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schumacher</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Krebs</surname>
<given-names>M.</given-names>
</name>
</person-group>
(
<year>2010</year>
).
<article-title>The V-ATPase: small cargo, large effects</article-title>
.
<source>Curr. Opin. Plant Biol</source>
.
<volume>13</volume>
,
<fpage>724</fpage>
<lpage>730</lpage>
.
<pub-id pub-id-type="doi">10.1016/j.pbi.2010.07.003</pub-id>
<pub-id pub-id-type="pmid">20801076</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tamura</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Peterson</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Peterson</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Stecher</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Nei</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kumar</surname>
<given-names>S.</given-names>
</name>
</person-group>
(
<year>2011</year>
).
<article-title>MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods</article-title>
.
<source>Mol. Biol. Evol</source>
.
<volume>28</volume>
,
<fpage>2731</fpage>
<lpage>2739</lpage>
<pub-id pub-id-type="doi">10.1093/molbev/msr121</pub-id>
<pub-id pub-id-type="pmid">21546353</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Terol</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Soler</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Talon</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Cercos</surname>
<given-names>M.</given-names>
</name>
</person-group>
(
<year>2010</year>
).
<article-title>The aconitate hydratase family from Citrus</article-title>
.
<source>BMC Plant Biol</source>
.
<volume>10</volume>
:
<fpage>222</fpage>
.
<pub-id pub-id-type="doi">10.1186/1471-2229-10-222</pub-id>
<pub-id pub-id-type="pmid">20958971</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Umezawa</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Nakashima</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Miyakawa</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kuromori</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Tanokura</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Shinozaki</surname>
<given-names>K.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>2010</year>
).
<article-title>Molecular basis of the core regulatory network in ABA responses: sensing, signaling and transport</article-title>
.
<source>Plant Cell Physiol</source>
.
<volume>51</volume>
,
<fpage>1821</fpage>
<lpage>1839</lpage>
.
<pub-id pub-id-type="doi">10.1093/pcp/pcq156</pub-id>
<pub-id pub-id-type="pmid">20980270</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verweij</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Spelt</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Di Sansebastiano</surname>
<given-names>G.-P.</given-names>
</name>
<name>
<surname>Vermeer</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Reale</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Ferranti</surname>
<given-names>F.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>2008</year>
).
<article-title>An H+ P-ATPase on the tonoplast determines vacuolar pH and flower colour</article-title>
.
<source>Nat. Cell Biol</source>
.
<volume>10</volume>
:
<fpage>1456</fpage>
.
<pub-id pub-id-type="doi">10.1038/ncb1805</pub-id>
<pub-id pub-id-type="pmid">18997787</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L. L.</given-names>
</name>
<name>
<surname>Ruan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>C.</given-names>
</name>
<etal></etal>
</person-group>
. (
<year>2012</year>
).
<article-title>The draft genome of sweet orange (
<italic>Citrus sinensis</italic>
)</article-title>
.
<source>Nat. Genet</source>
.
<volume>45</volume>
,
<fpage>59</fpage>
<lpage>66</lpage>
.
<pub-id pub-id-type="doi">10.1038/ng.2472</pub-id>
<pub-id pub-id-type="pmid">23179022</pub-id>
</mixed-citation>
</ref>
<ref id="B49">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname>
<given-names>G. F.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y. Z.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>Q. J.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Islam</surname>
<given-names>M. Z.</given-names>
</name>
</person-group>
(
<year>2014</year>
).
<article-title>The physiological and nutritional responses of seven different citrus rootstock seedlings to boron deficiency</article-title>
.
<source>Trees</source>
<volume>28</volume>
,
<fpage>295</fpage>
<lpage>307</lpage>
<pub-id pub-id-type="doi">10.1007/s00468-013-0949-y</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000F310 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000F310 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024