Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot

Identifieur interne : 000B12 ( Pmc/Corpus ); précédent : 000B11; suivant : 000B13

High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot

Auteurs : Zhihong Gao ; Ting Shi ; Xiaoyan Luo ; Zhen Zhang ; Weibing Zhuang ; Liangju Wang

Source :

RBID : PMC:3464595

Abstract

Background

MicroRNAs (miRNAs) are a class of endogenous, small, non-coding RNAs that regulate gene expression by mediating gene silencing at transcriptional and post-transcriptional levels in high plants. However, the diversity of miRNAs and their roles in floral development in Japanese apricot (Prunus mume Sieb. et Zucc) remains largely unexplored. Imperfect flowers with pistil abortion seriously decrease production yields. To understand the role of miRNAs in pistil development, pistil development-related miRNAs were identified by Solexa sequencing in Japanese apricot.

Results

Solexa sequencing was used to identify and quantitatively profile small RNAs from perfect and imperfect flower buds of Japanese apricot. A total of 22,561,972 and 24,952,690 reads were sequenced from two small RNA libraries constructed from perfect and imperfect flower buds, respectively. Sixty-one known miRNAs, belonging to 24 families, were identified. Comparative profiling revealed that seven known miRNAs exhibited significant differential expression between perfect and imperfect flower buds. A total of 61 potentially novel miRNAs/new members of known miRNA families were also identified by the presence of mature miRNAs and corresponding miRNA*s in the sRNA libraries. Comparative analysis showed that six potentially novel miRNAs were differentially expressed between perfect and imperfect flower buds. Target predictions of the 13 differentially expressed miRNAs resulted in 212 target genes. Gene ontology (GO) annotation revealed that high-ranking miRNA target genes are those implicated in the developmental process, the regulation of transcription and response to stress.

Conclusions

This study represents the first comparative identification of miRNAomes between perfect and imperfect Japanese apricot flowers. Seven known miRNAs and six potentially novel miRNAs associated with pistil development were identified, using high-throughput sequencing of small RNAs. The findings, both computationally and experimentally, provide valuable information for further functional characterisation of miRNAs associated with pistil development in plants.


Url:
DOI: 10.1186/1471-2164-13-371
PubMed: 22863067
PubMed Central: 3464595

Links to Exploration step

PMC:3464595

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot</title>
<author>
<name sortKey="Gao, Zhihong" sort="Gao, Zhihong" uniqKey="Gao Z" first="Zhihong" last="Gao">Zhihong Gao</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Shi, Ting" sort="Shi, Ting" uniqKey="Shi T" first="Ting" last="Shi">Ting Shi</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Luo, Xiaoyan" sort="Luo, Xiaoyan" uniqKey="Luo X" first="Xiaoyan" last="Luo">Xiaoyan Luo</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Zhen" sort="Zhang, Zhen" uniqKey="Zhang Z" first="Zhen" last="Zhang">Zhen Zhang</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhuang, Weibing" sort="Zhuang, Weibing" uniqKey="Zhuang W" first="Weibing" last="Zhuang">Weibing Zhuang</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Liangju" sort="Wang, Liangju" uniqKey="Wang L" first="Liangju" last="Wang">Liangju Wang</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">22863067</idno>
<idno type="pmc">3464595</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3464595</idno>
<idno type="RBID">PMC:3464595</idno>
<idno type="doi">10.1186/1471-2164-13-371</idno>
<date when="2012">2012</date>
<idno type="wicri:Area/Pmc/Corpus">000B12</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot</title>
<author>
<name sortKey="Gao, Zhihong" sort="Gao, Zhihong" uniqKey="Gao Z" first="Zhihong" last="Gao">Zhihong Gao</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Shi, Ting" sort="Shi, Ting" uniqKey="Shi T" first="Ting" last="Shi">Ting Shi</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Luo, Xiaoyan" sort="Luo, Xiaoyan" uniqKey="Luo X" first="Xiaoyan" last="Luo">Xiaoyan Luo</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhang, Zhen" sort="Zhang, Zhen" uniqKey="Zhang Z" first="Zhen" last="Zhang">Zhen Zhang</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Zhuang, Weibing" sort="Zhuang, Weibing" uniqKey="Zhuang W" first="Weibing" last="Zhuang">Weibing Zhuang</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Liangju" sort="Wang, Liangju" uniqKey="Wang L" first="Liangju" last="Wang">Liangju Wang</name>
<affiliation>
<nlm:aff id="I1">College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">BMC Genomics</title>
<idno type="eISSN">1471-2164</idno>
<imprint>
<date when="2012">2012</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>MicroRNAs (miRNAs) are a class of endogenous, small, non-coding RNAs that regulate gene expression by mediating gene silencing at transcriptional and post-transcriptional levels in high plants. However, the diversity of miRNAs and their roles in floral development in Japanese apricot (
<italic>Prunus mume</italic>
Sieb. et Zucc) remains largely unexplored. Imperfect flowers with pistil abortion seriously decrease production yields. To understand the role of miRNAs in pistil development, pistil development-related miRNAs were identified by Solexa sequencing in Japanese apricot.</p>
</sec>
<sec>
<title>Results</title>
<p>Solexa sequencing was used to identify and quantitatively profile small RNAs from perfect and imperfect flower buds of Japanese apricot. A total of 22,561,972 and 24,952,690 reads were sequenced from two small RNA libraries constructed from perfect and imperfect flower buds, respectively. Sixty-one known miRNAs, belonging to 24 families, were identified. Comparative profiling revealed that seven known miRNAs exhibited significant differential expression between perfect and imperfect flower buds. A total of 61 potentially novel miRNAs/new members of known miRNA families were also identified by the presence of mature miRNAs and corresponding miRNA*s in the sRNA libraries. Comparative analysis showed that six potentially novel miRNAs were differentially expressed between perfect and imperfect flower buds. Target predictions of the 13 differentially expressed miRNAs resulted in 212 target genes. Gene ontology (GO) annotation revealed that high-ranking miRNA target genes are those implicated in the developmental process, the regulation of transcription and response to stress.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>This study represents the first comparative identification of miRNAomes between perfect and imperfect Japanese apricot flowers. Seven known miRNAs and six potentially novel miRNAs associated with pistil development were identified, using high-throughput sequencing of small RNAs. The findings, both computationally and experimentally, provide valuable information for further functional characterisation of miRNAs associated with pistil development in plants.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Chu, My" uniqKey="Chu M">MY Chu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gao, Z" uniqKey="Gao Z">Z Gao</name>
</author>
<author>
<name sortKey="Wang, S" uniqKey="Wang S">S Wang</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hou, J" uniqKey="Hou J">J Hou</name>
</author>
<author>
<name sortKey="Gao, Z" uniqKey="Gao Z">Z Gao</name>
</author>
<author>
<name sortKey="Wang, S" uniqKey="Wang S">S Wang</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author>
<name sortKey="Chen, S" uniqKey="Chen S">S Chen</name>
</author>
<author>
<name sortKey="Ando, T" uniqKey="Ando T">T Ando</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J Zhang</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, S" uniqKey="Wang S">S Wang</name>
</author>
<author>
<name sortKey="Gao, Z" uniqKey="Gao Z">Z Gao</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author>
<name sortKey="Xu, J" uniqKey="Xu J">J Xu</name>
</author>
<author>
<name sortKey="Hou, J" uniqKey="Hou J">J Hou</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Montgomery, Ta" uniqKey="Montgomery T">TA Montgomery</name>
</author>
<author>
<name sortKey="Howell, Md" uniqKey="Howell M">MD Howell</name>
</author>
<author>
<name sortKey="Cuperus, Jt" uniqKey="Cuperus J">JT Cuperus</name>
</author>
<author>
<name sortKey="Li, D" uniqKey="Li D">D Li</name>
</author>
<author>
<name sortKey="Hansen, Je" uniqKey="Hansen J">JE Hansen</name>
</author>
<author>
<name sortKey="Alexander, Al" uniqKey="Alexander A">AL Alexander</name>
</author>
<author>
<name sortKey="Chapman, Ej" uniqKey="Chapman E">EJ Chapman</name>
</author>
<author>
<name sortKey="Fahlgren, N" uniqKey="Fahlgren N">N Fahlgren</name>
</author>
<author>
<name sortKey="Allen, E" uniqKey="Allen E">E Allen</name>
</author>
<author>
<name sortKey="Carrington, Jc" uniqKey="Carrington J">JC Carrington</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhu, Qh" uniqKey="Zhu Q">QH Zhu</name>
</author>
<author>
<name sortKey="Helliwell, Ca" uniqKey="Helliwell C">CA Helliwell</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nag, A" uniqKey="Nag A">A Nag</name>
</author>
<author>
<name sortKey="Jack, T" uniqKey="Jack T">T Jack</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X Liu</name>
</author>
<author>
<name sortKey="Huang, J" uniqKey="Huang J">J Huang</name>
</author>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author>
<name sortKey="Khanna, K" uniqKey="Khanna K">K Khanna</name>
</author>
<author>
<name sortKey="Xie, Z" uniqKey="Xie Z">Z Xie</name>
</author>
<author>
<name sortKey="Owen, Ha" uniqKey="Owen H">HA Owen</name>
</author>
<author>
<name sortKey="Zhao, D" uniqKey="Zhao D">D Zhao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lee, H" uniqKey="Lee H">H Lee</name>
</author>
<author>
<name sortKey="Yoo, Sj" uniqKey="Yoo S">SJ Yoo</name>
</author>
<author>
<name sortKey="Lee, Jh" uniqKey="Lee J">JH Lee</name>
</author>
<author>
<name sortKey="Kim, W" uniqKey="Kim W">W Kim</name>
</author>
<author>
<name sortKey="Yoo, Sk" uniqKey="Yoo S">SK Yoo</name>
</author>
<author>
<name sortKey="Fitzgerald, H" uniqKey="Fitzgerald H">H Fitzgerald</name>
</author>
<author>
<name sortKey="Carrington, Jc" uniqKey="Carrington J">JC Carrington</name>
</author>
<author>
<name sortKey="Ahn, Jh" uniqKey="Ahn J">JH Ahn</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, Y" uniqKey="Zhang Y">Y Zhang</name>
</author>
<author>
<name sortKey="Cao, G" uniqKey="Cao G">G Cao</name>
</author>
<author>
<name sortKey="Qu, Lj" uniqKey="Qu L">LJ Qu</name>
</author>
<author>
<name sortKey="Gu, H" uniqKey="Gu H">H Gu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, J" uniqKey="Wang J">J Wang</name>
</author>
<author>
<name sortKey="Czech, B" uniqKey="Czech B">B Czech</name>
</author>
<author>
<name sortKey="Weigel, D" uniqKey="Weigel D">D Weigel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Amiteye, S" uniqKey="Amiteye S">S Amiteye</name>
</author>
<author>
<name sortKey="Corral, Jm" uniqKey="Corral J">JM Corral</name>
</author>
<author>
<name sortKey="Vogel, H" uniqKey="Vogel H">H Vogel</name>
</author>
<author>
<name sortKey="Sharbel, Tf" uniqKey="Sharbel T">TF Sharbel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, S" uniqKey="Wang S">S Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Carthew, Rw" uniqKey="Carthew R">RW Carthew</name>
</author>
<author>
<name sortKey="Sontheimer, Ej" uniqKey="Sontheimer E">EJ Sontheimer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mallory, Ac" uniqKey="Mallory A">AC Mallory</name>
</author>
<author>
<name sortKey="Vaucheret, H" uniqKey="Vaucheret H">H Vaucheret</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, C" uniqKey="Chen C">C Chen</name>
</author>
<author>
<name sortKey="Ridzon, Da" uniqKey="Ridzon D">DA Ridzon</name>
</author>
<author>
<name sortKey="Broomer, Aj" uniqKey="Broomer A">AJ Broomer</name>
</author>
<author>
<name sortKey="Zhou, Z" uniqKey="Zhou Z">Z Zhou</name>
</author>
<author>
<name sortKey="Lee, Dh" uniqKey="Lee D">DH Lee</name>
</author>
<author>
<name sortKey="Nguyen, Jt" uniqKey="Nguyen J">JT Nguyen</name>
</author>
<author>
<name sortKey="Barbisin, M" uniqKey="Barbisin M">M Barbisin</name>
</author>
<author>
<name sortKey="Xu, Nl" uniqKey="Xu N">NL Xu</name>
</author>
<author>
<name sortKey="Mahuvakar, Vr" uniqKey="Mahuvakar V">VR Mahuvakar</name>
</author>
<author>
<name sortKey="Andersen, Mr" uniqKey="Andersen M">MR Andersen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jones Rhoades, Mw" uniqKey="Jones Rhoades M">MW Jones-Rhoades</name>
</author>
<author>
<name sortKey="Bartel, Dp" uniqKey="Bartel D">DP Bartel</name>
</author>
<author>
<name sortKey="Barte, B" uniqKey="Barte B">B Barte</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bushati, N" uniqKey="Bushati N">N Bushati</name>
</author>
<author>
<name sortKey="Cohen, Sm" uniqKey="Cohen S">SM Cohen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mette, Mf" uniqKey="Mette M">MF Mette</name>
</author>
<author>
<name sortKey="Winden, J" uniqKey="Winden J">J Winden</name>
</author>
<author>
<name sortKey="Matzke, M" uniqKey="Matzke M">M Matzke</name>
</author>
<author>
<name sortKey="Matzke, Ajm" uniqKey="Matzke A">AJM Matzke</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Llave, C" uniqKey="Llave C">C Llave</name>
</author>
<author>
<name sortKey="Xie, Z" uniqKey="Xie Z">Z Xie</name>
</author>
<author>
<name sortKey="Kasschau, Kd" uniqKey="Kasschau K">KD Kasschau</name>
</author>
<author>
<name sortKey="Carrington, Jc" uniqKey="Carrington J">JC Carrington</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, B" uniqKey="Zhang B">B Zhang</name>
</author>
<author>
<name sortKey="Pan, X" uniqKey="Pan X">X Pan</name>
</author>
<author>
<name sortKey="Cobb, Gp" uniqKey="Cobb G">GP Cobb</name>
</author>
<author>
<name sortKey="Anderson, Ta" uniqKey="Anderson T">TA Anderson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jones Rhoades, Mw" uniqKey="Jones Rhoades M">MW Jones-Rhoades</name>
</author>
<author>
<name sortKey="Bartel, Dp" uniqKey="Bartel D">DP Bartel</name>
</author>
<author>
<name sortKey="Bartel, B" uniqKey="Bartel B">B Bartel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rubio Somoza, I" uniqKey="Rubio Somoza I">I Rubio-Somoza</name>
</author>
<author>
<name sortKey="Weigel, D" uniqKey="Weigel D">D Weigel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="An, Fm" uniqKey="An F">FM An</name>
</author>
<author>
<name sortKey="Hsiao, Sr" uniqKey="Hsiao S">SR Hsiao</name>
</author>
<author>
<name sortKey="Chan, Mt" uniqKey="Chan M">MT Chan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sunkar, R" uniqKey="Sunkar R">R Sunkar</name>
</author>
<author>
<name sortKey="Jagadeeswaran, G" uniqKey="Jagadeeswaran G">G Jagadeeswaran</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Song, C" uniqKey="Song C">C Song</name>
</author>
<author>
<name sortKey="Fang, J" uniqKey="Fang J">J Fang</name>
</author>
<author>
<name sortKey="Li, X" uniqKey="Li X">X Li</name>
</author>
<author>
<name sortKey="Liu, H" uniqKey="Liu H">H Liu</name>
</author>
<author>
<name sortKey="Chao, Ct" uniqKey="Chao C">CT Chao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rajagopalan, R" uniqKey="Rajagopalan R">R Rajagopalan</name>
</author>
<author>
<name sortKey="Vaucheret, H" uniqKey="Vaucheret H">H Vaucheret</name>
</author>
<author>
<name sortKey="Trejo, J" uniqKey="Trejo J">J Trejo</name>
</author>
<author>
<name sortKey="Bartel, Dp" uniqKey="Bartel D">DP Bartel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fahlgren, N" uniqKey="Fahlgren N">N Fahlgren</name>
</author>
<author>
<name sortKey="Howell, Md" uniqKey="Howell M">MD Howell</name>
</author>
<author>
<name sortKey="Kasschau, Kd" uniqKey="Kasschau K">KD Kasschau</name>
</author>
<author>
<name sortKey="Chapman, Ej" uniqKey="Chapman E">EJ Chapman</name>
</author>
<author>
<name sortKey="Sullivan, Cm" uniqKey="Sullivan C">CM Sullivan</name>
</author>
<author>
<name sortKey="Cumbie, Js" uniqKey="Cumbie J">JS Cumbie</name>
</author>
<author>
<name sortKey="Givan, Sa" uniqKey="Givan S">SA Givan</name>
</author>
<author>
<name sortKey="Law, Tf" uniqKey="Law T">TF Law</name>
</author>
<author>
<name sortKey="Grant, Sr" uniqKey="Grant S">SR Grant</name>
</author>
<author>
<name sortKey="Dangl, Jl" uniqKey="Dangl J">JL Dangl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nobuta, K" uniqKey="Nobuta K">K Nobuta</name>
</author>
<author>
<name sortKey="Venu, R" uniqKey="Venu R">R Venu</name>
</author>
<author>
<name sortKey="Lu, C" uniqKey="Lu C">C Lu</name>
</author>
<author>
<name sortKey="Bel, A" uniqKey="Bel A">A Beló</name>
</author>
<author>
<name sortKey="Vemaraju, K" uniqKey="Vemaraju K">K Vemaraju</name>
</author>
<author>
<name sortKey="Kulkarni, K" uniqKey="Kulkarni K">K Kulkarni</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
<author>
<name sortKey="Pillay, M" uniqKey="Pillay M">M Pillay</name>
</author>
<author>
<name sortKey="Green, Pj" uniqKey="Green P">PJ Green</name>
</author>
<author>
<name sortKey="Wang, G" uniqKey="Wang G">G Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhou, M" uniqKey="Zhou M">M Zhou</name>
</author>
<author>
<name sortKey="Gu, L" uniqKey="Gu L">L Gu</name>
</author>
<author>
<name sortKey="Li, P" uniqKey="Li P">P Li</name>
</author>
<author>
<name sortKey="Song, X" uniqKey="Song X">X Song</name>
</author>
<author>
<name sortKey="Wei, L" uniqKey="Wei L">L Wei</name>
</author>
<author>
<name sortKey="Chen, Z" uniqKey="Chen Z">Z Chen</name>
</author>
<author>
<name sortKey="Cao, X" uniqKey="Cao X">X Cao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Barakat, A" uniqKey="Barakat A">A Barakat</name>
</author>
<author>
<name sortKey="Wall, P" uniqKey="Wall P">P Wall</name>
</author>
<author>
<name sortKey="Diloreto, S" uniqKey="Diloreto S">S DiLoreto</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Klevebring, D" uniqKey="Klevebring D">D Klevebring</name>
</author>
<author>
<name sortKey="Street, N" uniqKey="Street N">N Street</name>
</author>
<author>
<name sortKey="Fahlgren, N" uniqKey="Fahlgren N">N Fahlgren</name>
</author>
<author>
<name sortKey="Kasschau, K" uniqKey="Kasschau K">K Kasschau</name>
</author>
<author>
<name sortKey="Carrington, J" uniqKey="Carrington J">J Carrington</name>
</author>
<author>
<name sortKey="Lundeberg, J" uniqKey="Lundeberg J">J Lundeberg</name>
</author>
<author>
<name sortKey="Jansson, S" uniqKey="Jansson S">S Jansson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lu, Yd" uniqKey="Lu Y">YD Lu</name>
</author>
<author>
<name sortKey="Gan, Qh" uniqKey="Gan Q">QH Gan</name>
</author>
<author>
<name sortKey="Chi, Xy" uniqKey="Chi X">XY Chi</name>
</author>
<author>
<name sortKey="Qin, S" uniqKey="Qin S">S Qin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhao, Cz" uniqKey="Zhao C">CZ Zhao</name>
</author>
<author>
<name sortKey="Xia, H" uniqKey="Xia H">H Xia</name>
</author>
<author>
<name sortKey="Frazier, Tp" uniqKey="Frazier T">TP Frazier</name>
</author>
<author>
<name sortKey="Yao, Yy" uniqKey="Yao Y">YY Yao</name>
</author>
<author>
<name sortKey="Bi, Yp" uniqKey="Bi Y">YP Bi</name>
</author>
<author>
<name sortKey="Li, Aq" uniqKey="Li A">AQ Li</name>
</author>
<author>
<name sortKey="Li, Mj" uniqKey="Li M">MJ Li</name>
</author>
<author>
<name sortKey="Li, Cs" uniqKey="Li C">CS Li</name>
</author>
<author>
<name sortKey="Zhang, Bh" uniqKey="Zhang B">BH Zhang</name>
</author>
<author>
<name sortKey="Wang, Xj" uniqKey="Wang X">XJ Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xu, Q" uniqKey="Xu Q">Q Xu</name>
</author>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y Liu</name>
</author>
<author>
<name sortKey="Zhu, A" uniqKey="Zhu A">A Zhu</name>
</author>
<author>
<name sortKey="Wu, X" uniqKey="Wu X">X Wu</name>
</author>
<author>
<name sortKey="Ye, J" uniqKey="Ye J">J Ye</name>
</author>
<author>
<name sortKey="Yu, K" uniqKey="Yu K">K Yu</name>
</author>
<author>
<name sortKey="Guo, W" uniqKey="Guo W">W Guo</name>
</author>
<author>
<name sortKey="Deng, X" uniqKey="Deng X">X Deng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Song, C" uniqKey="Song C">C Song</name>
</author>
<author>
<name sortKey="Wang, C" uniqKey="Wang C">C Wang</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C Zhang</name>
</author>
<author>
<name sortKey="Korir, N" uniqKey="Korir N">N Korir</name>
</author>
<author>
<name sortKey="Yu, H" uniqKey="Yu H">H Yu</name>
</author>
<author>
<name sortKey="Ma, Z" uniqKey="Ma Z">Z Ma</name>
</author>
<author>
<name sortKey="Fang, J" uniqKey="Fang J">J Fang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, T" uniqKey="Wang T">T Wang</name>
</author>
<author>
<name sortKey="Chen, L" uniqKey="Chen L">L Chen</name>
</author>
<author>
<name sortKey="Zhao, M" uniqKey="Zhao M">M Zhao</name>
</author>
<author>
<name sortKey="Tian, Q" uniqKey="Tian Q">Q Tian</name>
</author>
<author>
<name sortKey="Zhang, W H" uniqKey="Zhang W">W-H Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Szittya, G" uniqKey="Szittya G">G Szittya</name>
</author>
<author>
<name sortKey="Moxon, S" uniqKey="Moxon S">S Moxon</name>
</author>
<author>
<name sortKey="Santos, Dm" uniqKey="Santos D">DM Santos</name>
</author>
<author>
<name sortKey="Jing, R" uniqKey="Jing R">R Jing</name>
</author>
<author>
<name sortKey="Fevereiro, Mps" uniqKey="Fevereiro M">MPS Fevereiro</name>
</author>
<author>
<name sortKey="Moulton, V" uniqKey="Moulton V">V Moulton</name>
</author>
<author>
<name sortKey="Dalmay, T" uniqKey="Dalmay T">T Dalmay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Song, Q" uniqKey="Song Q">Q Song</name>
</author>
<author>
<name sortKey="Liu, Y" uniqKey="Liu Y">Y Liu</name>
</author>
<author>
<name sortKey="Hu, X" uniqKey="Hu X">X Hu</name>
</author>
<author>
<name sortKey="Zhang, W" uniqKey="Zhang W">W Zhang</name>
</author>
<author>
<name sortKey="Ma, B" uniqKey="Ma B">B Ma</name>
</author>
<author>
<name sortKey="Chen, S" uniqKey="Chen S">S Chen</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Martinez, G" uniqKey="Martinez G">G Martínez</name>
</author>
<author>
<name sortKey="Forment, J" uniqKey="Forment J">J Forment</name>
</author>
<author>
<name sortKey="Llave, C" uniqKey="Llave C">C Llave</name>
</author>
<author>
<name sortKey="Pallas, V" uniqKey="Pallas V">V Pallás</name>
</author>
<author>
<name sortKey="G Mez, G" uniqKey="G Mez G">G Gómez</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, Y" uniqKey="Yang Y">Y Yang</name>
</author>
<author>
<name sortKey="Chen, X" uniqKey="Chen X">X Chen</name>
</author>
<author>
<name sortKey="Chen, J" uniqKey="Chen J">J Chen</name>
</author>
<author>
<name sortKey="Xu, H" uniqKey="Xu H">H Xu</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Meyers, Bc" uniqKey="Meyers B">BC Meyers</name>
</author>
<author>
<name sortKey="Axtell, Mj" uniqKey="Axtell M">MJ Axtell</name>
</author>
<author>
<name sortKey="Bartel, B" uniqKey="Bartel B">B Bartel</name>
</author>
<author>
<name sortKey="Bartel, Dp" uniqKey="Bartel D">DP Bartel</name>
</author>
<author>
<name sortKey="Baulcombe, D" uniqKey="Baulcombe D">D Baulcombe</name>
</author>
<author>
<name sortKey="Bowman, Jl" uniqKey="Bowman J">JL Bowman</name>
</author>
<author>
<name sortKey="Cao, X" uniqKey="Cao X">X Cao</name>
</author>
<author>
<name sortKey="Carrington, Jc" uniqKey="Carrington J">JC Carrington</name>
</author>
<author>
<name sortKey="Chen, X" uniqKey="Chen X">X Chen</name>
</author>
<author>
<name sortKey="Green, Pj" uniqKey="Green P">PJ Green</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sunkar, R" uniqKey="Sunkar R">R Sunkar</name>
</author>
<author>
<name sortKey="Zhu, Jk" uniqKey="Zhu J">JK Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jones Rhoades, Mw" uniqKey="Jones Rhoades M">MW Jones-Rhoades</name>
</author>
<author>
<name sortKey="Bartel, Dp" uniqKey="Bartel D">DP Bartel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bonnet, E" uniqKey="Bonnet E">E Bonnet</name>
</author>
<author>
<name sortKey="Wuyts, J" uniqKey="Wuyts J">J Wuyts</name>
</author>
<author>
<name sortKey="Rouze, P" uniqKey="Rouze P">P Rouzé</name>
</author>
<author>
<name sortKey="Van De Peer, Y" uniqKey="Van De Peer Y">Y Van de Peer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, B" uniqKey="Zhang B">B Zhang</name>
</author>
<author>
<name sortKey="Pan, X" uniqKey="Pan X">X Pan</name>
</author>
<author>
<name sortKey="Wang, Q" uniqKey="Wang Q">Q Wang</name>
</author>
<author>
<name sortKey="Cobb, Gp" uniqKey="Cobb G">GP Cobb</name>
</author>
<author>
<name sortKey="Anderson, Ta" uniqKey="Anderson T">TA Anderson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yu, H" uniqKey="Yu H">H Yu</name>
</author>
<author>
<name sortKey="Song, C" uniqKey="Song C">C Song</name>
</author>
<author>
<name sortKey="Jia, Q" uniqKey="Jia Q">Q Jia</name>
</author>
<author>
<name sortKey="Wang, C" uniqKey="Wang C">C Wang</name>
</author>
<author>
<name sortKey="Li, F" uniqKey="Li F">F Li</name>
</author>
<author>
<name sortKey="Nicholas, Kk" uniqKey="Nicholas K">KK Nicholas</name>
</author>
<author>
<name sortKey="Zhang, X" uniqKey="Zhang X">X Zhang</name>
</author>
<author>
<name sortKey="Fang, J" uniqKey="Fang J">J Fang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moxon, S" uniqKey="Moxon S">S Moxon</name>
</author>
<author>
<name sortKey="Jing, R" uniqKey="Jing R">R Jing</name>
</author>
<author>
<name sortKey="Szittya, G" uniqKey="Szittya G">G Szittya</name>
</author>
<author>
<name sortKey="Schwach, F" uniqKey="Schwach F">F Schwach</name>
</author>
<author>
<name sortKey="Rusholme Pilcher, Rl" uniqKey="Rusholme Pilcher R">RL Rusholme Pilcher</name>
</author>
<author>
<name sortKey="Moulton, V" uniqKey="Moulton V">V Moulton</name>
</author>
<author>
<name sortKey="Dalmay, T" uniqKey="Dalmay T">T Dalmay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pang, M" uniqKey="Pang M">M Pang</name>
</author>
<author>
<name sortKey="Woodward, Aw" uniqKey="Woodward A">AW Woodward</name>
</author>
<author>
<name sortKey="Agarwal, V" uniqKey="Agarwal V">V Agarwal</name>
</author>
<author>
<name sortKey="Guan, X" uniqKey="Guan X">X Guan</name>
</author>
<author>
<name sortKey="Ha, M" uniqKey="Ha M">M Ha</name>
</author>
<author>
<name sortKey="Ramachandran, V" uniqKey="Ramachandran V">V Ramachandran</name>
</author>
<author>
<name sortKey="Chen, X" uniqKey="Chen X">X Chen</name>
</author>
<author>
<name sortKey="Triplett, Ba" uniqKey="Triplett B">BA Triplett</name>
</author>
<author>
<name sortKey="Stelly, Dm" uniqKey="Stelly D">DM Stelly</name>
</author>
<author>
<name sortKey="Chen, Zj" uniqKey="Chen Z">ZJ Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Huang, S" uniqKey="Huang S">S Huang</name>
</author>
<author>
<name sortKey="Li, R" uniqKey="Li R">R Li</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author>
<name sortKey="Li, L" uniqKey="Li L">L Li</name>
</author>
<author>
<name sortKey="Gu, X" uniqKey="Gu X">X Gu</name>
</author>
<author>
<name sortKey="Fan, W" uniqKey="Fan W">W Fan</name>
</author>
<author>
<name sortKey="Lucas, Wj" uniqKey="Lucas W">WJ Lucas</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author>
<name sortKey="Xie, B" uniqKey="Xie B">B Xie</name>
</author>
<author>
<name sortKey="Ni, P" uniqKey="Ni P">P Ni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xu, M" uniqKey="Xu M">M Xu</name>
</author>
<author>
<name sortKey="Liu, Q" uniqKey="Liu Q">Q Liu</name>
</author>
<author>
<name sortKey="Nisbet, Aj" uniqKey="Nisbet A">AJ Nisbet</name>
</author>
<author>
<name sortKey="Cai, X" uniqKey="Cai X">X Cai</name>
</author>
<author>
<name sortKey="Yan, C" uniqKey="Yan C">C Yan</name>
</author>
<author>
<name sortKey="Lin, R" uniqKey="Lin R">R Lin</name>
</author>
<author>
<name sortKey="Yuan, Z" uniqKey="Yuan Z">Z Yuan</name>
</author>
<author>
<name sortKey="Song, H" uniqKey="Song H">H Song</name>
</author>
<author>
<name sortKey="He, X" uniqKey="He X">X He</name>
</author>
<author>
<name sortKey="Zhu, X" uniqKey="Zhu X">X Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bartel, Dp" uniqKey="Bartel D">DP Bartel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yang, X" uniqKey="Yang X">X Yang</name>
</author>
<author>
<name sortKey="Zhang, H" uniqKey="Zhang H">H Zhang</name>
</author>
<author>
<name sortKey="Li, L" uniqKey="Li L">L Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, Y" uniqKey="Wang Y">Y Wang</name>
</author>
<author>
<name sortKey="Itaya, A" uniqKey="Itaya A">A Itaya</name>
</author>
<author>
<name sortKey="Zhong, X" uniqKey="Zhong X">X Zhong</name>
</author>
<author>
<name sortKey="Wu, Y" uniqKey="Wu Y">Y Wu</name>
</author>
<author>
<name sortKey="Zhang, J" uniqKey="Zhang J">J Zhang</name>
</author>
<author>
<name sortKey="Van Der Knaap, E" uniqKey="Van Der Knaap E">E van der Knaap</name>
</author>
<author>
<name sortKey="Olmstead, R" uniqKey="Olmstead R">R Olmstead</name>
</author>
<author>
<name sortKey="Qi, Y" uniqKey="Qi Y">Y Qi</name>
</author>
<author>
<name sortKey="Ding, B" uniqKey="Ding B">B Ding</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L Wang</name>
</author>
<author>
<name sortKey="Liu, H" uniqKey="Liu H">H Liu</name>
</author>
<author>
<name sortKey="Li, D" uniqKey="Li D">D Li</name>
</author>
<author>
<name sortKey="Chen, H" uniqKey="Chen H">H Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, C" uniqKey="Wang C">C Wang</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author>
<name sortKey="Kibet, Nk" uniqKey="Kibet N">NK Kibet</name>
</author>
<author>
<name sortKey="Song, C" uniqKey="Song C">C Song</name>
</author>
<author>
<name sortKey="Zhang, C" uniqKey="Zhang C">C Zhang</name>
</author>
<author>
<name sortKey="Li, X" uniqKey="Li X">X Li</name>
</author>
<author>
<name sortKey="Han, J" uniqKey="Han J">J Han</name>
</author>
<author>
<name sortKey="Fang, J" uniqKey="Fang J">J Fang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pantaleo, V" uniqKey="Pantaleo V">V Pantaleo</name>
</author>
<author>
<name sortKey="Szittya, G" uniqKey="Szittya G">G Szittya</name>
</author>
<author>
<name sortKey="Moxon, S" uniqKey="Moxon S">S Moxon</name>
</author>
<author>
<name sortKey="Miozzi, L" uniqKey="Miozzi L">L Miozzi</name>
</author>
<author>
<name sortKey="Moulton, V" uniqKey="Moulton V">V Moulton</name>
</author>
<author>
<name sortKey="Dalmay, T" uniqKey="Dalmay T">T Dalmay</name>
</author>
<author>
<name sortKey="Burgyan, J" uniqKey="Burgyan J">J Burgyan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhao, L" uniqKey="Zhao L">L Zhao</name>
</author>
<author>
<name sortKey="Kim, Yj" uniqKey="Kim Y">YJ Kim</name>
</author>
<author>
<name sortKey="Dinh, Tt" uniqKey="Dinh T">TT Dinh</name>
</author>
<author>
<name sortKey="Chen, X" uniqKey="Chen X">X Chen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ji, L" uniqKey="Ji L">L Ji</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X Liu</name>
</author>
<author>
<name sortKey="Yan, J" uniqKey="Yan J">J Yan</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
<author>
<name sortKey="Yumul, Re" uniqKey="Yumul R">RE Yumul</name>
</author>
<author>
<name sortKey="Kim, Yj" uniqKey="Kim Y">YJ Kim</name>
</author>
<author>
<name sortKey="Dinh, Tt" uniqKey="Dinh T">TT Dinh</name>
</author>
<author>
<name sortKey="Liu, J" uniqKey="Liu J">J Liu</name>
</author>
<author>
<name sortKey="Cui, X" uniqKey="Cui X">X Cui</name>
</author>
<author>
<name sortKey="Zheng, B" uniqKey="Zheng B">B Zheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Reinhart, Bj" uniqKey="Reinhart B">BJ Reinhart</name>
</author>
<author>
<name sortKey="Weinstein, Eg" uniqKey="Weinstein E">EG Weinstein</name>
</author>
<author>
<name sortKey="Rhoades, Mw" uniqKey="Rhoades M">MW Rhoades</name>
</author>
<author>
<name sortKey="Bartel, B" uniqKey="Bartel B">B Bartel</name>
</author>
<author>
<name sortKey="Bartel, Dp" uniqKey="Bartel D">DP Bartel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Licausi, F" uniqKey="Licausi F">F Licausi</name>
</author>
<author>
<name sortKey="Weits, Da" uniqKey="Weits D">DA Weits</name>
</author>
<author>
<name sortKey="Pant, Bd" uniqKey="Pant B">BD Pant</name>
</author>
<author>
<name sortKey="Scheible, Wr" uniqKey="Scheible W">WR Scheible</name>
</author>
<author>
<name sortKey="Geigenberger, P" uniqKey="Geigenberger P">P Geigenberger</name>
</author>
<author>
<name sortKey="Van Dongen, Jt" uniqKey="Van Dongen J">JT Van Dongen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Earley, K" uniqKey="Earley K">K Earley</name>
</author>
<author>
<name sortKey="Smith, M" uniqKey="Smith M">M Smith</name>
</author>
<author>
<name sortKey="Weber, R" uniqKey="Weber R">R Weber</name>
</author>
<author>
<name sortKey="Gregory, B" uniqKey="Gregory B">B Gregory</name>
</author>
<author>
<name sortKey="Poethig, R" uniqKey="Poethig R">R Poethig</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L Wang</name>
</author>
<author>
<name sortKey="Hua, D" uniqKey="Hua D">D Hua</name>
</author>
<author>
<name sortKey="He, J" uniqKey="He J">J He</name>
</author>
<author>
<name sortKey="Duan, Y" uniqKey="Duan Y">Y Duan</name>
</author>
<author>
<name sortKey="Chen, Z" uniqKey="Chen Z">Z Chen</name>
</author>
<author>
<name sortKey="Hong, X" uniqKey="Hong X">X Hong</name>
</author>
<author>
<name sortKey="Gong, Z" uniqKey="Gong Z">Z Gong</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lim, Po" uniqKey="Lim P">PO Lim</name>
</author>
<author>
<name sortKey="Lee, Ic" uniqKey="Lee I">IC Lee</name>
</author>
<author>
<name sortKey="Kim, J" uniqKey="Kim J">J Kim</name>
</author>
<author>
<name sortKey="Kim, Hj" uniqKey="Kim H">HJ Kim</name>
</author>
<author>
<name sortKey="Ryu, Js" uniqKey="Ryu J">JS Ryu</name>
</author>
<author>
<name sortKey="Woo, Hr" uniqKey="Woo H">HR Woo</name>
</author>
<author>
<name sortKey="Nam, Hg" uniqKey="Nam H">HG Nam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ellis, Cm" uniqKey="Ellis C">CM Ellis</name>
</author>
<author>
<name sortKey="Nagpal, P" uniqKey="Nagpal P">P Nagpal</name>
</author>
<author>
<name sortKey="Young, Jc" uniqKey="Young J">JC Young</name>
</author>
<author>
<name sortKey="Hagen, G" uniqKey="Hagen G">G Hagen</name>
</author>
<author>
<name sortKey="Guilfoyle, Tj" uniqKey="Guilfoyle T">TJ Guilfoyle</name>
</author>
<author>
<name sortKey="Reed, Jw" uniqKey="Reed J">JW Reed</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Palatnik, Jf" uniqKey="Palatnik J">JF Palatnik</name>
</author>
<author>
<name sortKey="Wollmann, H" uniqKey="Wollmann H">H Wollmann</name>
</author>
<author>
<name sortKey="Schommer, C" uniqKey="Schommer C">C Schommer</name>
</author>
<author>
<name sortKey="Schwab, R" uniqKey="Schwab R">R Schwab</name>
</author>
<author>
<name sortKey="Boisbouvier, J" uniqKey="Boisbouvier J">J Boisbouvier</name>
</author>
<author>
<name sortKey="Rodriguez, R" uniqKey="Rodriguez R">R Rodriguez</name>
</author>
<author>
<name sortKey="Warthmann, N" uniqKey="Warthmann N">N Warthmann</name>
</author>
<author>
<name sortKey="Allen, E" uniqKey="Allen E">E Allen</name>
</author>
<author>
<name sortKey="Dezulian, T" uniqKey="Dezulian T">T Dezulian</name>
</author>
<author>
<name sortKey="Huson, D" uniqKey="Huson D">D Huson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author>
<name sortKey="Xiong, A" uniqKey="Xiong A">A Xiong</name>
</author>
<author>
<name sortKey="Yao, Q" uniqKey="Yao Q">Q Yao</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author>
<name sortKey="Qiao, Y" uniqKey="Qiao Y">Y Qiao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zuker, M" uniqKey="Zuker M">M Zuker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jiang, P" uniqKey="Jiang P">P Jiang</name>
</author>
<author>
<name sortKey="Wu, H" uniqKey="Wu H">H Wu</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
<author>
<name sortKey="Ma, W" uniqKey="Ma W">W Ma</name>
</author>
<author>
<name sortKey="Sun, X" uniqKey="Sun X">X Sun</name>
</author>
<author>
<name sortKey="Lu, Z" uniqKey="Lu Z">Z Lu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, G" uniqKey="Li G">G Li</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author>
<name sortKey="Li, X" uniqKey="Li X">X Li</name>
</author>
<author>
<name sortKey="Ning, X" uniqKey="Ning X">X Ning</name>
</author>
<author>
<name sortKey="Li, M" uniqKey="Li M">M Li</name>
</author>
<author>
<name sortKey="Yang, G" uniqKey="Yang G">G Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Allen, E" uniqKey="Allen E">E Allen</name>
</author>
<author>
<name sortKey="Xie, Z" uniqKey="Xie Z">Z Xie</name>
</author>
<author>
<name sortKey="Gustafson, Am" uniqKey="Gustafson A">AM Gustafson</name>
</author>
<author>
<name sortKey="Carrington, Jc" uniqKey="Carrington J">JC Carrington</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schwab, R" uniqKey="Schwab R">R Schwab</name>
</author>
<author>
<name sortKey="Palatnik, Jf" uniqKey="Palatnik J">JF Palatnik</name>
</author>
<author>
<name sortKey="Riester, M" uniqKey="Riester M">M Riester</name>
</author>
<author>
<name sortKey="Schommer, C" uniqKey="Schommer C">C Schommer</name>
</author>
<author>
<name sortKey="Schmid, M" uniqKey="Schmid M">M Schmid</name>
</author>
<author>
<name sortKey="Weigel, D" uniqKey="Weigel D">D Weigel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fujii, H" uniqKey="Fujii H">H Fujii</name>
</author>
<author>
<name sortKey="Chiou, Tj" uniqKey="Chiou T">TJ Chiou</name>
</author>
<author>
<name sortKey="Lin, Si" uniqKey="Lin S">SI Lin</name>
</author>
<author>
<name sortKey="Aung, K" uniqKey="Aung K">K Aung</name>
</author>
<author>
<name sortKey="Zhu, Jk" uniqKey="Zhu J">JK Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Shi, R" uniqKey="Shi R">R Shi</name>
</author>
<author>
<name sortKey="Chiang, Vl" uniqKey="Chiang V">VL Chiang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ramakers, C" uniqKey="Ramakers C">C Ramakers</name>
</author>
<author>
<name sortKey="Ruijter, Jm" uniqKey="Ruijter J">JM Ruijter</name>
</author>
<author>
<name sortKey="Deprez, Rhl" uniqKey="Deprez R">RHL Deprez</name>
</author>
<author>
<name sortKey="Moorman, Afm" uniqKey="Moorman A">AFM Moorman</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article" xml:lang="en">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">BMC Genomics</journal-id>
<journal-id journal-id-type="iso-abbrev">BMC Genomics</journal-id>
<journal-title-group>
<journal-title>BMC Genomics</journal-title>
</journal-title-group>
<issn pub-type="epub">1471-2164</issn>
<publisher>
<publisher-name>BioMed Central</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">22863067</article-id>
<article-id pub-id-type="pmc">3464595</article-id>
<article-id pub-id-type="publisher-id">1471-2164-13-371</article-id>
<article-id pub-id-type="doi">10.1186/1471-2164-13-371</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes" equal-contrib="yes" id="A1">
<name>
<surname>Gao</surname>
<given-names>Zhihong</given-names>
</name>
<xref ref-type="aff" rid="I1">1</xref>
<email>gaozhihong@njau.edu.cn</email>
</contrib>
<contrib contrib-type="author" equal-contrib="yes" id="A2">
<name>
<surname>Shi</surname>
<given-names>Ting</given-names>
</name>
<xref ref-type="aff" rid="I1">1</xref>
<email>2009104025@njau.edu.cn</email>
</contrib>
<contrib contrib-type="author" id="A3">
<name>
<surname>Luo</surname>
<given-names>Xiaoyan</given-names>
</name>
<xref ref-type="aff" rid="I1">1</xref>
<email>2010104019@njau.edu.cn</email>
</contrib>
<contrib contrib-type="author" id="A4">
<name>
<surname>Zhang</surname>
<given-names>Zhen</given-names>
</name>
<xref ref-type="aff" rid="I1">1</xref>
<email>zhangzh@njau.edu.cn</email>
</contrib>
<contrib contrib-type="author" id="A5">
<name>
<surname>Zhuang</surname>
<given-names>Weibing</given-names>
</name>
<xref ref-type="aff" rid="I1">1</xref>
<email>2009104027@njau.edu.cn</email>
</contrib>
<contrib contrib-type="author" id="A6">
<name>
<surname>Wang</surname>
<given-names>Liangju</given-names>
</name>
<xref ref-type="aff" rid="I1">1</xref>
<email>wlj@njau.edu.cn</email>
</contrib>
</contrib-group>
<aff id="I1">
<label>1</label>
College of Horticulture, Nanjing Agricultural University, No 1 Weigang, Nanjing, 210095, P. R. China</aff>
<pub-date pub-type="collection">
<year>2012</year>
</pub-date>
<pub-date pub-type="epub">
<day>3</day>
<month>8</month>
<year>2012</year>
</pub-date>
<volume>13</volume>
<fpage>371</fpage>
<lpage>371</lpage>
<history>
<date date-type="received">
<day>21</day>
<month>11</month>
<year>2011</year>
</date>
<date date-type="accepted">
<day>25</day>
<month>7</month>
<year>2012</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright ©2012 Gao et al.; licensee BioMed Central Ltd.</copyright-statement>
<copyright-year>2012</copyright-year>
<copyright-holder>Gao et al.; licensee BioMed Central Ltd.</copyright-holder>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/2.0">
<license-p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/2.0">http://creativecommons.org/licenses/by/2.0</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
</license>
</permissions>
<self-uri xlink:href="http://www.biomedcentral.com/1471-2164/13/371"></self-uri>
<abstract>
<sec>
<title>Background</title>
<p>MicroRNAs (miRNAs) are a class of endogenous, small, non-coding RNAs that regulate gene expression by mediating gene silencing at transcriptional and post-transcriptional levels in high plants. However, the diversity of miRNAs and their roles in floral development in Japanese apricot (
<italic>Prunus mume</italic>
Sieb. et Zucc) remains largely unexplored. Imperfect flowers with pistil abortion seriously decrease production yields. To understand the role of miRNAs in pistil development, pistil development-related miRNAs were identified by Solexa sequencing in Japanese apricot.</p>
</sec>
<sec>
<title>Results</title>
<p>Solexa sequencing was used to identify and quantitatively profile small RNAs from perfect and imperfect flower buds of Japanese apricot. A total of 22,561,972 and 24,952,690 reads were sequenced from two small RNA libraries constructed from perfect and imperfect flower buds, respectively. Sixty-one known miRNAs, belonging to 24 families, were identified. Comparative profiling revealed that seven known miRNAs exhibited significant differential expression between perfect and imperfect flower buds. A total of 61 potentially novel miRNAs/new members of known miRNA families were also identified by the presence of mature miRNAs and corresponding miRNA*s in the sRNA libraries. Comparative analysis showed that six potentially novel miRNAs were differentially expressed between perfect and imperfect flower buds. Target predictions of the 13 differentially expressed miRNAs resulted in 212 target genes. Gene ontology (GO) annotation revealed that high-ranking miRNA target genes are those implicated in the developmental process, the regulation of transcription and response to stress.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>This study represents the first comparative identification of miRNAomes between perfect and imperfect Japanese apricot flowers. Seven known miRNAs and six potentially novel miRNAs associated with pistil development were identified, using high-throughput sequencing of small RNAs. The findings, both computationally and experimentally, provide valuable information for further functional characterisation of miRNAs associated with pistil development in plants.</p>
</sec>
</abstract>
<kwd-group>
<kwd>Japanese apricot</kwd>
<kwd>microRNA</kwd>
<kwd>Pistil abortion</kwd>
<kwd>qRT-PCR</kwd>
<kwd>Solexa sequencing</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec>
<title>Background</title>
<p>Japanese apricot (
<italic>Prunus mume</italic>
Sieb. et Zucc) is an important economic fruit crop in China and Japan, with more than 200 cultivars in China [
<xref ref-type="bibr" rid="B1">1</xref>
]. Japanese apricot fruit has consistently been one of the most valuable processing materials used in the food and wine-making industries and is believed to contain many physiochemicals beneficial to human health. However, the phenomenon of imperfect flowers is common and seriously affects production yields. The percentage of imperfect flowers depends on the cultivar; the highest is 75.15% and the average is 35% [
<xref ref-type="bibr" rid="B2">2</xref>
]. Imperfect flowers are characterised by pistils below the stamens, withered pistils or the absence of pistils, and hence, they fail to bear fruit [
<xref ref-type="bibr" rid="B3">3</xref>
]. Several environmental factors and physiological processes have been shown to affect pistil development [
<xref ref-type="bibr" rid="B1">1</xref>
,
<xref ref-type="bibr" rid="B4">4</xref>
]. Previous research indicated that several miRNAs and multiple target genes are involved in flower development in model plants [
<xref ref-type="bibr" rid="B5">5</xref>
-
<xref ref-type="bibr" rid="B12">12</xref>
]. More recently, real-time quantitative reverse transcription polymerase chain reaction and
<italic>in situ</italic>
hybridisation showed that the
<italic>PmAG</italic>
mRNA was highly-expressed in the sepals, carpels and stamens, and a weak signal was detected in the seeds and nutlets. No expressions were detected in the leaves or petals, but no significant differential was expressed between perfect and imperfect flowers [
<xref ref-type="bibr" rid="B3">3</xref>
]. Meanwhile, comparative proteomic analyses were performed on perfect and imperfect flowers, and several differently-expressed proteins were identified [
<xref ref-type="bibr" rid="B13">13</xref>
]. However, the type of molecular mechanism involved in pistil abortion remains unknown in Japanese apricot.</p>
<p>Small RNAs (sRNAs) are low molecular weight RNAs with regulatory functions. Based on differences in biogenesis and action, sRNAs are grouped into two categories: short interfering RNAs (siRNAs) and microRNAs (miRNAs) [
<xref ref-type="bibr" rid="B14">14</xref>
,
<xref ref-type="bibr" rid="B15">15</xref>
]. MicroRNAs are non-coding RNAs, 21–24 nucleotides (nt) long, which regulate gene expression at the post-transcriptional level [
<xref ref-type="bibr" rid="B16">16</xref>
-
<xref ref-type="bibr" rid="B18">18</xref>
]. In plants, miRNAs are processed from the stem-loop regions of long primary transcripts by a Dicer-like enzyme and are loaded into silencing complexes, where they generally direct the cleavage of complementary mRNAs [
<xref ref-type="bibr" rid="B17">17</xref>
]. Identified in plants less than 10 years ago [
<xref ref-type="bibr" rid="B19">19</xref>
,
<xref ref-type="bibr" rid="B20">20</xref>
], miRNAs are already known to play numerous crucial roles at each major stage of development, typically at the cores of gene regulatory networks, targeting genes that are themselves regulators, such as those that encode transcription factors, suggesting that plant miRNAs are master regulators [
<xref ref-type="bibr" rid="B18">18</xref>
,
<xref ref-type="bibr" rid="B21">21</xref>
]. Among non-transcription factor targets, many miRNAs encode F-box proteins or ubiquitin-conjugating enzymes implicated in targeting selected proteins for proteasomal degradation, indicating miRNAs play a role in regulating protein stability and plant development [
<xref ref-type="bibr" rid="B22">22</xref>
,
<xref ref-type="bibr" rid="B23">23</xref>
]. miR156, miR163, miR169, miR172, miR398 and miR399 play important roles in flowering-time regulation and belong to ambient temperature-responsive miRNAs in plants [
<xref ref-type="bibr" rid="B9">9</xref>
,
<xref ref-type="bibr" rid="B24">24</xref>
]. miR172 has also acquired specialised species-specific functions in other aspects of plant development, such as cleistogamy and tuberisation [
<xref ref-type="bibr" rid="B6">6</xref>
].</p>
<p>The fact that a large number of the known miRNAs in the plant kingdom, from mosses and ferns to higher flowering plants, are evolutionarily conserved has been used as a practical indicator for the identification or prediction of miRNAs using homology searches in other species [
<xref ref-type="bibr" rid="B25">25</xref>
,
<xref ref-type="bibr" rid="B26">26</xref>
]. Recently developed, next-generation, high-throughput sequencing technologies provide a powerful tool for identifying, as well as quantifying, miRNAs. These technologies open up the possibility of exploring sRNA populations in economically important species such as
<italic>Arabidopsis thaliana</italic>
[
<xref ref-type="bibr" rid="B27">27</xref>
,
<xref ref-type="bibr" rid="B28">28</xref>
],
<italic>Oryza sativa</italic>
[
<xref ref-type="bibr" rid="B29">29</xref>
,
<xref ref-type="bibr" rid="B30">30</xref>
],
<italic>Populus trichocarpa</italic>
[
<xref ref-type="bibr" rid="B31">31</xref>
,
<xref ref-type="bibr" rid="B32">32</xref>
],
<italic>Vitis vinifera</italic>
[
<xref ref-type="bibr" rid="B33">33</xref>
],
<italic>Arachis hypogaea</italic>
[
<xref ref-type="bibr" rid="B34">34</xref>
],
<italic>Citrus sinensis</italic>
[
<xref ref-type="bibr" rid="B35">35</xref>
],
<italic>Citrus trifoliate</italic>
[
<xref ref-type="bibr" rid="B36">36</xref>
],
<italic>Medicago truncatula</italic>
[
<xref ref-type="bibr" rid="B37">37</xref>
,
<xref ref-type="bibr" rid="B38">38</xref>
],
<italic>Glycine max</italic>
[
<xref ref-type="bibr" rid="B39">39</xref>
],
<italic>Carthamus tinctorius</italic>
<italic>Cucumis sativus</italic>
[
<xref ref-type="bibr" rid="B40">40</xref>
],
<italic>Rehmannia glutinosa</italic>
[
<xref ref-type="bibr" rid="B41">41</xref>
] and others. By means of high-throughput sequencing, miR164 and miR169 were shown to be drought-responsive miRNAs in
<italic>Medicago truncatula</italic>
[
<xref ref-type="bibr" rid="B37">37</xref>
]. miR167, miR1857 and miR172a are involved in the mutant trait formation of lycopene accumulation in sweet orange [
<xref ref-type="bibr" rid="B35">35</xref>
].</p>
<p>Although miRNAs have been extensively studied in the past, there has be no systematic examination of miRNAs performed on the Japanese apricot. To investigate the role of miRNAs on the pistil development of Japanese apricot, high-throughput sequencing technology (Solexa) was employed to survey sRNA populations from perfect and imperfect flower buds.</p>
</sec>
<sec sec-type="results">
<title>Results</title>
<sec>
<title>High-throughput sequencing of small RNAs from Japanese apricot flower bud tissue</title>
<p>To identify miRNAs involved in the development of Japanese apricot flowers, Solexa sequencing was used on libraries of small RNAs from perfect and imperfect flower buds. A total of 22,561,972 and 24,952,690 reads were obtained from perfect and imperfect flower bud libraries, respectively, after filtering out those reads without small RNA sequences, ranging from 18 to 30 nt in length (Figure
<xref ref-type="fig" rid="F1">1</xref>
), of which the majority were 19–25 nt long. The most abundant small RNAs in the perfect and imperfect libraries were 21 nt and 24 nt long, respectively. The distribution of 21 nt small RNAs was approximately 28.35% and 32.31% in perfect and imperfect libraries, respectively, while the distribution of 24 nt small RNAs was approximately 40.08% and 31.17% in the perfect and imperfect libraries, respectively. After removal of the adaptor, insert, poly(A) and short RNAs of <18 nt, 21,985,053 and 24,239,332 redundant clean reads were obtained from the perfect and imperfect flower buds, respectively, including rRNA, tRNA, snRNA, snoRNA, miRNA and several other unannotated reads (Tables 
<xref ref-type="table" rid="T1">1</xref>
and
<xref ref-type="table" rid="T2">2</xref>
). Of these clean reads, 11.76% (unique, 43.32%) were perfect-specific, 10.88% (unique, 40.35%) were imperfect-specific, and 77.36% (unique, 16.33%) were present in both (Figure
<xref ref-type="fig" rid="F2">2</xref>
). The average number of common sequence frequency was 20.67, while that of library-specific reads was not more than 1.2 (Table
<xref ref-type="table" rid="T3">3</xref>
). Among the sRNAs sequenced, unannotated redundant reads accounted for 77.83% and 74.25% for perfect and imperfect flower buds, respectively.</p>
<fig id="F1" position="float">
<label>Figure 1</label>
<caption>
<p>Length distribution of the small RNA library in Japanese apricot perfect and imperfect libraries.</p>
</caption>
<graphic xlink:href="1471-2164-13-371-1"></graphic>
</fig>
<table-wrap position="float" id="T1">
<label>Table 1</label>
<caption>
<p>Summary of data cleaning produced by small RNA sequencing (perfect and imperfect flower buds)</p>
</caption>
<table frame="hsides" rules="groups" border="1">
<colgroup>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
</colgroup>
<thead valign="top">
<tr>
<th rowspan="2" align="center">
<bold>Type</bold>
</th>
<th colspan="2" align="center" valign="bottom">
<bold>Perfect</bold>
<hr></hr>
</th>
<th colspan="2" align="center" valign="bottom">
<bold>Imperfect</bold>
<hr></hr>
</th>
</tr>
<tr>
<th align="center">
<bold>Count</bold>
</th>
<th align="center">
<bold>Percent (%)</bold>
</th>
<th align="center">
<bold>Count</bold>
</th>
<th align="center">
<bold>Percent (%)</bold>
</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center" valign="bottom">Total reads
<hr></hr>
</td>
<td align="center" valign="bottom">22,561,972
<hr></hr>
</td>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">24,952,690
<hr></hr>
</td>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">High quality
<hr></hr>
</td>
<td align="center" valign="bottom">22,135,703
<hr></hr>
</td>
<td align="center" valign="bottom">100%
<hr></hr>
</td>
<td align="center" valign="bottom">24,466,679
<hr></hr>
</td>
<td align="center" valign="bottom">100%
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">3′ adapter null
<hr></hr>
</td>
<td align="center" valign="bottom">53,592
<hr></hr>
</td>
<td align="center" valign="bottom">0.24%
<hr></hr>
</td>
<td align="center" valign="bottom">49,464
<hr></hr>
</td>
<td align="center" valign="bottom">0.20%
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">Insert null
<hr></hr>
</td>
<td align="center" valign="bottom">6,598
<hr></hr>
</td>
<td align="center" valign="bottom">0.03%
<hr></hr>
</td>
<td align="center" valign="bottom">8,281
<hr></hr>
</td>
<td align="center" valign="bottom">0.03%
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">5′ adapter contaminants
<hr></hr>
</td>
<td align="center" valign="bottom">36,203
<hr></hr>
</td>
<td align="center" valign="bottom">0.16%
<hr></hr>
</td>
<td align="center" valign="bottom">58,925
<hr></hr>
</td>
<td align="center" valign="bottom">0.24%
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">Smaller than 18nt
<hr></hr>
</td>
<td align="center" valign="bottom">48,147
<hr></hr>
</td>
<td align="center" valign="bottom">0.22%
<hr></hr>
</td>
<td align="center" valign="bottom">107,094
<hr></hr>
</td>
<td align="center" valign="bottom">0.44%
<hr></hr>
</td>
</tr>
<tr>
<td align="center">Poly(A)</td>
<td align="center">6,110</td>
<td align="center">0.03%</td>
<td align="center">3,583</td>
<td align="center">0.01%</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap position="float" id="T2">
<label>Table 2</label>
<caption>
<p>Distribution of small RNAs among different categories (perfect and imperfect flower buds)</p>
</caption>
<table frame="hsides" rules="groups" border="1">
<colgroup>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
</colgroup>
<thead valign="top">
<tr>
<th rowspan="2" align="center">
<bold>Category</bold>
</th>
<th colspan="2" align="center" valign="bottom">
<bold>Perfec0074</bold>
<hr></hr>
</th>
<th colspan="2" align="center" valign="bottom">
<bold>Imperfect</bold>
<hr></hr>
</th>
</tr>
<tr>
<th align="center">
<bold>Unique reads</bold>
</th>
<th align="center">
<bold>Redundant reads</bold>
</th>
<th align="center">
<bold>Unique reads</bold>
</th>
<th align="center">
<bold>Redundant reads</bold>
</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center" valign="bottom">Total
<hr></hr>
</td>
<td align="center" valign="bottom">6,317,546 (100%)
<hr></hr>
</td>
<td align="center" valign="bottom">21,985,053 (100%)
<hr></hr>
</td>
<td align="center" valign="bottom">6,002,602 (100%)
<hr></hr>
</td>
<td align="center" valign="bottom">24,239,332 (100%)
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">rRNA
<hr></hr>
</td>
<td align="center" valign="bottom">55,021 (0.87%)
<hr></hr>
</td>
<td align="center" valign="bottom">1,990,779 (9.06%)
<hr></hr>
</td>
<td align="center" valign="bottom">63,243 (1.05%)
<hr></hr>
</td>
<td align="center" valign="bottom">2,844,574 (11.74%)
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">snRNA
<hr></hr>
</td>
<td align="center" valign="bottom">4,443 (0.07%)
<hr></hr>
</td>
<td align="center" valign="bottom">31,490 (0.14%)
<hr></hr>
</td>
<td align="center" valign="bottom">5,145 (0.09%)
<hr></hr>
</td>
<td align="center" valign="bottom">40,170 (0.17%)
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">snoRNA
<hr></hr>
</td>
<td align="center" valign="bottom">1,376 (0.02%)
<hr></hr>
</td>
<td align="center" valign="bottom">6,672 (0.03%)
<hr></hr>
</td>
<td align="center" valign="bottom">1,445 (0.02%)
<hr></hr>
</td>
<td align="center" valign="bottom">7,517 (0.03%)
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">tRNA
<hr></hr>
</td>
<td align="center" valign="bottom">10,502 (0.17%)
<hr></hr>
</td>
<td align="center" valign="bottom">364,461 (1.66%)
<hr></hr>
</td>
<td align="center" valign="bottom">11,885 (0.20%)
<hr></hr>
</td>
<td align="center" valign="bottom">698,413 (2.88%)
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miRNA
<hr></hr>
</td>
<td align="center" valign="bottom">26,734 (0.42%)
<hr></hr>
</td>
<td align="center" valign="bottom">2,479,659 (11.28%)
<hr></hr>
</td>
<td align="center" valign="bottom">30,931 (0.52%)
<hr></hr>
</td>
<td align="center" valign="bottom">2,649,934 (10.93%)
<hr></hr>
</td>
</tr>
<tr>
<td align="center">Unannotated</td>
<td align="center">6,219,470 (98.45%)</td>
<td align="center">17,111,992 (77.83%)</td>
<td align="center">5,889,953 (98.12%)</td>
<td align="center">17,998,724 (74.25%)</td>
</tr>
</tbody>
</table>
</table-wrap>
<fig id="F2" position="float">
<label>Figure 2</label>
<caption>
<p>
<bold>Summary of common and specific sequences between perfect and imperfect libraries.</bold>
(
<bold>A</bold>
)Total sRNAs and (
<bold>B</bold>
)Unique sRNAs.</p>
</caption>
<graphic xlink:href="1471-2164-13-371-2"></graphic>
</fig>
<table-wrap position="float" id="T3">
<label>Table 3</label>
<caption>
<p>Small RNA sequences and mean frequencies in both perfect and imperfect libraries</p>
</caption>
<table frame="hsides" rules="groups" border="1">
<colgroup>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
</colgroup>
<thead valign="top">
<tr>
<th align="center">
<bold>Class</bold>
</th>
<th align="center">
<bold>Unique sRNAs</bold>
</th>
<th align="center">
<bold>Total sRNAs</bold>
</th>
<th align="center">
<bold>Mean frequency</bold>
</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center" valign="bottom">Total sRNAs
<hr></hr>
</td>
<td align="center" valign="bottom">10590449
<hr></hr>
</td>
<td align="center" valign="bottom">46224385
<hr></hr>
</td>
<td align="center" valign="bottom">4.36
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">Perfect and imperfect common
<hr></hr>
</td>
<td align="center" valign="bottom">1729699
<hr></hr>
</td>
<td align="center" valign="bottom">35758031
<hr></hr>
</td>
<td align="center" valign="bottom">20.67
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">Perfect specific
<hr></hr>
</td>
<td align="center" valign="bottom">4587847
<hr></hr>
</td>
<td align="center" valign="bottom">5437697
<hr></hr>
</td>
<td align="center" valign="bottom">1.19
<hr></hr>
</td>
</tr>
<tr>
<td align="center">Imperfect specific</td>
<td align="center">4272903</td>
<td align="center">5028657</td>
<td align="center">1.18</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec>
<title>Identification of known miRNAs and evolutionary conservation</title>
<p>To identify the known miRNAs, the sRNA library was BLASTN searched for known mature plant miRNAs in miRBase 17.0 (April 2011). Following the BLASTN searches and further sequence analysis, 61 unique sequences, belonging to 24 families, in the perfect and imperfect libraries were found to be orthologues of known miRNAs from other plant species, which had previously been deposited in the miRBase database (Table
<xref ref-type="table" rid="T4">4</xref>
).</p>
<table-wrap position="float" id="T4">
<label>Table 4</label>
<caption>
<p>Known miRNAs in perfect and imperfect libraries</p>
</caption>
<table frame="hsides" rules="groups" border="1">
<colgroup>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
</colgroup>
<thead valign="top">
<tr>
<th rowspan="2" align="center">
<bold>Family</bold>
</th>
<th rowspan="2" align="center">
<bold>miRNA name</bold>
</th>
<th colspan="2" align="center" valign="bottom">
<bold>Perfect</bold>
<hr></hr>
</th>
<th colspan="2" align="center" valign="bottom">
<bold>Imperfect</bold>
<hr></hr>
</th>
</tr>
<tr>
<th align="center">
<bold>Counts</bold>
</th>
<th align="center">
<bold>Normalised</bold>
</th>
<th align="center">
<bold>Counts</bold>
</th>
<th align="center">
<bold>Normalised</bold>
</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center" valign="bottom">MIR156
<hr></hr>
</td>
<td align="center" valign="bottom">miR156a
<hr></hr>
</td>
<td align="center" valign="bottom">45352
<hr></hr>
</td>
<td align="center" valign="bottom">2062.86
<hr></hr>
</td>
<td align="center" valign="bottom">61361
<hr></hr>
</td>
<td align="center" valign="bottom">2531.46
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR156b
<hr></hr>
</td>
<td align="center" valign="bottom">26572
<hr></hr>
</td>
<td align="center" valign="bottom">1208.64
<hr></hr>
</td>
<td align="center" valign="bottom">29886
<hr></hr>
</td>
<td align="center" valign="bottom">1232.95
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR156c
<hr></hr>
</td>
<td align="center" valign="bottom">145205
<hr></hr>
</td>
<td align="center" valign="bottom">6604.71
<hr></hr>
</td>
<td align="center" valign="bottom">210543
<hr></hr>
</td>
<td align="center" valign="bottom">8686.01
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR156f
<hr></hr>
</td>
<td align="center" valign="bottom">118
<hr></hr>
</td>
<td align="center" valign="bottom">5.37
<hr></hr>
</td>
<td align="center" valign="bottom">188
<hr></hr>
</td>
<td align="center" valign="bottom">7.76
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR156h
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
<td align="center" valign="bottom">4
<hr></hr>
</td>
<td align="center" valign="bottom">0.17
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR156k
<hr></hr>
</td>
<td align="center" valign="bottom">25
<hr></hr>
</td>
<td align="center" valign="bottom">1.14
<hr></hr>
</td>
<td align="center" valign="bottom">46
<hr></hr>
</td>
<td align="center" valign="bottom">1.90
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR157a
<hr></hr>
</td>
<td align="center" valign="bottom">735314
<hr></hr>
</td>
<td align="center" valign="bottom">33446.09
<hr></hr>
</td>
<td align="center" valign="bottom">658343
<hr></hr>
</td>
<td align="center" valign="bottom">27160.11
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR157d
<hr></hr>
</td>
<td align="center" valign="bottom">8866
<hr></hr>
</td>
<td align="center" valign="bottom">403.27
<hr></hr>
</td>
<td align="center" valign="bottom">8738
<hr></hr>
</td>
<td align="center" valign="bottom">360.49
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR159
<hr></hr>
</td>
<td align="center" valign="bottom">miR159a
<hr></hr>
</td>
<td align="center" valign="bottom">18682
<hr></hr>
</td>
<td align="center" valign="bottom">849.76
<hr></hr>
</td>
<td align="center" valign="bottom">38726
<hr></hr>
</td>
<td align="center" valign="bottom">1597.65
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR319
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">0.96
<hr></hr>
</td>
<td align="center" valign="bottom">171
<hr></hr>
</td>
<td align="center" valign="bottom">7.05
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR319a
<hr></hr>
</td>
<td align="center" valign="bottom">121
<hr></hr>
</td>
<td align="center" valign="bottom">5.50
<hr></hr>
</td>
<td align="center" valign="bottom">1172
<hr></hr>
</td>
<td align="center" valign="bottom">48.35
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR319c
<hr></hr>
</td>
<td align="center" valign="bottom">6
<hr></hr>
</td>
<td align="center" valign="bottom">0.27
<hr></hr>
</td>
<td align="center" valign="bottom">7
<hr></hr>
</td>
<td align="center" valign="bottom">0.29
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR319e
<hr></hr>
</td>
<td align="center" valign="bottom">1
<hr></hr>
</td>
<td align="center" valign="bottom">0.05
<hr></hr>
</td>
<td align="center" valign="bottom">40
<hr></hr>
</td>
<td align="center" valign="bottom">1.65
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR319g
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
<td align="center" valign="bottom">5
<hr></hr>
</td>
<td align="center" valign="bottom">0.21
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR160
<hr></hr>
</td>
<td align="center" valign="bottom">miR160a
<hr></hr>
</td>
<td align="center" valign="bottom">110
<hr></hr>
</td>
<td align="center" valign="bottom">5.00
<hr></hr>
</td>
<td align="center" valign="bottom">808
<hr></hr>
</td>
<td align="center" valign="bottom">33.33
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR162
<hr></hr>
</td>
<td align="center" valign="bottom">miR162
<hr></hr>
</td>
<td align="center" valign="bottom">1
<hr></hr>
</td>
<td align="center" valign="bottom">0.05
<hr></hr>
</td>
<td align="center" valign="bottom">4
<hr></hr>
</td>
<td align="center" valign="bottom">0.17
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR162a
<hr></hr>
</td>
<td align="center" valign="bottom">718
<hr></hr>
</td>
<td align="center" valign="bottom">32.66
<hr></hr>
</td>
<td align="center" valign="bottom">617
<hr></hr>
</td>
<td align="center" valign="bottom">25.45
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR164
<hr></hr>
</td>
<td align="center" valign="bottom">miR164a
<hr></hr>
</td>
<td align="center" valign="bottom">6256
<hr></hr>
</td>
<td align="center" valign="bottom">284.56
<hr></hr>
</td>
<td align="center" valign="bottom">4134
<hr></hr>
</td>
<td align="center" valign="bottom">170.55
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR164f
<hr></hr>
</td>
<td align="center" valign="bottom">63
<hr></hr>
</td>
<td align="center" valign="bottom">2.87
<hr></hr>
</td>
<td align="center" valign="bottom">52
<hr></hr>
</td>
<td align="center" valign="bottom">2.15
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR166
<hr></hr>
</td>
<td align="center" valign="bottom">miR166
<hr></hr>
</td>
<td align="center" valign="bottom">60
<hr></hr>
</td>
<td align="center" valign="bottom">2.73
<hr></hr>
</td>
<td align="center" valign="bottom">85
<hr></hr>
</td>
<td align="center" valign="bottom">3.51
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR166a
<hr></hr>
</td>
<td align="center" valign="bottom">222689
<hr></hr>
</td>
<td align="center" valign="bottom">10129.11
<hr></hr>
</td>
<td align="center" valign="bottom">281639
<hr></hr>
</td>
<td align="center" valign="bottom">11619.09
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR166h
<hr></hr>
</td>
<td align="center" valign="bottom">1369
<hr></hr>
</td>
<td align="center" valign="bottom">62.27
<hr></hr>
</td>
<td align="center" valign="bottom">2013
<hr></hr>
</td>
<td align="center" valign="bottom">83.05
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR167
<hr></hr>
</td>
<td align="center" valign="bottom">miR167-3p
<hr></hr>
</td>
<td align="center" valign="bottom">810
<hr></hr>
</td>
<td align="center" valign="bottom">36.84
<hr></hr>
</td>
<td align="center" valign="bottom">691
<hr></hr>
</td>
<td align="center" valign="bottom">28.51
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR167a
<hr></hr>
</td>
<td align="center" valign="bottom">151440
<hr></hr>
</td>
<td align="center" valign="bottom">6888.32
<hr></hr>
</td>
<td align="center" valign="bottom">127360
<hr></hr>
</td>
<td align="center" valign="bottom">5254.27
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR167d
<hr></hr>
</td>
<td align="center" valign="bottom">52161
<hr></hr>
</td>
<td align="center" valign="bottom">2372.57
<hr></hr>
</td>
<td align="center" valign="bottom">45113
<hr></hr>
</td>
<td align="center" valign="bottom">1861.15
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR167f
<hr></hr>
</td>
<td align="center" valign="bottom">61643
<hr></hr>
</td>
<td align="center" valign="bottom">2803.86
<hr></hr>
</td>
<td align="center" valign="bottom">44482
<hr></hr>
</td>
<td align="center" valign="bottom">1835.12
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR168
<hr></hr>
</td>
<td align="center" valign="bottom">miR168a
<hr></hr>
</td>
<td align="center" valign="bottom">64099
<hr></hr>
</td>
<td align="center" valign="bottom">2915.57
<hr></hr>
</td>
<td align="center" valign="bottom">82261
<hr></hr>
</td>
<td align="center" valign="bottom">3393.70
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR169
<hr></hr>
</td>
<td align="center" valign="bottom">miR169b
<hr></hr>
</td>
<td align="center" valign="bottom">510
<hr></hr>
</td>
<td align="center" valign="bottom">23.20
<hr></hr>
</td>
<td align="center" valign="bottom">538
<hr></hr>
</td>
<td align="center" valign="bottom">22.20
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR169e
<hr></hr>
</td>
<td align="center" valign="bottom">10
<hr></hr>
</td>
<td align="center" valign="bottom">0.45
<hr></hr>
</td>
<td align="center" valign="bottom">6
<hr></hr>
</td>
<td align="center" valign="bottom">0.25
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR169g
<hr></hr>
</td>
<td align="center" valign="bottom">11
<hr></hr>
</td>
<td align="center" valign="bottom">0.50
<hr></hr>
</td>
<td align="center" valign="bottom">1
<hr></hr>
</td>
<td align="center" valign="bottom">0.04
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR169h
<hr></hr>
</td>
<td align="center" valign="bottom">18
<hr></hr>
</td>
<td align="center" valign="bottom">0.82
<hr></hr>
</td>
<td align="center" valign="bottom">10
<hr></hr>
</td>
<td align="center" valign="bottom">0.41
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR171
<hr></hr>
</td>
<td align="center" valign="bottom">miR171
<hr></hr>
</td>
<td align="center" valign="bottom">483
<hr></hr>
</td>
<td align="center" valign="bottom">21.97
<hr></hr>
</td>
<td align="center" valign="bottom">630
<hr></hr>
</td>
<td align="center" valign="bottom">25.99
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR171b
<hr></hr>
</td>
<td align="center" valign="bottom">1578
<hr></hr>
</td>
<td align="center" valign="bottom">71.78
<hr></hr>
</td>
<td align="center" valign="bottom">1994
<hr></hr>
</td>
<td align="center" valign="bottom">82.26
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR171d
<hr></hr>
</td>
<td align="center" valign="bottom">1
<hr></hr>
</td>
<td align="center" valign="bottom">0.05
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR171f
<hr></hr>
</td>
<td align="center" valign="bottom">13
<hr></hr>
</td>
<td align="center" valign="bottom">0.59
<hr></hr>
</td>
<td align="center" valign="bottom">15
<hr></hr>
</td>
<td align="center" valign="bottom">0.62
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR171b-3p
<hr></hr>
</td>
<td align="center" valign="bottom">2195
<hr></hr>
</td>
<td align="center" valign="bottom">99.84
<hr></hr>
</td>
<td align="center" valign="bottom">2831
<hr></hr>
</td>
<td align="center" valign="bottom">116.79
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR171l
<hr></hr>
</td>
<td align="center" valign="bottom">4
<hr></hr>
</td>
<td align="center" valign="bottom">0.18
<hr></hr>
</td>
<td align="center" valign="bottom">9
<hr></hr>
</td>
<td align="center" valign="bottom">0.37
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR172
<hr></hr>
</td>
<td align="center" valign="bottom">miR172a
<hr></hr>
</td>
<td align="center" valign="bottom">13173
<hr></hr>
</td>
<td align="center" valign="bottom">599.18
<hr></hr>
</td>
<td align="center" valign="bottom">10393
<hr></hr>
</td>
<td align="center" valign="bottom">428.77
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR172b
<hr></hr>
</td>
<td align="center" valign="bottom">5
<hr></hr>
</td>
<td align="center" valign="bottom">0.23
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR172e
<hr></hr>
</td>
<td align="center" valign="bottom">181
<hr></hr>
</td>
<td align="center" valign="bottom">8.23
<hr></hr>
</td>
<td align="center" valign="bottom">181
<hr></hr>
</td>
<td align="center" valign="bottom">7.47
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR172g
<hr></hr>
</td>
<td align="center" valign="bottom">123
<hr></hr>
</td>
<td align="center" valign="bottom">5.59
<hr></hr>
</td>
<td align="center" valign="bottom">102
<hr></hr>
</td>
<td align="center" valign="bottom">4.21
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR2111
<hr></hr>
</td>
<td align="center" valign="bottom">miR2111a
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
<td align="center" valign="bottom">5
<hr></hr>
</td>
<td align="center" valign="bottom">0.21
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR390
<hr></hr>
</td>
<td align="center" valign="bottom">miR390a
<hr></hr>
</td>
<td align="center" valign="bottom">18872
<hr></hr>
</td>
<td align="center" valign="bottom">858.40
<hr></hr>
</td>
<td align="center" valign="bottom">32445
<hr></hr>
</td>
<td align="center" valign="bottom">1338.53
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR390a-3p
<hr></hr>
</td>
<td align="center" valign="bottom">602
<hr></hr>
</td>
<td align="center" valign="bottom">27.38
<hr></hr>
</td>
<td align="center" valign="bottom">1207
<hr></hr>
</td>
<td align="center" valign="bottom">49.80
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR393
<hr></hr>
</td>
<td align="center" valign="bottom">miR393
<hr></hr>
</td>
<td align="center" valign="bottom">221
<hr></hr>
</td>
<td align="center" valign="bottom">10.05
<hr></hr>
</td>
<td align="center" valign="bottom">603
<hr></hr>
</td>
<td align="center" valign="bottom">24.88
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR393a
<hr></hr>
</td>
<td align="center" valign="bottom">2
<hr></hr>
</td>
<td align="center" valign="bottom">0.09
<hr></hr>
</td>
<td align="center" valign="bottom">77
<hr></hr>
</td>
<td align="center" valign="bottom">3.18
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR393b
<hr></hr>
</td>
<td align="center" valign="bottom">4
<hr></hr>
</td>
<td align="center" valign="bottom">0.18
<hr></hr>
</td>
<td align="center" valign="bottom">3
<hr></hr>
</td>
<td align="center" valign="bottom">0.12
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR394
<hr></hr>
</td>
<td align="center" valign="bottom">miR394a
<hr></hr>
</td>
<td align="center" valign="bottom">24
<hr></hr>
</td>
<td align="center" valign="bottom">1.09
<hr></hr>
</td>
<td align="center" valign="bottom">301
<hr></hr>
</td>
<td align="center" valign="bottom">12.42
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR395
<hr></hr>
</td>
<td align="center" valign="bottom">miR395a
<hr></hr>
</td>
<td align="center" valign="bottom">14
<hr></hr>
</td>
<td align="center" valign="bottom">0.64
<hr></hr>
</td>
<td align="center" valign="bottom">94
<hr></hr>
</td>
<td align="center" valign="bottom">3.88
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR395b
<hr></hr>
</td>
<td align="center" valign="bottom">1
<hr></hr>
</td>
<td align="center" valign="bottom">0.05
<hr></hr>
</td>
<td align="center" valign="bottom">2
<hr></hr>
</td>
<td align="center" valign="bottom">0.08
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR396
<hr></hr>
</td>
<td align="center" valign="bottom">miR396a
<hr></hr>
</td>
<td align="center" valign="bottom">2046
<hr></hr>
</td>
<td align="center" valign="bottom">93.06
<hr></hr>
</td>
<td align="center" valign="bottom">3149
<hr></hr>
</td>
<td align="center" valign="bottom">129.91
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR396b
<hr></hr>
</td>
<td align="center" valign="bottom">869
<hr></hr>
</td>
<td align="center" valign="bottom">39.53
<hr></hr>
</td>
<td align="center" valign="bottom">1194
<hr></hr>
</td>
<td align="center" valign="bottom">49.26
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR398
<hr></hr>
</td>
<td align="center" valign="bottom">miR398
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
<td align="center" valign="bottom">1
<hr></hr>
</td>
<td align="center" valign="bottom">0.04
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR398a
<hr></hr>
</td>
<td align="center" valign="bottom">13
<hr></hr>
</td>
<td align="center" valign="bottom">0.59
<hr></hr>
</td>
<td align="center" valign="bottom">16
<hr></hr>
</td>
<td align="center" valign="bottom">0.66
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR398b
<hr></hr>
</td>
<td align="center" valign="bottom">7
<hr></hr>
</td>
<td align="center" valign="bottom">0.32
<hr></hr>
</td>
<td align="center" valign="bottom">12
<hr></hr>
</td>
<td align="center" valign="bottom">0.50
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR399
<hr></hr>
</td>
<td align="center" valign="bottom">miR399a
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
<td align="center" valign="bottom">7
<hr></hr>
</td>
<td align="center" valign="bottom">0.29
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR399f
<hr></hr>
</td>
<td align="center" valign="bottom">29
<hr></hr>
</td>
<td align="center" valign="bottom">1.32
<hr></hr>
</td>
<td align="center" valign="bottom">45
<hr></hr>
</td>
<td align="center" valign="bottom">1.86
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR403
<hr></hr>
</td>
<td align="center" valign="bottom">miR403
<hr></hr>
</td>
<td align="center" valign="bottom">325
<hr></hr>
</td>
<td align="center" valign="bottom">14.78
<hr></hr>
</td>
<td align="center" valign="bottom">510
<hr></hr>
</td>
<td align="center" valign="bottom">21.04
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR408
<hr></hr>
</td>
<td align="center" valign="bottom">miR408
<hr></hr>
</td>
<td align="center" valign="bottom">19
<hr></hr>
</td>
<td align="center" valign="bottom">0.86
<hr></hr>
</td>
<td align="center" valign="bottom">14
<hr></hr>
</td>
<td align="center" valign="bottom">0.58
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR535
<hr></hr>
</td>
<td align="center" valign="bottom">miR535a
<hr></hr>
</td>
<td align="center" valign="bottom">9743
<hr></hr>
</td>
<td align="center" valign="bottom">443.16
<hr></hr>
</td>
<td align="center" valign="bottom">12158
<hr></hr>
</td>
<td align="center" valign="bottom">501.58
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR827
<hr></hr>
</td>
<td align="center" valign="bottom">miR827a
<hr></hr>
</td>
<td align="center" valign="bottom">22512
<hr></hr>
</td>
<td align="center" valign="bottom">1023.97
<hr></hr>
</td>
<td align="center" valign="bottom">21786
<hr></hr>
</td>
<td align="center" valign="bottom">898.79
<hr></hr>
</td>
</tr>
<tr>
<td align="center">MIR828</td>
<td align="center">miR828a</td>
<td align="center">48</td>
<td align="center">2.18</td>
<td align="center">48</td>
<td align="center">1.98</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>The number of members in differently-conserved miRNA families was analysed (Figure
<xref ref-type="fig" rid="F3">3</xref>
). A majority of the 24 miRNA families contained several members, and three families (miR156, miR159 and miR171) possessed multiple members, with 8, 6 and 5 members, respectively. Nine miRNA families, namely miR160, miR168, miR394, miR403, miR408, miR535, miR827, miR828 and mir2111, had only one member.</p>
<fig id="F3" position="float">
<label>Figure 3</label>
<caption>
<p>Member numbers of identified miRNAs in each conserved miRNA family in Japanese apricot.</p>
</caption>
<graphic xlink:href="1471-2164-13-371-3"></graphic>
</fig>
<p>The counts of reads for known miRNA families were also analysed, and it was found they indicated large divergences in expression frequency among these miRNAs. The number of reads for conserved miRNAs sequenced from the same, or different, miRNA families also varied drastically, with miR156, miR166 and miR167 represented most frequently in the two libraries. Of these, miR156 was represented the most frequently, with 961,452 and 969,109 copies in the perfect and imperfect libraries, respectively. miR156, miR169, miR827 and miR828 were moderately abundant in the two libraries, while miR2111 was absent from the perfect library. It appeared, therefore, that the miRNA population present in the perfect library differed from that present in the imperfect library to some extent (Figure
<xref ref-type="fig" rid="F4">4</xref>
).</p>
<fig id="F4" position="float">
<label>Figure 4</label>
<caption>
<p>Counts of identified miRNAs in each conserved miRNA family in Japanese apricot.</p>
</caption>
<graphic xlink:href="1471-2164-13-371-4"></graphic>
</fig>
<p>To investigate the evolutionary roles of these known miRNAs, extensive comparisons were performed against known miRNAs in other plant species, including
<italic>Physcomitrella, Selaginella, Picea, Pinus, Arabidopsis, Brassica, Ricinus, Glycine, Medicago, Gossypium, Solanum, Aquilegia, Citrus, Populus, Vitis, Oryza, Sorghum</italic>
and
<italic>Zea</italic>
(Figure
<xref ref-type="fig" rid="F5">5</xref>
). Among the miRNA sequences obtained from Japanese apricot, members in five of families (miR403, miR535, miR827, miR828 and miR2111) showed a lack of conservation of sequence identity compared to orthologues from 18 other plant species. Generally, Japanese apricot miRNAs had corresponding homologues in at least two plant species. Japanese apricot,
<italic>Arabidopsis</italic>
and
<italic>Vitis vinifera</italic>
shared 23 conserved miRNA families. Twelve (miR156, miR159, miR160, miR166, miR167, miR171, miR390, miR395, miR396, miR398, miR408 and miR535) out of 24 families had orthologues in Coniferophyta and Embryophyta, indicating that these 12 Japanese apricot miRNA families are ancient. Twelve (miR162, miR164, miR168, miR169, miR172, miR393, miR394, miR399, miR403, miR827, miR828 and miR2111) out of 24 families only had homologues in angiosperm, indicating that these 12 Japanese apricot miRNA families are recent. In addition, miR403, miR828 and miR2111 only had homologues in eudicotyledons, suggesting that these miRNAs are probably involved in the regulation of specific development, such as the development of embryos and cotyledons.</p>
<fig id="F5" position="float">
<label>Figure 5</label>
<caption>
<p>
<bold>Known miRNAs from Japanese apricot, designated as</bold>
<bold>
<italic>pmu</italic>
</bold>
<bold>on the first column, and their homologs in other plant species.</bold>
</p>
</caption>
<graphic xlink:href="1471-2164-13-371-5"></graphic>
</fig>
</sec>
<sec>
<title>Identification of potentially novel miRNAs/new members of known miRNA families and nucleotide bias</title>
<p>The Mireap prediction software developed by the Beijing Genomics Institute (Shenzhen, China) was used to identify potentially novel miRNAs and new members of known miRNA families by exploring the secondary structure based upon a trans-species alignment of apricot small RNA data against the peach (
<italic>Prunus persica</italic>
) genome. After removal of the conserved miRNAs, sequences were aligned with the peach genome sequence. A total of 405 and 423 miRNA candidates were obtained from the perfect and imperfect flower bud libraries, respectively. The prediction of potentially novel miRNA/new members of known miRNA families candidates was summarised, including the base bias on the first position among small RNA candidates of certain lengths. Based on this summary, prediction accuracy could be assessed according to the base bias of known miRNAs. The majority of these novel miRNA candidates had lengths of 21 and 22 nt, and started with a 5′ U (Figure
<xref ref-type="fig" rid="F6">6</xref>
A and B).</p>
<fig id="F6" position="float">
<label>Figure 6</label>
<caption>
<p>
<bold>Novel miRNA candidates first nucleotide bias in Japanese apricot.</bold>
(
<bold>A</bold>
) Perfect library and (
<bold>B</bold>
) Imperfect library.</p>
</caption>
<graphic xlink:href="1471-2164-13-371-6"></graphic>
</fig>
<p>Among the miRNA candidates, 61 were identified with complementary miRNA*s (fold-back structures in Additional files
<xref ref-type="supplementary-material" rid="S1">1</xref>
and
<xref ref-type="supplementary-material" rid="S2">2</xref>
), indicating that these candidate miRNAs were most likely new in Japanese apricot, and several potentially novel ones may be unique to Japanese apricot or
<italic>Prunus</italic>
plants. The counts of several miRNA*s of these potentially novel miRNAs were low (Table
<xref ref-type="table" rid="T5">5</xref>
). Nevertheless, no requirement for counts of miRNA*s was given in the most recent criteria for the annotation of plant miRNAs [
<xref ref-type="bibr" rid="B42">42</xref>
]. Therefore, these miRNAs were still considered to be potentially new. Candidate miRNAs with only one miRNA* have been identified as new miRNAs in rice and leguminous plants. The minimum free energy (MFE) for the hairpin structures of miRNA precursors was lower than −18 kcal/mol, and the length of new miRNA precursors ranged from 74 nt to 377 nt (Table
<xref ref-type="table" rid="T5">5</xref>
).</p>
<table-wrap position="float" id="T5">
<label>Table 5</label>
<caption>
<p>Novel miRNAs/new members of known miRNA families in perfect and imperfect libraries</p>
</caption>
<table frame="hsides" rules="groups" border="1">
<colgroup>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
</colgroup>
<thead valign="top">
<tr>
<th align="center">
<bold>miRNA</bold>
</th>
<th align="center">
<bold>Length of mature(nt)</bold>
</th>
<th align="center">
<bold>Sequence(5′–3′)</bold>
</th>
<th align="center">
<bold>Counts of miRNAs/miRNA*s</bold>
</th>
<th align="center">
<bold>Location</bold>
</th>
<th align="center">
<bold>Length of precursors(nt)</bold>
</th>
<th align="center">
<bold>Arm</bold>
</th>
<th align="center">
<bold>MFE (kcal/mol)</bold>
</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center" valign="bottom">miR6257
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TCTTAACTGTTGGATTAGGCT
<hr></hr>
</td>
<td align="center" valign="bottom">22/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_10:708566:708677:−
<hr></hr>
</td>
<td align="center" valign="bottom">112
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−26.7
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6258
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TTCCAGCTGTAAAGATCAAGA
<hr></hr>
</td>
<td align="center" valign="bottom">5/5
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:230373:230544:+
<hr></hr>
</td>
<td align="center" valign="bottom">172
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−88.7
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6259
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TAGAAAAATACGGGCGATAAA
<hr></hr>
</td>
<td align="center" valign="bottom">6/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:37406755:37406880:+
<hr></hr>
</td>
<td align="center" valign="bottom">126
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−53.6
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6260
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TGGAGTGAGAGAATGGGAGGT
<hr></hr>
</td>
<td align="center" valign="bottom">14/2
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:40569695:40569796:+
<hr></hr>
</td>
<td align="center" valign="bottom">102
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−50.4
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6261
<hr></hr>
</td>
<td align="center" valign="bottom">22
<hr></hr>
</td>
<td align="center" valign="bottom">AAGTGATTATATGGAGAAGCAC
<hr></hr>
</td>
<td align="center" valign="bottom">13/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:46392103:46392176:+
<hr></hr>
</td>
<td align="center" valign="bottom">74
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−26.5
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6262
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TCTTTAGAAAGTTAGAATTGT
<hr></hr>
</td>
<td align="center" valign="bottom">5/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:23904565:23904750:−
<hr></hr>
</td>
<td align="center" valign="bottom">186
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−67
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6263
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">AAGTGGACAAAAGGGGAGTGG
<hr></hr>
</td>
<td align="center" valign="bottom">16/2
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_2:16774627:16774733:+
<hr></hr>
</td>
<td align="center" valign="bottom">107
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−24.9
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6264
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">ATGCCTATGGACACGTGTCAA
<hr></hr>
</td>
<td align="center" valign="bottom">6/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_2:10473541:10473644:−
<hr></hr>
</td>
<td align="center" valign="bottom">104
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−56.02
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6265
<hr></hr>
</td>
<td align="center" valign="bottom">23
<hr></hr>
</td>
<td align="center" valign="bottom">TTGAACTTTGACCCGATTCGCAT
<hr></hr>
</td>
<td align="center" valign="bottom">15/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_3:13798983:13799084:+
<hr></hr>
</td>
<td align="center" valign="bottom">102
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−36.77
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6266a
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TAAATGCAGGGGCAAAATGAT
<hr></hr>
</td>
<td align="center" valign="bottom">149/4
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:6953607:6953883:+
<hr></hr>
</td>
<td align="center" valign="bottom">277
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−69.81
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6266b
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TAAATGCAGGGGCAAAATGAT
<hr></hr>
</td>
<td align="center" valign="bottom">109/2
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:8221370:8221603:+
<hr></hr>
</td>
<td align="center" valign="bottom">234
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−60.63
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6266c
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TAAATGCAGGGGCAAAATGAT
<hr></hr>
</td>
<td align="center" valign="bottom">106/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_7:12665062:12665327:−
<hr></hr>
</td>
<td align="center" valign="bottom">266
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−59.43
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6267a
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TAGAGAGGTGGTACAATTGTG
<hr></hr>
</td>
<td align="center" valign="bottom">45/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:9720663:9720766:+
<hr></hr>
</td>
<td align="center" valign="bottom">104
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−69.6
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6267b
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">ATTAGAGAGGCGGTAAACAAT
<hr></hr>
</td>
<td align="center" valign="bottom">5/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:13686619:13686731:−
<hr></hr>
</td>
<td align="center" valign="bottom">113
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−35.9
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6268
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TGAGGAGATGGAGAGTAGATA
<hr></hr>
</td>
<td align="center" valign="bottom">244/3
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:16645739:16645874:+
<hr></hr>
</td>
<td align="center" valign="bottom">136
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−77.7
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6269
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TGTGAATAGTGATTGCCATGG
<hr></hr>
</td>
<td align="center" valign="bottom">18/5
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:20136895:20136989:+
<hr></hr>
</td>
<td align="center" valign="bottom">95
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−36.7
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6270
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TTCTGGTATTGGAATTTCATT
<hr></hr>
</td>
<td align="center" valign="bottom">259/26
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:30105651:30106027:+
<hr></hr>
</td>
<td align="center" valign="bottom">377
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−117.7
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6271
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TCAAGATTGAGAGATATAATG
<hr></hr>
</td>
<td align="center" valign="bottom">24/3
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:8916468:8916590:−
<hr></hr>
</td>
<td align="center" valign="bottom">123
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−34.3
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6272
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TAGCTGTAAATGAGTGTTTTT
<hr></hr>
</td>
<td align="center" valign="bottom">5/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:19289821:19289925:−
<hr></hr>
</td>
<td align="center" valign="bottom">105
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−25.8
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6273
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">AATGCAGCATGATTTTTTTTT
<hr></hr>
</td>
<td align="center" valign="bottom">81/63
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_5:3421010:3421132:+
<hr></hr>
</td>
<td align="center" valign="bottom">123
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−42.2
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6274
<hr></hr>
</td>
<td align="center" valign="bottom">23
<hr></hr>
</td>
<td align="center" valign="bottom">TATTTTGCTATCTTCGGGCAATA
<hr></hr>
</td>
<td align="center" valign="bottom">15/2
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_5:3414706:3414834:−
<hr></hr>
</td>
<td align="center" valign="bottom">129
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−35.8
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6275
<hr></hr>
</td>
<td align="center" valign="bottom">22
<hr></hr>
</td>
<td align="center" valign="bottom">AGTGGAAGTAGCAAGGGGAAGC
<hr></hr>
</td>
<td align="center" valign="bottom">14/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_5:10005396:10005502:−
<hr></hr>
</td>
<td align="center" valign="bottom">107
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−67.6
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6276
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">AAAGGCTCATACAAATATTCC
<hr></hr>
</td>
<td align="center" valign="bottom">14/3
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_6:8093383:8093491:−
<hr></hr>
</td>
<td align="center" valign="bottom">109
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−21.7
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6277
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TGTGTGTGGAAAGAGCGAGAC
<hr></hr>
</td>
<td align="center" valign="bottom">1661/5
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_6:28212589:28212684:−
<hr></hr>
</td>
<td align="center" valign="bottom">96
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−47.16
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6278
<hr></hr>
</td>
<td align="center" valign="bottom">22
<hr></hr>
</td>
<td align="center" valign="bottom">TGAACCTTGTGTACAAATTGGC
<hr></hr>
</td>
<td align="center" valign="bottom">16/3
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_7:7789275:7789372:+
<hr></hr>
</td>
<td align="center" valign="bottom">98
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−41.9
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6279
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TAGACAAGAATTCCAGAGACC
<hr></hr>
</td>
<td align="center" valign="bottom">9/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_7:16179849:16180001:+
<hr></hr>
</td>
<td align="center" valign="bottom">153
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−31.4
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6280
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TTGGCAGTAAGATTTTTGGTG
<hr></hr>
</td>
<td align="center" valign="bottom">15/2
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_7:8897336:8897500:−
<hr></hr>
</td>
<td align="center" valign="bottom">165
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−42.1
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6281
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">GTTAGAGATAGAGAGAGTGAG
<hr></hr>
</td>
<td align="center" valign="bottom">60/21
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_8:277682:277841:+
<hr></hr>
</td>
<td align="center" valign="bottom">160
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−86
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6282
<hr></hr>
</td>
<td align="center" valign="bottom">23
<hr></hr>
</td>
<td align="center" valign="bottom">GTTGATCGATGTGGGATGTTACA
<hr></hr>
</td>
<td align="center" valign="bottom">8/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_8:11190431:11190772:+
<hr></hr>
</td>
<td align="center" valign="bottom">342
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−93.3
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6283
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">CAAAAGGGGAGTGGGAAAATC
<hr></hr>
</td>
<td align="center" valign="bottom">33/2
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_8:19627180:19627307:+
<hr></hr>
</td>
<td align="center" valign="bottom">128
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−64.9
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6284
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TTTGGACCATGGATGAAGATT
<hr></hr>
</td>
<td align="center" valign="bottom">5128/2
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_8:20948100:20948196:+
<hr></hr>
</td>
<td align="center" valign="bottom">97
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−31.9
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6285
<hr></hr>
</td>
<td align="center" valign="bottom">22
<hr></hr>
</td>
<td align="center" valign="bottom">TAGTGAAGTTTGAATTAGGGCT
<hr></hr>
</td>
<td align="center" valign="bottom">2195/3
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_8:16684630:16684710:−
<hr></hr>
</td>
<td align="center" valign="bottom">81
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−38
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6286
<hr></hr>
</td>
<td align="center" valign="bottom">23
<hr></hr>
</td>
<td align="center" valign="bottom">TTTGAACCATTGGATCGTAGTTA
<hr></hr>
</td>
<td align="center" valign="bottom">8/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_14:309411:309508:−
<hr></hr>
</td>
<td align="center" valign="bottom">98
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−21.8
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6287
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">CAAGAAGTGGAAGTTTTGGGC
<hr></hr>
</td>
<td align="center" valign="bottom">5/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:17236128:17236204:−
<hr></hr>
</td>
<td align="center" valign="bottom">77
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−31.3
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6288
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">GAAAATGACAAGTGGCTAGTT
<hr></hr>
</td>
<td align="center" valign="bottom">27/13
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_2:18743450:18743549:+
<hr></hr>
</td>
<td align="center" valign="bottom">100
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−51.3
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6289
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TCCTTTGAATGGTTAGGCTCA
<hr></hr>
</td>
<td align="center" valign="bottom">7/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_3:4077260:4077364:−
<hr></hr>
</td>
<td align="center" valign="bottom">105
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−51.2
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6290
<hr></hr>
</td>
<td align="center" valign="bottom">23
<hr></hr>
</td>
<td align="center" valign="bottom">TGAATGAGTTCAGAGATCGTGTA
<hr></hr>
</td>
<td align="center" valign="bottom">17/12
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:28016862:28016957:+
<hr></hr>
</td>
<td align="center" valign="bottom">96
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−18.7
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6291a
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">CTTACCACATTTTTATACCAT
<hr></hr>
</td>
<td align="center" valign="bottom">67/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:8758152:8758281:−
<hr></hr>
</td>
<td align="center" valign="bottom">130
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−66.31
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6291b
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">CTTACCACATTTTTATACCAT
<hr></hr>
</td>
<td align="center" valign="bottom">67/4
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_7:5853383:5853533:+
<hr></hr>
</td>
<td align="center" valign="bottom">151
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−41.6
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6292
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TATCTTTTAATCGTTAGATCA
<hr></hr>
</td>
<td align="center" valign="bottom">18/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_4:11582347:11582421:−
<hr></hr>
</td>
<td align="center" valign="bottom">75
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−29.99
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6293
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TAAGAGGCTGATGACTAAAAC
<hr></hr>
</td>
<td align="center" valign="bottom">355/9
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_5:2922263:2922370:+
<hr></hr>
</td>
<td align="center" valign="bottom">107
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−59.8
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6294
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TGGTGTAGGCTAATCACAATC
<hr></hr>
</td>
<td align="center" valign="bottom">7/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_5:18324006:18324209:+
<hr></hr>
</td>
<td align="center" valign="bottom">204
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−89.9
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6295
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">GAGGACAGAAGATGATTCAGC
<hr></hr>
</td>
<td align="center" valign="bottom">42/10
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_6:25684504:25684833:+
<hr></hr>
</td>
<td align="center" valign="bottom">330
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−155.3
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6296
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TAAGGCCCTTAGATGAGACCC
<hr></hr>
</td>
<td align="center" valign="bottom">10/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_6:28262446:28262576:+
<hr></hr>
</td>
<td align="center" valign="bottom">131
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−56
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6297a
<hr></hr>
</td>
<td align="center" valign="bottom">23
<hr></hr>
</td>
<td align="center" valign="bottom">AATAATTTTTCGTCGCGCAAAAT
<hr></hr>
</td>
<td align="center" valign="bottom">10/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_8:6395625:6395769:+
<hr></hr>
</td>
<td align="center" valign="bottom">145
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−63.2
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR6297b
<hr></hr>
</td>
<td align="center" valign="bottom">23
<hr></hr>
</td>
<td align="center" valign="bottom">GATGTATTGTCGTCGCGCAAAGT
<hr></hr>
</td>
<td align="center" valign="bottom">11/11
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_8:2802801:2802903:−
<hr></hr>
</td>
<td align="center" valign="bottom">103
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−54.6
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR171a
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TGATTGAGCCGTGCCAATATC
<hr></hr>
</td>
<td align="center" valign="bottom">1651/29
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_3:16557250:16557364:+
<hr></hr>
</td>
<td align="center" valign="bottom">115
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−58.4
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR171c
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TGATTGAGCCGTGCCAATATC
<hr></hr>
</td>
<td align="center" valign="bottom">1586/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_3:21505898:21505996:−
<hr></hr>
</td>
<td align="center" valign="bottom">99
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−46.3
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR171e
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TTATTGAACCGGACCAATATC
<hr></hr>
</td>
<td align="center" valign="bottom">10/1
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_3:16557258:16557354:−
<hr></hr>
</td>
<td align="center" valign="bottom">97
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−39.8
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR171g
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TGATTGAGCCGTGCCAATATC
<hr></hr>
</td>
<td align="center" valign="bottom">3634/3
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_5:13607844:13607938:−
<hr></hr>
</td>
<td align="center" valign="bottom">95
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−46.5
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR171h
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">TTGAGCCGCGTCAATATCTCC
<hr></hr>
</td>
<td align="center" valign="bottom">1141/43
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_3:16525596:16525722:+
<hr></hr>
</td>
<td align="center" valign="bottom">127
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−44.32
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR319b
<hr></hr>
</td>
<td align="center" valign="bottom">22
<hr></hr>
</td>
<td align="center" valign="bottom">TAGCTGCCGAGTCATTCATCCA
<hr></hr>
</td>
<td align="center" valign="bottom">71/30
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_5:11602974:11603095:−
<hr></hr>
</td>
<td align="center" valign="bottom">122
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−49.26
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR394
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">AAGCGTTTCTTACAGAGTTTA
<hr></hr>
</td>
<td align="center" valign="bottom">130/4
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:32136105:32136248:−
<hr></hr>
</td>
<td align="center" valign="bottom">144
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−65
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR477a
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">GTTGGGGGCTCTTTTGGGACG
<hr></hr>
</td>
<td align="center" valign="bottom">161/28
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_3:9747726:9747847:−
<hr></hr>
</td>
<td align="center" valign="bottom">122
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−58.5
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR477b
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">GTTGGGGGCTCTTTTGGGACG
<hr></hr>
</td>
<td align="center" valign="bottom">161/28
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_3:9752784:9752905:−
<hr></hr>
</td>
<td align="center" valign="bottom">122
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−62.1
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR482a
<hr></hr>
</td>
<td align="center" valign="bottom">22
<hr></hr>
</td>
<td align="center" valign="bottom">TTTCCGAAACCTCCCATTCCAA
<hr></hr>
</td>
<td align="center" valign="bottom">1293/75
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:29646062:29646181:+
<hr></hr>
</td>
<td align="center" valign="bottom">120
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−47.2
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR482b
<hr></hr>
</td>
<td align="center" valign="bottom">22
<hr></hr>
</td>
<td align="center" valign="bottom">CTTCCCAAACCTCCCATTCCTA
<hr></hr>
</td>
<td align="center" valign="bottom">4677/518
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:29648520:29648655:+
<hr></hr>
</td>
<td align="center" valign="bottom">136
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−55.5
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR482c
<hr></hr>
</td>
<td align="center" valign="bottom">20
<hr></hr>
</td>
<td align="center" valign="bottom">GGAATGGGCTGTTTGGGATG
<hr></hr>
</td>
<td align="center" valign="bottom">30342/30319
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_3:10579287:10579407:+
<hr></hr>
</td>
<td align="center" valign="bottom">121
<hr></hr>
</td>
<td align="center" valign="bottom">5′
<hr></hr>
</td>
<td align="center" valign="bottom">−63.6
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR482d
<hr></hr>
</td>
<td align="center" valign="bottom">22
<hr></hr>
</td>
<td align="center" valign="bottom">CCTCCCATGCCACGCATTTCTA
<hr></hr>
</td>
<td align="center" valign="bottom">20734/3022
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_8:10608388:10608531:−
<hr></hr>
</td>
<td align="center" valign="bottom">144
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−59.3
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">miR482e
<hr></hr>
</td>
<td align="center" valign="bottom">22
<hr></hr>
</td>
<td align="center" valign="bottom">TTGCCTATTCCTCCCATGCCAA
<hr></hr>
</td>
<td align="center" valign="bottom">210/2
<hr></hr>
</td>
<td align="center" valign="bottom">scaffold_1:29646743:29646870:+
<hr></hr>
</td>
<td align="center" valign="bottom">128
<hr></hr>
</td>
<td align="center" valign="bottom">3′
<hr></hr>
</td>
<td align="center" valign="bottom">−55
<hr></hr>
</td>
</tr>
<tr>
<td align="center">miR828</td>
<td align="center">21</td>
<td align="center">TCATTTCAGCAAGCAGCGTTA</td>
<td align="center">1491/1</td>
<td align="center">scaffold_2:25971195:25971319:−</td>
<td align="center">125</td>
<td align="center">3′</td>
<td align="center">−55.9</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec>
<title>Differentially expressed miRNAs between perfect and imperfect flower bud libraries</title>
<p>Small RNAs in the perfect and imperfect libraries were enriched for lengths of 21–24 nt (Figure
<xref ref-type="fig" rid="F1">1</xref>
), a typical range for plant miRNAs. For small RNAs shorter than 23 nt, the imperfect flower buds had higher expression levels than the perfect flower buds, while for small RNAs longer than 23 nt, the opposite was the case. In addition to the different length distributions of small RNAs, the proportions of each type of small RNA in the two libraries were also different (Table
<xref ref-type="table" rid="T2">2</xref>
). The proportion of miRNAs in perfect flower buds was higher than that in imperfect flower buds. However, rRNAs, snRNAs and tRNAs in imperfect flower buds were higher than in perfect flower buds. In summary, the small RNA transcriptomes of the two libraries exhibited certain differences with respect to length distribution and composition.</p>
<p>In order to identify miRNAs related to pistil development, the normalised expressions of miRNAs in the perfect and imperfect small RNA libraries were compared. The miRNAs with changes in expression levels greater than 1.5-fold and
<italic>p</italic>
-values less than 0.05 are presented in Table
<xref ref-type="table" rid="T6">6</xref>
. The results from high-throughput sequencing showed that seven known miRNAs and six potentially novel miRNAs/new members of known miRNA families were relevant to pistil development (Table
<xref ref-type="table" rid="T6">6</xref>
). Of these 13 sequences, nine demonstrated a greater than three-fold change in expression levels between the perfect and imperfect libraries. Among the six differentially expressed potentially novel miRNAs/new members of known miRNA families, miR6274 and miR482c were perfect specific, while miR6295, mi171d and miR319b were imperfect specific. Three miRNAs were down-regulated, and ten miRNAs were up-regulated in pistil abortion (Table
<xref ref-type="table" rid="T6">6</xref>
).</p>
<table-wrap position="float" id="T6">
<label>Table 6</label>
<caption>
<p>miRNAs expressed differentially in perfect and imperfect libraries</p>
</caption>
<table frame="hsides" rules="groups" border="1">
<colgroup>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
<col align="center"></col>
</colgroup>
<thead valign="top">
<tr>
<th rowspan="2" align="center">
<bold>Family</bold>
</th>
<th rowspan="2" align="center">
<bold>miRNA name</bold>
</th>
<th colspan="2" align="center" valign="bottom">
<bold>Perfect</bold>
<hr></hr>
</th>
<th colspan="2" align="center" valign="bottom">
<bold>Imperfect</bold>
<hr></hr>
</th>
<th rowspan="2" align="center">
<bold>Fold-change log2(s2/s1)</bold>
</th>
<th rowspan="2" align="center">
<bold>P-value</bold>
</th>
<th rowspan="2" align="center">
<bold>Mode</bold>
</th>
<th rowspan="2" align="center">
<bold>Sig-lable</bold>
</th>
</tr>
<tr>
<th align="center">
<bold>Counts</bold>
</th>
<th align="center">
<bold>Normalised</bold>
</th>
<th align="center">
<bold>Counts</bold>
</th>
<th align="center">
<bold>Normalised</bold>
</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center" valign="bottom">MIR159
<hr></hr>
</td>
<td align="center" valign="bottom">miR319
<hr></hr>
</td>
<td align="center" valign="bottom">21
<hr></hr>
</td>
<td align="center" valign="bottom">0.96
<hr></hr>
</td>
<td align="center" valign="bottom">171
<hr></hr>
</td>
<td align="center" valign="bottom">7.05
<hr></hr>
</td>
<td align="center" valign="bottom">2.88
<hr></hr>
</td>
<td align="center" valign="bottom">1.45e − 06
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR319a
<hr></hr>
</td>
<td align="center" valign="bottom">121
<hr></hr>
</td>
<td align="center" valign="bottom">5.50
<hr></hr>
</td>
<td align="center" valign="bottom">1172
<hr></hr>
</td>
<td align="center" valign="bottom">48.35
<hr></hr>
</td>
<td align="center" valign="bottom">3.14
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom"> 
<hr></hr>
</td>
<td align="center" valign="bottom">miR319e
<hr></hr>
</td>
<td align="center" valign="bottom">1
<hr></hr>
</td>
<td align="center" valign="bottom">0.05
<hr></hr>
</td>
<td align="center" valign="bottom">40
<hr></hr>
</td>
<td align="center" valign="bottom">1.65
<hr></hr>
</td>
<td align="center" valign="bottom">5.18
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR160
<hr></hr>
</td>
<td align="center" valign="bottom">miR160a
<hr></hr>
</td>
<td align="center" valign="bottom">110
<hr></hr>
</td>
<td align="center" valign="bottom">5.00
<hr></hr>
</td>
<td align="center" valign="bottom">808
<hr></hr>
</td>
<td align="center" valign="bottom">33.33
<hr></hr>
</td>
<td align="center" valign="bottom">2.74
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR393
<hr></hr>
</td>
<td align="center" valign="bottom">miR393a
<hr></hr>
</td>
<td align="center" valign="bottom">2
<hr></hr>
</td>
<td align="center" valign="bottom">0.09
<hr></hr>
</td>
<td align="center" valign="bottom">77
<hr></hr>
</td>
<td align="center" valign="bottom">3.18
<hr></hr>
</td>
<td align="center" valign="bottom">5.13
<hr></hr>
</td>
<td align="center" valign="bottom">6.41e − 12
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR394
<hr></hr>
</td>
<td align="center" valign="bottom">miR394a
<hr></hr>
</td>
<td align="center" valign="bottom">24
<hr></hr>
</td>
<td align="center" valign="bottom">1.09
<hr></hr>
</td>
<td align="center" valign="bottom">301
<hr></hr>
</td>
<td align="center" valign="bottom">12.42
<hr></hr>
</td>
<td align="center" valign="bottom">3.51
<hr></hr>
</td>
<td align="center" valign="bottom">9.05e − 51
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR395
<hr></hr>
</td>
<td align="center" valign="bottom">miR395a
<hr></hr>
</td>
<td align="center" valign="bottom">14
<hr></hr>
</td>
<td align="center" valign="bottom">0.64
<hr></hr>
</td>
<td align="center" valign="bottom">94
<hr></hr>
</td>
<td align="center" valign="bottom">3.88
<hr></hr>
</td>
<td align="center" valign="bottom">2.61
<hr></hr>
</td>
<td align="center" valign="bottom">6.82e − 25
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">unknown
<hr></hr>
</td>
<td align="center" valign="bottom">miR6274
<hr></hr>
</td>
<td align="center" valign="bottom">60
<hr></hr>
</td>
<td align="center" valign="bottom">2.73
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
<td align="center" valign="bottom">−8.09
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">Down
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">unknown
<hr></hr>
</td>
<td align="center" valign="bottom">miR6268
<hr></hr>
</td>
<td align="center" valign="bottom">178
<hr></hr>
</td>
<td align="center" valign="bottom">8.10
<hr></hr>
</td>
<td align="center" valign="bottom">66
<hr></hr>
</td>
<td align="center" valign="bottom">2.72
<hr></hr>
</td>
<td align="center" valign="bottom">−1.57
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">Down
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">unknown
<hr></hr>
</td>
<td align="center" valign="bottom">miR6295
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
<td align="center" valign="bottom">42
<hr></hr>
</td>
<td align="center" valign="bottom">1.73
<hr></hr>
</td>
<td align="center" valign="bottom">7.44
<hr></hr>
</td>
<td align="center" valign="bottom">1.97e − 37
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR159
<hr></hr>
</td>
<td align="center" valign="bottom">miR319b
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
<td align="center" valign="bottom">71
<hr></hr>
</td>
<td align="center" valign="bottom">2.93
<hr></hr>
</td>
<td align="center" valign="bottom">8.19
<hr></hr>
</td>
<td align="center" valign="bottom">4.14e − 99
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center" valign="bottom">MIR171
<hr></hr>
</td>
<td align="center" valign="bottom">miR171d
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">0.01
<hr></hr>
</td>
<td align="center" valign="bottom">2097
<hr></hr>
</td>
<td align="center" valign="bottom">86.51
<hr></hr>
</td>
<td align="center" valign="bottom">13.08
<hr></hr>
</td>
<td align="center" valign="bottom">0
<hr></hr>
</td>
<td align="center" valign="bottom">Up
<hr></hr>
</td>
<td align="center" valign="bottom">**
<hr></hr>
</td>
</tr>
<tr>
<td align="center">MIR482</td>
<td align="center">miR482c</td>
<td align="center">30342</td>
<td align="center">1380.12</td>
<td align="center">0</td>
<td align="center">0.01</td>
<td align="center">−17.07</td>
<td align="center">0</td>
<td align="center">Down</td>
<td align="center">**</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>To confirm the differential expression of the miRNAs, the expressions of four of the seven known miRNA genes and five of the six novel miRNA genes were analysed using poly(A) qRT-PCR. The expression level of each gene in the perfect and imperfect flower buds was compared with its abundance in the sequencing data of the sRNA library. The results indicated that nine miRNAs had the same expression patterns in the perfect and imperfect flower buds as those in the sequencing data (Figure
<xref ref-type="fig" rid="F7">7</xref>
).</p>
<fig id="F7" position="float">
<label>Figure 7</label>
<caption>
<p>
<bold>Expression confirmation of miRNAs in Japanese apricot derived from high throughput sequencing.</bold>
Differentially expressed miRNAs expression detected by poly(A) qRT-PCR.</p>
</caption>
<graphic xlink:href="1471-2164-13-371-7"></graphic>
</fig>
</sec>
<sec>
<title>Prediction of potential targets of differentially expressed miRNAs</title>
<p>An indication of the genes responsible for pistil abortion was sought by the inspection of 212 potential targets of the 13 differentially expressed miRNAs (Additional file
<xref ref-type="supplementary-material" rid="S3">3</xref>
). There are three ontologies in Gene Ontology (GO): molecular functions, cellular components and biological processes. GO categories were assigned to all 212 putative targets, according to their cellular components, molecular functions and biological processes (Figure
<xref ref-type="fig" rid="F8">8</xref>
). On the basis of molecular function, the genes were finally classified into 10 categories, as shown in Figure
<xref ref-type="fig" rid="F8">8</xref>
B. The top three over-represented GO terms are enzyme activity, nucleic acid binding and other binding. Thirteen biological processes were identified, with the three most frequent being developmental process, regulation of transcription and response to stress (Figure
<xref ref-type="fig" rid="F8">8</xref>
C).</p>
<fig id="F8" position="float">
<label>Figure 8</label>
<caption>
<p>
<bold>Gene ontology of the predicted targets for 13 differentially expressed miRNAs.</bold>
Categorization of miRNA-target genes was performed according to the cellular component (
<bold>A</bold>
), molecular function (
<bold>B</bold>
) and biological process (
<bold>C</bold>
).</p>
</caption>
<graphic xlink:href="1471-2164-13-371-8"></graphic>
</fig>
<p>The high frequency of ‘regulation of transcription’ and ‘response to stress’ terms are easily explainable, since miRNAs are involved in diverse regulatory events [
<xref ref-type="bibr" rid="B43">43</xref>
]. Moreover, many flower developmental genes were also predicted targets of miRNAs. One gene involved in ovule development was further analysed (miR319, miR319a and miR319e and putative target auxin response factor 2 (ARF2) [Ppa022314m]). The results implied the possible roles of miRNAs in the regulation of biological processes involved in pistil abortion.</p>
</sec>
</sec>
<sec sec-type="discussion">
<title>Discussion</title>
<sec>
<title>High-throughput sequencing of Japanese apricot small RNAs</title>
<p>Most conserved miRNAs in plants have been identified by traditional Sanger sequencing or computational approaches [
<xref ref-type="bibr" rid="B43">43</xref>
-
<xref ref-type="bibr" rid="B47">47</xref>
]. However, a large number of non-conserved or species-specific miRNAs in plants usually accumulate at a lower level than conserved miRNAs, and are typically not easily revealed using traditional sequencing methods [
<xref ref-type="bibr" rid="B48">48</xref>
]. Therefore, the construction and high-throughput sequencing of small RNA libraries seems to be the most efficient method for miRNA identification [
<xref ref-type="bibr" rid="B36">36</xref>
,
<xref ref-type="bibr" rid="B49">49</xref>
]. The aim of this work was to identify the evolutionary known and potentially novel Japanese apricot-specific miRNAs recovered from perfect and imperfect flower bud libraries, and to analyse the differentially expressed miRNAs associated with pistil development. In our study, small RNA libraries of Japanese apricot from the Solexa platform, one of the newly-developed high-throughput sequencing technologies, generated shorter reads (up to 35 bp) but yielded 1–3 million reads per sample. This method has been most popularly employed to discover miRNAs in various organisms. As expected, a large number of reads were generated by our small RNA libraries, of which 61 are known to belong to 24 families. In addition, 61 potentially novel miRNAs/new members of known miRNA families were identified in Japanese apricot.</p>
<p>Taking a broader view of the high-throughput sequencing of small RNAs in Japanese apricot, it was observed that small RNAs of 24 nt dominated the library of unique species, as has been reported for many other plant species, such as
<italic>Arabidopsis thaliana</italic>
[
<xref ref-type="bibr" rid="B28">28</xref>
],
<italic>Citrus trifoliata</italic>
[
<xref ref-type="bibr" rid="B36">36</xref>
],
<italic>Medicago truncatula</italic>
[
<xref ref-type="bibr" rid="B37">37</xref>
,
<xref ref-type="bibr" rid="B38">38</xref>
],
<italic>Citrus sativus</italic>
[
<xref ref-type="bibr" rid="B50">50</xref>
] and
<italic>Citrus Sinensis</italic>
[
<xref ref-type="bibr" rid="B51">51</xref>
]. However, the most abundant small RNAs in the imperfect library were 21 nt long. Normally, the length of small RNAs is between 18 nt and 30 nt. Length distribution analysis is a helpful way to assess the composition of small RNA samples. For example, miRNA is normally 21 nt or 22 nt long, whereas siRNA is 24 nt long [
<xref ref-type="bibr" rid="B52">52</xref>
]. The data obtained here imply that the most abundant small RNAs are miRNAs and siRNAs in perfect and imperfect flower buds, respectively.</p>
<p>The overall distribution pattern of small RNAs (21 nt sRNAs = 30.33%, and 24 nt sRNAs = 35.63%) in Japanese apricot is significantly different from that in
<italic>Pinus contorta</italic>
, a conifer species in which 21 nt RNAs are more abundant (>50%) and 24 nt RNAs are less frequent (2.5%). A striking difference also exists when comparing Japanese apricot small RNAs with monocot species of rice. When compared with eudicotyledon species of sweet orange, the difference is not as noticeable, but still exists, such that 24 nt sRNAs are most frequent (>50%) while 21 nt sRNAs are less common (<20%). These analyses indicate that the small RNA transcriptome is complicated across plant species and can be significantly different between phylogenetically distant plant families.</p>
</sec>
<sec>
<title>miRNAs identified in plant flowers</title>
<p>Arabidopsis miRNAs [
<xref ref-type="bibr" rid="B27">27</xref>
] regulate multiple developmental events. In the past, miRNA identification in flowers using sequencing approaches has been common, and has been applied in the study of
<italic>Arabidopsis</italic>
[
<xref ref-type="bibr" rid="B53">53</xref>
], tomato [
<xref ref-type="bibr" rid="B54">54</xref>
], orchid [
<xref ref-type="bibr" rid="B24">24</xref>
],
<italic>Boechera</italic>
[
<xref ref-type="bibr" rid="B12">12</xref>
], maize [
<xref ref-type="bibr" rid="B55">55</xref>
], cotton [
<xref ref-type="bibr" rid="B49">49</xref>
], safflower and grape [
<xref ref-type="bibr" rid="B56">56</xref>
,
<xref ref-type="bibr" rid="B57">57</xref>
]. In this study, high-throughput sequencing of extracts from Japanese apricot flower buds led to the identification of 61 known miRNAs, belonging to 24 families, and 61 potentially novel miRNAs/new members of known miRNA families. Analysis of these revealed that some miRNA families are expressed in the flowers of other plant species, but they are not flower-specific. miR156/miR157, miR166 and miR167 were represented most frequently in the libraries in this study. The involvement of three miRNA families (miR172, miR159/miR319 and miR156) in flowering-time regulation has been recently demonstrated in other investigations [
<xref ref-type="bibr" rid="B22">22</xref>
]. miR164, miR319, miR159 and miR167 specify particular cell types during the later stages of flower development [
<xref ref-type="bibr" rid="B7">7</xref>
]. Furthermore, the comparison of these species’ miRNAs showed that miR156/miR157 and miR172 may be components of a regulatory pathway mediating the transition between the vegetative and reproductive phases in plants. In addition, miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and pistillata expression domains in
<italic>Arabidopsis</italic>
floral meristems [
<xref ref-type="bibr" rid="B58">58</xref>
]. By targeting APETALA2 and type III homeodomain-leucine zipper (HD-Zip) genes, miR166 regulates the temporal program of floral stem cells [
<xref ref-type="bibr" rid="B59">59</xref>
]. It is believed that miR167, like miR160, targets mRNAs coding for ARF, which are DNA-binding proteins that are thought to control transcription in response to the phytohormone auxin [
<xref ref-type="bibr" rid="B27">27</xref>
,
<xref ref-type="bibr" rid="B60">60</xref>
]. Transcriptional regulation is important for many of the diverse developmental responses to auxin signals, which include cell elongation, division and differentiation in both roots and shoots [
<xref ref-type="bibr" rid="B61">61</xref>
].</p>
</sec>
<sec>
<title>miRNAs possibly involved in the regulation of pistil abortion in imperfect Japanese apricot flower buds</title>
<p>The characterisation and comparative profiling of entire sets of small RNAs (small RNA transcriptome), especially miRNAs, provides the foundation for unraveling the complex miRNA-mediated regulatory networks controlling pistil abortion in imperfect Japanese apricot flower buds. In this study, a number of miRNAs were shown to be differentially expressed between perfect and imperfect flower buds. Compared with the perfect library, four known miRNA genes and three potentially novel miRNA/new members of known miRNA families genes were expressed exclusively in imperfect flower buds. On the other hand, it was found that two potentially novel miRNAs/new members of known miRNA families were perfect-specific. Moreover, a total of seven known miRNAs and six potentially novel miRNAs exhibited significant expression changes between the perfect and imperfect libraries.</p>
<p>The relationship between the sRNA genes and the miRNA target genes is one of the hot spots in the phenomenon of ‘miRNA-associated transitivity’. Target prediction of these differential miRNAs could provide information on the biological processes regulated by miRNA. The annotations of these potential miRNA target genes provided an alternate view of gene regulation of the pistil abortion trait formation in imperfect flower buds. It was discovered that these groups of predicted miRNA-target genes are possibly involved in the pistil abortion trait formation.</p>
<p>The majority of genes encoding transcription factors or F-box proteins have a significant role in the plant development [
<xref ref-type="bibr" rid="B44">44</xref>
,
<xref ref-type="bibr" rid="B62">62</xref>
]. In the present study, it was found that the predicted targets of miR319, miR319a, miR319e, miR160, miR393, miR394, miR6274, miR6295 and miR171d were either transcription factors or F-box proteins. In addition, it is predicted that miR319/miR319a/miR319e target
<italic>ARF2</italic>
genes and that miR160a targets
<italic>ARF16/17</italic>
. Auxin regulates a variety of physiological and developmental processes in plants. ARF has been reported to regulate flower and leaf development [
<xref ref-type="bibr" rid="B8">8</xref>
,
<xref ref-type="bibr" rid="B63">63</xref>
,
<xref ref-type="bibr" rid="B64">64</xref>
]. ARF2 is a transcriptional suppressor that has been found to be involved in ethylene, auxin, ABA and brassinosteroid pathways, in order to control the onset of leaf senescence, floral organ abscission and ovule development [
<xref ref-type="bibr" rid="B64">64</xref>
]. ARF2 promotes transitions between multiple stages of
<italic>Arabidopsis</italic>
development and positively regulates flower development [
<xref ref-type="bibr" rid="B65">65</xref>
]. In this study, the expression of miR319/miR319a/miR319e was shown to be higher in imperfect than in perfect flower buds. Consequently, the expression of ARF2 was repressed by these miRNAs and thus regulated pistil development. Moreover, TCP2 (
<italic>TEOSINTE BRANCHED/CYCLOIDEA/PCF</italic>
) transcription factor genes and MYB33, which belong to a GAMYB-like family of transcription factors, are also targets of miR319/miR319a/miR319e in our prediction, which agrees with previous reports [
<xref ref-type="bibr" rid="B10">10</xref>
,
<xref ref-type="bibr" rid="B66">66</xref>
]. Therefore, it is conceivable that the over-expression of miR319/miR319a/miR319e may contribute to an increase in imperfect flower ratios in pistil development.</p>
</sec>
</sec>
<sec sec-type="conclusions">
<title>Conclusions</title>
<p>The present study first comparatively constructed the miRNAomes between perfect and imperfect Japanese apricot flowers and identified 61 known miRNAs belonging to 24 families. Comparative profiling revealed that seven known miRNAs exhibited significant expression differences between perfect and imperfect flower buds. In addition, 61 potentially novel miRNAs/new members of known miRNA families were also identified, by the presence of mature miRNAs and corresponding miRNA*s in the sRNA libraries. Comparative analysis showed that six potentially novel miRNAs were differentially expressed between perfect and imperfect flower buds. Target predictions of the 13 differential miRNAs resulted in 212 target genes. GO annotation revealed that highly-ranked miRNA target genes were those implicated in the developmental process, regulation of transcription and response to stress. These findings, both computational and experimental, provide valuable information for further functional characterisation of miRNAs associated with pistil development in plants.</p>
</sec>
<sec sec-type="methods">
<title>Methods</title>
<sec>
<title>Plant materials</title>
<p>The frequency of imperfect flowers in Japanese apricot cultivar ‘Daqiandi’ is about 76%. While the pistils of perfect flowers continued to develop, the pistils of imperfect flowers stopped developing in early December and ultimately disintegrated. The present study used these two types of flower buds from this period, from ‘Daqiandi’ trees grown in the ‘National Field Genebank for Japanese apricot’ (Nanjing, Jiangsu Province, China). All the samples were collected and immediately frozen in liquid nitrogen and stored at −80°C.</p>
</sec>
<sec>
<title>Small RNA library construction and high-throughput sequencing</title>
<p>In order to construct small RNA libraries, small RNAs were extracted from perfect and imperfect flower buds using a method based on polyethylene glycol (PEG) precipitation combining CTAB buffer [
<xref ref-type="bibr" rid="B67">67</xref>
]. Two small RNA samples were sequenced by the Beijing Genomics Institute (BGI) (Shenzhen, Guangdong Province, China) using the high-throughput pyrosequencing technology developed by Solexa.</p>
</sec>
<sec>
<title>Bioinformatics analysis of sequencing data</title>
<p>The raw sequences were processed as described by Sunkar
<italic>et al.</italic>
[
<xref ref-type="bibr" rid="B25">25</xref>
]. Following removal of the vector sequences, modified sequences from 18 nt to 30 nt were used for further analyses. To begin with, rRNA, tRNA, snRNA, snoRNA and material containing the poly-A tail were removed from the sRNA sequences. The remaining sequences were compared with rice and
<italic>Arabidopsis</italic>
ncRNAs deposited in the NCBI GenBank and Rfam10.0 databases. Then, the unique sRNA sequences were used in a BLASTN search of the miRNA database. Only perfectly matched sequences were considered to be conserved miRNAs.</p>
<p>Potentially novel sequences were identified through alignment with the peach genome sequence on the GDR (
<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/species/prunus/peach">http://www.rosaceae.org/species/prunus/peach</ext-link>
). Candidate pre-miRNAs were identified by folding the flanking genome sequence of distinct miRNAs using MIREAP [
<xref ref-type="bibr" rid="B55">55</xref>
], followed by a prediction of secondary structure using mFold v3.5 [
<xref ref-type="bibr" rid="B68">68</xref>
]. The criteria chosen for stem-loop hairpins were those described by Meyers
<italic>et al.</italic>
and Wang
<italic>et al.</italic>
[
<xref ref-type="bibr" rid="B42">42</xref>
,
<xref ref-type="bibr" rid="B55">55</xref>
].</p>
</sec>
<sec>
<title>Differential expression analyses of miRNAs related to pistil development</title>
<p>The frequency of miRNAs in the two libraries was normalised to one million by the total number of miRNAs in each sample (normalised expression = actual miRNA count/total count of clean reads*1,000,000). Following normalisation, if the miRNA gene expression of two samples was zero, then it was revised to 0.01; if the miRNA gene expression of two samples was less than 1, owing to their too low expression and did not participate in analysis of differential expression.</p>
<p>The fold-change between treatment and control was calculated as: fold-change = log
<sub>2</sub>
(imperfect/perfect). The
<italic>p-value</italic>
was calculated using the formula below [
<xref ref-type="bibr" rid="B69">69</xref>
,
<xref ref-type="bibr" rid="B70">70</xref>
], where: N1 and N2 represent the total counts of clean reads of a given miRNA in the sRNA libraries of perfect and imperfect flower bud samples, respectively; and x and y represent the normalised expression levels of a given miRNA in the sRNA libraries of perfect and imperfect flower bud samples, respectively.</p>
<p>
<disp-formula id="bmcM1">
<label>(1)</label>
<mml:math id="M1" name="1471-2164-13-371-i1" overflow="scroll">
<mml:mi>p</mml:mi>
<mml:mfenced open="(" close=")">
<mml:mrow>
<mml:mi>x</mml:mi>
<mml:mo stretchy="true">|</mml:mo>
<mml:mi>y</mml:mi>
</mml:mrow>
</mml:mfenced>
<mml:mo>=</mml:mo>
<mml:msup>
<mml:mfenced open="(" close=")">
<mml:mfrac>
<mml:msub>
<mml:mi>N</mml:mi>
<mml:mn>2</mml:mn>
</mml:msub>
<mml:msub>
<mml:mi>N</mml:mi>
<mml:mn>1</mml:mn>
</mml:msub>
</mml:mfrac>
</mml:mfenced>
<mml:mi>y</mml:mi>
</mml:msup>
<mml:mfrac>
<mml:mrow>
<mml:mfenced open="(" close=")">
<mml:mrow>
<mml:mi>x</mml:mi>
<mml:mo>+</mml:mo>
<mml:mi>γ</mml:mi>
</mml:mrow>
</mml:mfenced>
<mml:mo>!</mml:mo>
</mml:mrow>
<mml:mrow>
<mml:mi>x</mml:mi>
<mml:mo>!</mml:mo>
<mml:mi>γ</mml:mi>
<mml:mo>!</mml:mo>
<mml:msup>
<mml:mfenced open="(" close=")">
<mml:mrow>
<mml:mn>1</mml:mn>
<mml:mo>+</mml:mo>
<mml:mfrac>
<mml:msub>
<mml:mi>N</mml:mi>
<mml:mn>2</mml:mn>
</mml:msub>
<mml:msub>
<mml:mi>N</mml:mi>
<mml:mn>1</mml:mn>
</mml:msub>
</mml:mfrac>
</mml:mrow>
</mml:mfenced>
<mml:mfenced open="(" close=")">
<mml:mrow>
<mml:mi>x</mml:mi>
<mml:mo>+</mml:mo>
<mml:mi>γ</mml:mi>
<mml:mo>+</mml:mo>
<mml:mn>1</mml:mn>
</mml:mrow>
</mml:mfenced>
</mml:msup>
</mml:mrow>
</mml:mfrac>
<mml:mi>C</mml:mi>
<mml:mfenced open="(" close=")">
<mml:mrow>
<mml:mi>γ</mml:mi>
<mml:mo></mml:mo>
<mml:msub>
<mml:mi>γ</mml:mi>
<mml:mo>min</mml:mo>
</mml:msub>
<mml:mo stretchy="true">|</mml:mo>
<mml:mtext>x</mml:mtext>
</mml:mrow>
</mml:mfenced>
<mml:mo>=</mml:mo>
<mml:mrow>
<mml:munderover>
<mml:mo></mml:mo>
<mml:mrow>
<mml:mi>γ</mml:mi>
<mml:mo>=</mml:mo>
<mml:mn>0</mml:mn>
</mml:mrow>
<mml:mrow>
<mml:mi>γ</mml:mi>
<mml:mo></mml:mo>
<mml:msub>
<mml:mi>γ</mml:mi>
<mml:mo>min</mml:mo>
</mml:msub>
</mml:mrow>
</mml:munderover>
<mml:mi>p</mml:mi>
<mml:mfenced open="(" close=")">
<mml:mrow>
<mml:mi>γ</mml:mi>
<mml:mo stretchy="true">|</mml:mo>
<mml:mtext>x</mml:mtext>
</mml:mrow>
</mml:mfenced>
</mml:mrow>
<mml:mi>D</mml:mi>
<mml:mfenced open="(" close=")">
<mml:mrow>
<mml:mi>γ</mml:mi>
<mml:msub>
<mml:mo></mml:mo>
<mml:mo>max</mml:mo>
</mml:msub>
<mml:mo stretchy="true">|</mml:mo>
<mml:mtext>x</mml:mtext>
</mml:mrow>
</mml:mfenced>
<mml:mo>=</mml:mo>
<mml:mrow>
<mml:munderover>
<mml:mo></mml:mo>
<mml:mrow>
<mml:mi>γ</mml:mi>
<mml:mo></mml:mo>
<mml:msub>
<mml:mi>γ</mml:mi>
<mml:mo>max</mml:mo>
</mml:msub>
</mml:mrow>
<mml:mi></mml:mi>
</mml:munderover>
<mml:mi>p</mml:mi>
<mml:mfenced open="(" close=")">
<mml:mrow>
<mml:mi>γ</mml:mi>
<mml:mo stretchy="true">|</mml:mo>
<mml:mtext>x</mml:mtext>
</mml:mrow>
</mml:mfenced>
</mml:mrow>
</mml:math>
</disp-formula>
</p>
</sec>
<sec>
<title>Prediction of potential target mRNAs for Japanese apricot miRNAs</title>
<p>The rules used for target prediction were based on those suggested by Allen
<italic>et al.</italic>
[
<xref ref-type="bibr" rid="B71">71</xref>
] and Schwab
<italic>et al.</italic>
[
<xref ref-type="bibr" rid="B72">72</xref>
]. Putative Japanese apricot miRNAs were first blasted against the peach unigene database on the GDR (
<ext-link ext-link-type="uri" xlink:href="http://www.rosaceae.org/species/prunus/peach">http://www.rosaceae.org/species/prunus/peach</ext-link>
). BLASTN hits possessing less than four mismatches were chosen as candidate targets. BLASTX was then used to obtain their putative functions.</p>
</sec>
<sec>
<title>Validation of miRNAs by poly(A)-tailed qRT-PCR</title>
<p>The poly(A)-tailed qRT-PCR was carried out as previously reported, with a minor modifications [
<xref ref-type="bibr" rid="B67">67</xref>
,
<xref ref-type="bibr" rid="B73">73</xref>
]. This could not only detect the existence of Japanese apricot miRNAs, but also their expression trends in various organs and tissues. Small RNAs were extracted from Japanese apricot flower buds as described above and used in a 50-μl reaction system for adding poly(A) tails with poly(A) polymerase (NEB, USA). Reverse transcription was performed using poly(A)-tailed small RNAs from Japanese apricot flower buds, such that 1 μg of small RNA was reverse transcribed to cDNA using MLV reverse transcriptase (Promega, Madison, USA) and looped antisense primers [5′-CCAGTAGCGTATGATGAGCACAGAGTCTGAGATCACTCGTAGCGAGG-d(T)
<sub>33</sub>
-V(A/C/G)N(A/C/G/T)-3′]. According to the manufacturer’s instructions, the mix was incubated at 37°C for 40 minutes. qPCR was performed using SYBR® Green Realtime PCR Master Mix (Toyobo, Osaka, Japan). A list of all the primers used is provided in Additional file
<xref ref-type="supplementary-material" rid="S4">4</xref>
. For each reaction, 1 μL of diluted cDNA (equivalent to 100 pg of total RNA) was mixed with 10 μL of 2X SYBR Green Reaction Mix (SYBR® Green qRT-PCR Master Mix, Takara). A final volume of 20 μL was achieved by the addition of 5 pmol of the forward and the reverse primers. The conditions for the PCR amplification were as follows: polymerase activation at 95°C for 3 minutes, followed by 40 cycles of 95°C for 20 seconds, 60°C for 20 seconds and 72°C for 45 seconds. The fluorescence signal was measured once every 1°C. Negative PCR controls (no cDNA template) were prepared, in order to detect possible contamination. The specificity of the primer amplicons was tested by the analysis of a melting curve. The CT values were converted into relative copy numbers using a standard curve [
<xref ref-type="bibr" rid="B44">44</xref>
]. The 5 S rRNA was used as a reference gene in the qPCR detection of miRNAs in
<italic>Arabidopsis</italic>
[
<xref ref-type="bibr" rid="B56">56</xref>
,
<xref ref-type="bibr" rid="B74">74</xref>
]. The data was analysed with an R
<sup>2</sup>
>0.998 using the LinRegPCR program [
<xref ref-type="bibr" rid="B75">75</xref>
].</p>
</sec>
</sec>
<sec>
<title>Competing interests</title>
<p>The authors declare that they have no competing interest.</p>
</sec>
<sec>
<title>Authors’ contributions</title>
<p>TS, XL and WZ were responsible for generating the sRNA data and interpreting the results. TS and XL carried out the qRT-PCR experiments. TS drafted the manuscript. ZZ, LW and ZG participated in the research design and statistical analyses. ZG proposed and supervised the research. All authors read and approved the final manuscript.</p>
</sec>
<sec sec-type="supplementary-material">
<title>Supplementary Material</title>
<supplementary-material content-type="local-data" id="S1">
<caption>
<title>Additional file 1</title>
<p>
<bold>The predicted hairpin structures of all the potentially novel miRNAs/new members of known miRNA families’ precursors.</bold>
The red lightened sequences are mature miRNAs.</p>
</caption>
<media xlink:href="1471-2164-13-371-S1.pdf" mimetype="application" mime-subtype="pdf">
<caption>
<p>Click here for file</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="S2">
<caption>
<title>Additional file 2</title>
<p>Alignments of all reads from each hairpin of potentially novel miRNAs/new members of known miRNA families.</p>
</caption>
<media xlink:href="1471-2164-13-371-S2.txt" mimetype="text" mime-subtype="plain">
<caption>
<p>Click here for file</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="S3">
<caption>
<title>Additional file 3</title>
<p> The potential targets of differentially expressed miRNAs.</p>
</caption>
<media xlink:href="1471-2164-13-371-S3.pdf" mimetype="application" mime-subtype="pdf">
<caption>
<p>Click here for file</p>
</caption>
</media>
</supplementary-material>
<supplementary-material content-type="local-data" id="S4">
<caption>
<title>Additional file 4</title>
<p>The primers designed for qRT-PCR.</p>
</caption>
<media xlink:href="1471-2164-13-371-S4.pdf" mimetype="application" mime-subtype="pdf">
<caption>
<p>Click here for file</p>
</caption>
</media>
</supplementary-material>
</sec>
</body>
<back>
<sec>
<title>Acknowledgements</title>
<p>We gratefully acknowledge support of this research by the Special Fund for Agro-scientific Research in the Public Interest of the Ministry of Agriculture of China (201003058), grants from the National Science Foundation of China (31101526) and the Natural Science Foundation of Jiangsu Province (BK2011642), and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).</p>
</sec>
<ref-list>
<ref id="B1">
<mixed-citation publication-type="book">
<name>
<surname>Chu</surname>
<given-names>MY</given-names>
</name>
<source>China fruit records-Mei (in Chinese)</source>
<year>1999</year>
<publisher-name>China Forestry, Beijing</publisher-name>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<name>
<surname>Gao</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<article-title>Comparative study on flower and fruit characteristics of 29 varieties in Japanese apricot (Prunus mume Sieb. et Zucc.)</article-title>
<source>Jiangsu Agri Sci</source>
<year>2006</year>
<volume>6</volume>
<fpage>231</fpage>
<lpage>233</lpage>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<name>
<surname>Hou</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Ando</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
<article-title>Isolation and characterization of an AGAMOUS homologue PmAG from the Japanese Apricot (Prunus mume Sieb. et Zucc.)</article-title>
<source>Plant Mol Biol Rep</source>
<year>2011</year>
<volume>29</volume>
<fpage>473</fpage>
<lpage>480</lpage>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<name>
<surname>Wang</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Hou</surname>
<given-names>J</given-names>
</name>
<article-title>Comparison of the contents of nitrogen, phosphorus and potassium between perfect and imperfect flowers in Japanese apricot (Prunus mume)</article-title>
<source>J Fruit Sci</source>
<year>2009</year>
<volume>26</volume>
<fpage>564</fpage>
<lpage>567</lpage>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<name>
<surname>Montgomery</surname>
<given-names>TA</given-names>
</name>
<name>
<surname>Howell</surname>
<given-names>MD</given-names>
</name>
<name>
<surname>Cuperus</surname>
<given-names>JT</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Hansen</surname>
<given-names>JE</given-names>
</name>
<name>
<surname>Alexander</surname>
<given-names>AL</given-names>
</name>
<name>
<surname>Chapman</surname>
<given-names>EJ</given-names>
</name>
<name>
<surname>Fahlgren</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Allen</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Carrington</surname>
<given-names>JC</given-names>
</name>
<article-title>Specificity of ARGONAUTE7-miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation</article-title>
<source>Cell</source>
<year>2008</year>
<volume>133</volume>
<fpage>128</fpage>
<lpage>141</lpage>
<pub-id pub-id-type="pmid">18342362</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<name>
<surname>Zhu</surname>
<given-names>QH</given-names>
</name>
<name>
<surname>Helliwell</surname>
<given-names>CA</given-names>
</name>
<article-title>Regulation of flowering time and floral patterning by miR172</article-title>
<source>J Exp Bot</source>
<year>2011</year>
<volume>62</volume>
<fpage>487</fpage>
<pub-id pub-id-type="pmid">20952628</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<name>
<surname>Nag</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Jack</surname>
<given-names>T</given-names>
</name>
<article-title>Sculpting the flower; the role of microRNAs in flower development</article-title>
<source>Curr Top Dev Biol</source>
<year>2010</year>
<volume>91</volume>
<fpage>349</fpage>
<lpage>378</lpage>
<pub-id pub-id-type="pmid">20705188</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<name>
<surname>Liu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Khanna</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Owen</surname>
<given-names>HA</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>D</given-names>
</name>
<article-title>The role of floral organs in carpels, an Arabidopsis loss-of-function mutation in MicroRNA160a, in organogenesis and the mechanism regulating its expression</article-title>
<source>Plant J</source>
<year>2010</year>
<volume>62</volume>
<fpage>416</fpage>
<lpage>428</lpage>
<pub-id pub-id-type="pmid">20136729</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<name>
<surname>Lee</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Yoo</surname>
<given-names>SJ</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Yoo</surname>
<given-names>SK</given-names>
</name>
<name>
<surname>Fitzgerald</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Carrington</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Ahn</surname>
<given-names>JH</given-names>
</name>
<article-title>Genetic framework for flowering-time regulation by ambient temperature-responsive miRNAs in Arabidopsis</article-title>
<source>Nucleic Acids Res</source>
<year>2010</year>
<volume>38</volume>
<fpage>3081</fpage>
<lpage>3093</lpage>
<pub-id pub-id-type="pmid">20110261</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<name>
<surname>Zhang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Qu</surname>
<given-names>LJ</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>H</given-names>
</name>
<article-title>Involvement of an R2R3-MYB transcription factor gene AtMYB118 in embryogenesis in Arabidopsis</article-title>
<source>Plant Cell Rep</source>
<year>2009</year>
<volume>28</volume>
<fpage>337</fpage>
<lpage>346</lpage>
<pub-id pub-id-type="pmid">19066902</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<name>
<surname>Wang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Czech</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Weigel</surname>
<given-names>D</given-names>
</name>
<article-title>miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana</article-title>
<source>Cell</source>
<year>2009</year>
<volume>138</volume>
<fpage>738</fpage>
<lpage>749</lpage>
<pub-id pub-id-type="pmid">19703399</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<name>
<surname>Amiteye</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Corral</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Vogel</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Sharbel</surname>
<given-names>TF</given-names>
</name>
<article-title>Analysis of conserved microRNAs in floral tissues of sexual and apomictic Boechera species</article-title>
<source>BMC Genomics</source>
<year>2011</year>
<volume>12</volume>
<fpage>500</fpage>
<pub-id pub-id-type="pmid">21988906</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="book">
<name>
<surname>Wang</surname>
<given-names>S</given-names>
</name>
<source>Preliminary studies on differences of related characteristics between perfect flower and imperfect flower and protemics in Japanese apricot</source>
<year>2008</year>
<publisher-name>Nanjing Agricultural University, Nanjing</publisher-name>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<name>
<surname>Carthew</surname>
<given-names>RW</given-names>
</name>
<name>
<surname>Sontheimer</surname>
<given-names>EJ</given-names>
</name>
<article-title>Origins and mechanisms of miRNAs and siRNAs</article-title>
<source>Cell</source>
<year>2009</year>
<volume>136</volume>
<fpage>642</fpage>
<lpage>655</lpage>
<pub-id pub-id-type="pmid">19239886</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<name>
<surname>Mallory</surname>
<given-names>AC</given-names>
</name>
<name>
<surname>Vaucheret</surname>
<given-names>H</given-names>
</name>
<article-title>Functions of microRNAs and related small RNAs in plants</article-title>
<source>Nat Genet</source>
<year>2006</year>
<volume>38</volume>
<fpage>S31</fpage>
<lpage>S37</lpage>
<pub-id pub-id-type="pmid">16736022</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<name>
<surname>Chen</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ridzon</surname>
<given-names>DA</given-names>
</name>
<name>
<surname>Broomer</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>DH</given-names>
</name>
<name>
<surname>Nguyen</surname>
<given-names>JT</given-names>
</name>
<name>
<surname>Barbisin</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>NL</given-names>
</name>
<name>
<surname>Mahuvakar</surname>
<given-names>VR</given-names>
</name>
<name>
<surname>Andersen</surname>
<given-names>MR</given-names>
</name>
<article-title>Real-time quantification of microRNAs by stem–loop RT–PCR</article-title>
<source>Nucleic Acids Res</source>
<year>2005</year>
<volume>33</volume>
<fpage>e179</fpage>
<pub-id pub-id-type="pmid">16314309</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<name>
<surname>Jones-Rhoades</surname>
<given-names>MW</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>DP</given-names>
</name>
<name>
<surname>Barte</surname>
<given-names>B</given-names>
</name>
<article-title>MicroRNAs and their regulatory roles in plants</article-title>
<source>Annu Rev Plant Biol</source>
<year>2006</year>
<volume>57</volume>
<fpage>19</fpage>
<lpage>53</lpage>
<pub-id pub-id-type="pmid">16669754</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<name>
<surname>Bushati</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Cohen</surname>
<given-names>SM</given-names>
</name>
<article-title>MicroRNA functions</article-title>
<source>Annu Rev Cell Dev Biol</source>
<year>2007</year>
<volume>23</volume>
<fpage>175</fpage>
<lpage>205</lpage>
<pub-id pub-id-type="pmid">17506695</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<name>
<surname>Mette</surname>
<given-names>MF</given-names>
</name>
<name>
<surname>Winden</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Matzke</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Matzke</surname>
<given-names>AJM</given-names>
</name>
<article-title>Short RNAs can identify new candidate transposable element families in Arabidopsis</article-title>
<source>Plant Physiol</source>
<year>2002</year>
<volume>130</volume>
<fpage>6</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">12226481</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<name>
<surname>Llave</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Kasschau</surname>
<given-names>KD</given-names>
</name>
<name>
<surname>Carrington</surname>
<given-names>JC</given-names>
</name>
<article-title>Cleavage of scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA</article-title>
<source>Science</source>
<year>2002</year>
<volume>297</volume>
<fpage>2053</fpage>
<pub-id pub-id-type="pmid">12242443</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<name>
<surname>Zhang</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Cobb</surname>
<given-names>GP</given-names>
</name>
<name>
<surname>Anderson</surname>
<given-names>TA</given-names>
</name>
<article-title>Plant microRNA: a small regulatory molecule with big impact</article-title>
<source>Dev Biol</source>
<year>2006</year>
<volume>289</volume>
<fpage>3</fpage>
<lpage>16</lpage>
<pub-id pub-id-type="pmid">16325172</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<name>
<surname>Jones-Rhoades</surname>
<given-names>MW</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>DP</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>B</given-names>
</name>
<article-title>MicroRNAs and their regulatory roles in plants</article-title>
<source>Annu Rev Plant Biol</source>
<year>2006</year>
<volume>57</volume>
<fpage>19</fpage>
<lpage>53</lpage>
<pub-id pub-id-type="pmid">16669754</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<name>
<surname>Rubio-Somoza</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Weigel</surname>
<given-names>D</given-names>
</name>
<article-title>MicroRNA networks and developmental plasticity in plants</article-title>
<source>Trends Plant Sci</source>
<year>2011</year>
<volume>16</volume>
<fpage>258</fpage>
<lpage>264</lpage>
<pub-id pub-id-type="pmid">21466971</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<name>
<surname>An</surname>
<given-names>FM</given-names>
</name>
<name>
<surname>Hsiao</surname>
<given-names>SR</given-names>
</name>
<name>
<surname>Chan</surname>
<given-names>MT</given-names>
</name>
<article-title>Sequencing-based approaches reveal low ambient temperature-responsive and tissue-specific microRNAs in Phalaenopsis orchid</article-title>
<source>PLoS One</source>
<year>2011</year>
<volume>6</volume>
<fpage>e18937</fpage>
<pub-id pub-id-type="pmid">21573107</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<name>
<surname>Sunkar</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Jagadeeswaran</surname>
<given-names>G</given-names>
</name>
<article-title>In silico identification of conserved microRNAs in large number of diverse plant species</article-title>
<source>BMC Plant Biol</source>
<year>2008</year>
<volume>8</volume>
<fpage>37</fpage>
<pub-id pub-id-type="pmid">18416839</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<name>
<surname>Song</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Fang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Chao</surname>
<given-names>CT</given-names>
</name>
<article-title>Identification and characterization of 27 conserved microRNAs in citrus</article-title>
<source>Planta</source>
<year>2009</year>
<volume>230</volume>
<fpage>671</fpage>
<lpage>685</lpage>
<pub-id pub-id-type="pmid">19585144</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<name>
<surname>Rajagopalan</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Vaucheret</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Trejo</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>DP</given-names>
</name>
<article-title>A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana</article-title>
<source>Genes Dev</source>
<year>2006</year>
<volume>20</volume>
<fpage>3407</fpage>
<lpage>3425</lpage>
<pub-id pub-id-type="pmid">17182867</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<name>
<surname>Fahlgren</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Howell</surname>
<given-names>MD</given-names>
</name>
<name>
<surname>Kasschau</surname>
<given-names>KD</given-names>
</name>
<name>
<surname>Chapman</surname>
<given-names>EJ</given-names>
</name>
<name>
<surname>Sullivan</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Cumbie</surname>
<given-names>JS</given-names>
</name>
<name>
<surname>Givan</surname>
<given-names>SA</given-names>
</name>
<name>
<surname>Law</surname>
<given-names>TF</given-names>
</name>
<name>
<surname>Grant</surname>
<given-names>SR</given-names>
</name>
<name>
<surname>Dangl</surname>
<given-names>JL</given-names>
</name>
<article-title>High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes</article-title>
<source>PLoS One</source>
<year>2007</year>
<volume>2</volume>
<fpage>e219</fpage>
<pub-id pub-id-type="pmid">17299599</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<name>
<surname>Nobuta</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Venu</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Beló</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Vemaraju</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Kulkarni</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Pillay</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Green</surname>
<given-names>PJ</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G</given-names>
</name>
<article-title>An expression atlas of rice mRNAs and small RNAs</article-title>
<source>Nat Biotechnol</source>
<year>2007</year>
<volume>25</volume>
<fpage>473</fpage>
<lpage>477</lpage>
<pub-id pub-id-type="pmid">17351617</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<name>
<surname>Zhou</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>X</given-names>
</name>
<article-title>Degradome sequencing reveals endogenous small RNA targets in rice (Oryza sativa L. ssp. indica)</article-title>
<source>Front Biol</source>
<year>2010</year>
<volume>5</volume>
<fpage>67</fpage>
<lpage>90</lpage>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<name>
<surname>Barakat</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Wall</surname>
<given-names>P</given-names>
</name>
<name>
<surname>DiLoreto</surname>
<given-names>S</given-names>
</name>
<article-title>Conservation and divergence of microRNAs in Populus</article-title>
<source>BMC Genomics</source>
<year>2007</year>
<volume>8</volume>
<fpage>481</fpage>
<pub-id pub-id-type="pmid">18166134</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<name>
<surname>Klevebring</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Street</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Fahlgren</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Kasschau</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Carrington</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Lundeberg</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Jansson</surname>
<given-names>S</given-names>
</name>
<article-title>Genome-wide profiling of Populus small RNAs</article-title>
<source>BMC Genomics</source>
<year>2009</year>
<volume>10</volume>
<fpage>620</fpage>
<pub-id pub-id-type="pmid">20021695</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<name>
<surname>Lu</surname>
<given-names>YD</given-names>
</name>
<name>
<surname>Gan</surname>
<given-names>QH</given-names>
</name>
<name>
<surname>Chi</surname>
<given-names>XY</given-names>
</name>
<name>
<surname>Qin</surname>
<given-names>S</given-names>
</name>
<article-title>Identification and characterization of microRNAs and their targets in grapevine (Vitis vinifera)</article-title>
<source>Agr Sci China</source>
<year>2008</year>
<volume>7</volume>
<fpage>929</fpage>
<lpage>943</lpage>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<name>
<surname>Zhao</surname>
<given-names>CZ</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Frazier</surname>
<given-names>TP</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>YY</given-names>
</name>
<name>
<surname>Bi</surname>
<given-names>YP</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>AQ</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>CS</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>BH</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>XJ</given-names>
</name>
<article-title>Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.)</article-title>
<source>BMC Plant Biol</source>
<year>2010</year>
<volume>10</volume>
<fpage>3</fpage>
<pub-id pub-id-type="pmid">20047695</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<name>
<surname>Xu</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Ye</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>X</given-names>
</name>
<article-title>Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type</article-title>
<source>BMC Genomics</source>
<year>2010</year>
<volume>11</volume>
<fpage>246</fpage>
<pub-id pub-id-type="pmid">20398412</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<name>
<surname>Song</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Korir</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Fang</surname>
<given-names>J</given-names>
</name>
<article-title>Deep sequencing discovery of novel and conserved microRNAs in trifoliate orange (Citrus trifoliata)</article-title>
<source>BMC Genomics</source>
<year>2010</year>
<volume>11</volume>
<fpage>431</fpage>
<pub-id pub-id-type="pmid">20626894</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<name>
<surname>Wang</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W-H</given-names>
</name>
<article-title>Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing</article-title>
<source>BMC Genomics</source>
<year>2011</year>
<volume>12</volume>
<fpage>367</fpage>
<pub-id pub-id-type="pmid">21762498</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<name>
<surname>Szittya</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Moxon</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Santos</surname>
<given-names>DM</given-names>
</name>
<name>
<surname>Jing</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Fevereiro</surname>
<given-names>MPS</given-names>
</name>
<name>
<surname>Moulton</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Dalmay</surname>
<given-names>T</given-names>
</name>
<article-title>High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families</article-title>
<source>BMC Genomics</source>
<year>2008</year>
<volume>9</volume>
<fpage>593</fpage>
<pub-id pub-id-type="pmid">19068109</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<name>
<surname>Song</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J</given-names>
</name>
<article-title>Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing</article-title>
<source>BMC Plant Biol</source>
<year>2011</year>
<volume>11</volume>
<fpage>5</fpage>
<pub-id pub-id-type="pmid">21219599</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="journal">
<name>
<surname>Martínez</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Forment</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Llave</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Pallás</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Gómez</surname>
<given-names>G</given-names>
</name>
<article-title>High-throughput sequencing, characterization and detection of new and conserved cucumber miRNAs</article-title>
<source>PLoS One</source>
<year>2011</year>
<volume>6</volume>
<fpage>e19523</fpage>
<pub-id pub-id-type="pmid">21603611</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<name>
<surname>Yang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<article-title>Differential miRNA expression in Rehmannia glutinosa plants subjected to continuous cropping</article-title>
<source>BMC Plant Biol</source>
<year>2011</year>
<volume>11</volume>
<fpage>53</fpage>
<pub-id pub-id-type="pmid">21439075</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<name>
<surname>Meyers</surname>
<given-names>BC</given-names>
</name>
<name>
<surname>Axtell</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>DP</given-names>
</name>
<name>
<surname>Baulcombe</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Bowman</surname>
<given-names>JL</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Carrington</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Green</surname>
<given-names>PJ</given-names>
</name>
<etal></etal>
<article-title>Criteria for annotation of plant microRNAs</article-title>
<source>Plant Cell</source>
<year>2008</year>
<volume>20</volume>
<fpage>3186</fpage>
<lpage>3190</lpage>
<pub-id pub-id-type="pmid">19074682</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<name>
<surname>Sunkar</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>JK</given-names>
</name>
<article-title>Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis</article-title>
<source>Plant Cell</source>
<year>2004</year>
<volume>16</volume>
<fpage>2001</fpage>
<pub-id pub-id-type="pmid">15258262</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<mixed-citation publication-type="journal">
<name>
<surname>Jones-Rhoades</surname>
<given-names>MW</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>DP</given-names>
</name>
<article-title>Computational identification of plant microRNAs and their targets, including a stress-induced miRNA</article-title>
<source>Mol Cell</source>
<year>2004</year>
<volume>14</volume>
<fpage>787</fpage>
<lpage>799</lpage>
<pub-id pub-id-type="pmid">15200956</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="journal">
<name>
<surname>Bonnet</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Wuyts</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Rouzé</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Van de Peer</surname>
<given-names>Y</given-names>
</name>
<article-title>Detection of 91 potential conserved plant microRNAs in Arabidopsis thaliana and Oryza sativa identifies important target genes</article-title>
<source>Proc Natl Acad Sci USA</source>
<year>2004</year>
<volume>101</volume>
<fpage>11511</fpage>
<lpage>11516</lpage>
<pub-id pub-id-type="pmid">15272084</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<name>
<surname>Zhang</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Cobb</surname>
<given-names>GP</given-names>
</name>
<name>
<surname>Anderson</surname>
<given-names>TA</given-names>
</name>
<article-title>Identification and characterization of new plant microRNAs using EST analysis</article-title>
<source>Cell Res</source>
<year>2005</year>
<volume>15</volume>
<fpage>336</fpage>
<lpage>360</lpage>
<pub-id pub-id-type="pmid">15916721</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<mixed-citation publication-type="journal">
<name>
<surname>Yu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Jia</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Nicholas</surname>
<given-names>KK</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Fang</surname>
<given-names>J</given-names>
</name>
<article-title>Computational identification of microRNAs in apple expressed sequence tags and validation of their precise sequences by miR-RACE</article-title>
<source>Physiol Plant</source>
<year>2011</year>
<volume>141</volume>
<fpage>56</fpage>
<lpage>70</lpage>
<pub-id pub-id-type="pmid">20875055</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<mixed-citation publication-type="journal">
<name>
<surname>Moxon</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Jing</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Szittya</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Schwach</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Rusholme Pilcher</surname>
<given-names>RL</given-names>
</name>
<name>
<surname>Moulton</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Dalmay</surname>
<given-names>T</given-names>
</name>
<article-title>Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening</article-title>
<source>Genome Res</source>
<year>2008</year>
<volume>18</volume>
<fpage>1602</fpage>
<pub-id pub-id-type="pmid">18653800</pub-id>
</mixed-citation>
</ref>
<ref id="B49">
<mixed-citation publication-type="journal">
<name>
<surname>Pang</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Woodward</surname>
<given-names>AW</given-names>
</name>
<name>
<surname>Agarwal</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Guan</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Ha</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ramachandran</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Triplett</surname>
<given-names>BA</given-names>
</name>
<name>
<surname>Stelly</surname>
<given-names>DM</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>ZJ</given-names>
</name>
<article-title>Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)</article-title>
<source>Genome Biol</source>
<year>2009</year>
<volume>10</volume>
<fpage>R122</fpage>
<pub-id pub-id-type="pmid">19889219</pub-id>
</mixed-citation>
</ref>
<ref id="B50">
<mixed-citation publication-type="journal">
<name>
<surname>Huang</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Fan</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Lucas</surname>
<given-names>WJ</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Ni</surname>
<given-names>P</given-names>
</name>
<article-title>The genome of the cucumber, Cucumis sativus L</article-title>
<source>Nat Genet</source>
<year>2009</year>
<volume>41</volume>
<fpage>1275</fpage>
<lpage>1281</lpage>
<pub-id pub-id-type="pmid">19881527</pub-id>
</mixed-citation>
</ref>
<ref id="B51">
<mixed-citation publication-type="journal">
<name>
<surname>Xu</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Nisbet</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>H</given-names>
</name>
<name>
<surname>He</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>X</given-names>
</name>
<article-title>Identification and characterization of microRNAs in Clonorchis sinensis of human health significance</article-title>
<source>BMC Genomics</source>
<year>2010</year>
<volume>11</volume>
<fpage>521</fpage>
<pub-id pub-id-type="pmid">20920166</pub-id>
</mixed-citation>
</ref>
<ref id="B52">
<mixed-citation publication-type="journal">
<name>
<surname>Bartel</surname>
<given-names>DP</given-names>
</name>
<article-title>MicroRNAs: genomics, biogenesis, mechanism, and function</article-title>
<source>Cell</source>
<year>2004</year>
<volume>116</volume>
<fpage>281</fpage>
<lpage>297</lpage>
<pub-id pub-id-type="pmid">14744438</pub-id>
</mixed-citation>
</ref>
<ref id="B53">
<mixed-citation publication-type="journal">
<name>
<surname>Yang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>L</given-names>
</name>
<article-title>Global analysis of gene-level microRNA expression in Arabidopsis using deep sequencing data</article-title>
<source>Genomics</source>
<year>2011</year>
<volume>98</volume>
<fpage>40</fpage>
<lpage>46</lpage>
<pub-id pub-id-type="pmid">21473907</pub-id>
</mixed-citation>
</ref>
<ref id="B54">
<mixed-citation publication-type="journal">
<name>
<surname>Wang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Itaya</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Zhong</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>van der Knaap</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Olmstead</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Qi</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>B</given-names>
</name>
<article-title>Function and evolution of a microRNA that regulates a CaZ + −ATPase and triggers the formation of phased small interfering RNAs in tomato reproductive growth</article-title>
<source>Plant Cell</source>
<year>2011</year>
<volume>23</volume>
<fpage>3185</fpage>
<lpage>3203</lpage>
<pub-id pub-id-type="pmid">21917547</pub-id>
</mixed-citation>
</ref>
<ref id="B55">
<mixed-citation publication-type="journal">
<name>
<surname>Wang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>H</given-names>
</name>
<article-title>Identification and characterization of maize microRNAs involved in the very early stage of seed germination</article-title>
<source>BMC Genomics</source>
<year>2011</year>
<volume>12</volume>
<fpage>154</fpage>
<pub-id pub-id-type="pmid">21414237</pub-id>
</mixed-citation>
</ref>
<ref id="B56">
<mixed-citation publication-type="journal">
<name>
<surname>Wang</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Kibet</surname>
<given-names>NK</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Fang</surname>
<given-names>J</given-names>
</name>
<article-title>Deep sequencing of grapevine flower and berry short RNA library for discovery of novel microRNAs and validation of precise sequences of grapevine microRNAs deposited in miRBase</article-title>
<source>Physiol Plant</source>
<year>2011</year>
<volume>143</volume>
<fpage>64</fpage>
<lpage>81</lpage>
<pub-id pub-id-type="pmid">21496033</pub-id>
</mixed-citation>
</ref>
<ref id="B57">
<mixed-citation publication-type="journal">
<name>
<surname>Pantaleo</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Szittya</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Moxon</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Miozzi</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Moulton</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Dalmay</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Burgyan</surname>
<given-names>J</given-names>
</name>
<article-title>Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis</article-title>
<source>Plant J</source>
<year>2010</year>
<volume>62</volume>
<fpage>960</fpage>
<lpage>976</lpage>
<pub-id pub-id-type="pmid">20230504</pub-id>
</mixed-citation>
</ref>
<ref id="B58">
<mixed-citation publication-type="journal">
<name>
<surname>Zhao</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>YJ</given-names>
</name>
<name>
<surname>Dinh</surname>
<given-names>TT</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X</given-names>
</name>
<article-title>miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floral meristems</article-title>
<source>Plant J</source>
<year>2007</year>
<volume>51</volume>
<fpage>840</fpage>
<lpage>849</lpage>
<pub-id pub-id-type="pmid">17573799</pub-id>
</mixed-citation>
</ref>
<ref id="B59">
<mixed-citation publication-type="journal">
<name>
<surname>Ji</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Yumul</surname>
<given-names>RE</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>YJ</given-names>
</name>
<name>
<surname>Dinh</surname>
<given-names>TT</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>B</given-names>
</name>
<etal></etal>
<article-title>ARGONAUTE10 and ARGONAUTE1 regulate the termination of floral stem cells through two microRNAs in Arabidopsis</article-title>
<source>PLoS Genet</source>
<year>2011</year>
<volume>7</volume>
<fpage>e1001358</fpage>
<pub-id pub-id-type="pmid">21483759</pub-id>
</mixed-citation>
</ref>
<ref id="B60">
<mixed-citation publication-type="journal">
<name>
<surname>Reinhart</surname>
<given-names>BJ</given-names>
</name>
<name>
<surname>Weinstein</surname>
<given-names>EG</given-names>
</name>
<name>
<surname>Rhoades</surname>
<given-names>MW</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>DP</given-names>
</name>
<article-title>MicroRNAs in plants</article-title>
<source>Genes Dev</source>
<year>2002</year>
<volume>16</volume>
<fpage>1616</fpage>
<lpage>1626</lpage>
<pub-id pub-id-type="pmid">12101121</pub-id>
</mixed-citation>
</ref>
<ref id="B61">
<mixed-citation publication-type="journal">
<name>
<surname>Licausi</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Weits</surname>
<given-names>DA</given-names>
</name>
<name>
<surname>Pant</surname>
<given-names>BD</given-names>
</name>
<name>
<surname>Scheible</surname>
<given-names>WR</given-names>
</name>
<name>
<surname>Geigenberger</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Van Dongen</surname>
<given-names>JT</given-names>
</name>
<article-title>Hypoxia responsive gene expression is mediated by various subsets of transcription factors and miRNAs that are determined by the actual oxygen availability</article-title>
<source>New Phytol</source>
<year>2011</year>
<volume>190</volume>
<fpage>442</fpage>
<lpage>456</lpage>
<pub-id pub-id-type="pmid">20840511</pub-id>
</mixed-citation>
</ref>
<ref id="B62">
<mixed-citation publication-type="journal">
<name>
<surname>Earley</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Smith</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Weber</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Gregory</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Poethig</surname>
<given-names>R</given-names>
</name>
<article-title>An endogenous F-box protein regulates ARGONAUTE1 in Arabidopsis thaliana</article-title>
<source>Silence</source>
<year>2010</year>
<volume>1</volume>
<fpage>1</fpage>
<lpage>10</lpage>
<pub-id pub-id-type="pmid">20226068</pub-id>
</mixed-citation>
</ref>
<ref id="B63">
<mixed-citation publication-type="journal">
<name>
<surname>Wang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Hua</surname>
<given-names>D</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Duan</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Hong</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>Z</given-names>
</name>
<article-title>Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis</article-title>
<source>PLoS Genet</source>
<year>2011</year>
<volume>7</volume>
<fpage>e1002172</fpage>
<pub-id pub-id-type="pmid">21779177</pub-id>
</mixed-citation>
</ref>
<ref id="B64">
<mixed-citation publication-type="journal">
<name>
<surname>Lim</surname>
<given-names>PO</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>IC</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>HJ</given-names>
</name>
<name>
<surname>Ryu</surname>
<given-names>JS</given-names>
</name>
<name>
<surname>Woo</surname>
<given-names>HR</given-names>
</name>
<name>
<surname>Nam</surname>
<given-names>HG</given-names>
</name>
<article-title>Auxin response factor 2 (ARF2) plays a major role in regulating auxin-mediated leaf longevity</article-title>
<source>J Exp Bot</source>
<year>2010</year>
<volume>61</volume>
<fpage>1419</fpage>
<lpage>1430</lpage>
<pub-id pub-id-type="pmid">20164142</pub-id>
</mixed-citation>
</ref>
<ref id="B65">
<mixed-citation publication-type="journal">
<name>
<surname>Ellis</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Nagpal</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Young</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Hagen</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Guilfoyle</surname>
<given-names>TJ</given-names>
</name>
<name>
<surname>Reed</surname>
<given-names>JW</given-names>
</name>
<article-title>AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana</article-title>
<source>Development</source>
<year>2005</year>
<volume>132</volume>
<fpage>4563</fpage>
<lpage>4574</lpage>
<pub-id pub-id-type="pmid">16176952</pub-id>
</mixed-citation>
</ref>
<ref id="B66">
<mixed-citation publication-type="journal">
<name>
<surname>Palatnik</surname>
<given-names>JF</given-names>
</name>
<name>
<surname>Wollmann</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Schommer</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Schwab</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Boisbouvier</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Rodriguez</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Warthmann</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Allen</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Dezulian</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Huson</surname>
<given-names>D</given-names>
</name>
<article-title>Sequence and expression differences underlie functional specialization of Arabidopsis microRNAs miR159 and miR319</article-title>
<source>Dev Cell</source>
<year>2007</year>
<volume>13</volume>
<fpage>115</fpage>
<lpage>125</lpage>
<pub-id pub-id-type="pmid">17609114</pub-id>
</mixed-citation>
</ref>
<ref id="B67">
<mixed-citation publication-type="journal">
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Qiao</surname>
<given-names>Y</given-names>
</name>
<article-title>Direct isolation of high-quality low molecular weight RNA of pear peel from the extraction mixture containing nucleic acid</article-title>
<source>Mol Biotechnol</source>
<year>2009</year>
<volume>44</volume>
<fpage>61</fpage>
<lpage>65</lpage>
<pub-id pub-id-type="pmid">19669950</pub-id>
</mixed-citation>
</ref>
<ref id="B68">
<mixed-citation publication-type="journal">
<name>
<surname>Zuker</surname>
<given-names>M</given-names>
</name>
<article-title>Mfold web server for nucleic acid folding and hybridization prediction</article-title>
<source>Nucleic Acids Res</source>
<year>2003</year>
<volume>31</volume>
<fpage>3406</fpage>
<lpage>3415</lpage>
<pub-id pub-id-type="pmid">12824337</pub-id>
</mixed-citation>
</ref>
<ref id="B69">
<mixed-citation publication-type="journal">
<name>
<surname>Jiang</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>Z</given-names>
</name>
<article-title>MiPred: classification of real and pseudo microRNA precursors using random forest prediction model with combined features</article-title>
<source>Nucleic Acids Res</source>
<year>2007</year>
<volume>35</volume>
<fpage>W339</fpage>
<lpage>W344</lpage>
<pub-id pub-id-type="pmid">17553836</pub-id>
</mixed-citation>
</ref>
<ref id="B70">
<mixed-citation publication-type="journal">
<name>
<surname>Li</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Ning</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>G</given-names>
</name>
<article-title>MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing</article-title>
<source>J Cell Biochem</source>
<year>2011</year>
<volume>112</volume>
<fpage>1318</fpage>
<lpage>1328</lpage>
<pub-id pub-id-type="pmid">21312241</pub-id>
</mixed-citation>
</ref>
<ref id="B71">
<mixed-citation publication-type="journal">
<name>
<surname>Allen</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Gustafson</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Carrington</surname>
<given-names>JC</given-names>
</name>
<article-title>microRNA-directed phasing during trans-acting siRNA biogenesis in plants</article-title>
<source>Cell</source>
<year>2005</year>
<volume>121</volume>
<fpage>207</fpage>
<lpage>221</lpage>
<pub-id pub-id-type="pmid">15851028</pub-id>
</mixed-citation>
</ref>
<ref id="B72">
<mixed-citation publication-type="journal">
<name>
<surname>Schwab</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Palatnik</surname>
<given-names>JF</given-names>
</name>
<name>
<surname>Riester</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Schommer</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Schmid</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Weigel</surname>
<given-names>D</given-names>
</name>
<article-title>Specific effects of microRNAs on the plant transcriptome</article-title>
<source>Dev Cell</source>
<year>2005</year>
<volume>8</volume>
<fpage>517</fpage>
<lpage>527</lpage>
<pub-id pub-id-type="pmid">15809034</pub-id>
</mixed-citation>
</ref>
<ref id="B73">
<mixed-citation publication-type="journal">
<name>
<surname>Fujii</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Chiou</surname>
<given-names>TJ</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>SI</given-names>
</name>
<name>
<surname>Aung</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>JK</given-names>
</name>
<article-title>A miRNA involved in phosphate-starvation response in Arabidopsis</article-title>
<source>Curr Biol</source>
<year>2005</year>
<volume>15</volume>
<fpage>2038</fpage>
<lpage>2043</lpage>
<pub-id pub-id-type="pmid">16303564</pub-id>
</mixed-citation>
</ref>
<ref id="B74">
<mixed-citation publication-type="journal">
<name>
<surname>Shi</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Chiang</surname>
<given-names>VL</given-names>
</name>
<article-title>Facile means for quantifying microRNA expression by real-time PCR</article-title>
<source>Biotechniques</source>
<year>2005</year>
<volume>39</volume>
<fpage>519</fpage>
<lpage>525</lpage>
<pub-id pub-id-type="pmid">16235564</pub-id>
</mixed-citation>
</ref>
<ref id="B75">
<mixed-citation publication-type="journal">
<name>
<surname>Ramakers</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ruijter</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Deprez</surname>
<given-names>RHL</given-names>
</name>
<name>
<surname>Moorman</surname>
<given-names>AFM</given-names>
</name>
<article-title>Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data</article-title>
<source>Neurosci Lett</source>
<year>2003</year>
<volume>339</volume>
<fpage>62</fpage>
<lpage>66</lpage>
<pub-id pub-id-type="pmid">12618301</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000B12 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000B12 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     PMC:3464595
   |texte=   High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i   -Sk "pubmed:22863067" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd   \
       | NlmPubMed2Wicri -a OrangerV1 

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024