Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 000630 ( Pmc/Corpus ); précédent : 0006299; suivant : 0006310 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Characterization of the cork oak transcriptome dynamics during acorn development</title>
<author>
<name sortKey="Miguel, Andreia" sort="Miguel, Andreia" uniqKey="Miguel A" first="Andreia" last="Miguel">Andreia Miguel</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="De Vega Bartol, Jose" sort="De Vega Bartol, Jose" uniqKey="De Vega Bartol J" first="José" last="De Vega-Bartol">José De Vega-Bartol</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff3">The Genome Analysis Centre, Norwich Research Park, Norwich, NR4 7UH, UK</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Marum, Liliana" sort="Marum, Liliana" uniqKey="Marum L" first="Liliana" last="Marum">Liliana Marum</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff4">KLÓN, Innovative Technologies from Cloning, Biocant Park, Núcleo 4, Lote 4A, 3060-197, Cantanhede, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chaves, Ines" sort="Chaves, Ines" uniqKey="Chaves I" first="Inês" last="Chaves">Inês Chaves</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Santo, Tatiana" sort="Santo, Tatiana" uniqKey="Santo T" first="Tatiana" last="Santo">Tatiana Santo</name>
<affiliation>
<nlm:aff id="Aff5">Laboratory of Genomics and Genetic Improvement, BioFIG, FCT, Universidade do Algarve, E.8, Campus de Gambelas, Faro, 8300 Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Leitao, Jose" sort="Leitao, Jose" uniqKey="Leitao J" first="José" last="Leitão">José Leitão</name>
<affiliation>
<nlm:aff id="Aff5">Laboratory of Genomics and Genetic Improvement, BioFIG, FCT, Universidade do Algarve, E.8, Campus de Gambelas, Faro, 8300 Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Varela, Maria Carolina" sort="Varela, Maria Carolina" uniqKey="Varela M" first="Maria Carolina" last="Varela">Maria Carolina Varela</name>
<affiliation>
<nlm:aff id="Aff6">INIAV- Instituto Nacional de Investigação Agrária e Veterinária, IP, Quinta do, Marquês Oeiras, 2780-159, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Miguel, Celia M" sort="Miguel, Celia M" uniqKey="Miguel C" first="Célia M." last="Miguel">Célia M. Miguel</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">26109289</idno>
<idno type="pmc">4479327</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4479327</idno>
<idno type="RBID">PMC:4479327</idno>
<idno type="doi">10.1186/s12870-015-0534-1</idno>
<date when="2015">2015</date>
<idno type="wicri:Area/Pmc/Corpus">000630</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Characterization of the cork oak transcriptome dynamics during acorn development</title>
<author>
<name sortKey="Miguel, Andreia" sort="Miguel, Andreia" uniqKey="Miguel A" first="Andreia" last="Miguel">Andreia Miguel</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="De Vega Bartol, Jose" sort="De Vega Bartol, Jose" uniqKey="De Vega Bartol J" first="José" last="De Vega-Bartol">José De Vega-Bartol</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff3">The Genome Analysis Centre, Norwich Research Park, Norwich, NR4 7UH, UK</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Marum, Liliana" sort="Marum, Liliana" uniqKey="Marum L" first="Liliana" last="Marum">Liliana Marum</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff4">KLÓN, Innovative Technologies from Cloning, Biocant Park, Núcleo 4, Lote 4A, 3060-197, Cantanhede, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chaves, Ines" sort="Chaves, Ines" uniqKey="Chaves I" first="Inês" last="Chaves">Inês Chaves</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Santo, Tatiana" sort="Santo, Tatiana" uniqKey="Santo T" first="Tatiana" last="Santo">Tatiana Santo</name>
<affiliation>
<nlm:aff id="Aff5">Laboratory of Genomics and Genetic Improvement, BioFIG, FCT, Universidade do Algarve, E.8, Campus de Gambelas, Faro, 8300 Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Leitao, Jose" sort="Leitao, Jose" uniqKey="Leitao J" first="José" last="Leitão">José Leitão</name>
<affiliation>
<nlm:aff id="Aff5">Laboratory of Genomics and Genetic Improvement, BioFIG, FCT, Universidade do Algarve, E.8, Campus de Gambelas, Faro, 8300 Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Varela, Maria Carolina" sort="Varela, Maria Carolina" uniqKey="Varela M" first="Maria Carolina" last="Varela">Maria Carolina Varela</name>
<affiliation>
<nlm:aff id="Aff6">INIAV- Instituto Nacional de Investigação Agrária e Veterinária, IP, Quinta do, Marquês Oeiras, 2780-159, Portugal</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Miguel, Celia M" sort="Miguel, Celia M" uniqKey="Miguel C" first="Célia M." last="Miguel">Célia M. Miguel</name>
<affiliation>
<nlm:aff id="Aff1">Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">BMC Plant Biology</title>
<idno type="eISSN">1471-2229</idno>
<imprint>
<date when="2015">2015</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>Cork oak (
<italic>Quercus suber</italic>
L.) has a natural distribution across western Mediterranean regions and is a keystone forest tree species in these ecosystems. The fruiting phase is especially critical for its regeneration but the molecular mechanisms underlying the biochemical and physiological changes during cork oak acorn development are poorly understood. In this study, the transcriptome of the cork oak acorn, including the seed, was characterized in five stages of development, from early development to acorn maturation, to identify the dominant processes in each stage and reveal transcripts with important functions in gene expression regulation and response to water.</p>
</sec>
<sec>
<title>Results</title>
<p>A total of 80,357 expressed sequence tags (ESTs) were
<italic>de novo</italic>
assembled from RNA-Seq libraries representative of the several acorn developmental stages. Approximately 7.6 % of the total number of transcripts present in
<italic>Q. suber</italic>
transcriptome was identified as acorn specific. The analysis of expression profiles during development returned 2,285 differentially expressed (DE) transcripts, which were clustered into six groups. The stage of development corresponding to the mature acorn exhibited an expression profile markedly different from other stages. Approximately 22 % of the DE transcripts putatively code for transcription factors (TF) or transcriptional regulators, and were found almost equally distributed among the several expression profile clusters, highlighting their major roles in controlling the whole developmental process. On the other hand, carbohydrate metabolism, the biological pathway most represented during acorn development, was especially prevalent in mid to late stages as evidenced by enrichment analysis. We further show that genes related to response to water, water deprivation and transport were mostly represented during the early (S2) and the last stage (S8) of acorn development, when tolerance to water desiccation is possibly critical for acorn viability.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>To our knowledge this work represents the first report of acorn development transcriptomics in oaks. The obtained results provide novel insights into the developmental biology of cork oak acorns, highlighting transcripts putatively involved in the regulation of the gene expression program and in specific processes likely essential for adaptation. It is expected that this knowledge can be transferred to other oak species of great ecological value.</p>
</sec>
<sec>
<title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/s12870-015-0534-1) contains supplementary material, which is available to authorized users.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Ruan, Yl" uniqKey="Ruan Y">YL Ruan</name>
</author>
<author>
<name sortKey="Patrick, Jw" uniqKey="Patrick J">JW Patrick</name>
</author>
<author>
<name sortKey="Bouzayen, M" uniqKey="Bouzayen M">M Bouzayen</name>
</author>
<author>
<name sortKey="Osorio, S" uniqKey="Osorio S">S Osorio</name>
</author>
<author>
<name sortKey="Fernie, Ar" uniqKey="Fernie A">AR Fernie</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Alba, R" uniqKey="Alba R">R Alba</name>
</author>
<author>
<name sortKey="Payton, P" uniqKey="Payton P">P Payton</name>
</author>
<author>
<name sortKey="Fei, Z" uniqKey="Fei Z">Z Fei</name>
</author>
<author>
<name sortKey="Mcquinn, R" uniqKey="Mcquinn R">R McQuinn</name>
</author>
<author>
<name sortKey="Debbie, P" uniqKey="Debbie P">P Debbie</name>
</author>
<author>
<name sortKey="Martin, Gb" uniqKey="Martin G">GB Martin</name>
</author>
<author>
<name sortKey="Tanksley, Sd" uniqKey="Tanksley S">SD Tanksley</name>
</author>
<author>
<name sortKey="Giovannoni, Jj" uniqKey="Giovannoni J">JJ Giovannoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rocco, M" uniqKey="Rocco M">M Rocco</name>
</author>
<author>
<name sortKey="D Mbrosio, C" uniqKey="D Mbrosio C">C D’Ambrosio</name>
</author>
<author>
<name sortKey="Arena, S" uniqKey="Arena S">S Arena</name>
</author>
<author>
<name sortKey="Mirelle, F" uniqKey="Mirelle F">F Mirelle</name>
</author>
<author>
<name sortKey="Scaloni, A" uniqKey="Scaloni A">A Scaloni</name>
</author>
<author>
<name sortKey="Marra, M" uniqKey="Marra M">M Marra</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mintz Oron, S" uniqKey="Mintz Oron S">S Mintz-Oron</name>
</author>
<author>
<name sortKey="Mandel, T" uniqKey="Mandel T">T Mandel</name>
</author>
<author>
<name sortKey="Rogachev, I" uniqKey="Rogachev I">I Rogachev</name>
</author>
<author>
<name sortKey="Feldberg, L" uniqKey="Feldberg L">L Feldberg</name>
</author>
<author>
<name sortKey="Lotan, O" uniqKey="Lotan O">O Lotan</name>
</author>
<author>
<name sortKey="Yativ, M" uniqKey="Yativ M">M Yativ</name>
</author>
<author>
<name sortKey="Wang, Z" uniqKey="Wang Z">Z Wang</name>
</author>
<author>
<name sortKey="Jetter, R" uniqKey="Jetter R">R Jetter</name>
</author>
<author>
<name sortKey="Venger, I" uniqKey="Venger I">I Venger</name>
</author>
<author>
<name sortKey="Adato, A" uniqKey="Adato A">A Adato</name>
</author>
<author>
<name sortKey="Aharoni, A" uniqKey="Aharoni A">A Aharoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vriezen, Wh" uniqKey="Vriezen W">WH Vriezen</name>
</author>
<author>
<name sortKey="Feron, R" uniqKey="Feron R">R Feron</name>
</author>
<author>
<name sortKey="Maretto, F" uniqKey="Maretto F">F Maretto</name>
</author>
<author>
<name sortKey="Keijman, J" uniqKey="Keijman J">J Keijman</name>
</author>
<author>
<name sortKey="Mariani, C" uniqKey="Mariani C">C Mariani</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Karlova, R" uniqKey="Karlova R">R Karlova</name>
</author>
<author>
<name sortKey="Rosin, Fm" uniqKey="Rosin F">FM Rosin</name>
</author>
<author>
<name sortKey="Busscher Lange, J" uniqKey="Busscher Lange J">J Busscher-Lange</name>
</author>
<author>
<name sortKey="Parapunova, V" uniqKey="Parapunova V">V Parapunova</name>
</author>
<author>
<name sortKey="Phuc, Td" uniqKey="Phuc T">TD Phuc</name>
</author>
<author>
<name sortKey="Fernie, Ar" uniqKey="Fernie A">AR Fernie</name>
</author>
<author>
<name sortKey="Fraser, Pd" uniqKey="Fraser P">PD Fraser</name>
</author>
<author>
<name sortKey="Baxter, C" uniqKey="Baxter C">C Baxter</name>
</author>
<author>
<name sortKey="Angenent, Gc" uniqKey="Angenent G">GC Angenent</name>
</author>
<author>
<name sortKey="Maagd, Ra" uniqKey="Maagd R">RA Maagd</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Osorio, S" uniqKey="Osorio S">S Osorio</name>
</author>
<author>
<name sortKey="Alba, R" uniqKey="Alba R">R Alba</name>
</author>
<author>
<name sortKey="Damasceno, Cmb" uniqKey="Damasceno C">CMB Damasceno</name>
</author>
<author>
<name sortKey="Lopez Casado, G" uniqKey="Lopez Casado G">G Lopez-Casado</name>
</author>
<author>
<name sortKey="Lohse, M" uniqKey="Lohse M">M Lohse</name>
</author>
<author>
<name sortKey="Zanor, Mi" uniqKey="Zanor M">MI Zanor</name>
</author>
<author>
<name sortKey="Tohge, T" uniqKey="Tohge T">T Tohge</name>
</author>
<author>
<name sortKey="Usadel, B" uniqKey="Usadel B">B Usadel</name>
</author>
<author>
<name sortKey="Rose, Jkc" uniqKey="Rose J">JKC Rose</name>
</author>
<author>
<name sortKey="Fei, Z" uniqKey="Fei Z">Z Fei</name>
</author>
<author>
<name sortKey="Giovannoni, Jj" uniqKey="Giovannoni J">JJ Giovannoni</name>
</author>
<author>
<name sortKey="Fernie, Ar" uniqKey="Fernie A">AR Fernie</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Goes, F" uniqKey="Goes F">F Goes</name>
</author>
<author>
<name sortKey="Iandolino, A" uniqKey="Iandolino A">A Iandolino</name>
</author>
<author>
<name sortKey="Al Kayal, F" uniqKey="Al Kayal F">F Al-kayal</name>
</author>
<author>
<name sortKey="Bohlmann, Mc" uniqKey="Bohlmann M">MC Bohlmann</name>
</author>
<author>
<name sortKey="Cushman, Ma" uniqKey="Cushman M">MA Cushman</name>
</author>
<author>
<name sortKey="Lim, H" uniqKey="Lim H">H Lim</name>
</author>
<author>
<name sortKey="Ergul, A" uniqKey="Ergul A">A Ergul</name>
</author>
<author>
<name sortKey="Figueroa, R" uniqKey="Figueroa R">R Figueroa</name>
</author>
<author>
<name sortKey="Kabuloglu, Ek" uniqKey="Kabuloglu E">EK Kabuloglu</name>
</author>
<author>
<name sortKey="Osborne, C" uniqKey="Osborne C">C Osborne</name>
</author>
<author>
<name sortKey="Rowe, J" uniqKey="Rowe J">J Rowe</name>
</author>
<author>
<name sortKey="Tattersall, E" uniqKey="Tattersall E">E Tattersall</name>
</author>
<author>
<name sortKey="Leslie, A" uniqKey="Leslie A">A Leslie</name>
</author>
<author>
<name sortKey="Xu, J" uniqKey="Xu J">J Xu</name>
</author>
<author>
<name sortKey="Baek, J" uniqKey="Baek J">J Baek</name>
</author>
<author>
<name sortKey="Cramer, Gr" uniqKey="Cramer G">GR Cramer</name>
</author>
<author>
<name sortKey="Cushman, Jc" uniqKey="Cushman J">JC Cushman</name>
</author>
<author>
<name sortKey="Cook, Dr" uniqKey="Cook D">DR Cook</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Peng, Fy" uniqKey="Peng F">FY Peng</name>
</author>
<author>
<name sortKey="Reid, Ke" uniqKey="Reid K">KE Reid</name>
</author>
<author>
<name sortKey="Liao, N" uniqKey="Liao N">N Liao</name>
</author>
<author>
<name sortKey="Schlosser, J" uniqKey="Schlosser J">J Schlosser</name>
</author>
<author>
<name sortKey="Lijavetzky, D" uniqKey="Lijavetzky D">D Lijavetzky</name>
</author>
<author>
<name sortKey="Holt, R" uniqKey="Holt R">R Holt</name>
</author>
<author>
<name sortKey="Martinez Zapater, Jm" uniqKey="Martinez Zapater J">JM Martínez Zapater</name>
</author>
<author>
<name sortKey="Jones, S" uniqKey="Jones S">S Jones</name>
</author>
<author>
<name sortKey="Marra, M" uniqKey="Marra M">M Marra</name>
</author>
<author>
<name sortKey="Bohlmann, J" uniqKey="Bohlmann J">J Bohlmann</name>
</author>
<author>
<name sortKey="Lund, St" uniqKey="Lund S">ST Lund</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sweetman, C" uniqKey="Sweetman C">C Sweetman</name>
</author>
<author>
<name sortKey="Wong, Dc" uniqKey="Wong D">DC Wong</name>
</author>
<author>
<name sortKey="Ford, Cm" uniqKey="Ford C">CM Ford</name>
</author>
<author>
<name sortKey="Drew, Dp" uniqKey="Drew D">DP Drew</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rowland, Lj" uniqKey="Rowland L">LJ Rowland</name>
</author>
<author>
<name sortKey="Alkharouf, N" uniqKey="Alkharouf N">N Alkharouf</name>
</author>
<author>
<name sortKey="Darwish, O" uniqKey="Darwish O">O Darwish</name>
</author>
<author>
<name sortKey="Ogden, El" uniqKey="Ogden E">EL Ogden</name>
</author>
<author>
<name sortKey="Polashock, Jj" uniqKey="Polashock J">JJ Polashock</name>
</author>
<author>
<name sortKey="Bassil, Nv" uniqKey="Bassil N">NV Bassil</name>
</author>
<author>
<name sortKey="Main, D" uniqKey="Main D">D Main</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yu, K" uniqKey="Yu K">K Yu</name>
</author>
<author>
<name sortKey="Xu, Q" uniqKey="Xu Q">Q Xu</name>
</author>
<author>
<name sortKey="Da, X" uniqKey="Da X">X Da</name>
</author>
<author>
<name sortKey="Guo, F" uniqKey="Guo F">F Guo</name>
</author>
<author>
<name sortKey="Ding, Y" uniqKey="Ding Y">Y Ding</name>
</author>
<author>
<name sortKey="Deng, X" uniqKey="Deng X">X Deng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Clepet, C" uniqKey="Clepet C">C Clepet</name>
</author>
<author>
<name sortKey="Joobeur, T" uniqKey="Joobeur T">T Joobeur</name>
</author>
<author>
<name sortKey="Zheng, Y" uniqKey="Zheng Y">Y Zheng</name>
</author>
<author>
<name sortKey="Jublot, D" uniqKey="Jublot D">D Jublot</name>
</author>
<author>
<name sortKey="Huang, M" uniqKey="Huang M">M Huang</name>
</author>
<author>
<name sortKey="Truniger, V" uniqKey="Truniger V">V Truniger</name>
</author>
<author>
<name sortKey="Boualem, A" uniqKey="Boualem A">A Boualem</name>
</author>
<author>
<name sortKey="Hernandez Gonzalez, Me" uniqKey="Hernandez Gonzalez M">ME Hernandez-Gonzalez</name>
</author>
<author>
<name sortKey="Dolcet Sanjuan, R" uniqKey="Dolcet Sanjuan R">R Dolcet-Sanjuan</name>
</author>
<author>
<name sortKey="Portnoy, V" uniqKey="Portnoy V">V Portnoy</name>
</author>
<author>
<name sortKey="Mascarell Creus, A" uniqKey="Mascarell Creus A">A Mascarell-Creus</name>
</author>
<author>
<name sortKey="Ca O Delgado, Ai" uniqKey="Ca O Delgado A">AI Caño-Delgado</name>
</author>
<author>
<name sortKey="Katzir, N" uniqKey="Katzir N">N Katzir</name>
</author>
<author>
<name sortKey="Bendahmane, A" uniqKey="Bendahmane A">A Bendahmane</name>
</author>
<author>
<name sortKey="Giovannoni, Jj" uniqKey="Giovannoni J">JJ Giovannoni</name>
</author>
<author>
<name sortKey="Aranda, Ma" uniqKey="Aranda M">MA Aranda</name>
</author>
<author>
<name sortKey="Garcia Mas, J" uniqKey="Garcia Mas J">J Garcia-Mas</name>
</author>
<author>
<name sortKey="Fei, Z" uniqKey="Fei Z">Z Fei</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moore, S" uniqKey="Moore S">S Moore</name>
</author>
<author>
<name sortKey="Vrebalov, J" uniqKey="Vrebalov J">J Vrebalov</name>
</author>
<author>
<name sortKey="Payton, P" uniqKey="Payton P">P Payton</name>
</author>
<author>
<name sortKey="Giovannoni, J" uniqKey="Giovannoni J">J Giovannoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fei, Z" uniqKey="Fei Z">Z Fei</name>
</author>
<author>
<name sortKey="Tang, X" uniqKey="Tang X">X Tang</name>
</author>
<author>
<name sortKey="Alba, Rm" uniqKey="Alba R">RM Alba</name>
</author>
<author>
<name sortKey="White, Ja" uniqKey="White J">JA White</name>
</author>
<author>
<name sortKey="Ronning, Cm" uniqKey="Ronning C">CM Ronning</name>
</author>
<author>
<name sortKey="Martin, Gb" uniqKey="Martin G">GB Martin</name>
</author>
<author>
<name sortKey="Tanksley, Sd" uniqKey="Tanksley S">SD Tanksley</name>
</author>
<author>
<name sortKey="Giovannoni, Jj" uniqKey="Giovannoni J">JJ Giovannoni</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Park, S" uniqKey="Park S">S Park</name>
</author>
<author>
<name sortKey="Sugimoto, N" uniqKey="Sugimoto N">N Sugimoto</name>
</author>
<author>
<name sortKey="Larson, Md" uniqKey="Larson M">MD Larson</name>
</author>
<author>
<name sortKey="Beaudry, R" uniqKey="Beaudry R">R Beaudry</name>
</author>
<author>
<name sortKey="Nocker, Sv" uniqKey="Nocker S">SV Nocker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, G" uniqKey="Zhang G">G Zhang</name>
</author>
<author>
<name sortKey="Pan, L" uniqKey="Pan L">L Pan</name>
</author>
<author>
<name sortKey="Yin, Y" uniqKey="Yin Y">Y Yin</name>
</author>
<author>
<name sortKey="Liu, W" uniqKey="Liu W">W Liu</name>
</author>
<author>
<name sortKey="Huang, D" uniqKey="Huang D">D Huang</name>
</author>
<author>
<name sortKey="Zhang, T" uniqKey="Zhang T">T Zhang</name>
</author>
<author>
<name sortKey="Wang, L" uniqKey="Wang L">L Wang</name>
</author>
<author>
<name sortKey="Xin, C" uniqKey="Xin C">C Xin</name>
</author>
<author>
<name sortKey="Lin, Q" uniqKey="Lin Q">Q Lin</name>
</author>
<author>
<name sortKey="Sun, G" uniqKey="Sun G">G Sun</name>
</author>
<author>
<name sortKey="Abdullah, Mmb" uniqKey="Abdullah M">MMB Abdullah</name>
</author>
<author>
<name sortKey="Zhang, X" uniqKey="Zhang X">X Zhang</name>
</author>
<author>
<name sortKey="Hu, S" uniqKey="Hu S">S Hu</name>
</author>
<author>
<name sortKey="Al Mssallem, Is" uniqKey="Al Mssallem I">IS Al-Mssallem</name>
</author>
<author>
<name sortKey="Yu, J" uniqKey="Yu J">J Yu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bugalho, Mn" uniqKey="Bugalho M">MN Bugalho</name>
</author>
<author>
<name sortKey="Caldeira, Mc" uniqKey="Caldeira M">MC Caldeira</name>
</author>
<author>
<name sortKey="Pereira, Js" uniqKey="Pereira J">JS Pereira</name>
</author>
<author>
<name sortKey="Aronson, J" uniqKey="Aronson J">J Aronson</name>
</author>
<author>
<name sortKey="Pausas, Jg" uniqKey="Pausas J">JG Pausas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Aronson, J" uniqKey="Aronson J">J Aronson</name>
</author>
<author>
<name sortKey="Pereira, Js" uniqKey="Pereira J">JS Pereira</name>
</author>
<author>
<name sortKey="Pausas, Jg" uniqKey="Pausas J">JG Pausas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ramirez Valiente, J" uniqKey="Ramirez Valiente J">J Ramírez-Valiente</name>
</author>
<author>
<name sortKey="Lorenzo, Z" uniqKey="Lorenzo Z">Z Lorenzo</name>
</author>
<author>
<name sortKey="Soto, A" uniqKey="Soto A">A Soto</name>
</author>
<author>
<name sortKey="Valladares, F" uniqKey="Valladares F">F Valladares</name>
</author>
<author>
<name sortKey="Gil, L" uniqKey="Gil L">L Gil</name>
</author>
<author>
<name sortKey="Aranda, I" uniqKey="Aranda I">I Aranda</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Silva, Sp" uniqKey="Silva S">SP Silva</name>
</author>
<author>
<name sortKey="Sabino, Ma" uniqKey="Sabino M">MA Sabino</name>
</author>
<author>
<name sortKey="Fernandes, Em" uniqKey="Fernandes E">EM Fernandes</name>
</author>
<author>
<name sortKey="Correlo, Vm" uniqKey="Correlo V">VM Correlo</name>
</author>
<author>
<name sortKey="Boesel, Lf" uniqKey="Boesel L">LF Boesel</name>
</author>
<author>
<name sortKey="Reis, Rl" uniqKey="Reis R">RL Reis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Corti, R" uniqKey="Corti R">R Corti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Merouani, H" uniqKey="Merouani H">H Merouani</name>
</author>
<author>
<name sortKey="Apolinario, L" uniqKey="Apolinario L">L Apolinário</name>
</author>
<author>
<name sortKey="Almeida, M" uniqKey="Almeida M">M Almeida</name>
</author>
<author>
<name sortKey="Pereira, J" uniqKey="Pereira J">J Pereira</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Diaz Fernandez, Pm" uniqKey="Diaz Fernandez P">PM Díaz-Fernández</name>
</author>
<author>
<name sortKey="Climent, J" uniqKey="Climent J">J Climent</name>
</author>
<author>
<name sortKey="Gil, L" uniqKey="Gil L">L Gil</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pons, J" uniqKey="Pons J">J Pons</name>
</author>
<author>
<name sortKey="Pausas, Jg" uniqKey="Pausas J">JG Pausas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ramirez Valiente, Ja" uniqKey="Ramirez Valiente J">JA Ramírez-Valiente</name>
</author>
<author>
<name sortKey="Valladares, F" uniqKey="Valladares F">F Valladares</name>
</author>
<author>
<name sortKey="Gil, L" uniqKey="Gil L">L Gil</name>
</author>
<author>
<name sortKey="Aranda, I" uniqKey="Aranda I">I Aranda</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bonito, A" uniqKey="Bonito A">A Bonito</name>
</author>
<author>
<name sortKey="Varone, L" uniqKey="Varone L">L Varone</name>
</author>
<author>
<name sortKey="Gratani, L" uniqKey="Gratani L">L Gratani</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moles, At" uniqKey="Moles A">AT Moles</name>
</author>
<author>
<name sortKey="Westoby, M" uniqKey="Westoby M">M Westoby</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="G Mez, Jm" uniqKey="G Mez J">JM Gómez</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Boavida, Lc" uniqKey="Boavida L">LC Boavida</name>
</author>
<author>
<name sortKey="Varela, C" uniqKey="Varela C">C Varela</name>
</author>
<author>
<name sortKey="Feij, Ja" uniqKey="Feij J">JA Feijó</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Elena Rosello, J" uniqKey="Elena Rosello J">J Elena-Rosello</name>
</author>
<author>
<name sortKey="Rio, J" uniqKey="Rio J">J Rio</name>
</author>
<author>
<name sortKey="Valdecantos, Jg" uniqKey="Valdecantos J">JG Valdecantos</name>
</author>
<author>
<name sortKey="Santamaria, I" uniqKey="Santamaria I">I Santamaria</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Boavida, Lc" uniqKey="Boavida L">LC Boavida</name>
</author>
<author>
<name sortKey="Silva, Jp" uniqKey="Silva J">JP Silva</name>
</author>
<author>
<name sortKey="Feij, Ja" uniqKey="Feij J">JA Feijó</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Varela, M" uniqKey="Varela M">M Varela</name>
</author>
<author>
<name sortKey="Valdiviesso, T" uniqKey="Valdiviesso T">T Valdiviesso</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rocheta, M" uniqKey="Rocheta M">M Rocheta</name>
</author>
<author>
<name sortKey="Sobral, R" uniqKey="Sobral R">R Sobral</name>
</author>
<author>
<name sortKey="Magalhaes, J" uniqKey="Magalhaes J">J Magalhães</name>
</author>
<author>
<name sortKey="Amorim, Mi" uniqKey="Amorim M">MI Amorim</name>
</author>
<author>
<name sortKey="Ribeiro, T" uniqKey="Ribeiro T">T Ribeiro</name>
</author>
<author>
<name sortKey="Pinheiro, M" uniqKey="Pinheiro M">M Pinheiro</name>
</author>
<author>
<name sortKey="Egas, C" uniqKey="Egas C">C Egas</name>
</author>
<author>
<name sortKey="Morais Cecilio, L" uniqKey="Morais Cecilio L">L Morais-Cecílio</name>
</author>
<author>
<name sortKey="Costa, Mmr" uniqKey="Costa M">MMR Costa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Borgardt, S" uniqKey="Borgardt S">S Borgardt</name>
</author>
<author>
<name sortKey="Nixon, K" uniqKey="Nixon K">K Nixon</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ueno, S" uniqKey="Ueno S">S Ueno</name>
</author>
<author>
<name sortKey="Le Provost, G" uniqKey="Le Provost G">G Le Provost</name>
</author>
<author>
<name sortKey="Leger, V" uniqKey="Leger V">V Léger</name>
</author>
<author>
<name sortKey="Klopp, C" uniqKey="Klopp C">C Klopp</name>
</author>
<author>
<name sortKey="Noirot, C" uniqKey="Noirot C">C Noirot</name>
</author>
<author>
<name sortKey="Frigerio, J M" uniqKey="Frigerio J">J-M Frigerio</name>
</author>
<author>
<name sortKey="Salin, F" uniqKey="Salin F">F Salin</name>
</author>
<author>
<name sortKey="Salse, J" uniqKey="Salse J">J Salse</name>
</author>
<author>
<name sortKey="Abrouk, M" uniqKey="Abrouk M">M Abrouk</name>
</author>
<author>
<name sortKey="Murat, F" uniqKey="Murat F">F Murat</name>
</author>
<author>
<name sortKey="Brendel, O" uniqKey="Brendel O">O Brendel</name>
</author>
<author>
<name sortKey="Derory, J" uniqKey="Derory J">J Derory</name>
</author>
<author>
<name sortKey="Abadie, P" uniqKey="Abadie P">P Abadie</name>
</author>
<author>
<name sortKey="Leger, P" uniqKey="Leger P">P Léger</name>
</author>
<author>
<name sortKey="Cabane, C" uniqKey="Cabane C">C Cabane</name>
</author>
<author>
<name sortKey="Barre, A" uniqKey="Barre A">A Barré</name>
</author>
<author>
<name sortKey="De Daruvar, A" uniqKey="De Daruvar A">A de Daruvar</name>
</author>
<author>
<name sortKey="Couloux, A" uniqKey="Couloux A">A Couloux</name>
</author>
<author>
<name sortKey="Wincker, P" uniqKey="Wincker P">P Wincker</name>
</author>
<author>
<name sortKey="Reviron, M P" uniqKey="Reviron M">M-P Reviron</name>
</author>
<author>
<name sortKey="Kremer, A" uniqKey="Kremer A">A Kremer</name>
</author>
<author>
<name sortKey="Plomion, C" uniqKey="Plomion C">C Plomion</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ueno, S" uniqKey="Ueno S">S Ueno</name>
</author>
<author>
<name sortKey="Klopp, C" uniqKey="Klopp C">C Klopp</name>
</author>
<author>
<name sortKey="Leple, Jc" uniqKey="Leple J">JC Leplé</name>
</author>
<author>
<name sortKey="Derory, J" uniqKey="Derory J">J Derory</name>
</author>
<author>
<name sortKey="Noirot, C" uniqKey="Noirot C">C Noirot</name>
</author>
<author>
<name sortKey="Leger, V" uniqKey="Leger V">V Léger</name>
</author>
<author>
<name sortKey="Prince, E" uniqKey="Prince E">E Prince</name>
</author>
<author>
<name sortKey="Kremer, A" uniqKey="Kremer A">A Kremer</name>
</author>
<author>
<name sortKey="Plomion, C" uniqKey="Plomion C">C Plomion</name>
</author>
<author>
<name sortKey="Le Provost, G" uniqKey="Le Provost G">G Le Provost</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rampant, Pf" uniqKey="Rampant P">PF Rampant</name>
</author>
<author>
<name sortKey="Lesur, I" uniqKey="Lesur I">I Lesur</name>
</author>
<author>
<name sortKey="Boussardon, C" uniqKey="Boussardon C">C Boussardon</name>
</author>
<author>
<name sortKey="Bitton, F" uniqKey="Bitton F">F Bitton</name>
</author>
<author>
<name sortKey="Martin Magniette, M L" uniqKey="Martin Magniette M">M-L Martin-Magniette</name>
</author>
<author>
<name sortKey="Bodenes, C" uniqKey="Bodenes C">C Bodénès</name>
</author>
<author>
<name sortKey="Le Provost, G" uniqKey="Le Provost G">G Le Provost</name>
</author>
<author>
<name sortKey="Berges, H" uniqKey="Berges H">H Bergès</name>
</author>
<author>
<name sortKey="Fluch, S" uniqKey="Fluch S">S Fluch</name>
</author>
<author>
<name sortKey="Kremer, A" uniqKey="Kremer A">A Kremer</name>
</author>
<author>
<name sortKey="Plomion, C" uniqKey="Plomion C">C Plomion</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pereira Leal, Jb" uniqKey="Pereira Leal J">JB Pereira-Leal</name>
</author>
<author>
<name sortKey="Abreu, Ia" uniqKey="Abreu I">IA Abreu</name>
</author>
<author>
<name sortKey="Alabaca, Cs" uniqKey="Alabaca C">CS Alabaça</name>
</author>
<author>
<name sortKey="Almeida, Mh" uniqKey="Almeida M">MH Almeida</name>
</author>
<author>
<name sortKey="Almeida, P" uniqKey="Almeida P">P Almeida</name>
</author>
<author>
<name sortKey="Almeida, T" uniqKey="Almeida T">T Almeida</name>
</author>
<author>
<name sortKey="Amorim, Mi" uniqKey="Amorim M">MI Amorim</name>
</author>
<author>
<name sortKey="Araujo, S" uniqKey="Araujo S">S Araújo</name>
</author>
<author>
<name sortKey="Azevedo, H" uniqKey="Azevedo H">H Azevedo</name>
</author>
<author>
<name sortKey="Badia, A" uniqKey="Badia A">A Badia</name>
</author>
<author>
<name sortKey="Batista, D" uniqKey="Batista D">D Batista</name>
</author>
<author>
<name sortKey="Bohn, A" uniqKey="Bohn A">A Bohn</name>
</author>
<author>
<name sortKey="Capote, T" uniqKey="Capote T">T Capote</name>
</author>
<author>
<name sortKey="Carrasquinho, I" uniqKey="Carrasquinho I">I Carrasquinho</name>
</author>
<author>
<name sortKey="Chaves, I" uniqKey="Chaves I">I Chaves</name>
</author>
<author>
<name sortKey="Coelho, Ac" uniqKey="Coelho A">AC Coelho</name>
</author>
<author>
<name sortKey="Costa, Mm" uniqKey="Costa M">MM Costa</name>
</author>
<author>
<name sortKey="Costa, R" uniqKey="Costa R">R Costa</name>
</author>
<author>
<name sortKey="Cravador, A" uniqKey="Cravador A">A Cravador</name>
</author>
<author>
<name sortKey="Egas, C" uniqKey="Egas C">C Egas</name>
</author>
<author>
<name sortKey="Faro, C" uniqKey="Faro C">C Faro</name>
</author>
<author>
<name sortKey="Fortes, Am" uniqKey="Fortes A">AM Fortes</name>
</author>
<author>
<name sortKey="Fortunato, As" uniqKey="Fortunato A">AS Fortunato</name>
</author>
<author>
<name sortKey="Gaspar, Mj" uniqKey="Gaspar M">MJ Gaspar</name>
</author>
<author>
<name sortKey="Goncalves, S" uniqKey="Goncalves S">S Gonçalves</name>
</author>
<author>
<name sortKey="Graca, J" uniqKey="Graca J">J Graça</name>
</author>
<author>
<name sortKey="Horta, M" uniqKey="Horta M">M Horta</name>
</author>
<author>
<name sortKey="Inacio, V" uniqKey="Inacio V">V Inácio</name>
</author>
<author>
<name sortKey="Leitao, Jm" uniqKey="Leitao J">JM Leitão</name>
</author>
<author>
<name sortKey="Lino Neto, T" uniqKey="Lino Neto T">T Lino-Neto</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seymour, Gb" uniqKey="Seymour G">GB Seymour</name>
</author>
<author>
<name sortKey=" Stergaard, L" uniqKey=" Stergaard L">L Østergaard</name>
</author>
<author>
<name sortKey="Chapman, Nh" uniqKey="Chapman N">NH Chapman</name>
</author>
<author>
<name sortKey="Knapp, S" uniqKey="Knapp S">S Knapp</name>
</author>
<author>
<name sortKey="Martin, C" uniqKey="Martin C">C Martin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Van Der Pijl, L" uniqKey="Van Der Pijl L">L Van der Pijl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chan, Yh" uniqKey="Chan Y">YH Chan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Margulies, M" uniqKey="Margulies M">M Margulies</name>
</author>
<author>
<name sortKey="Egholm, M" uniqKey="Egholm M">M Egholm</name>
</author>
<author>
<name sortKey="Altman, We" uniqKey="Altman W">WE Altman</name>
</author>
<author>
<name sortKey="Attiya, S" uniqKey="Attiya S">S Attiya</name>
</author>
<author>
<name sortKey="Bader, Js" uniqKey="Bader J">JS Bader</name>
</author>
<author>
<name sortKey="Bemben, La" uniqKey="Bemben L">LA Bemben</name>
</author>
<author>
<name sortKey="Berka, J" uniqKey="Berka J">J Berka</name>
</author>
<author>
<name sortKey="Braverman, Ms" uniqKey="Braverman M">MS Braverman</name>
</author>
<author>
<name sortKey="Chen, Y J" uniqKey="Chen Y">Y-J Chen</name>
</author>
<author>
<name sortKey="Chen, Z" uniqKey="Chen Z">Z Chen</name>
</author>
<author>
<name sortKey="Dewell, Sb" uniqKey="Dewell S">SB Dewell</name>
</author>
<author>
<name sortKey="Du, L" uniqKey="Du L">L Du</name>
</author>
<author>
<name sortKey="Fierro, Jm" uniqKey="Fierro J">JM Fierro</name>
</author>
<author>
<name sortKey="Gomes, Xv" uniqKey="Gomes X">XV Gomes</name>
</author>
<author>
<name sortKey="Godwin, Bc" uniqKey="Godwin B">BC Godwin</name>
</author>
<author>
<name sortKey="He, W" uniqKey="He W">W He</name>
</author>
<author>
<name sortKey="Helgesen, S" uniqKey="Helgesen S">S Helgesen</name>
</author>
<author>
<name sortKey="Ho, Ch" uniqKey="Ho C">CH Ho</name>
</author>
<author>
<name sortKey="Ho, Ch" uniqKey="Ho C">CH Ho</name>
</author>
<author>
<name sortKey="Irzyk, Gp" uniqKey="Irzyk G">GP Irzyk</name>
</author>
<author>
<name sortKey="Jando, Sc" uniqKey="Jando S">SC Jando</name>
</author>
<author>
<name sortKey="Alenquer, Mli" uniqKey="Alenquer M">MLI Alenquer</name>
</author>
<author>
<name sortKey="Jarvie, Tp" uniqKey="Jarvie T">TP Jarvie</name>
</author>
<author>
<name sortKey="Jirage, Kb" uniqKey="Jirage K">KB Jirage</name>
</author>
<author>
<name sortKey="Kim, J B" uniqKey="Kim J">J-B Kim</name>
</author>
<author>
<name sortKey="Knight, Jr" uniqKey="Knight J">JR Knight</name>
</author>
<author>
<name sortKey="Lanza, Jr" uniqKey="Lanza J">JR Lanza</name>
</author>
<author>
<name sortKey="Leamon, Jh" uniqKey="Leamon J">JH Leamon</name>
</author>
<author>
<name sortKey="Lefkowitz, Sm" uniqKey="Lefkowitz S">SM Lefkowitz</name>
</author>
<author>
<name sortKey="Lei, M" uniqKey="Lei M">M Lei</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chevreux, B" uniqKey="Chevreux B">B Chevreux</name>
</author>
<author>
<name sortKey="Pfisterer, T" uniqKey="Pfisterer T">T Pfisterer</name>
</author>
<author>
<name sortKey="Drescher, B" uniqKey="Drescher B">B Drescher</name>
</author>
<author>
<name sortKey="Driesel, Aj" uniqKey="Driesel A">AJ Driesel</name>
</author>
<author>
<name sortKey="Muller, Weg" uniqKey="Muller W">WEG Müller</name>
</author>
<author>
<name sortKey="Wetter, T" uniqKey="Wetter T">T Wetter</name>
</author>
<author>
<name sortKey="Suhai, S" uniqKey="Suhai S">S Suhai</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Weber, Apm" uniqKey="Weber A">APM Weber</name>
</author>
<author>
<name sortKey="Weber, Kl" uniqKey="Weber K">KL Weber</name>
</author>
<author>
<name sortKey="Carr, K" uniqKey="Carr K">K Carr</name>
</author>
<author>
<name sortKey="Wilkerson, C" uniqKey="Wilkerson C">C Wilkerson</name>
</author>
<author>
<name sortKey="Ohlrogge, Jb" uniqKey="Ohlrogge J">JB Ohlrogge</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kumar, S" uniqKey="Kumar S">S Kumar</name>
</author>
<author>
<name sortKey="Blaxter, Ml" uniqKey="Blaxter M">ML Blaxter</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Garg, R" uniqKey="Garg R">R Garg</name>
</author>
<author>
<name sortKey="Patel, Rk" uniqKey="Patel R">RK Patel</name>
</author>
<author>
<name sortKey="Jhanwar, S" uniqKey="Jhanwar S">S Jhanwar</name>
</author>
<author>
<name sortKey="Priya, P" uniqKey="Priya P">P Priya</name>
</author>
<author>
<name sortKey="Bhattacharjee, A" uniqKey="Bhattacharjee A">A Bhattacharjee</name>
</author>
<author>
<name sortKey="Yadav, G" uniqKey="Yadav G">G Yadav</name>
</author>
<author>
<name sortKey="Bhatia, S" uniqKey="Bhatia S">S Bhatia</name>
</author>
<author>
<name sortKey="Chattopadhyay, D" uniqKey="Chattopadhyay D">D Chattopadhyay</name>
</author>
<author>
<name sortKey="Tyagi, Ak" uniqKey="Tyagi A">AK Tyagi</name>
</author>
<author>
<name sortKey="Jain, M" uniqKey="Jain M">M Jain</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mundry, M" uniqKey="Mundry M">M Mundry</name>
</author>
<author>
<name sortKey="Bornberg Bauer, E" uniqKey="Bornberg Bauer E">E Bornberg-Bauer</name>
</author>
<author>
<name sortKey="Sammeth, M" uniqKey="Sammeth M">M Sammeth</name>
</author>
<author>
<name sortKey="Feulner, Pgd" uniqKey="Feulner P">PGD Feulner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Huang, X" uniqKey="Huang X">X Huang</name>
</author>
<author>
<name sortKey="Madan, A" uniqKey="Madan A">A Madan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Koch, K" uniqKey="Koch K">K Koch</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baroja Fernandez, E" uniqKey="Baroja Fernandez E">E Baroja-Fernández</name>
</author>
<author>
<name sortKey="Mu Oz, Fj" uniqKey="Mu Oz F">FJ Muñoz</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Bahaji, A" uniqKey="Bahaji A">A Bahaji</name>
</author>
<author>
<name sortKey="Almagro, G" uniqKey="Almagro G">G Almagro</name>
</author>
<author>
<name sortKey="Montero, M" uniqKey="Montero M">M Montero</name>
</author>
<author>
<name sortKey="Etxeberria, E" uniqKey="Etxeberria E">E Etxeberria</name>
</author>
<author>
<name sortKey="Hidalgo, M" uniqKey="Hidalgo M">M Hidalgo</name>
</author>
<author>
<name sortKey="Sesma, Mt" uniqKey="Sesma M">MT Sesma</name>
</author>
<author>
<name sortKey="Pozueta Romero, J" uniqKey="Pozueta Romero J">J Pozueta-Romero</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bray, Ea" uniqKey="Bray E">EA Bray</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Le, Bh" uniqKey="Le B">BH Le</name>
</author>
<author>
<name sortKey="Cheng, C" uniqKey="Cheng C">C Cheng</name>
</author>
<author>
<name sortKey="Bui, Aq" uniqKey="Bui A">AQ Bui</name>
</author>
<author>
<name sortKey="Wagmaister, Ja" uniqKey="Wagmaister J">JA Wagmaister</name>
</author>
<author>
<name sortKey="Henry, Kf" uniqKey="Henry K">KF Henry</name>
</author>
<author>
<name sortKey="Pelletier, J" uniqKey="Pelletier J">J Pelletier</name>
</author>
<author>
<name sortKey="Kwong, L" uniqKey="Kwong L">L Kwong</name>
</author>
<author>
<name sortKey="Belmonte, M" uniqKey="Belmonte M">M Belmonte</name>
</author>
<author>
<name sortKey="Kirkbride, R" uniqKey="Kirkbride R">R Kirkbride</name>
</author>
<author>
<name sortKey="Horvath, S" uniqKey="Horvath S">S Horvath</name>
</author>
<author>
<name sortKey="Drews, Gn" uniqKey="Drews G">GN Drews</name>
</author>
<author>
<name sortKey="Fischer, Rl" uniqKey="Fischer R">RL Fischer</name>
</author>
<author>
<name sortKey="Okamuro, Jk" uniqKey="Okamuro J">JK Okamuro</name>
</author>
<author>
<name sortKey="Harada, Jj" uniqKey="Harada J">JJ Harada</name>
</author>
<author>
<name sortKey="Goldberg, Rb" uniqKey="Goldberg R">RB Goldberg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Barnabas, B" uniqKey="Barnabas B">B Barnabás</name>
</author>
<author>
<name sortKey="J Ger, K" uniqKey="J Ger K">K Jäger</name>
</author>
<author>
<name sortKey="Feher, A" uniqKey="Feher A">A Fehér</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fujita, M" uniqKey="Fujita M">M Fujita</name>
</author>
<author>
<name sortKey="Fujita, Y" uniqKey="Fujita Y">Y Fujita</name>
</author>
<author>
<name sortKey="Maruyama, K" uniqKey="Maruyama K">K Maruyama</name>
</author>
<author>
<name sortKey="Seki, M" uniqKey="Seki M">M Seki</name>
</author>
<author>
<name sortKey="Hiratsu, K" uniqKey="Hiratsu K">K Hiratsu</name>
</author>
<author>
<name sortKey="Ohme Takagi, M" uniqKey="Ohme Takagi M">M Ohme-Takagi</name>
</author>
<author>
<name sortKey="Tran, L Sp" uniqKey="Tran L">L-SP Tran</name>
</author>
<author>
<name sortKey="Yamaguchi Shinozaki, K" uniqKey="Yamaguchi Shinozaki K">K Yamaguchi-Shinozaki</name>
</author>
<author>
<name sortKey="Shinozaki, K" uniqKey="Shinozaki K">K Shinozaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yamaguchi Shinozaki, K" uniqKey="Yamaguchi Shinozaki K">K Yamaguchi-Shinozaki</name>
</author>
<author>
<name sortKey="Shinozaki, K" uniqKey="Shinozaki K">K Shinozaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tran, Lp" uniqKey="Tran L">LP Tran</name>
</author>
<author>
<name sortKey="Nakashima, K" uniqKey="Nakashima K">K Nakashima</name>
</author>
<author>
<name sortKey="Sakuma, Y" uniqKey="Sakuma Y">Y Sakuma</name>
</author>
<author>
<name sortKey="Simpson, Sd" uniqKey="Simpson S">SD Simpson</name>
</author>
<author>
<name sortKey="Fujita, Y" uniqKey="Fujita Y">Y Fujita</name>
</author>
<author>
<name sortKey="Maruyama, K" uniqKey="Maruyama K">K Maruyama</name>
</author>
<author>
<name sortKey="Fujita, M" uniqKey="Fujita M">M Fujita</name>
</author>
<author>
<name sortKey="Seki, M" uniqKey="Seki M">M Seki</name>
</author>
<author>
<name sortKey="Shinozaki, K" uniqKey="Shinozaki K">K Shinozaki</name>
</author>
<author>
<name sortKey="Yamaguchi Shinozaki, K" uniqKey="Yamaguchi Shinozaki K">K Yamaguchi-shinozaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Singh, Ak" uniqKey="Singh A">AK Singh</name>
</author>
<author>
<name sortKey="Sharma, V" uniqKey="Sharma V">V Sharma</name>
</author>
<author>
<name sortKey="Pal, Ak" uniqKey="Pal A">AK Pal</name>
</author>
<author>
<name sortKey="Acharya, V" uniqKey="Acharya V">V Acharya</name>
</author>
<author>
<name sortKey="Ahuja, Ps" uniqKey="Ahuja P">PS Ahuja</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xu, H" uniqKey="Xu H">H Xu</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
<author>
<name sortKey="Yan, Y" uniqKey="Yan Y">Y Yan</name>
</author>
<author>
<name sortKey="Wang, K" uniqKey="Wang K">K Wang</name>
</author>
<author>
<name sortKey="Gao, Y" uniqKey="Gao Y">Y Gao</name>
</author>
<author>
<name sortKey="Hu, Y" uniqKey="Hu Y">Y Hu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Park, My" uniqKey="Park M">MY Park</name>
</author>
<author>
<name sortKey="Chung, Ms" uniqKey="Chung M">MS Chung</name>
</author>
<author>
<name sortKey="Koh, Hs" uniqKey="Koh H">HS Koh</name>
</author>
<author>
<name sortKey="Lee, Dj" uniqKey="Lee D">DJ Lee</name>
</author>
<author>
<name sortKey="Ahn, Sj" uniqKey="Ahn S">SJ Ahn</name>
</author>
<author>
<name sortKey="Kim, Cs" uniqKey="Kim C">CS Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Song, H" uniqKey="Song H">H Song</name>
</author>
<author>
<name sortKey="Zhao, R" uniqKey="Zhao R">R Zhao</name>
</author>
<author>
<name sortKey="Fan, P" uniqKey="Fan P">P Fan</name>
</author>
<author>
<name sortKey="Wang, X" uniqKey="Wang X">X Wang</name>
</author>
<author>
<name sortKey="Chen, X" uniqKey="Chen X">X Chen</name>
</author>
<author>
<name sortKey="Li, Y" uniqKey="Li Y">Y Li</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, Ey" uniqKey="Kim E">EY Kim</name>
</author>
<author>
<name sortKey="Seo, Ys" uniqKey="Seo Y">YS Seo</name>
</author>
<author>
<name sortKey="Park, Ky" uniqKey="Park K">KY Park</name>
</author>
<author>
<name sortKey="Kim, Sj" uniqKey="Kim S">SJ Kim</name>
</author>
<author>
<name sortKey="Kim, Wt" uniqKey="Kim W">WT Kim</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Matus, Jt" uniqKey="Matus J">JT Matus</name>
</author>
<author>
<name sortKey="Aquea, F" uniqKey="Aquea F">F Aquea</name>
</author>
<author>
<name sortKey="Espinoza, C" uniqKey="Espinoza C">C Espinoza</name>
</author>
<author>
<name sortKey="Vega, A" uniqKey="Vega A">A Vega</name>
</author>
<author>
<name sortKey="Cavallini, E" uniqKey="Cavallini E">E Cavallini</name>
</author>
<author>
<name sortKey="Santo, Sd" uniqKey="Santo S">SD Santo</name>
</author>
<author>
<name sortKey="Ca N, P" uniqKey="Ca N P">P Cañón</name>
</author>
<author>
<name sortKey="De La Guardia, Ar H" uniqKey="De La Guardia A">AR-H de la Guardia</name>
</author>
<author>
<name sortKey="Serrano, J" uniqKey="Serrano J">J Serrano</name>
</author>
<author>
<name sortKey="Tornielli, Gb" uniqKey="Tornielli G">GB Tornielli</name>
</author>
<author>
<name sortKey="Arce Johnson, P" uniqKey="Arce Johnson P">P Arce-Johnson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Terasaka, K" uniqKey="Terasaka K">K Terasaka</name>
</author>
<author>
<name sortKey="Blakeslee, Jj" uniqKey="Blakeslee J">JJ Blakeslee</name>
</author>
<author>
<name sortKey="Titapiwatanakun, B" uniqKey="Titapiwatanakun B">B Titapiwatanakun</name>
</author>
<author>
<name sortKey="Peer, Wa" uniqKey="Peer W">WA Peer</name>
</author>
<author>
<name sortKey="Bandyopadhyay, A" uniqKey="Bandyopadhyay A">A Bandyopadhyay</name>
</author>
<author>
<name sortKey="Makam, Sn" uniqKey="Makam S">SN Makam</name>
</author>
<author>
<name sortKey="Lee, Or" uniqKey="Lee O">OR Lee</name>
</author>
<author>
<name sortKey="Richards, El" uniqKey="Richards E">EL Richards</name>
</author>
<author>
<name sortKey="Murphy, As" uniqKey="Murphy A">AS Murphy</name>
</author>
<author>
<name sortKey="Sato, F" uniqKey="Sato F">F Sato</name>
</author>
<author>
<name sortKey="Yazaki, K" uniqKey="Yazaki K">K Yazaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tripathi, V" uniqKey="Tripathi V">V Tripathi</name>
</author>
<author>
<name sortKey="Syed, N" uniqKey="Syed N">N Syed</name>
</author>
<author>
<name sortKey="Laxmi, A" uniqKey="Laxmi A">A Laxmi</name>
</author>
<author>
<name sortKey="Chattopadhyay, D" uniqKey="Chattopadhyay D">D Chattopadhyay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cui, F" uniqKey="Cui F">F Cui</name>
</author>
<author>
<name sortKey="Liu, L" uniqKey="Liu L">L Liu</name>
</author>
<author>
<name sortKey="Zhao, Q" uniqKey="Zhao Q">Q Zhao</name>
</author>
<author>
<name sortKey="Zhang, Z" uniqKey="Zhang Z">Z Zhang</name>
</author>
<author>
<name sortKey="Li, Q" uniqKey="Li Q">Q Li</name>
</author>
<author>
<name sortKey="Lin, B" uniqKey="Lin B">B Lin</name>
</author>
<author>
<name sortKey="Wu, Y" uniqKey="Wu Y">Y Wu</name>
</author>
<author>
<name sortKey="Tang, S" uniqKey="Tang S">S Tang</name>
</author>
<author>
<name sortKey="Xie, Q" uniqKey="Xie Q">Q Xie</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kaplan, F" uniqKey="Kaplan F">F Kaplan</name>
</author>
<author>
<name sortKey="Guy, Cl" uniqKey="Guy C">CL Guy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Moore, Jp" uniqKey="Moore J">JP Moore</name>
</author>
<author>
<name sortKey="Le, Nt" uniqKey="Le N">NT Le</name>
</author>
<author>
<name sortKey="Brandt, Wf" uniqKey="Brandt W">WF Brandt</name>
</author>
<author>
<name sortKey="Driouich, A" uniqKey="Driouich A">A Driouich</name>
</author>
<author>
<name sortKey="Farrant, Jm" uniqKey="Farrant J">JM Farrant</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Quettier, Al" uniqKey="Quettier A">AL Quettier</name>
</author>
<author>
<name sortKey="Bertrand, C" uniqKey="Bertrand C">C Bertrand</name>
</author>
<author>
<name sortKey="Habricot, Y" uniqKey="Habricot Y">Y Habricot</name>
</author>
<author>
<name sortKey="Miginiac, E" uniqKey="Miginiac E">E Miginiac</name>
</author>
<author>
<name sortKey="Agnes, C" uniqKey="Agnes C">C Agnes</name>
</author>
<author>
<name sortKey="Jeannette, E" uniqKey="Jeannette E">E Jeannette</name>
</author>
<author>
<name sortKey="Maldiney, R" uniqKey="Maldiney R">R Maldiney</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ma, J" uniqKey="Ma J">J Ma</name>
</author>
<author>
<name sortKey="Jiang, Qt" uniqKey="Jiang Q">QT Jiang</name>
</author>
<author>
<name sortKey="Zhang, Xw" uniqKey="Zhang X">XW Zhang</name>
</author>
<author>
<name sortKey="Lan, Xj" uniqKey="Lan X">XJ Lan</name>
</author>
<author>
<name sortKey="Pu, Ze" uniqKey="Pu Z">ZE Pu</name>
</author>
<author>
<name sortKey="Wei, Ym" uniqKey="Wei Y">YM Wei</name>
</author>
<author>
<name sortKey="Liu, C" uniqKey="Liu C">C Liu</name>
</author>
<author>
<name sortKey="Lu, Zx" uniqKey="Lu Z">ZX Lu</name>
</author>
<author>
<name sortKey="Zheng, Yl" uniqKey="Zheng Y">YL Zheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Satoh, H" uniqKey="Satoh H">H Satoh</name>
</author>
<author>
<name sortKey="Shibahara, K" uniqKey="Shibahara K">K Shibahara</name>
</author>
<author>
<name sortKey="Tokunaga, T" uniqKey="Tokunaga T">T Tokunaga</name>
</author>
<author>
<name sortKey="Nishi, A" uniqKey="Nishi A">A Nishi</name>
</author>
<author>
<name sortKey="Tasaki, M" uniqKey="Tasaki M">M Tasaki</name>
</author>
<author>
<name sortKey="Hwang, S K" uniqKey="Hwang S">S-K Hwang</name>
</author>
<author>
<name sortKey="Okita, Tw" uniqKey="Okita T">TW Okita</name>
</author>
<author>
<name sortKey="Kaneko, N" uniqKey="Kaneko N">N Kaneko</name>
</author>
<author>
<name sortKey="Fujita, N" uniqKey="Fujita N">N Fujita</name>
</author>
<author>
<name sortKey="Yoshida, M" uniqKey="Yoshida M">M Yoshida</name>
</author>
<author>
<name sortKey="Hosaka, Y" uniqKey="Hosaka Y">Y Hosaka</name>
</author>
<author>
<name sortKey="Sato, A" uniqKey="Sato A">A Sato</name>
</author>
<author>
<name sortKey="Utsumi, Y" uniqKey="Utsumi Y">Y Utsumi</name>
</author>
<author>
<name sortKey="Ohdan, T" uniqKey="Ohdan T">T Ohdan</name>
</author>
<author>
<name sortKey="Nakamura, Y" uniqKey="Nakamura Y">Y Nakamura</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Parcy, F" uniqKey="Parcy F">F Parcy</name>
</author>
<author>
<name sortKey="Valon, C" uniqKey="Valon C">C Valon</name>
</author>
<author>
<name sortKey="Raynal, M" uniqKey="Raynal M">M Raynal</name>
</author>
<author>
<name sortKey="Gaubier Comella, P" uniqKey="Gaubier Comella P">P Gaubier-Comella</name>
</author>
<author>
<name sortKey="Delseny, M" uniqKey="Delseny M">M Delseny</name>
</author>
<author>
<name sortKey="Giraudat, J" uniqKey="Giraudat J">J Giraudat</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X Liu</name>
</author>
<author>
<name sortKey="Zhang, H" uniqKey="Zhang H">H Zhang</name>
</author>
<author>
<name sortKey="Zhao, Y" uniqKey="Zhao Y">Y Zhao</name>
</author>
<author>
<name sortKey="Feng, Z" uniqKey="Feng Z">Z Feng</name>
</author>
<author>
<name sortKey="Li, Q" uniqKey="Li Q">Q Li</name>
</author>
<author>
<name sortKey="Yang, H Q" uniqKey="Yang H">H-Q Yang</name>
</author>
<author>
<name sortKey="Luan, S" uniqKey="Luan S">S Luan</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="He, Z H" uniqKey="He Z">Z-H He</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hare, Pd" uniqKey="Hare P">PD Hare</name>
</author>
<author>
<name sortKey="Cress, Wa" uniqKey="Cress W">WA Cress</name>
</author>
<author>
<name sortKey="Van Staden, J" uniqKey="Van Staden J">J van Staden</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Prewein, C" uniqKey="Prewein C">C Prewein</name>
</author>
<author>
<name sortKey="Endemann, M" uniqKey="Endemann M">M Endemann</name>
</author>
<author>
<name sortKey="Reinohl, V" uniqKey="Reinohl V">V Reinöhl</name>
</author>
<author>
<name sortKey="Salaj, J" uniqKey="Salaj J">J Salaj</name>
</author>
<author>
<name sortKey="Sunderlikova, V" uniqKey="Sunderlikova V">V Sunderlikova</name>
</author>
<author>
<name sortKey="Wilhelm, E" uniqKey="Wilhelm E">E Wilhelm</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Finch Savage, We" uniqKey="Finch Savage W">WE Finch-Savage</name>
</author>
<author>
<name sortKey="Clay, Ha" uniqKey="Clay H">HA Clay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kiyosue, T" uniqKey="Kiyosue T">T Kiyosue</name>
</author>
<author>
<name sortKey="Yamaguchi Shinozaki, K" uniqKey="Yamaguchi Shinozaki K">K Yamaguchi-Shinozaki</name>
</author>
<author>
<name sortKey="Shinozaki, K" uniqKey="Shinozaki K">K Shinozaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kariola, T" uniqKey="Kariola T">T Kariola</name>
</author>
<author>
<name sortKey="Brader, G" uniqKey="Brader G">G Brader</name>
</author>
<author>
<name sortKey="Helenius, E" uniqKey="Helenius E">E Helenius</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Heino, P" uniqKey="Heino P">P Heino</name>
</author>
<author>
<name sortKey="Palva, Et" uniqKey="Palva E">ET Palva</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Aalto, Mk" uniqKey="Aalto M">MK Aalto</name>
</author>
<author>
<name sortKey="Helenius, E" uniqKey="Helenius E">E Helenius</name>
</author>
<author>
<name sortKey="Kariola, T" uniqKey="Kariola T">T Kariola</name>
</author>
<author>
<name sortKey="Pennanen, V" uniqKey="Pennanen V">V Pennanen</name>
</author>
<author>
<name sortKey="Heino, P" uniqKey="Heino P">P Heino</name>
</author>
<author>
<name sortKey="H Rak, H" uniqKey="H Rak H">H Hõrak</name>
</author>
<author>
<name sortKey="Puz Rjova, I" uniqKey="Puz Rjova I">I Puzõrjova</name>
</author>
<author>
<name sortKey="Kollist, H" uniqKey="Kollist H">H Kollist</name>
</author>
<author>
<name sortKey="Palva, Et" uniqKey="Palva E">ET Palva</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Seo, Pj" uniqKey="Seo P">PJ Seo</name>
</author>
<author>
<name sortKey="Lee, Sb" uniqKey="Lee S">SB Lee</name>
</author>
<author>
<name sortKey="Suh, Mc" uniqKey="Suh M">MC Suh</name>
</author>
<author>
<name sortKey="Park, M J" uniqKey="Park M">M-J Park</name>
</author>
<author>
<name sortKey="Go, Ys" uniqKey="Go Y">YS Go</name>
</author>
<author>
<name sortKey="Park, C M" uniqKey="Park C">C-M Park</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guo, L" uniqKey="Guo L">L Guo</name>
</author>
<author>
<name sortKey="Yang, H" uniqKey="Yang H">H Yang</name>
</author>
<author>
<name sortKey="Zhang, X" uniqKey="Zhang X">X Zhang</name>
</author>
<author>
<name sortKey="Yang, S" uniqKey="Yang S">S Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Candat, A" uniqKey="Candat A">A Candat</name>
</author>
<author>
<name sortKey="Paszkiewicz, G" uniqKey="Paszkiewicz G">G Paszkiewicz</name>
</author>
<author>
<name sortKey="Neveu, M" uniqKey="Neveu M">M Neveu</name>
</author>
<author>
<name sortKey="Gautier, R" uniqKey="Gautier R">R Gautier</name>
</author>
<author>
<name sortKey="Logan, Dc" uniqKey="Logan D">DC Logan</name>
</author>
<author>
<name sortKey="Avelange Macherel, M H" uniqKey="Avelange Macherel M">M-H Avelange-Macherel</name>
</author>
<author>
<name sortKey="Macherel, D" uniqKey="Macherel D">D Macherel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Olvera Carrillo, Y" uniqKey="Olvera Carrillo Y">Y Olvera-Carrillo</name>
</author>
<author>
<name sortKey="Campos, F" uniqKey="Campos F">F Campos</name>
</author>
<author>
<name sortKey="Reyes, Jl" uniqKey="Reyes J">JL Reyes</name>
</author>
<author>
<name sortKey="Garciarrubio, A" uniqKey="Garciarrubio A">A Garciarrubio</name>
</author>
<author>
<name sortKey="Covarrubias, Aa" uniqKey="Covarrubias A">AA Covarrubias</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hundertmark, M" uniqKey="Hundertmark M">M Hundertmark</name>
</author>
<author>
<name sortKey="Hincha, Dk" uniqKey="Hincha D">DK Hincha</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hualkasin, W" uniqKey="Hualkasin W">W Hualkasin</name>
</author>
<author>
<name sortKey="Thongin, W" uniqKey="Thongin W">W Thongin</name>
</author>
<author>
<name sortKey="Petsean, K" uniqKey="Petsean K">K Petsean</name>
</author>
<author>
<name sortKey="Phongdara, A" uniqKey="Phongdara A">A Phongdara</name>
</author>
<author>
<name sortKey="Nakkaew, A" uniqKey="Nakkaew A">A Nakkaew</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sunderlikova, V" uniqKey="Sunderlikova V">V Sunderlíková</name>
</author>
<author>
<name sortKey="Wilhelm, E" uniqKey="Wilhelm E">E Wilhelm</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sunderlikova, V" uniqKey="Sunderlikova V">V Sunderlíková</name>
</author>
<author>
<name sortKey="Salaj, J" uniqKey="Salaj J">J Salaj</name>
</author>
<author>
<name sortKey="Kopecky, D" uniqKey="Kopecky D">D Kopecky</name>
</author>
<author>
<name sortKey="Salaj, T" uniqKey="Salaj T">T Salaj</name>
</author>
<author>
<name sortKey="Wilhem, E" uniqKey="Wilhem E">E Wilhem</name>
</author>
<author>
<name sortKey="Matusikova, I" uniqKey="Matusikova I">I Matusíková</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tognetti, Vb" uniqKey="Tognetti V">VB Tognetti</name>
</author>
<author>
<name sortKey="Van Aken, O" uniqKey="Van Aken O">O Van Aken</name>
</author>
<author>
<name sortKey="Morreel, K" uniqKey="Morreel K">K Morreel</name>
</author>
<author>
<name sortKey="Vandenbroucke, K" uniqKey="Vandenbroucke K">K Vandenbroucke</name>
</author>
<author>
<name sortKey="Van De Cotte, B" uniqKey="Van De Cotte B">B van de Cotte</name>
</author>
<author>
<name sortKey="De Clercq, I" uniqKey="De Clercq I">I De Clercq</name>
</author>
<author>
<name sortKey="Chiwocha, S" uniqKey="Chiwocha S">S Chiwocha</name>
</author>
<author>
<name sortKey="Fenske, R" uniqKey="Fenske R">R Fenske</name>
</author>
<author>
<name sortKey="Prinsen, E" uniqKey="Prinsen E">E Prinsen</name>
</author>
<author>
<name sortKey="Boerjan, W" uniqKey="Boerjan W">W Boerjan</name>
</author>
<author>
<name sortKey="Genty, B" uniqKey="Genty B">B Genty</name>
</author>
<author>
<name sortKey="Stubbs, Ka" uniqKey="Stubbs K">KA Stubbs</name>
</author>
<author>
<name sortKey="Inze, D" uniqKey="Inze D">D Inzé</name>
</author>
<author>
<name sortKey="Van Breusegem, F" uniqKey="Van Breusegem F">F Van Breusegem</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xue, T" uniqKey="Xue T">T Xue</name>
</author>
<author>
<name sortKey="Li, X" uniqKey="Li X">X Li</name>
</author>
<author>
<name sortKey="Zhu, W" uniqKey="Zhu W">W Zhu</name>
</author>
<author>
<name sortKey="Wu, C" uniqKey="Wu C">C Wu</name>
</author>
<author>
<name sortKey="Yang, G" uniqKey="Yang G">G Yang</name>
</author>
<author>
<name sortKey="Zheng, C" uniqKey="Zheng C">C Zheng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Reid, Sj" uniqKey="Reid S">SJ Reid</name>
</author>
<author>
<name sortKey="Ross, Gs" uniqKey="Ross G">GS Ross</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abdullah, Sna" uniqKey="Abdullah S">SNA Abdullah</name>
</author>
<author>
<name sortKey="Cheah, Sc" uniqKey="Cheah S">SC Cheah</name>
</author>
<author>
<name sortKey="Murphy, Dj" uniqKey="Murphy D">DJ Murphy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ledger, Se" uniqKey="Ledger S">SE Ledger</name>
</author>
<author>
<name sortKey="Gardner, Rc" uniqKey="Gardner R">RC Gardner</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dabrowska, G" uniqKey="Dabrowska G">G Dabrowska</name>
</author>
<author>
<name sortKey="Mierek Adamska, A" uniqKey="Mierek Adamska A">A Mierek-Adamska</name>
</author>
<author>
<name sortKey="Goc, A" uniqKey="Goc A">A Goc</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liscum, E" uniqKey="Liscum E">E Liscum</name>
</author>
<author>
<name sortKey="Reed, Jw" uniqKey="Reed J">JW Reed</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sagar, M" uniqKey="Sagar M">M Sagar</name>
</author>
<author>
<name sortKey="Chervin, C" uniqKey="Chervin C">C Chervin</name>
</author>
<author>
<name sortKey="Mila, I" uniqKey="Mila I">I Mila</name>
</author>
<author>
<name sortKey="Hao, Y" uniqKey="Hao Y">Y Hao</name>
</author>
<author>
<name sortKey="Roustan, J P" uniqKey="Roustan J">J-P Roustan</name>
</author>
<author>
<name sortKey="Benichou, M" uniqKey="Benichou M">M Benichou</name>
</author>
<author>
<name sortKey="Gibon, Y" uniqKey="Gibon Y">Y Gibon</name>
</author>
<author>
<name sortKey="Biais, B" uniqKey="Biais B">B Biais</name>
</author>
<author>
<name sortKey="Maury, P" uniqKey="Maury P">P Maury</name>
</author>
<author>
<name sortKey="Latche, A" uniqKey="Latche A">A Latché</name>
</author>
<author>
<name sortKey="Pech, J C" uniqKey="Pech J">J-C Pech</name>
</author>
<author>
<name sortKey="Bouzayen, M" uniqKey="Bouzayen M">M Bouzayen</name>
</author>
<author>
<name sortKey="Zouine, M" uniqKey="Zouine M">M Zouine</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chaves, I" uniqKey="Chaves I">I Chaves</name>
</author>
<author>
<name sortKey="Lin, Yc" uniqKey="Lin Y">YC Lin</name>
</author>
<author>
<name sortKey="Pinto Ricardo, C" uniqKey="Pinto Ricardo C">C Pinto-Ricardo</name>
</author>
<author>
<name sortKey="Van De Peer, Y" uniqKey="Van De Peer Y">Y Van de Peer</name>
</author>
<author>
<name sortKey="Miguel, C" uniqKey="Miguel C">C Miguel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pagnussat, Gc" uniqKey="Pagnussat G">GC Pagnussat</name>
</author>
<author>
<name sortKey="Yu, H J" uniqKey="Yu H">H-J Yu</name>
</author>
<author>
<name sortKey="Sundaresan, V" uniqKey="Sundaresan V">V Sundaresan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sakakibara, K" uniqKey="Sakakibara K">K Sakakibara</name>
</author>
<author>
<name sortKey="Ando, S" uniqKey="Ando S">S Ando</name>
</author>
<author>
<name sortKey="Yip, Hk" uniqKey="Yip H">HK Yip</name>
</author>
<author>
<name sortKey="Tamada, Y" uniqKey="Tamada Y">Y Tamada</name>
</author>
<author>
<name sortKey="Hiwatashi, Y" uniqKey="Hiwatashi Y">Y Hiwatashi</name>
</author>
<author>
<name sortKey="Murata, T" uniqKey="Murata T">T Murata</name>
</author>
<author>
<name sortKey="Deguchi, H" uniqKey="Deguchi H">H Deguchi</name>
</author>
<author>
<name sortKey="Hasebe, M" uniqKey="Hasebe M">M Hasebe</name>
</author>
<author>
<name sortKey="Bowman, Jl" uniqKey="Bowman J">JL Bowman</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Allan, Ac" uniqKey="Allan A">AC Allan</name>
</author>
<author>
<name sortKey="Hellens, Rp" uniqKey="Hellens R">RP Hellens</name>
</author>
<author>
<name sortKey="Laing, Wa" uniqKey="Laing W">WA Laing</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cominelli, E" uniqKey="Cominelli E">E Cominelli</name>
</author>
<author>
<name sortKey="Tonelli, C" uniqKey="Tonelli C">C Tonelli</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vimolmangkang, S" uniqKey="Vimolmangkang S">S Vimolmangkang</name>
</author>
<author>
<name sortKey="Han, Y" uniqKey="Han Y">Y Han</name>
</author>
<author>
<name sortKey="Wei, G" uniqKey="Wei G">G Wei</name>
</author>
<author>
<name sortKey="Korban, Ss" uniqKey="Korban S">SS Korban</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zoratti, L" uniqKey="Zoratti L">L Zoratti</name>
</author>
<author>
<name sortKey="Karppinen, K" uniqKey="Karppinen K">K Karppinen</name>
</author>
<author>
<name sortKey="Luengo Escobar, A" uniqKey="Luengo Escobar A">A Luengo Escobar</name>
</author>
<author>
<name sortKey="Haggman, H" uniqKey="Haggman H">H HÃggman</name>
</author>
<author>
<name sortKey="Jaakola, L" uniqKey="Jaakola L">L Jaakola</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stracke, R" uniqKey="Stracke R">R Stracke</name>
</author>
<author>
<name sortKey="Werber, M" uniqKey="Werber M">M Werber</name>
</author>
<author>
<name sortKey="Weisshaar, B" uniqKey="Weisshaar B">B Weisshaar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Koes, R" uniqKey="Koes R">R Koes</name>
</author>
<author>
<name sortKey="Verweij, W" uniqKey="Verweij W">W Verweij</name>
</author>
<author>
<name sortKey="Quattrocchio, F" uniqKey="Quattrocchio F">F Quattrocchio</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bogs, J" uniqKey="Bogs J">J Bogs</name>
</author>
<author>
<name sortKey="Jaffe, Fw" uniqKey="Jaffe F">FW Jaffé</name>
</author>
<author>
<name sortKey="Takos, Am" uniqKey="Takos A">AM Takos</name>
</author>
<author>
<name sortKey="Walker, Ar" uniqKey="Walker A">AR Walker</name>
</author>
<author>
<name sortKey="Robinson, Sp" uniqKey="Robinson S">SP Robinson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Armengaud, P" uniqKey="Armengaud P">P Armengaud</name>
</author>
<author>
<name sortKey="Breitling, R" uniqKey="Breitling R">R Breitling</name>
</author>
<author>
<name sortKey="Amtmann, A" uniqKey="Amtmann A">A Amtmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Valerio, L" uniqKey="Valerio L">L Valério</name>
</author>
<author>
<name sortKey="De Meyer, M" uniqKey="De Meyer M">M De Meyer</name>
</author>
<author>
<name sortKey="Penel, C" uniqKey="Penel C">C Penel</name>
</author>
<author>
<name sortKey="Dunand, C" uniqKey="Dunand C">C Dunand</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Irshad, M" uniqKey="Irshad M">M Irshad</name>
</author>
<author>
<name sortKey="Canut, H" uniqKey="Canut H">H Canut</name>
</author>
<author>
<name sortKey="Borderies, G" uniqKey="Borderies G">G Borderies</name>
</author>
<author>
<name sortKey="Pont Lezica, R" uniqKey="Pont Lezica R">R Pont-Lezica</name>
</author>
<author>
<name sortKey="Jamet, E" uniqKey="Jamet E">E Jamet</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Herrero, J" uniqKey="Herrero J">J Herrero</name>
</author>
<author>
<name sortKey="Fernandez Perez, F" uniqKey="Fernandez Perez F">F Fernández-Pérez</name>
</author>
<author>
<name sortKey="Yebra, T" uniqKey="Yebra T">T Yebra</name>
</author>
<author>
<name sortKey="Novo Uzal, E" uniqKey="Novo Uzal E">E Novo-Uzal</name>
</author>
<author>
<name sortKey="Pomar, F" uniqKey="Pomar F">F Pomar</name>
</author>
<author>
<name sortKey="Pedre O, Ma" uniqKey="Pedre O M">MÁ Pedreño</name>
</author>
<author>
<name sortKey="Cuello, J" uniqKey="Cuello J">J Cuello</name>
</author>
<author>
<name sortKey="Guera, A" uniqKey="Guera A">A Guéra</name>
</author>
<author>
<name sortKey="Esteban Carrasco, A" uniqKey="Esteban Carrasco A">A Esteban-Carrasco</name>
</author>
<author>
<name sortKey="Zapata, Jm" uniqKey="Zapata J">JM Zapata</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hudson, M" uniqKey="Hudson M">M Hudson</name>
</author>
<author>
<name sortKey="Ringli, C" uniqKey="Ringli C">C Ringli</name>
</author>
<author>
<name sortKey="Boylan, Mt" uniqKey="Boylan M">MT Boylan</name>
</author>
<author>
<name sortKey="Quail, Ph" uniqKey="Quail P">PH Quail</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author>
<name sortKey="Xing, Wd" uniqKey="Xing W">WD Xing</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Allen, T" uniqKey="Allen T">T Allen</name>
</author>
<author>
<name sortKey="Koustenis, A" uniqKey="Koustenis A">A Koustenis</name>
</author>
<author>
<name sortKey="Theodorou, G" uniqKey="Theodorou G">G Theodorou</name>
</author>
<author>
<name sortKey="Somers, De" uniqKey="Somers D">DE Somers</name>
</author>
<author>
<name sortKey="Kay, Sa" uniqKey="Kay S">SA Kay</name>
</author>
<author>
<name sortKey="Whitelam, Gc" uniqKey="Whitelam G">GC Whitelam</name>
</author>
<author>
<name sortKey="Devlin, Pf" uniqKey="Devlin P">PF Devlin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lin, R" uniqKey="Lin R">R Lin</name>
</author>
<author>
<name sortKey="Ding, L" uniqKey="Ding L">L Ding</name>
</author>
<author>
<name sortKey="Casola, C" uniqKey="Casola C">C Casola</name>
</author>
<author>
<name sortKey="Ripoll, Dr" uniqKey="Ripoll D">DR Ripoll</name>
</author>
<author>
<name sortKey="Feschotte, C" uniqKey="Feschotte C">C Feschotte</name>
</author>
<author>
<name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, G" uniqKey="Li G">G Li</name>
</author>
<author>
<name sortKey="Siddiqui, H" uniqKey="Siddiqui H">H Siddiqui</name>
</author>
<author>
<name sortKey="Teng, Y" uniqKey="Teng Y">Y Teng</name>
</author>
<author>
<name sortKey="Lin, R" uniqKey="Lin R">R Lin</name>
</author>
<author>
<name sortKey="Wan, X" uniqKey="Wan X">X Wan</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Lau, O S" uniqKey="Lau O">O-S Lau</name>
</author>
<author>
<name sortKey="Ouyang, X" uniqKey="Ouyang X">X Ouyang</name>
</author>
<author>
<name sortKey="Dai, M" uniqKey="Dai M">M Dai</name>
</author>
<author>
<name sortKey="Wan, J" uniqKey="Wan J">J Wan</name>
</author>
<author>
<name sortKey="Devlin, Pf" uniqKey="Devlin P">PF Devlin</name>
</author>
<author>
<name sortKey="Deng, Xw" uniqKey="Deng X">XW Deng</name>
</author>
<author>
<name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ouyang, X" uniqKey="Ouyang X">X Ouyang</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Li, G" uniqKey="Li G">G Li</name>
</author>
<author>
<name sortKey="Li, B" uniqKey="Li B">B Li</name>
</author>
<author>
<name sortKey="Chen, B" uniqKey="Chen B">B Chen</name>
</author>
<author>
<name sortKey="Shen, H" uniqKey="Shen H">H Shen</name>
</author>
<author>
<name sortKey="Huang, X" uniqKey="Huang X">X Huang</name>
</author>
<author>
<name sortKey="Mo, X" uniqKey="Mo X">X Mo</name>
</author>
<author>
<name sortKey="Wan, X" uniqKey="Wan X">X Wan</name>
</author>
<author>
<name sortKey="Lin, R" uniqKey="Lin R">R Lin</name>
</author>
<author>
<name sortKey="Li, S" uniqKey="Li S">S Li</name>
</author>
<author>
<name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author>
<name sortKey="Deng, Xw" uniqKey="Deng X">XW Deng</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tang, W" uniqKey="Tang W">W Tang</name>
</author>
<author>
<name sortKey="Wang, W" uniqKey="Wang W">W Wang</name>
</author>
<author>
<name sortKey="Chen, D" uniqKey="Chen D">D Chen</name>
</author>
<author>
<name sortKey="Ji, Q" uniqKey="Ji Q">Q Ji</name>
</author>
<author>
<name sortKey="Jing, Y" uniqKey="Jing Y">Y Jing</name>
</author>
<author>
<name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author>
<name sortKey="Lin, R" uniqKey="Lin R">R Lin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tang, W" uniqKey="Tang W">W Tang</name>
</author>
<author>
<name sortKey="Ji, Q" uniqKey="Ji Q">Q Ji</name>
</author>
<author>
<name sortKey="Huang, Y" uniqKey="Huang Y">Y Huang</name>
</author>
<author>
<name sortKey="Jiang, Z" uniqKey="Jiang Z">Z Jiang</name>
</author>
<author>
<name sortKey="Bao, M" uniqKey="Bao M">M Bao</name>
</author>
<author>
<name sortKey="Wang, H" uniqKey="Wang H">H Wang</name>
</author>
<author>
<name sortKey="Lin, R" uniqKey="Lin R">R Lin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gao, Y" uniqKey="Gao Y">Y Gao</name>
</author>
<author>
<name sortKey="Liu, H" uniqKey="Liu H">H Liu</name>
</author>
<author>
<name sortKey="An, C" uniqKey="An C">C An</name>
</author>
<author>
<name sortKey="Shi, Y" uniqKey="Shi Y">Y Shi</name>
</author>
<author>
<name sortKey="Liu, X" uniqKey="Liu X">X Liu</name>
</author>
<author>
<name sortKey="Yuan, W" uniqKey="Yuan W">W Yuan</name>
</author>
<author>
<name sortKey="Zhang, B" uniqKey="Zhang B">B Zhang</name>
</author>
<author>
<name sortKey="Yang, J" uniqKey="Yang J">J Yang</name>
</author>
<author>
<name sortKey="Yu, C" uniqKey="Yu C">C Yu</name>
</author>
<author>
<name sortKey="Gao, H" uniqKey="Gao H">H Gao</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Siloto, Rmp" uniqKey="Siloto R">RMP Siloto</name>
</author>
<author>
<name sortKey="Findlay, K" uniqKey="Findlay K">K Findlay</name>
</author>
<author>
<name sortKey="Lopez Villalobos, A" uniqKey="Lopez Villalobos A">A Lopez-villalobos</name>
</author>
<author>
<name sortKey="Yeung, Ec" uniqKey="Yeung E">EC Yeung</name>
</author>
<author>
<name sortKey="Nykiforuk, Cl" uniqKey="Nykiforuk C">CL Nykiforuk</name>
</author>
<author>
<name sortKey="Moloney, Mm" uniqKey="Moloney M">MM Moloney</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Miquel, M" uniqKey="Miquel M">M Miquel</name>
</author>
<author>
<name sortKey="Trigui, G" uniqKey="Trigui G">G Trigui</name>
</author>
<author>
<name sortKey="D Ndrea, S" uniqKey="D Ndrea S">S D’Andréa</name>
</author>
<author>
<name sortKey="Kelemen, Z" uniqKey="Kelemen Z">Z Kelemen</name>
</author>
<author>
<name sortKey="Baud, S" uniqKey="Baud S">S Baud</name>
</author>
<author>
<name sortKey="Berger, A" uniqKey="Berger A">A Berger</name>
</author>
<author>
<name sortKey="Deruyffelaere, C" uniqKey="Deruyffelaere C">C Deruyffelaere</name>
</author>
<author>
<name sortKey="Trubuil, A" uniqKey="Trubuil A">A Trubuil</name>
</author>
<author>
<name sortKey="Lepiniec, L" uniqKey="Lepiniec L">L Lepiniec</name>
</author>
<author>
<name sortKey="Dubreucq, B" uniqKey="Dubreucq B">B Dubreucq</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, Dd" uniqKey="Li D">DD Li</name>
</author>
<author>
<name sortKey="Fan, Ym" uniqKey="Fan Y">YM Fan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Popluechai, S" uniqKey="Popluechai S">S Popluechai</name>
</author>
<author>
<name sortKey="Froissard, M" uniqKey="Froissard M">M Froissard</name>
</author>
<author>
<name sortKey="Jolivet, P" uniqKey="Jolivet P">P Jolivet</name>
</author>
<author>
<name sortKey="Breviario, D" uniqKey="Breviario D">D Breviario</name>
</author>
<author>
<name sortKey="Gatehouse, Amr" uniqKey="Gatehouse A">AMR Gatehouse</name>
</author>
<author>
<name sortKey="O Onnell, Ag" uniqKey="O Onnell A">AG O’Donnell</name>
</author>
<author>
<name sortKey="Chardot, T" uniqKey="Chardot T">T Chardot</name>
</author>
<author>
<name sortKey="Kohli, A" uniqKey="Kohli A">A Kohli</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cao, H" uniqKey="Cao H">H Cao</name>
</author>
<author>
<name sortKey="Zhang, L" uniqKey="Zhang L">L Zhang</name>
</author>
<author>
<name sortKey="Tan, X" uniqKey="Tan X">X Tan</name>
</author>
<author>
<name sortKey="Long, H" uniqKey="Long H">H Long</name>
</author>
<author>
<name sortKey="Shockey, Jm" uniqKey="Shockey J">JM Shockey</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhang, F" uniqKey="Zhang F">F Zhang</name>
</author>
<author>
<name sortKey="Gonzalez, A" uniqKey="Gonzalez A">A Gonzalez</name>
</author>
<author>
<name sortKey="Zhao, M" uniqKey="Zhao M">M Zhao</name>
</author>
<author>
<name sortKey="Payne, Ct" uniqKey="Payne C">CT Payne</name>
</author>
<author>
<name sortKey="Lloyd, A" uniqKey="Lloyd A">A Lloyd</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Feller, A" uniqKey="Feller A">A Feller</name>
</author>
<author>
<name sortKey="Machemer, K" uniqKey="Machemer K">K Machemer</name>
</author>
<author>
<name sortKey="Braun, El" uniqKey="Braun E">EL Braun</name>
</author>
<author>
<name sortKey="Grotewold, E" uniqKey="Grotewold E">E Grotewold</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nakashima, K" uniqKey="Nakashima K">K Nakashima</name>
</author>
<author>
<name sortKey="Takasaki, H" uniqKey="Takasaki H">H Takasaki</name>
</author>
<author>
<name sortKey="Mizoi, J" uniqKey="Mizoi J">J Mizoi</name>
</author>
<author>
<name sortKey="Shinozaki, K" uniqKey="Shinozaki K">K Shinozaki</name>
</author>
<author>
<name sortKey="Yamaguchi Shinozaki, K" uniqKey="Yamaguchi Shinozaki K">K Yamaguchi-Shinozaki</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nuruzzaman, M" uniqKey="Nuruzzaman M">M Nuruzzaman</name>
</author>
<author>
<name sortKey="Sharoni, Am" uniqKey="Sharoni A">AM Sharoni</name>
</author>
<author>
<name sortKey="Kikuchi, S" uniqKey="Kikuchi S">S Kikuchi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Olsen, An" uniqKey="Olsen A">AN Olsen</name>
</author>
<author>
<name sortKey="Ernst, Ha" uniqKey="Ernst H">HA Ernst</name>
</author>
<author>
<name sortKey="Lo, Ll" uniqKey="Lo L">LL Lo</name>
</author>
<author>
<name sortKey="Skriver, K" uniqKey="Skriver K">K Skriver</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Christensen, Jh" uniqKey="Christensen J">JH Christensen</name>
</author>
<author>
<name sortKey="Hewitson, B" uniqKey="Hewitson B">B Hewitson</name>
</author>
<author>
<name sortKey="Busuioc, A" uniqKey="Busuioc A">A Busuioc</name>
</author>
<author>
<name sortKey="Chen, A" uniqKey="Chen A">A Chen</name>
</author>
<author>
<name sortKey="Gao, X" uniqKey="Gao X">X Gao</name>
</author>
<author>
<name sortKey="Held, I" uniqKey="Held I">I Held</name>
</author>
<author>
<name sortKey="Jones, R" uniqKey="Jones R">R Jones</name>
</author>
<author>
<name sortKey="Kolli, Rk" uniqKey="Kolli R">RK Kolli</name>
</author>
<author>
<name sortKey="Kwon, Wt" uniqKey="Kwon W">WT Kwon</name>
</author>
<author>
<name sortKey="Laprise, R" uniqKey="Laprise R">R Laprise</name>
</author>
<author>
<name sortKey="Maga A Rueda, V" uniqKey="Maga A Rueda V">V Magaña Rueda</name>
</author>
<author>
<name sortKey="Mearns, L" uniqKey="Mearns L">L Mearns</name>
</author>
<author>
<name sortKey="Menendez, Cg" uniqKey="Menendez C">CG Menéndez</name>
</author>
<author>
<name sortKey="R Is Nen, J" uniqKey="R Is Nen J">J Räisänen</name>
</author>
<author>
<name sortKey="Rinke, A" uniqKey="Rinke A">A Rinke</name>
</author>
<author>
<name sortKey="Sarr, A" uniqKey="Sarr A">A Sarr</name>
</author>
<author>
<name sortKey="Whetton, P" uniqKey="Whetton P">P Whetton</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Giorgi, F" uniqKey="Giorgi F">F Giorgi</name>
</author>
<author>
<name sortKey="Lionello, P" uniqKey="Lionello P">P Lionello</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Marum, L" uniqKey="Marum L">L Marum</name>
</author>
<author>
<name sortKey="Miguel, A" uniqKey="Miguel A">A Miguel</name>
</author>
<author>
<name sortKey="Ricardo, Cp" uniqKey="Ricardo C">CP Ricardo</name>
</author>
<author>
<name sortKey="Miguel, C" uniqKey="Miguel C">C Miguel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhu, Yy" uniqKey="Zhu Y">YY Zhu</name>
</author>
<author>
<name sortKey="Machleder, Em" uniqKey="Machleder E">EM Machleder</name>
</author>
<author>
<name sortKey="Chenchik, A" uniqKey="Chenchik A">A Chenchik</name>
</author>
<author>
<name sortKey="Li, R" uniqKey="Li R">R Li</name>
</author>
<author>
<name sortKey="Siebert, Pd" uniqKey="Siebert P">PD Siebert</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhulidov, Pa" uniqKey="Zhulidov P">PA Zhulidov</name>
</author>
<author>
<name sortKey="Bogdanova, Ea" uniqKey="Bogdanova E">EA Bogdanova</name>
</author>
<author>
<name sortKey="Shcheglov, As" uniqKey="Shcheglov A">AS Shcheglov</name>
</author>
<author>
<name sortKey="Vagner, Ll" uniqKey="Vagner L">LL Vagner</name>
</author>
<author>
<name sortKey="Khaspekov, Gl" uniqKey="Khaspekov G">GL Khaspekov</name>
</author>
<author>
<name sortKey="Kozhemyako, Vb" uniqKey="Kozhemyako V">VB Kozhemyako</name>
</author>
<author>
<name sortKey="Matz, Mv" uniqKey="Matz M">MV Matz</name>
</author>
<author>
<name sortKey="Meleshkevitch, E" uniqKey="Meleshkevitch E">E Meleshkevitch</name>
</author>
<author>
<name sortKey="Moroz, Ll" uniqKey="Moroz L">LL Moroz</name>
</author>
<author>
<name sortKey="Lukyanov, Sa" uniqKey="Lukyanov S">SA Lukyanov</name>
</author>
<author>
<name sortKey="Shagin, Da" uniqKey="Shagin D">DA Shagin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Falgueras, J" uniqKey="Falgueras J">J Falgueras</name>
</author>
<author>
<name sortKey="Lara, Aj" uniqKey="Lara A">AJ Lara</name>
</author>
<author>
<name sortKey="Fernandez Pozo, N" uniqKey="Fernandez Pozo N">N Fernández-Pozo</name>
</author>
<author>
<name sortKey="Cant N, Fr" uniqKey="Cant N F">FR Cantón</name>
</author>
<author>
<name sortKey="Perez Trabado, G" uniqKey="Perez Trabado G">G Pérez-Trabado</name>
</author>
<author>
<name sortKey="Claros, Mg" uniqKey="Claros M">MG Claros</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Conesa, A" uniqKey="Conesa A">A Conesa</name>
</author>
<author>
<name sortKey="Gotz, S" uniqKey="Gotz S">S Götz</name>
</author>
<author>
<name sortKey="Garcia G Mez, Jm" uniqKey="Garcia G Mez J">JM García-Gómez</name>
</author>
<author>
<name sortKey="Terol, J" uniqKey="Terol J">J Terol</name>
</author>
<author>
<name sortKey="Tal N, M" uniqKey="Tal N M">M Talón</name>
</author>
<author>
<name sortKey="Robles, M" uniqKey="Robles M">M Robles</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Battke, F" uniqKey="Battke F">F Battke</name>
</author>
<author>
<name sortKey="Symons, S" uniqKey="Symons S">S Symons</name>
</author>
<author>
<name sortKey="Nieselt, K" uniqKey="Nieselt K">K Nieselt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kal, A" uniqKey="Kal A">A Kal</name>
</author>
<author>
<name sortKey="Van Zonneveld, A" uniqKey="Van Zonneveld A">A van Zonneveld</name>
</author>
<author>
<name sortKey="Benes, V" uniqKey="Benes V">V Benes</name>
</author>
<author>
<name sortKey="Van Den Berg, M" uniqKey="Van Den Berg M">M van den Berg</name>
</author>
<author>
<name sortKey="Koerkamp, M" uniqKey="Koerkamp M">M Koerkamp</name>
</author>
<author>
<name sortKey="Albermann, K" uniqKey="Albermann K">K Albermann</name>
</author>
<author>
<name sortKey="Strack, N" uniqKey="Strack N">N Strack</name>
</author>
<author>
<name sortKey="Ruijter, J" uniqKey="Ruijter J">J Ruijter</name>
</author>
<author>
<name sortKey="Richter, A" uniqKey="Richter A">A Richter</name>
</author>
<author>
<name sortKey="Dujon, B" uniqKey="Dujon B">B Dujon</name>
</author>
<author>
<name sortKey="Ansorge, W" uniqKey="Ansorge W">W Ansorge</name>
</author>
<author>
<name sortKey="Tabak, H" uniqKey="Tabak H">H Tabak</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Supek, F" uniqKey="Supek F">F Supek</name>
</author>
<author>
<name sortKey="Bosnjak, M" uniqKey="Bosnjak M">M Bošnjak</name>
</author>
<author>
<name sortKey="Skunca, N" uniqKey="Skunca N">N Škunca</name>
</author>
<author>
<name sortKey="Smuc, T" uniqKey="Smuc T">T Šmuc</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kearse, M" uniqKey="Kearse M">M Kearse</name>
</author>
<author>
<name sortKey="Moir, R" uniqKey="Moir R">R Moir</name>
</author>
<author>
<name sortKey="Wilson, A" uniqKey="Wilson A">A Wilson</name>
</author>
<author>
<name sortKey="Stones Havas, S" uniqKey="Stones Havas S">S Stones-Havas</name>
</author>
<author>
<name sortKey="Cheung, M" uniqKey="Cheung M">M Cheung</name>
</author>
<author>
<name sortKey="Sturrock, S" uniqKey="Sturrock S">S Sturrock</name>
</author>
<author>
<name sortKey="Buxton, S" uniqKey="Buxton S">S Buxton</name>
</author>
<author>
<name sortKey="Cooper, A" uniqKey="Cooper A">A Cooper</name>
</author>
<author>
<name sortKey="Markowitz, S" uniqKey="Markowitz S">S Markowitz</name>
</author>
<author>
<name sortKey="Duran, C" uniqKey="Duran C">C Duran</name>
</author>
<author>
<name sortKey="Thierer, T" uniqKey="Thierer T">T Thierer</name>
</author>
<author>
<name sortKey="Ashton, B" uniqKey="Ashton B">B Ashton</name>
</author>
<author>
<name sortKey="Meintjes, P" uniqKey="Meintjes P">P Meintjes</name>
</author>
<author>
<name sortKey="Drummond, A" uniqKey="Drummond A">A Drummond</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pfaffl, Mw" uniqKey="Pfaffl M">MW Pfaffl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Livak, Kj" uniqKey="Livak K">KJ Livak</name>
</author>
<author>
<name sortKey="Schmittgen, Td" uniqKey="Schmittgen T">TD Schmittgen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hellemans, J" uniqKey="Hellemans J">J Hellemans</name>
</author>
<author>
<name sortKey="Mortier, G" uniqKey="Mortier G">G Mortier</name>
</author>
<author>
<name sortKey="De Paepe, A" uniqKey="De Paepe A">A De Paepe</name>
</author>
<author>
<name sortKey="Speleman, F" uniqKey="Speleman F">F Speleman</name>
</author>
<author>
<name sortKey="Vandesompele, J" uniqKey="Vandesompele J">J Vandesompele</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Stewart, R" uniqKey="Stewart R">R Stewart</name>
</author>
<author>
<name sortKey="Rasc N, Ca" uniqKey="Rasc N C">CA Rascón</name>
</author>
<author>
<name sortKey="Tian, S" uniqKey="Tian S">S Tian</name>
</author>
<author>
<name sortKey="Nie, J" uniqKey="Nie J">J Nie</name>
</author>
<author>
<name sortKey="Barry, C" uniqKey="Barry C">C Barry</name>
</author>
<author>
<name sortKey="Chu, L F" uniqKey="Chu L">L-F Chu</name>
</author>
<author>
<name sortKey="Ardalani, H" uniqKey="Ardalani H">H Ardalani</name>
</author>
<author>
<name sortKey="Wagner, Rj" uniqKey="Wagner R">RJ Wagner</name>
</author>
<author>
<name sortKey="Probasco, Md" uniqKey="Probasco M">MD Probasco</name>
</author>
<author>
<name sortKey="Bolin, Jm" uniqKey="Bolin J">JM Bolin</name>
</author>
<author>
<name sortKey="Leng, N" uniqKey="Leng N">N Leng</name>
</author>
<author>
<name sortKey="Sengupta, S" uniqKey="Sengupta S">S Sengupta</name>
</author>
<author>
<name sortKey="Volkmer, M" uniqKey="Volkmer M">M Volkmer</name>
</author>
<author>
<name sortKey="Habermann, B" uniqKey="Habermann B">B Habermann</name>
</author>
<author>
<name sortKey="Tanaka, Em" uniqKey="Tanaka E">EM Tanaka</name>
</author>
<author>
<name sortKey="Thomson, Ja" uniqKey="Thomson J">JA Thomson</name>
</author>
<author>
<name sortKey="Dewey, Cn" uniqKey="Dewey C">CN Dewey</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">BMC Plant Biol</journal-id>
<journal-id journal-id-type="iso-abbrev">BMC Plant Biol</journal-id>
<journal-title-group>
<journal-title>BMC Plant Biology</journal-title>
</journal-title-group>
<issn pub-type="epub">1471-2229</issn>
<publisher>
<publisher-name>BioMed Central</publisher-name>
<publisher-loc>London</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">26109289</article-id>
<article-id pub-id-type="pmc">4479327</article-id>
<article-id pub-id-type="publisher-id">534</article-id>
<article-id pub-id-type="doi">10.1186/s12870-015-0534-1</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Characterization of the cork oak transcriptome dynamics during acorn development</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Miguel</surname>
<given-names>Andreia</given-names>
</name>
<address>
<email>andreiamiguel@itqb.unl.pt</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>de Vega-Bartol</surname>
<given-names>José</given-names>
</name>
<address>
<email>devegabartol@itqb.unl.pt</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
<xref ref-type="aff" rid="Aff2"></xref>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Marum</surname>
<given-names>Liliana</given-names>
</name>
<address>
<email>marum@itqb.unl.pt</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
<xref ref-type="aff" rid="Aff2"></xref>
<xref ref-type="aff" rid="Aff4"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chaves</surname>
<given-names>Inês</given-names>
</name>
<address>
<email>ichaves@itqb.unl.pt</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Santo</surname>
<given-names>Tatiana</given-names>
</name>
<address>
<email>ts.tatianasanto@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff5"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Leitão</surname>
<given-names>José</given-names>
</name>
<address>
<email>jleitao@ualg.pt</email>
</address>
<xref ref-type="aff" rid="Aff5"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Varela</surname>
<given-names>Maria Carolina</given-names>
</name>
<address>
<email>carolina.varela@iniav.pt</email>
</address>
<xref ref-type="aff" rid="Aff6"></xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Miguel</surname>
<given-names>Célia M.</given-names>
</name>
<address>
<phone>+351 214469627</phone>
<email>cmiguel@itqb.unl.pt</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<aff id="Aff1">
<label></label>
Instituto de Biologia Experimental e Tecnológica, Apartado 12, 2781-901, Oeiras, Portugal</aff>
<aff id="Aff2">
<label></label>
Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, 2780-157, Oeiras, Portugal</aff>
<aff id="Aff3">
<label></label>
The Genome Analysis Centre, Norwich Research Park, Norwich, NR4 7UH, UK</aff>
<aff id="Aff4">
<label></label>
KLÓN, Innovative Technologies from Cloning, Biocant Park, Núcleo 4, Lote 4A, 3060-197, Cantanhede, Portugal</aff>
<aff id="Aff5">
<label></label>
Laboratory of Genomics and Genetic Improvement, BioFIG, FCT, Universidade do Algarve, E.8, Campus de Gambelas, Faro, 8300 Portugal</aff>
<aff id="Aff6">
<label></label>
INIAV- Instituto Nacional de Investigação Agrária e Veterinária, IP, Quinta do, Marquês Oeiras, 2780-159, Portugal</aff>
</contrib-group>
<pub-date pub-type="epub">
<day>25</day>
<month>6</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="pmc-release">
<day>25</day>
<month>6</month>
<year>2015</year>
</pub-date>
<pub-date pub-type="collection">
<year>2015</year>
</pub-date>
<volume>15</volume>
<elocation-id>158</elocation-id>
<history>
<date date-type="received">
<day>20</day>
<month>2</month>
<year>2015</year>
</date>
<date date-type="accepted">
<day>26</day>
<month>5</month>
<year>2015</year>
</date>
</history>
<permissions>
<copyright-statement>© Miguel et al. 2015</copyright-statement>
<license license-type="open-access">
<license-p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0">http://creativecommons.org/licenses/by/4.0</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<abstract id="Abs1">
<sec>
<title>Background</title>
<p>Cork oak (
<italic>Quercus suber</italic>
L.) has a natural distribution across western Mediterranean regions and is a keystone forest tree species in these ecosystems. The fruiting phase is especially critical for its regeneration but the molecular mechanisms underlying the biochemical and physiological changes during cork oak acorn development are poorly understood. In this study, the transcriptome of the cork oak acorn, including the seed, was characterized in five stages of development, from early development to acorn maturation, to identify the dominant processes in each stage and reveal transcripts with important functions in gene expression regulation and response to water.</p>
</sec>
<sec>
<title>Results</title>
<p>A total of 80,357 expressed sequence tags (ESTs) were
<italic>de novo</italic>
assembled from RNA-Seq libraries representative of the several acorn developmental stages. Approximately 7.6 % of the total number of transcripts present in
<italic>Q. suber</italic>
transcriptome was identified as acorn specific. The analysis of expression profiles during development returned 2,285 differentially expressed (DE) transcripts, which were clustered into six groups. The stage of development corresponding to the mature acorn exhibited an expression profile markedly different from other stages. Approximately 22 % of the DE transcripts putatively code for transcription factors (TF) or transcriptional regulators, and were found almost equally distributed among the several expression profile clusters, highlighting their major roles in controlling the whole developmental process. On the other hand, carbohydrate metabolism, the biological pathway most represented during acorn development, was especially prevalent in mid to late stages as evidenced by enrichment analysis. We further show that genes related to response to water, water deprivation and transport were mostly represented during the early (S2) and the last stage (S8) of acorn development, when tolerance to water desiccation is possibly critical for acorn viability.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>To our knowledge this work represents the first report of acorn development transcriptomics in oaks. The obtained results provide novel insights into the developmental biology of cork oak acorns, highlighting transcripts putatively involved in the regulation of the gene expression program and in specific processes likely essential for adaptation. It is expected that this knowledge can be transferred to other oak species of great ecological value.</p>
</sec>
<sec>
<title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/s12870-015-0534-1) contains supplementary material, which is available to authorized users.</p>
</sec>
</abstract>
<kwd-group xml:lang="en">
<title>Keywords</title>
<kwd>
<italic>Quercus suber</italic>
</kwd>
<kwd>Fruit</kwd>
<kwd>Seed</kwd>
<kwd>Transcriptomics</kwd>
<kwd>Transcription factor</kwd>
<kwd>Transcriptional regulators</kwd>
<kwd>Response to water</kwd>
<kwd>Carbohydrate metabolism</kwd>
</kwd-group>
<custom-meta-group>
<custom-meta>
<meta-name>issue-copyright-statement</meta-name>
<meta-value>© The Author(s) 2015</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="Sec1" sec-type="introduction">
<title>Background</title>
<p>Seed protection and dispersal are the main functions of the fruit. Fruit initiation and development play a crucial role in plant adaptation, and successful fruiting strategies are important drivers of colonization of new niches. Fruit and seed set are generally characterized by extensive cell division and coordinated development of maternal and filial tissues, while growth and maturation stages are characterized by cell expansion and accumulation of storage products, mainly proteins, starch and oils [
<xref ref-type="bibr" rid="CR1">1</xref>
]. The transcriptomic and proteomic analyses of genetic networks operating during specific processes of fruit and seed development have revealed the involvement of a wide range of molecular players including enzymes, regulatory proteins as well as hormonal signals. Molecular studies of fruit development have been mostly conducted in fleshy fruits such as tomato [
<xref ref-type="bibr" rid="CR2">2</xref>
<xref ref-type="bibr" rid="CR7">7</xref>
], grape [
<xref ref-type="bibr" rid="CR8">8</xref>
<xref ref-type="bibr" rid="CR10">10</xref>
], blueberry [
<xref ref-type="bibr" rid="CR11">11</xref>
,
<xref ref-type="bibr" rid="CR12">12</xref>
], sweet orange [
<xref ref-type="bibr" rid="CR13">13</xref>
] or melon [
<xref ref-type="bibr" rid="CR14">14</xref>
], due to their importance for human consumption. Genes related to fruit ripening have been extensively studied in tomato, grape and sweet orange [
<xref ref-type="bibr" rid="CR10">10</xref>
,
<xref ref-type="bibr" rid="CR13">13</xref>
,
<xref ref-type="bibr" rid="CR15">15</xref>
,
<xref ref-type="bibr" rid="CR16">16</xref>
] and genes specifically expressed in fruits have been identified in apple [
<xref ref-type="bibr" rid="CR17">17</xref>
] and date palm [
<xref ref-type="bibr" rid="CR18">18</xref>
]. In addition,
<italic>Arabidopsis</italic>
has proven very informative because its silique is a dehiscent fruit characteristic of the legumes and thus represents another exceptionally important fruit type in terms of human and animal food.</p>
<p>Much less attention has been paid to other types of fruits that although not generally used for human consumption, have huge ecological importance. The Fagaceae family comprises more than one thousand species half of which belong to the
<italic>Quercus</italic>
genus, commonly known as oaks. The oaks produce an indehiscent fruit, usually termed acorn, and are characteristically adapted to extremely variable habitats being widely distributed throughout the northern hemisphere in an almost continuous pattern.</p>
<p>Cork oak (
<italic>Quercus suber</italic>
L
<italic>.</italic>
), native to the western Mediterranean and north Africa regions [
<xref ref-type="bibr" rid="CR19">19</xref>
] characterized by hot and dry summers, has been considered a keystone forest tree species in the ecosystems where it grows [
<xref ref-type="bibr" rid="CR20">20</xref>
,
<xref ref-type="bibr" rid="CR21">21</xref>
]. The species is mostly recognized for producing cork, which is removed from adult trees at regular intervals of at least 9 years, sustaining highly profitable cork industries [
<xref ref-type="bibr" rid="CR22">22</xref>
]. Cork oak has an unusual fruiting strategy as it is the only known oak species with annual and biennial acorns on the same tree [
<xref ref-type="bibr" rid="CR23">23</xref>
<xref ref-type="bibr" rid="CR27">27</xref>
]. Other features such as bigger acorn size have been related to drought tolerance [
<xref ref-type="bibr" rid="CR28">28</xref>
<xref ref-type="bibr" rid="CR30">30</xref>
] and higher seed germination ability [
<xref ref-type="bibr" rid="CR29">29</xref>
<xref ref-type="bibr" rid="CR32">32</xref>
] and thus may strongly impact the capacity for species natural regeneration, the most common way of cork oak propagation [
<xref ref-type="bibr" rid="CR33">33</xref>
]. Seed development and germination are critical for the successful maintenance of the cork oak growing regions [
<xref ref-type="bibr" rid="CR34">34</xref>
<xref ref-type="bibr" rid="CR36">36</xref>
].</p>
<p>During development, the acorn undergoes many biochemical and physiological changes which likely confer the ability to survive the severe drought periods and high temperatures. The few studies that have been conducted in oak acorns have focused on morphological, physiological and phenological aspects [
<xref ref-type="bibr" rid="CR24">24</xref>
,
<xref ref-type="bibr" rid="CR29">29</xref>
,
<xref ref-type="bibr" rid="CR37">37</xref>
] and a few reports exist on aspects of the male and female flower development [
<xref ref-type="bibr" rid="CR33">33</xref>
,
<xref ref-type="bibr" rid="CR38">38</xref>
<xref ref-type="bibr" rid="CR40">40</xref>
] and flower/fruit anatomy [
<xref ref-type="bibr" rid="CR41">41</xref>
]. Although some transcriptomic and genomic studies have also been published in oak species [
<xref ref-type="bibr" rid="CR42">42</xref>
<xref ref-type="bibr" rid="CR44">44</xref>
], it was only recently that the transcriptome of cork oak has started to be analysed in multiple tissues, developmental stages and physiological conditions [
<xref ref-type="bibr" rid="CR45">45</xref>
]. In this context, and to gain knowledge on the molecular mechanisms underlying the development of cork oak acorn and to identify transcripts putatively related with adaptive traits, we have analysed the dynamics of the transcriptome of acorns along five stages of development, defined according to morphological characters, from early fruiting stages to fruit and seed maturation. Our approach identified genes with potentially relevant roles during acorn development focusing specially on transcripts coding for putative transcription factors and transcription regulators or transcripts associated to water related processes including response, transport and deprivation.</p>
</sec>
<sec id="Sec2" sec-type="results">
<title>Results</title>
<sec id="Sec3">
<title>Categorization of cork oak acorns into different developmental stages</title>
<p>Although the fruits are often defined as seed-bearing structures formed from a mature ovary, many structures that might be defined as fruit are in fact composed of different tissue types [
<xref ref-type="bibr" rid="CR46">46</xref>
]. Other definitions have been proposed, such as the one by Van der Pijl [
<xref ref-type="bibr" rid="CR47">47</xref>
] that considers the fruit as the dispersal unit. In this work we use the term acorn for simplicity, referring in fact to all the tissues enclosed by the pericarp, including the seed. It should be pointed out that at maturity most of the acorn mass consists of seed tissues, mainly cotyledons. Cork oak acorns were collected from late June to November in order to cover all developmental stages, from early development to full maturation. A staging system was established based on several morphological aspects (Fig. 
<xref rid="Fig1" ref-type="fig">1</xref>
and Table 
<xref rid="Tab1" ref-type="table">1</xref>
). Since the dimensions of the acorns were variable in the same collection date among trees in different locations, additional features were used to establish developmental classes. These included the presence of a visible endosperm, multiple embryos or a dominant embryo within the developing seed, covering of the acorn by the cupule and colour of the pericarp (Table 
<xref rid="Tab1" ref-type="table">1</xref>
). Accordingly, eight stages of acorn development were established (S1–S8, Fig. 
<xref rid="Fig1" ref-type="fig">1a, b</xref>
). In the first stage (S1), fertilization of the ovules may have occurred already but in most cases the endosperm was not yet visible. In the S2 stage multiple fertilised ovules were visible, however only one continued to grow becoming dominant and causing abortion of the other ovules (S3). During S4 and S5, the embryo continues to develop and in the remaining stages (S6, S7) further enlargement of the cotyledons takes place, with full maturation being reached in S8.
<fig id="Fig1">
<label>Fig. 1</label>
<caption>
<p>Developmental stages established for the cork oak acorn.
<bold>a</bold>
Cork oak fruits collected at different developmental stages (S1-S8). The scale bar corresponds to 1 mm in S1 to S3 and to 5 mm in S4 to S8.
<bold>b</bold>
Cork oak fruits at stages S3-S5 after removal of the cupule (above), or cupule and pericarp (below) exposing the seed, and acorn measurement parameters (S7) used for acorn staging. D, maximum diameter of the acorn; P
<sub>i</sub>
, portion of the acorn outside the cupule; P, acorn portion covered by the cupule. The scale bar corresponds to 1 mm in S3 to S5 and to 5 mm in S7</p>
</caption>
<graphic xlink:href="12870_2015_534_Fig1_HTML" id="MO1"></graphic>
</fig>
<table-wrap id="Tab1">
<label>Table 1</label>
<caption>
<p>Criteria used for categorizing the cork oak acorn into different developmental stages. Representation of each stage in the normalized (N) and non-normalized (nN) cDNA libraries. Embryo tissues isolated from acorns belonging to stages S3-S5 and S8 were classified as EM3-EM5 and EM8</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Developmental stage</th>
<th>Max Ø with cupule (mm)</th>
<th>Max Ø without cupule (mm)</th>
<th>Isolation of embryos</th>
<th>Other observations; library type</th>
</tr>
</thead>
<tbody>
<tr>
<td>S1</td>
<td>2 - 3</td>
<td>nd</td>
<td>no</td>
<td>no endosperm visible; N and nN</td>
</tr>
<tr>
<td>S2</td>
<td>3 - 5</td>
<td>nd</td>
<td>no</td>
<td>multiple fertilized ovules, some aborted; N and nN</td>
</tr>
<tr>
<td>S3</td>
<td>5 - 8</td>
<td>nd</td>
<td>yes (EM3)</td>
<td>dominant embryo; N and nN</td>
</tr>
<tr>
<td>S4</td>
<td>8 - 12</td>
<td>nd</td>
<td>yes (EM4)</td>
<td>acorn completely covered by the cupule; N and nN</td>
</tr>
<tr>
<td>S5</td>
<td>12 - 17</td>
<td>7 - 11</td>
<td>yes (EM5)</td>
<td>acorn already visible out of the cupule; N and nN</td>
</tr>
<tr>
<td>S6</td>
<td>17 - 20</td>
<td>11 - 16</td>
<td>no</td>
<td>~1/2 of the acorn out of the cupule</td>
</tr>
<tr>
<td>S7</td>
<td>>20</td>
<td>>16</td>
<td>no</td>
<td>Green acorn mostly out of the cupule; N</td>
</tr>
<tr>
<td>S8</td>
<td>>20</td>
<td>>16</td>
<td>yes (EM8)</td>
<td>Brown acorn; N and nN</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<p>
<italic>nd</italic>
: not determined</p>
</table-wrap-foot>
</table-wrap>
</p>
</sec>
<sec id="Sec4">
<title>Sequencing and assembly of the cork oak acorn transcriptome</title>
<p>The sequencing of the five non-normalized libraries corresponding to samples from stages S1, S2, S3 + S4, S5 and S8 aimed at gene expression analysis during acorn development. In addition, two normalized libraries prepared from RNA of cork oak acorns or from isolated embryos were sequenced to favour the detection of rare transcripts and thereby facilitate the assembly. After pre-processing, 2,088,335 high-quality sequences were retained and used in the assembly and mapping steps. The final average length of the reads was 215 and 400 bp for the normalized and non-normalized libraries, respectively (Table 
<xref rid="Tab2" ref-type="table">2</xref>
).
<table-wrap id="Tab2">
<label>Table 2</label>
<caption>
<p>Read statistics from libraries of cork oak acorn and embryos before and after pre-processing. Embryo tissues isolated from acorns belonging to stages S3-S5 and S8 were termed EM3-EM5 and EM8, respectively</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="2" colspan="2"></th>
<th colspan="5">Non-normalized cDNA libraries</th>
<th colspan="2">Normalized cDNA libraries</th>
</tr>
<tr>
<th>S1</th>
<th>S2</th>
<th>S3 + S4</th>
<th>S5</th>
<th>S8</th>
<th>S1 to S8</th>
<th>EM3 to EM5 + EM8</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="5">Raw reads</td>
<td>Total</td>
<td>111,703</td>
<td>373,962</td>
<td>200,862</td>
<td>302,253</td>
<td>102,250</td>
<td>738,266</td>
<td>705,151</td>
</tr>
<tr>
<td>Range (bp)</td>
<td>51-1,200</td>
<td>52-1,200</td>
<td>47-1,200</td>
<td>50-1,200</td>
<td>55-1,200</td>
<td>50-1,201</td>
<td>52-1,201</td>
</tr>
<tr>
<td>Mode (bp)</td>
<td>520</td>
<td>521</td>
<td>519</td>
<td>522</td>
<td>519</td>
<td>516</td>
<td>516</td>
</tr>
<tr>
<td>Mean (bp)</td>
<td>503.7</td>
<td>515.8</td>
<td>510.7</td>
<td>524.8</td>
<td>513</td>
<td>538.5</td>
<td>538.7</td>
</tr>
<tr>
<td>Size (Mbp)</td>
<td>47.5</td>
<td>162.5</td>
<td>86.1</td>
<td>133.6</td>
<td>44.3</td>
<td>314.7</td>
<td>298.8</td>
</tr>
<tr>
<td rowspan="5">Valid reads</td>
<td>Total</td>
<td>100,081</td>
<td>332,674</td>
<td>179,588</td>
<td>267,171</td>
<td>88,261</td>
<td>572,665</td>
<td>547,895</td>
</tr>
<tr>
<td>Range (bp)</td>
<td>40-568</td>
<td>40-579</td>
<td>40-571</td>
<td>40-565</td>
<td>40-546</td>
<td>40-576</td>
<td>40-616</td>
</tr>
<tr>
<td>Mode (bp)</td>
<td>209</td>
<td>213</td>
<td>220</td>
<td>217</td>
<td>214</td>
<td>409</td>
<td>380</td>
</tr>
<tr>
<td>Mean (bp)</td>
<td>254.1</td>
<td>255.2</td>
<td>253.6</td>
<td>253.5</td>
<td>258.1</td>
<td>304.3</td>
<td>289.2</td>
</tr>
<tr>
<td>Size (Mbp)</td>
<td>27.6</td>
<td>92.7</td>
<td>49.5</td>
<td>74.4</td>
<td>25.5</td>
<td>201.0</td>
<td>183.0</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p>The seven libraries were assembled by MIRA and Newbler (Table 
<xref rid="Tab3" ref-type="table">3</xref>
). MIRA assembly contained 104,862 contigs, 52.2 % of which were longer than 500 bp. Newbler assembly contained 33,034 contigs, 79.6 % of which were longer than 500 bp. The merging of the MIRA and the Newbler assembly using CAP3 resulted in 80,357 contigs that were deposited in ENA (the accession number of the
<italic>de novo</italic>
transcriptome is [ENA: HABZ01000000] and the accession numbers of the contigs are [ENA: HABZ01000001–HABZ01080357]). 62.5 % of these contigs were longer than 500 bp. The assembled transcripts were classified as complete, terminal, internal or novel by comparison with the complete plant proteins in UniprotKB database (Table 
<xref rid="Tab3" ref-type="table">3</xref>
and Additional file
<xref rid="MOESM1" ref-type="media">1</xref>
). 23,840 contigs did not have any homologous sequence in the tested database (Complete plant Uniprot proteins). However, it was possible to predict a clear ORF for 4,658 of them, and they were classified as novel.
<table-wrap id="Tab3">
<label>Table 3</label>
<caption>
<p>
<italic>De novo</italic>
transcriptome assemblies and classification of the assembled cork oak transcripts</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th></th>
<th>MIRA</th>
<th>Newbler 2.6</th>
<th>Final (Merged)</th>
</tr>
</thead>
<tbody>
<tr>
<td>Contigs</td>
<td>104,862</td>
<td>33,034</td>
<td>80,357</td>
</tr>
<tr>
<td>Contigs > 500 bp</td>
<td>54,764 (52.2 %)</td>
<td>26,313 (79.6 %)</td>
<td>50,197 (62.5 %)</td>
</tr>
<tr>
<td>Contigs < 200 bp</td>
<td>6,306 (6 %)</td>
<td>481 (1.5 %)</td>
<td>4,510
<sup>a</sup>
</td>
</tr>
<tr>
<td>Contigs with homologous in Uniprot</td>
<td>73,103 (69.7 %)</td>
<td>26,951 (81.6 %)</td>
<td>56,517 (70.3 %)</td>
</tr>
<tr>
<td>Unique Uniprot IDs</td>
<td>28,154 (38.5 %)</td>
<td>16,047 (48.6 %)</td>
<td>24,474 (43.3 %)</td>
</tr>
<tr>
<td>Complete contigs</td>
<td>16,149 (15.4 %)</td>
<td>12,953 (39.2 %)</td>
<td>19,146 (23.8 %)</td>
</tr>
<tr>
<td>C-terminus contigs</td>
<td>15,818 (15.1 %)</td>
<td>5,342 (16.2 %)</td>
<td>11,410 (14.2 %)</td>
</tr>
<tr>
<td>N-terminus contigs</td>
<td>15,368 (14.7 %)</td>
<td>4,064 (12.3 %)</td>
<td>10,108 (12.6 %)</td>
</tr>
<tr>
<td>Internal contigs</td>
<td>25,432 (24.2 %)</td>
<td>4,575 (13.8 %)</td>
<td>15,509 (19.3 %)</td>
</tr>
<tr>
<td>Misassembled contigs</td>
<td>336 (0.32 %)</td>
<td>17 (0.05 %)</td>
<td>344 (0.43 %)</td>
</tr>
<tr>
<td>Contigs without UNIPROT homologous</td>
<td>31,759 (30.3 %)</td>
<td>6,083 (18.40 %)</td>
<td>23,840 (29.6 %)</td>
</tr>
<tr>
<td>Novel genes</td>
<td>5,388 (5.14 %)</td>
<td>1,320 (4 %)</td>
<td>4,658 (5.8 %)</td>
</tr>
<tr>
<td>Complete ORF</td>
<td>2,758 (2.6 %)</td>
<td>664 (2.01 %)</td>
<td>2,318 (2.9 %)</td>
</tr>
<tr>
<td>Partial ORF</td>
<td>2,630 (2.5 %)</td>
<td>656 (1.99 %)</td>
<td>2,340 (2.9 %)</td>
</tr>
<tr>
<td>Unknown contigs</td>
<td>26,346 (25.1 %)</td>
<td>4,757 (14.4 %)</td>
<td>19,163 (23.8 %)</td>
</tr>
<tr>
<td>Unknown contigs < 200 bp</td>
<td>5,471 (5.2 %)</td>
<td>407 (1.2 %)</td>
<td>0
<sup>a</sup>
</td>
</tr>
<tr>
<td>Putative ncRNAs</td>
<td>25 (0.02 %)</td>
<td>6 (0.02 %)</td>
<td>19 (0.02 %)</td>
</tr>
<tr>
<td>Reads mapped
<sup>b</sup>
</td>
<td>2,020,921 (96.8 %)</td>
<td>1,909,842 (91.5 %)</td>
<td>2,009,759 (96.2 %)</td>
</tr>
<tr>
<td>Unique mapped reads</td>
<td>1,703,996 (84.3 %)</td>
<td>1,549,803 (74,2 %)</td>
<td>1,491,131 (71.4 %)</td>
</tr>
<tr>
<td>Duplicated mapped reads</td>
<td>273,619 (13.1 %)</td>
<td>270,027 (14.1 %)</td>
<td>367,486 (17.6 %)</td>
</tr>
<tr>
<td>Mapping more than two times</td>
<td>43,306 (2.1 %)</td>
<td>90,012 (4.7 %)</td>
<td>151,142 (7.2 %)</td>
</tr>
<tr>
<td>Average coverage</td>
<td>7.8</td>
<td>14.2</td>
<td>8</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<p>
<sup>a</sup>
Contigs shorter than 200 bp were filtered out before analyzing</p>
<p>
<sup>b</sup>
The percentage of reads that mapped over a possible total of 2,088,230 reads</p>
</table-wrap-foot>
</table-wrap>
</p>
</sec>
<sec id="Sec5">
<title>Completeness of the
<italic>Q. suber</italic>
transcriptome by comparison with other Fagaceae</title>
<p>The proteins in the
<italic>Q. suber</italic>
assembly were compared to the proteins from other four
<italic>Quercus spp</italic>
., two
<italic>Castanea spp</italic>
. and a
<italic>Fagus sp</italic>
. For this purpose, we obtained the assembled transcriptomes from the
<italic>Fagaceae</italic>
project (
<ext-link ext-link-type="uri" xlink:href="http://www.fagaceae.org/">www.fagaceae.org</ext-link>
) or NCBI (for
<italic>Q. robur</italic>
and
<italic>Q. petraea</italic>
). The transcripts in each transcriptome were classified as complete, terminal, internal or novel by comparison with the complete plant proteins in UniprotKB database, as we had previously done for
<italic>Q. suber</italic>
(Additional file
<xref rid="MOESM2" ref-type="media">2</xref>
). Our
<italic>Q. suber</italic>
assembly had the higher number of complete proteins (19,146) and the second higher number of total proteins (56,517).</p>
<p>On average, 94.2 % of the proteins from any of the tested species could be found in our
<italic>de novo</italic>
assembled
<italic>Q. suber</italic>
transcriptome when it was used as the target database (Additional file
<xref rid="MOESM3" ref-type="media">3</xref>
). On the other hand, when the
<italic>Q. suber</italic>
proteins were used as query, we found that between 60 and 80 % of the queries aligned to each of the other transcriptomes, and the higher ratios corresponded to the more complete
<italic>Castanea mollisina</italic>
and
<italic>Castanea dentata</italic>
transcriptomes. Of all the queries, only contig20020 was not found in any other transcriptome.</p>
</sec>
<sec id="Sec6">
<title>Functional annotation of the
<italic>Q. suber</italic>
transcriptome</title>
<p>All 80,357 transcripts were compared with the NCBI non-redundant (nr) protein database using Blastx with an E-value of 1e
<sup>-10</sup>
, which resulted in 53,670 (66.8 %) sequences with a significant alignment (Additional file
<xref rid="MOESM4" ref-type="media">4</xref>
). From the total number of transcripts, 19,757 (24.6 %) transcripts had the best match to
<italic>Vitis vinifera</italic>
sequences, followed by 9,329 (11.6 %); 8,636 (10.7 %) and 5,324 (6.6 %) transcripts that matched to
<italic>Ricinus communis</italic>
,
<italic>Populus trichocarpa</italic>
and
<italic>Glycine max</italic>
sequences, respectively. Similar results have been obtained in the transcriptome annotation for other plant species and linked to conserved biochemical, morphological and developmental characteristics [
<xref ref-type="bibr" rid="CR12">12</xref>
]. The number of alignments obtained among the
<italic>Fagaceae</italic>
family was very low: 122, 101, 97 and 75 sequences matched with sequences of
<italic>Castanea sativa</italic>
,
<italic>Fagus sylvatica</italic>
,
<italic>Quercus suber</italic>
and
<italic>Castanea mollissima</italic>
, respectively (Additional file
<xref rid="MOESM4" ref-type="media">4</xref>
A). This is mainly due to the limited amount of data available at the GenBank database for non-sequenced species. Most of the alignments showed a similitude between 75 and 90 % (Additional file
<xref rid="MOESM4" ref-type="media">4</xref>
B). Only about 7.6 % of the total number of transcripts present in
<italic>Q. suber</italic>
transcriptome was found to be fruit or seed specific but, according to our analysis of the conserved motifs and structures in the sequences, the majority of these transcripts are unknown (Additional file
<xref rid="MOESM1" ref-type="media">1</xref>
).</p>
<p>50,228 (62.5 %) transcripts were annotated with at least one Gene Ontology (GO) term (Additional file
<xref rid="MOESM5" ref-type="media">5</xref>
). There was a direct relation between the sequence length and percentage of annotated sequences and over 75 % of the sequences longer than 1 Kb could be annotated (Additional file
<xref rid="MOESM4" ref-type="media">4</xref>
C).</p>
<p>49,945 (52.15 %)
<italic>Q. suber</italic>
transcripts had a homologous in the
<italic>A. thaliana</italic>
genome (Blastx E-value < 1e
<sup>-10</sup>
). Each transcript was annotated with the GO terms of its
<italic>Arabidopsis</italic>
homologous gene. Additionally, each
<italic>A. thaliana</italic>
gene was annotated with its NCBI COGs, if any exists, and this annotation was also associated backwards to the original
<italic>Q. suber</italic>
transcript (Additional file
<xref rid="MOESM6" ref-type="media">6</xref>
). In order to compare our
<italic>de novo</italic>
transcriptome and identify COGs specific to
<italic>Q. suber</italic>
, a similar approach was followed for
<italic>Q. petraea</italic>
,
<italic>Q. robur</italic>
and the cork oak ESTs database (CODB). 44,300 (55.1 %); 59,572 (74.1 %) and 51,916 (64.6 %) transcripts from
<italic>Q. petraea</italic>
,
<italic>Q. robur</italic>
and CODB were homologous to genes from the
<italic>A. thaliana</italic>
genome, respectively. The distribution of protein clusters is summarized in a Venn diagram (Additional file
<xref rid="MOESM7" ref-type="media">7</xref>
). 2,254 (72.5 %) of a total of 3,110 COGs were present in all the species and 222 COGs were specific to
<italic>Q. suber</italic>
. Of these 222 COGs, 12.2 % were involved in
<italic>replication, recombination and repair</italic>
, 6.3 % in
<italic>RNA processing and modification,</italic>
5.9 % in
<italic>translation, ribosomal structure and biogenesis</italic>
, 5.4 % in
<italic>cell cycle control</italic>
,
<italic>cell division and chromosome partition</italic>
, 5 % in
<italic>post-translational modifications, protein turnover and chaperones</italic>
and 5 % in
<italic>transcription</italic>
. Finally, 20.8 % of the 222 COGs were
<italic>unknown</italic>
or
<italic>poorly characterized</italic>
(Additional file
<xref rid="MOESM6" ref-type="media">6</xref>
: File S3 and Additional file
<xref rid="MOESM8" ref-type="media">8</xref>
).</p>
</sec>
<sec id="Sec7">
<title>Pathway analysis during cork oak acorn development</title>
<p>15,612 (19.4 %) sequences were annotated according to their homology with known enzymes that belonged to 140 pathways (KEGG level-3 pathways) and all 14 KEGG groups of related pathways (KEGG level-2 pathways) (Additional file
<xref rid="MOESM9" ref-type="media">9</xref>
). The
<italic>carbohydrate metabolism</italic>
was the group most represented, which also includes several of the more represented pathways, such as
<italic>starch and sucrose</italic>
,
<italic>glycolysis and gluconeogenesis</italic>
,
<italic>amino sugar and nucleotide sugar</italic>
,
<italic>pyruvate</italic>
, and
<italic>galactose</italic>
metabolic pathways. The second most represented group was
<italic>amino acid metabolism</italic>
, which includes
<italic>phenylalanine metabolism</italic>
. When the number of different enzymes is considered, the more relevant pathways were
<italic>glycine, serine and threonine</italic>
;
<italic>arginine and proline</italic>
and
<italic>cysteine and methionine</italic>
pathways. The third most represented group was
<italic>lipid metabolism</italic>
followed by
<italic>energy metabolism</italic>
. Among the most represented pathways were also
<italic>purine</italic>
and
<italic>pyrimidine metabolism</italic>
,
<italic>methane metabolism</italic>
, and
<italic>phenylpropanoid biosynthesis</italic>
(Additional file
<xref rid="MOESM9" ref-type="media">9</xref>
)
<italic>.</italic>
</p>
<p>The reads from the five non-normalized libraries were mapped to the transcripts in the final assembly to quantify the expression in each stage. The number of mapped reads of the transcripts belonging to the same pathway was summed up to determine the expression of each pathway on time (Additional file
<xref rid="MOESM9" ref-type="media">9</xref>
). The normalized expression values for the level 2 pathways were represented in a heatmap (Fig. 
<xref rid="Fig2" ref-type="fig">2</xref>
). While the
<italic>immune system</italic>
was the most up-regulated pathway in the first acorn developmental stage (S1), followed by
<italic>metabolism of other aminoacids</italic>
and
<italic>secondary metabolites</italic>
, in middle stages of development (S2 to S5) up-regulation of
<italic>carbohydrate</italic>
,
<italic>nucleotide</italic>
,
<italic>glycan biosynthesis</italic>
and
<italic>energy metabolism</italic>
was observed.
<italic>Signal transduction</italic>
pathways were up-regulated only in S2, while
<italic>amino acid metabolism</italic>
and
<italic>translation</italic>
were specifically up-regulated in S3S4. S8 exhibited an expression profile markedly different from other developmental stages where
<italic>lipid metabolism</italic>
and
<italic>metabolism of cofactors and vitamins</italic>
were specifically up-regulated.
<fig id="Fig2">
<label>Fig. 2</label>
<caption>
<p>Heatmap of the expression levels of the KEGG level 2 pathways. The expression levels were normalized in Z scores, with signals from red (higher expression) to green (lower expression)</p>
</caption>
<graphic xlink:href="12870_2015_534_Fig2_HTML" id="MO2"></graphic>
</fig>
</p>
</sec>
<sec id="Sec8">
<title>Differentially expressed genes (DEGs) during cork oak acorn development</title>
<p>From the mapping of the reads of the five non-normalized libraries to the assembled transcriptome, 58,839 genes were identified as expressed during any of the developmental stages, 7,824 transcripts (13.3 %) were expressed in all the stages and 22,802 (38.8 %) were specific to one stage. The total number of transcripts present in each stage was 23,104 (39.3 %); 37,501 (63.7 %); 30,035 (51 %); 33,367 (56.7 %) and 17,310 (29.4 %), respectively from S1 to S8 (Additional file
<xref rid="MOESM10" ref-type="media">10</xref>
).</p>
<p>Of the 58,839 transcripts expressed during acorn development, 2,285 (3.9 %) were considered DE (Additional file
<xref rid="MOESM11" ref-type="media">11</xref>
). From those 710 (31.1 %), 475 (20.8 %), 685 (30 %) and 1,078 (47.2 %) transcripts were DE between stages S2 and S1, S3S4 and S2, S5 and S3S4, and S8 and S5, respectively. 568 transcripts (24.9 %) were DE in more than one stage transition (Fig. 
<xref rid="Fig3" ref-type="fig">3</xref>
). From the DEGs only 30 (~1.3 %) were found as acorn specific, with 5 transcripts in stage S1, 14 in stage S3S4, 7 in stage S5 and 4 in the last stage of the acorn development (S8). However, the majority of these transcripts are of unknown function (Additional file
<xref rid="MOESM11" ref-type="media">11</xref>
).
<fig id="Fig3">
<label>Fig. 3</label>
<caption>
<p>Venn diagram illustrating the number of transcripts differentially expressed between two consecutive stages of development</p>
</caption>
<graphic xlink:href="12870_2015_534_Fig3_HTML" id="MO3"></graphic>
</fig>
</p>
<p>An enrichment analysis by F-fisher test (FDR < 0.05) comparing the set of 2,285 DEGs
<italic>versus</italic>
the complete transcriptome evidenced 466 over-represented GO terms (Additional file
<xref rid="MOESM12" ref-type="media">12</xref>
). One third of the DEGs were involved in responses to abiotic stimulus, one fifth in carbohydrate catabolism, and other fifth in the catabolism and generation of energetic compounds. GO terms related with transport process, such as water and auxin polar transport, or development and growth were also significantly represented (Additional file
<xref rid="MOESM13" ref-type="media">13</xref>
).</p>
<p>DEGs were clustered in six groups according to their expression profile on time (Fig. 
<xref rid="Fig4" ref-type="fig">4</xref>
and Additional file
<xref rid="MOESM11" ref-type="media">11</xref>
). Since each cluster contains genes with a peak of expression in specific stage(s) of development, an enrichment analysis (FDR < 0.01) of the genes in each cluster
<italic>versus</italic>
the complete transcriptome evidenced the dominant processes in those stages (Additional file
<xref rid="MOESM12" ref-type="media">12</xref>
). Eight GO terms were over-represented at S1 (cluster A) including
<italic>response to stimulus, response to osmotic</italic>
and
<italic>salt stress</italic>
, and
<italic>hexose transmembrane transport</italic>
. Forty-one GO terms were over-represented at S2 (cluster B), including
<italic>response to stress</italic>
,
<italic>to water</italic>
,
<italic>to water deprivation</italic>
,
<italic>to osmotic</italic>
and
<italic>to salt stresses</italic>
, as well as
<italic>water transport</italic>
, and
<italic>transmembrane trans</italic>
port. At S3S4 stages (cluster C) 73 GO terms were over-represented, including the previous terms related with response, and also
<italic>regulation of meristem growth</italic>
and
<italic>of meristem development</italic>
, among others. Thirty-one GO terms were over-represented at S5 (cluster D), and 68 GO terms at S5 and S8 (cluster E), including
<italic>glycogen synthesis</italic>
and
<italic>metabolism</italic>
,
<italic>carbohydrates</italic>
(
<italic>glucose</italic>
,
<italic>hexose</italic>
,
<italic>glucan</italic>
)
<italic>metabolism</italic>
, as well as
<italic>starch synthesis</italic>
and
<italic>xylem development</italic>
. Fifty GO terms were over-expressed at S8 (cluster F), including
<italic>chitin binding</italic>
and
<italic>metabolism</italic>
and
<italic>aminoglycan</italic>
,
<italic>amino sugar</italic>
,
<italic>glucosamine</italic>
and
<italic>polysaccharide catabolism</italic>
.
<fig id="Fig4">
<label>Fig. 4</label>
<caption>
<p>Clustering analysis of differentially expressed genes (DEGs) according to their expression profiles</p>
</caption>
<graphic xlink:href="12870_2015_534_Fig4_HTML" id="MO4"></graphic>
</fig>
</p>
</sec>
<sec id="Sec9">
<title>Genes related to response to water, water deprivation or water transport</title>
<p>From the total DEG, 211 (9.23 %) were related to
<italic>water response</italic>
,
<italic>deprivation</italic>
and
<italic>transport</italic>
, and distributed across all the developmental stages but over-represented in S2, followed by the last developmental stage (S8) (Additional file
<xref rid="MOESM14" ref-type="media">14</xref>
). A shortlist of these transcripts is presented in Table 
<xref rid="Tab4" ref-type="table">4</xref>
, including those that have a known
<italic>Arabidopsis</italic>
homolog, are specific of a single cluster and have a level of expression at a given stage higher than 85 % compared with its expression in all stages. Fulfilling these criteria and mostly expressed in the first stage of acorn development (S1-cluster A) we found an homolog of the ABC transporter family,
<italic>MULTIDRUG RESISTANCE P-GLYCOPROTEINS</italic>
(
<italic>MDR4</italic>
/
<italic>PGP4</italic>
/
<italic>ABCB4</italic>
) as well as an homolog of the
<italic>UBIQUITIN-CONJUGATING ENZYME 32</italic>
(
<italic>UBC32</italic>
). In cluster B, with a peak of expression in stage S2, an homolog of the
<italic>Arabidopsis β-AMYLASE 1</italic>
(
<italic>BAM1</italic>
) was identified. In the subsequent stages of acorn development (S3S4, cluster C) we found a transcript with homology to the
<italic>RESPONSIVE TO DESICCATION 22</italic>
(
<italic>RD22</italic>
). Specific to cluster D we found homologs of the
<italic>ALPHA-GLUCAN PHOSPHORYLASE 1</italic>
(
<italic>PHS1</italic>
),
<italic>EARLY RESPONSIVE TO DEHYDRATION 5</italic>
(
<italic>ERD5</italic>
) and the
<italic>ABA INSENSITIVE 3</italic>
(
<italic>ABI3</italic>
). With an expression profile that fits in cluster E, was a member of the
<italic>EARLY RESPONSIVE TO DEHYDRATION</italic>
, an homolog of the
<italic>ERD15</italic>
. Transcripts putatively encoding for members of Late Embryogenesis Abundant protein family, such as
<italic>LATE EMBRYOGENESIS ABUNDANT 4–5</italic>
(
<italic>LEA4–5</italic>
),
<italic>DEHYDRIN XERO 1</italic>
(
<italic>XERO1</italic>
) and
<italic>DROUGHT-INDUCED 21</italic>
(
<italic>DI21</italic>
), for
<italic>LIPID TRANSFER PROTEIN 3</italic>
(
<italic>LTP3</italic>
), for
<italic>URIDINE DIPHOSPHATE GLYCOSYLTRANSFERASE 74E2</italic>
(
<italic>UGT74E2</italic>
) and for
<italic>METALLOTHIONEIN 3</italic>
(
<italic>MT3</italic>
) were almost uniquely expressed in the last stage of the acorn development (Table 
<xref rid="Tab4" ref-type="table">4</xref>
and Additional file
<xref rid="MOESM14" ref-type="media">14</xref>
).
<table-wrap id="Tab4">
<label>Table 4</label>
<caption>
<p>Shortlist of differentially expressed transcripts annotated as involved in response to water. Transcripts with a known
<italic>Arabidopsis</italic>
homolog were selected from a total of 211 DEGs in this category, based on their specificity to a single cluster and higher expression level in a given stage as determined by a stage expression factor (SEF
<sup>a</sup>
) higher than 0.85. To have transcripts specific of cluster D in the short list, the stage expression factor considered in this case was 0.57. Expression in each stage is represented as normalized counts</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Cluster</th>
<th>Transcript name</th>
<th>
<italic>At</italic>
Locus</th>
<th>
<italic>At</italic>
homologous</th>
<th>Annotation</th>
<th colspan="5">counts</th>
<th>SEF
<sup>a</sup>
</th>
</tr>
<tr>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
<th>S1</th>
<th>S2</th>
<th>S3S4</th>
<th>S5</th>
<th>S8</th>
<th></th>
</tr>
</thead>
<tbody>
<tr>
<td>A</td>
<td>Contig16112</td>
<td>AT2G47000</td>
<td>MDR4, PGP4, ABCB4</td>
<td>Multidrug resistance 4, P-glycoprotein 4, ATP binding cassette subfamily B4</td>
<td>19.8</td>
<td>0</td>
<td>0.6</td>
<td>0.4</td>
<td>0</td>
<td>0.95</td>
</tr>
<tr>
<td>A</td>
<td>Qs-dev_rep_c84235</td>
<td>AT3G17000</td>
<td>UBC32</td>
<td>Ubiquitin-conjugating enzyme 32</td>
<td>25</td>
<td>0</td>
<td>1.2</td>
<td>0</td>
<td>1.2</td>
<td>0.91</td>
</tr>
<tr>
<td rowspan="2">B</td>
<td>Contig18768</td>
<td rowspan="2">AT3G23920</td>
<td rowspan="2">BAM1</td>
<td rowspan="2">β-Amylase 1</td>
<td>1.2</td>
<td>29.6</td>
<td>0.6</td>
<td>1.2</td>
<td>2.2</td>
<td>0.85</td>
</tr>
<tr>
<td>Qs-dev_rep_c76744</td>
<td>0.4</td>
<td>54.2</td>
<td>0.2</td>
<td>8.4</td>
<td>0.8</td>
<td>0.85</td>
</tr>
<tr>
<td>C</td>
<td>Qs-dev_rep_c77033</td>
<td>AT5G25610</td>
<td>RD22</td>
<td>Responsive to desiccation 22</td>
<td>0.4</td>
<td>0</td>
<td>34.4</td>
<td>0</td>
<td>3.6</td>
<td>0.90</td>
</tr>
<tr>
<td>D</td>
<td>Contig17288</td>
<td>AT3G30775</td>
<td>ERD5, PRODH, ATPOX, ATPDH, PRO1, PDH1</td>
<td>Methylenetetrahydrofolate reductase family protein</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>22</td>
<td>15</td>
<td>0.59</td>
</tr>
<tr>
<td>D</td>
<td>Qs-dev_rep_c76415</td>
<td>AT3G29320</td>
<td>PHS1</td>
<td>Glycosyl transferase</td>
<td>0.4</td>
<td>0.6</td>
<td>0.2</td>
<td>25.4</td>
<td>16.6</td>
<td>0.59</td>
</tr>
<tr>
<td>D</td>
<td>Contig19318</td>
<td>AT3G24650</td>
<td>ABI3</td>
<td>AP2/B3-like transcriptional factor family protein</td>
<td>0</td>
<td>0</td>
<td>7.2</td>
<td>66.8</td>
<td>42.2</td>
<td>0.57</td>
</tr>
<tr>
<td>E</td>
<td>Contig19981</td>
<td>AT2G41430</td>
<td>ERD15, LSR1, CID1</td>
<td>Dehydration-induced protein (ERD15)</td>
<td>0</td>
<td>2.2</td>
<td>0.6</td>
<td>25.8</td>
<td>37.2</td>
<td>0.96</td>
</tr>
<tr>
<td>F</td>
<td>Contig18471</td>
<td>AT5G59320</td>
<td>LTP3</td>
<td>Lipid transfer protein 3</td>
<td>0</td>
<td>0.2</td>
<td>0</td>
<td>5.6</td>
<td>38.6</td>
<td>0.87</td>
</tr>
<tr>
<td rowspan="2">F</td>
<td>Contig16935</td>
<td rowspan="2">AT4G15910</td>
<td rowspan="2">DI21</td>
<td rowspan="2">Late embryogenesis abundant protein Lea5; drought-induced 21</td>
<td>1.2</td>
<td>0</td>
<td>3.6</td>
<td>18.8</td>
<td>179.2</td>
<td>0.88</td>
</tr>
<tr>
<td>Qs-dev_c42419</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>16.4</td>
<td>1</td>
</tr>
<tr>
<td>F</td>
<td>Contig18808</td>
<td>AT5G06760</td>
<td>LEA4-5</td>
<td>Late embryogenesis abundant 4-5</td>
<td>1.2</td>
<td>2.2</td>
<td>0.6</td>
<td>0.4</td>
<td>53</td>
<td>0.92</td>
</tr>
<tr>
<td>F</td>
<td>Contig17917</td>
<td>AT3G50980</td>
<td>XERO1</td>
<td>Dehydrin xero1</td>
<td>3</td>
<td>0.8</td>
<td>0.6</td>
<td>3.4</td>
<td>50.8</td>
<td>0.87</td>
</tr>
<tr>
<td>F</td>
<td>Contig19993</td>
<td>AT1G05680</td>
<td>UGT74E2</td>
<td>Uridine diphosphate glycosyltransferase 74E2</td>
<td>0</td>
<td>0.8</td>
<td>0</td>
<td>4.2</td>
<td>33.8</td>
<td>0.87</td>
</tr>
<tr>
<td rowspan="2">F</td>
<td>Qs-dev_rep_c73281</td>
<td rowspan="2">AT3G15353</td>
<td rowspan="2">MT3</td>
<td rowspan="2">Metallothionein 3</td>
<td>0.4</td>
<td>3</td>
<td>0.2</td>
<td>4.6</td>
<td>75</td>
<td>0.90</td>
</tr>
<tr>
<td>Qs-dev_rep_c79475</td>
<td>0.4</td>
<td>0</td>
<td>0.2</td>
<td>0.8</td>
<td>18.8</td>
<td>0.93</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<p>
<sup>a</sup>
<inline-formula id="IEq1">
<alternatives>
<tex-math id="M1">\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ Stage\ Expression\ Factor=\frac{normalizedcount{s}_{stageX}}{{\displaystyle \sum } normalizedcount{s}_{allstages}} $$\end{document}</tex-math>
<mml:math id="M2">
<mml:mtext mathvariant="italic">Stage Expression Factor</mml:mtext>
<mml:mo>=</mml:mo>
<mml:mfrac>
<mml:mrow>
<mml:mi mathvariant="italic">normalizedcount</mml:mi>
<mml:msub>
<mml:mi>s</mml:mi>
<mml:mi mathvariant="italic">stageX</mml:mi>
</mml:msub>
</mml:mrow>
<mml:mrow>
<mml:mstyle displaystyle="true">
<mml:mo stretchy="true"></mml:mo>
</mml:mstyle>
<mml:mi mathvariant="italic">normalizedcount</mml:mi>
<mml:msub>
<mml:mi>s</mml:mi>
<mml:mi mathvariant="italic">allstages</mml:mi>
</mml:msub>
</mml:mrow>
</mml:mfrac>
</mml:math>
<inline-graphic xlink:href="12870_2015_534_Article_IEq1.gif"></inline-graphic>
</alternatives>
</inline-formula>
</p>
</table-wrap-foot>
</table-wrap>
</p>
</sec>
<sec id="Sec10">
<title>Transcriptional regulators differentially expressed during acorn development</title>
<p>Transcription factors have important roles in gene expression due to their ability to bind specific DNA sequences and control transcription by acting as transcriptional activators or repressors. Out of 2,285 DEGs during acorn development a total of 498 (21.8 %) were annotated as TFs or transcriptional regulators (Additional file
<xref rid="MOESM15" ref-type="media">15</xref>
). These transcripts were almost equally distributed among the different clusters, but slightly up-regulated in early development, representing approximately 22.5 and 20.7 % of the transcripts in clusters A and B, respectively, and less expressed in the late stages of acorn development representing 7.4 and 15.9 % of the total DE TFs in clusters E and F, respectively.</p>
<p>A list of selected transcripts that have a known
<italic>Arabidopsis</italic>
homolog and are annotated as transcription factors or transcriptional regulators is presented in Table 
<xref rid="Tab5" ref-type="table">5</xref>
, including those that are specific of a single cluster and are also stage-specific or belong to TF families with well characterized roles in plant development. We found homologs of
<italic>MYB DOMAIN PROTEIN 36</italic>
(
<italic>MYB36</italic>
) and
<italic>AUXIN RESPONSE FACTOR 4</italic>
(
<italic>ARF4</italic>
) specifically expressed in stage S1 (cluster A) and a member of the MYB-related family, homolog of the
<italic>PEROXIDASE 72</italic>
(
<italic>PRX72</italic>
) specifically present in stage S3S4 (cluster C). Also other transcripts were identified which expression was restricted to the late stages of development, such as a homolog of the
<italic>FAR1-RELATED SEQUENCE 4</italic>
(
<italic>FRS4</italic>
) in stage S8 (cluster F). Interesting genes from well-known families of TFs or transcriptional regulators such as NAC, bHLH, class II
<italic>KNOTTED1</italic>
-like homeobox and OLEOSIN are also represented during the cork oak acorn development. Up-regulation in the early stages of development (S1 and S2) was observed for class II
<italic>KNOTTED1</italic>
-like homeobox genes. During the late stages of the acorn development transcripts putatively coding for
<italic>OLEOSIN</italic>
(
<italic>OLEO</italic>
) were up-regulated. Transcripts coding for NAC and bHLH transcription factor families were found DE across all the studied developmental stages (Table 
<xref rid="Tab5" ref-type="table">5</xref>
and Additional file
<xref rid="MOESM15" ref-type="media">15</xref>
).
<table-wrap id="Tab5">
<label>Table 5</label>
<caption>
<p>Shortlist of differentially expressed transcripts putatively coding for transcription factors and transcriptional regulators. Transcripts with a known Arabidopsis homolog were selected according the following criteria: transcript is either specific of a single cluster and is stage-specific or belongs to TF families with well characterized roles in plant development</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Cluster</th>
<th>Transcript name</th>
<th>Transcription factor</th>
<th>Domain /Family</th>
<th>
<italic>At</italic>
Locus</th>
<th>
<italic>At</italic>
homologous</th>
<th>Annotation</th>
<th colspan="5">counts</th>
<th>SEF
<sup>a</sup>
</th>
</tr>
<tr>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
<th>S1</th>
<th>S2</th>
<th>S3S4</th>
<th>S5</th>
<th>S8</th>
<th></th>
</tr>
</thead>
<tbody>
<tr>
<td>A</td>
<td>Contig20395</td>
<td>Vitis_vinifera_ GSVIVP00000629001</td>
<td>MYB_DNA binding/MYB</td>
<td>AT5G57620</td>
<td>MYB36</td>
<td>MYB domain protein 36</td>
<td>24.2</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>1</td>
</tr>
<tr>
<td>A</td>
<td>Contig14583</td>
<td>Vitis_vinifera_ GSVIVP00024505001</td>
<td>B3/ARF</td>
<td>AT5G60450</td>
<td>ARF4</td>
<td>Auxin response factor 4</td>
<td>21.6</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>1</td>
</tr>
<tr>
<td>C</td>
<td>Contig20996</td>
<td>Oryza_sativa_subsp._Indica_OsIBCD010288</td>
<td>MYB_DNA binding/MYB-related</td>
<td>AT5G66390</td>
<td>PRX72</td>
<td>Peroxidase superfamily protein</td>
<td>0</td>
<td>0</td>
<td>16.2</td>
<td>0</td>
<td>0</td>
<td>1</td>
</tr>
<tr>
<td>F</td>
<td>Contig14504</td>
<td>Oryza_sativa_subsp._japonica_LOC_Os11g45530.1</td>
<td>FAR1/FAR1</td>
<td>AT1G76320</td>
<td>FRS4, CPD25</td>
<td>FAR1-related sequence 4</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>23.2</td>
<td>1</td>
</tr>
<tr>
<td>A</td>
<td>Contig23988</td>
<td>Carica_papaya_emv.TU.supercontig_187.28</td>
<td rowspan="2">KNOX1/HB</td>
<td>AT5G25220</td>
<td>KNAT3</td>
<td>KNOTTED1-like homeobox gene 3</td>
<td>35.6</td>
<td>0.8</td>
<td>3.8</td>
<td>11.6</td>
<td>13.8</td>
<td>0.54</td>
</tr>
<tr>
<td>B</td>
<td>Contig17627</td>
<td>Vitis_vinifera_ GSVIVP00005632001</td>
<td>AT5G11060</td>
<td>KNAT4</td>
<td>KNOTTED1-like homeobox gene 4</td>
<td>1.2</td>
<td>34</td>
<td>27.4</td>
<td>5.6</td>
<td>2</td>
<td>0.48</td>
</tr>
<tr>
<td>E</td>
<td>Contig24728</td>
<td>Carica_papaya_emv.TU.supercontig_996.1</td>
<td rowspan="2">AP2/AP2-AREBP DUF260/LOB</td>
<td rowspan="2">AT4G25140</td>
<td rowspan="2">OLEO1</td>
<td rowspan="2">Oleosin 1</td>
<td>0</td>
<td>0</td>
<td>3</td>
<td>69.2</td>
<td>58.5</td>
<td>0.98</td>
</tr>
<tr>
<td>E</td>
<td>Contig20473</td>
<td>Vitis_vinifera_ GSVIVP00016010001</td>
<td>0</td>
<td>0</td>
<td>8.2</td>
<td>428.2</td>
<td>192.4</td>
<td>0.99</td>
</tr>
<tr>
<td>E</td>
<td>Contig23293</td>
<td>Vitis_vinifera_ GSVIVP00016010001</td>
<td rowspan="3">DUF260/LOB</td>
<td rowspan="2">AT3G27660</td>
<td rowspan="2">OLEO4</td>
<td rowspan="2">Oleosin 4</td>
<td>0</td>
<td>0</td>
<td>0</td>
<td>71</td>
<td>25.8</td>
<td>1</td>
</tr>
<tr>
<td>F</td>
<td>Qs-dev_rep_c103605</td>
<td>Vitis_vinifera_ GSVIVP00016010001</td>
<td>0.4</td>
<td>0</td>
<td>0</td>
<td>9.2</td>
<td>39.6</td>
<td>0.80</td>
</tr>
<tr>
<td>F</td>
<td>Qs-dev_c70574</td>
<td>Vitis_vinifera_ GSVIVP00016010001</td>
<td>AT5G40420</td>
<td>OLEO2</td>
<td>Oleosin 2</td>
<td>0.2</td>
<td>0</td>
<td>0</td>
<td>2.2</td>
<td>49.8</td>
<td>0.95</td>
</tr>
<tr>
<td>B</td>
<td>Contig1681</td>
<td>Carica_papaya_evm.TU.supercontig_3.229</td>
<td rowspan="3">HLH/bHLH</td>
<td>AT5G08130</td>
<td>BIM1</td>
<td></td>
<td>0</td>
<td>22.8</td>
<td>0</td>
<td>1.2</td>
<td>8.8</td>
<td>0.70</td>
</tr>
<tr>
<td>D</td>
<td>Contig25637</td>
<td>Vitis_vinifera_GSVIVP00008627001</td>
<td>AT1G01260</td>
<td>JAM2</td>
<td>Jasmonate associated MYC2 like 2</td>
<td>5.2</td>
<td>16.6</td>
<td>7.4</td>
<td>21.6</td>
<td>0</td>
<td>0.43</td>
</tr>
<tr>
<td>E</td>
<td>Contig18945</td>
<td>Populus_trichocarpa_180347</td>
<td>AT5G41315</td>
<td>GL3, MYC6.2</td>
<td>Glabra 3, Glabrous 3, MYC6.2</td>
<td>0</td>
<td>4.6</td>
<td>0.6</td>
<td>24.6</td>
<td>23.8</td>
<td>0.90</td>
</tr>
<tr>
<td>A</td>
<td>Contig4505</td>
<td>Populus_trichocarpa_218417</td>
<td rowspan="6">NAM/NAC</td>
<td>AT1G56010</td>
<td>NAC1</td>
<td>NAC domain containing protein 1</td>
<td>34.2</td>
<td>2.2</td>
<td>0.6</td>
<td>0</td>
<td>0</td>
<td>0.92</td>
</tr>
<tr>
<td>A</td>
<td>Contig23086</td>
<td rowspan="2">Populus_trichocarpa_714847</td>
<td rowspan="2">AT1G34190</td>
<td rowspan="2">NAC017, ANAC017</td>
<td rowspan="2">NAC domain containing protein 17</td>
<td>20.2</td>
<td>0</td>
<td>0</td>
<td>11</td>
<td>4.6</td>
<td>0.56</td>
</tr>
<tr>
<td>B</td>
<td>Contig23085</td>
<td>0</td>
<td>27.8</td>
<td>22.8</td>
<td>18.4</td>
<td>7</td>
<td>0.37</td>
</tr>
<tr>
<td>A</td>
<td>Contig16452</td>
<td>Vitis_vinifera_ GSVIVP00027622001</td>
<td>AT4G27410</td>
<td>RD26, ANAC072</td>
<td>Responsive to desiccation 26</td>
<td>608.8</td>
<td>184.2</td>
<td>138.6</td>
<td>32</td>
<td>11</td>
<td>0.62</td>
</tr>
<tr>
<td>B</td>
<td>Contig25368</td>
<td>Vitis_vinifera_ GSVIVP00000471001</td>
<td>AT4G35580</td>
<td>NTL9</td>
<td>NAC transcription factor-like 9</td>
<td>18.2</td>
<td>42</td>
<td>8.2</td>
<td>14.8</td>
<td>0</td>
<td>0.50</td>
</tr>
<tr>
<td>D</td>
<td>Contig26025</td>
<td>Vitis_vinifera_ GSVIVP00027621001</td>
<td>AT3G15510</td>
<td>NAC2</td>
<td>NAC domain containing protein 2</td>
<td>1.2</td>
<td>1.6</td>
<td>12</td>
<td>19.8</td>
<td>0</td>
<td>0.57</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<p>
<sup>a</sup>
<inline-formula id="IEq2">
<alternatives>
<tex-math id="M3">\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ Stage\ Expression\ Factor=\frac{normalizedcount{s}_{stageX}}{{\displaystyle \sum } normalizedcount{s}_{allstages}} $$\end{document}</tex-math>
<mml:math id="M4">
<mml:mtext mathvariant="italic">Stage Expression Factor</mml:mtext>
<mml:mo>=</mml:mo>
<mml:mfrac>
<mml:mrow>
<mml:mi mathvariant="italic">normalizedcount</mml:mi>
<mml:msub>
<mml:mi>s</mml:mi>
<mml:mi mathvariant="italic">stageX</mml:mi>
</mml:msub>
</mml:mrow>
<mml:mrow>
<mml:mstyle displaystyle="true">
<mml:mo stretchy="true"></mml:mo>
</mml:mstyle>
<mml:mi mathvariant="italic">normalizedcount</mml:mi>
<mml:msub>
<mml:mi>s</mml:mi>
<mml:mi mathvariant="italic">allstages</mml:mi>
</mml:msub>
</mml:mrow>
</mml:mfrac>
</mml:math>
<inline-graphic xlink:href="12870_2015_534_Article_IEq2.gif"></inline-graphic>
</alternatives>
</inline-formula>
</p>
</table-wrap-foot>
</table-wrap>
</p>
</sec>
<sec id="Sec11">
<title>Validation of the differential expression profiles by RT-qPCR</title>
<p>Several genes were selected to validate the data obtained by sequencing with 454 Technology (Table 
<xref rid="Tab6" ref-type="table">6</xref>
). Twenty DEGs related to water responses, seven of which also annotated as TFs, were chosen for the validation of expression profiles by reverse transcription quantitative real-time PCR (RT-qPCR). Two transcripts belong to cluster A, six to cluster B, three to C, four transcripts belong to D and five to F. Correlation between the gene expression levels and the profiles obtained by 454 technology was demonstrated by Pearson correlation (Fig. 
<xref rid="Fig5" ref-type="fig">5</xref>
) with most of the genes showing strong or moderately strong correlation [
<xref ref-type="bibr" rid="CR48">48</xref>
]. In addition, these results also validate that the transcript assemblies are correct for the sequences tested and support the robustness of the transcriptome assembly performed in this work.
<table-wrap id="Tab6">
<label>Table 6</label>
<caption>
<p>Primers used in RT-qPCR for validation of the expression profile obtained by 454 sequencing.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Cluster
<sup>a</sup>
</th>
<th>Gene abbreviation
<sup>b</sup>
</th>
<th>Gene description</th>
<th>Transcript name</th>
<th>
<italic>At</italic>
Locus</th>
<th>Primer sequences (forward / reverse)</th>
</tr>
</thead>
<tbody>
<tr>
<td>A</td>
<td>MRP10, ABCC14</td>
<td>ABC transporter C family member 14</td>
<td>Contig3296</td>
<td>AT3G62700</td>
<td>GCTGCCTTTGCCCCACACT/ TGGAAGAGCCTTGAACGCTGCC</td>
</tr>
<tr>
<td>A</td>
<td>CPK10, CDPK1</td>
<td>Calcium-dependent protein kinase</td>
<td>Contig4133</td>
<td>AT1G18890</td>
<td>GCTCACCTCCCTCGCACAACT/ AGGCGCGAGGTGGCGATAAT</td>
</tr>
<tr>
<td>B</td>
<td>ASPG1</td>
<td>Protein aspartic protease in guard cell</td>
<td>Contig19387</td>
<td>AT3G18490</td>
<td>ATGCAGCTCGCTCGACGTGT/ TGTCGTGTCCGCAACCCAGA</td>
</tr>
<tr>
<td>B</td>
<td>ABF2</td>
<td>Abscisic acid responsive elements-binding factor 2</td>
<td>Contig22999</td>
<td>AT1G45249</td>
<td>CGGCCTGCTTTTTCCGCAACT/ AGTCAGCTGCAAGGTCACGAGC</td>
</tr>
<tr>
<td>B</td>
<td>AVP1</td>
<td>Pyrophosphate-energized vacuolar membrane proton pump</td>
<td>Contig 8793</td>
<td>AT1G15690</td>
<td>CGCACTTGAGAACGACGCT/ TGCGCGGTCGTCGGAATCAT</td>
</tr>
<tr>
<td>B</td>
<td>HSP90-7</td>
<td>Chaperone protein htpG family protein</td>
<td>Qs-dev_rep_c72408</td>
<td>AT4G24190</td>
<td>CAGCATCAGCTTCAGCCTCGGT/ AGCGGCTTCACGCCTTCTGA</td>
</tr>
<tr>
<td>B</td>
<td>BAM1, BMY7, TR-BAMY</td>
<td>β-amylase 1</td>
<td>Contig 25491</td>
<td>AT3G23920</td>
<td>AACGCGAGTTTGCAGGCGCT/ CGACGTTTCCGCCGCATTGA</td>
</tr>
<tr>
<td>B</td>
<td>GolS2</td>
<td>Galactinol synthase 2</td>
<td>Contig 17943</td>
<td>AT1G56600</td>
<td>TGACGCCATAACATGGCCAGCA/ TTGCCAGCAGTGCCCTGACA</td>
</tr>
<tr>
<td>C</td>
<td>ALDH7B4</td>
<td>Aldehyde dehydrogenase 7B4</td>
<td>Contig 9124</td>
<td>AT1G54100</td>
<td>AGGGTGCTCCAACGACTCCA/ ACGCACAGCTAGGCCGATG</td>
</tr>
<tr>
<td>C</td>
<td>OPR3</td>
<td>Oxophytodienoate-reductase 3</td>
<td>Contig 16616</td>
<td>AT2G06050</td>
<td>TTGGTCTCTAACACAGCCGCCG/ CACGGCCGACATGCCATA</td>
</tr>
<tr>
<td>C</td>
<td>PAL1</td>
<td>Phenylalanine ammonia-lyase 1</td>
<td>Contig 9321</td>
<td>AT2G37040</td>
<td>TGCTAACTGGCCGCCCCAAT/ GCCAGAACCAACAGCTGTGCCA</td>
</tr>
<tr>
<td>D</td>
<td>ABI3, SIS10</td>
<td>Abscisic acid insensitive 3</td>
<td>Contig 19318</td>
<td>AT3G24650</td>
<td>GCAGTGGCCGTGGTGCAAT/ ATGGCGAGGCAAAGGCGGTT</td>
</tr>
<tr>
<td>D</td>
<td>PHS1</td>
<td>Glycosyl transferase, family 35</td>
<td>Contig 10143</td>
<td>AT3G29320</td>
<td>TGGCTTGAGATGGGCAACCCT/ TTTGGTGTGCTCCCCGGCAT</td>
</tr>
<tr>
<td>D</td>
<td>SIR</td>
<td>Sulfite reductase</td>
<td>Contig 19883</td>
<td>AT5G04590</td>
<td>TGCAATGGCATGCCCAGCCT/ ACTGGGGTTTCCACCAAGCCA</td>
</tr>
<tr>
<td>D</td>
<td>PIP2B</td>
<td>Aquaporin PIP2-4</td>
<td>Contig 24062</td>
<td>AT2G37170</td>
<td>GCTTGGGCCTTTGGTGGCA/ TGGCTCCACCACCGTACTTGCT</td>
</tr>
<tr>
<td>F</td>
<td>COR414-TM1</td>
<td>Cold-regulated 314 inner membrane 1</td>
<td>Contig 19349</td>
<td>AT1G29395</td>
<td>TGGTGAGCTTGAGCTGCCGT/ TGCAAGCTGCCTGCTCGTGA</td>
</tr>
<tr>
<td>F</td>
<td>DI21</td>
<td>Late embryogenesis abundant protein</td>
<td>Contig 16865</td>
<td>AT4G15910</td>
<td>AGCGTGCTCTCACCTTGTGGT/ TGCGGCTGCATCACATGCCT</td>
</tr>
<tr>
<td>F</td>
<td>JMT</td>
<td>Jasmonic acid carboxyl methyltransf.</td>
<td>Contig 17776</td>
<td>AT1G19640</td>
<td>TGGCTATCTTCGCCGCCCTT/ TGCCGTGGTTTGCACCTACTTCG</td>
</tr>
<tr>
<td>F</td>
<td>GSTU25</td>
<td>Glutathione S-transferase TAU 25</td>
<td>Contig 17981</td>
<td>AT1G17180</td>
<td>ACCACCTCGTCCGCCATTGT/ AGCCTGACCGACTCCATGGCAA</td>
</tr>
<tr>
<td>F</td>
<td>LTP3</td>
<td>Lipid transfer protein 3</td>
<td>Contig 19993</td>
<td>AT5G59320</td>
<td>TGCCCAGGCCACCATAACATGC/ TGTGGTCTTGGCCATGCCGTT</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<p>
<sup>a</sup>
According to their expression profiles each transcript belongs to a different cluster</p>
<p>
<sup>b</sup>
Corresponds to the homologous in
<italic>Arabidopsis thaliana</italic>
</p>
</table-wrap-foot>
</table-wrap>
<fig id="Fig5">
<label>Fig. 5</label>
<caption>
<p>Validation of the RNA-Seq transcript profiles. Comparison of transcripts expression patterns from RNA-Seq data and from reverse transcription quantitative real-time PCR (RT-qPCR). In the y-axis it is represented the Log
<sub>2</sub>
of the relative expression level in each developmental stage and the five acorn developmental stages are represented in the x-axis. The numbers above the graphics correspond to the values obtained with the Pearson correlation</p>
</caption>
<graphic xlink:href="12870_2015_534_Fig5_HTML" id="MO5"></graphic>
</fig>
</p>
</sec>
</sec>
<sec id="Sec12" sec-type="discussion">
<title>Discussion</title>
<p>Based on available genomic resources and NGS technologies we provide here the first overview of the dynamics of the transcriptome along different stages of the acorn development in a Fagaceae species. The analysis of our data highlighted specific genes and processes relevant to better understand the molecular mechanisms involved in cork oak acorn development, and it is expected that this knowledge can be transferable to other oak species of great ecological value. The studied stages of development were established according to morphological criteria and to previously described reports on cork oak reproductive features [
<xref ref-type="bibr" rid="CR33">33</xref>
] in order to cover the whole fruit and seed developmental process.</p>
<p>A set of 2,285 differentially expressed genes were identified with roles in a range of biological processes. We then focused our analysis on groups of transcripts with putative functions in transcriptional regulation and traits likely relevant to seed survival and dispersal, including mechanisms related to water response, water transport and water deprivation.</p>
<sec id="Sec13">
<title>A
<italic>de novo</italic>
transcriptome of cork oak acorn</title>
<p>A
<italic>de novo</italic>
transcriptome assembly with the data here generated allowed us to identify the transcripts expressed during the acorn developmental process, some of which classified as novel. This
<italic>de novo</italic>
assembly facilitated the mapping of reads in unique positions since it was not necessary to allow mismatches between reads and reference. In fact, we discarded the marginal number of reads mapping in several positions. Assemblers of 454 transcriptome data have been systematically compared using real and simulated datasets. In such reviews, Newbler [
<xref ref-type="bibr" rid="CR49">49</xref>
] and MIRA [
<xref ref-type="bibr" rid="CR50">50</xref>
] outperformed other assemblers [
<xref ref-type="bibr" rid="CR51">51</xref>
<xref ref-type="bibr" rid="CR54">54</xref>
]. Newbler usually assembles longer contigs that often cover more than the 80 % of the reference sequences. MIRA joins reads in a more conservative way than Newbler, which prevents chimeric contigs and generates bigger assemblies using more bases and containing higher number of contigs, but some of them are redundant. Kumar
<italic>et al</italic>
. [
<xref ref-type="bibr" rid="CR52">52</xref>
] proposed an assembly strategy that was used for the
<italic>de novo</italic>
assembly of pyrosequencing data from chickpea [
<xref ref-type="bibr" rid="CR53">53</xref>
], by merging individual assemblies using a traditional Overlap-Layout-Consensus assembler, such as CAP3 [
<xref ref-type="bibr" rid="CR55">55</xref>
]. Merged datasets aligned better to reference datasets and were more consistent in the total span and number and size of contigs than individual assemblies. In our case, the number of complete contigs (19,146) was higher in the merged assembly than in the individual ones, while the percentage of C-terminal and N-terminal contigs was smaller in the merged assembly than in any of the original assemblies (Table 
<xref rid="Tab3" ref-type="table">3</xref>
). This supports that several contigs from the same transcript were merged. When compared with other Fagaceae transcriptomes (Additional file
<xref rid="MOESM2" ref-type="media">2</xref>
), we report the highest number of complete proteins and different unique Uniprot IDs, which evidenced the advantages of this strategy.</p>
<p>Pathway analysis revealed that
<italic>carbohydrate metabolism</italic>
was the group (KEGG level-2 pathway) most represented in the transcriptome of developing cork oak acorns, especially in the middle stages of development. The enrichment analysis performed in the different clusters evidenced also the timing when a specific metabolic process appears prevalent. Using this approach, carbohydrates metabolism and starch synthesis, were found over-represented in the transcriptome of acorns at late stages of development, both S5 and S8. However, specific processes like hexose transmembrane transport were found over-represented in early stages of acorn development, where actively dividing cells contribute to a rapid growth of the fruit. In general, hexoses favour cell division and expansion, whereas sucrose favours differentiation and maturation [
<xref ref-type="bibr" rid="CR56">56</xref>
]. This is also supported by the analysis of DEGs. For instance during the middle stages of acorn development, several up-regulated DEGs homologous to
<italic>SUCROSE SYNTHASES</italic>
were identified which are putatively involved in the synthesis of UDP-glucose and ADP-glucose linked to cellulose and starch biosynthesis [
<xref ref-type="bibr" rid="CR57">57</xref>
]. These include
<italic>SUCROSE SYNTHASE 3</italic>
(
<italic>SUS3</italic>
), and
<italic>SUCROSE SYNTHASE 4</italic>
(
<italic>SUS4</italic>
). This is consistent with an active synthesis of cellulose and starch during these developmental stages, possibly related to the mobilization of sucrose into pathways involved in structural and storage functions. One fifth of the identified DEGs are related to carbohydrate metabolism and some of these transcripts, involved in water response or transcriptional regulation, are discussed below.</p>
</sec>
<sec id="Sec14">
<title>Response to water across acorn development</title>
<p>At complete maturity cork oak acorns contain a large and fleshy embryo with high water content. The natural shedding of cork oak acorns coincides with complete maturity and acorns left on the ground after shedding will either germinate or lose their viability as a result of desiccation [
<xref ref-type="bibr" rid="CR24">24</xref>
]. Increased tolerance to desiccation may thus represent an important factor in cork oak regeneration success and the identification of transcripts related to response to water, water deprivation or water transport may prove relevant for highlighting genes with adaptive roles. In agreement with previous reports in
<italic>Arabidopsis</italic>
[
<xref ref-type="bibr" rid="CR58">58</xref>
,
<xref ref-type="bibr" rid="CR59">59</xref>
], the DEGs annotated as being related to water responses during acorn development are not fruit specific. A high number of DEGs in this category were identified in the cluster of transcripts with a higher expression at the last stage of acorn development corresponding to maturity, probably reflecting some reduction in water content at this stage, but also during the early stages. The early stage of fruit and seed development is one of the most sensitive periods of the plant life cycle to abiotic stresses such as drought [
<xref ref-type="bibr" rid="CR60">60</xref>
]. Therefore, it is not surprising that transcripts involved in response to water stress are up regulated at these stages as to ensure the protection of offspring against conditions of low water availability common during the summer.</p>
<p>Among the transcripts strongly related to drought stress that were identified in early development are several homologs of the RD family, including
<italic>RD22</italic>
and other members not listed in Table 
<xref rid="Tab4" ref-type="table">4</xref>
such as
<italic>RD19</italic>
,
<italic>RD21, RD26</italic>
and
<italic>RD29B. RD22</italic>
and
<italic>RD26</italic>
, were previously described to respond to dehydration [
<xref ref-type="bibr" rid="CR61">61</xref>
<xref ref-type="bibr" rid="CR64">64</xref>
] and used as drought-induced marker genes in different plant species [
<xref ref-type="bibr" rid="CR65">65</xref>
<xref ref-type="bibr" rid="CR69">69</xref>
].
<italic>RD22</italic>
is expressed in the early and middle stages of
<italic>Arabidopsis</italic>
seed development [
<xref ref-type="bibr" rid="CR62">62</xref>
] and in our transcriptome analysis it is also highly expressed in the middle stages of the acorn development (S3S4, cluster C). During the early stage of the acorn development (cluster A), a putative homolog of
<italic>MDR4</italic>
annotated as being involved in response to water deprivation was also highly expressed. MDR4 belongs to the large family of the ABC (ATP binding cassete) transporter superfamily and has been mainly characterized for its role in the basipetal redirection of auxin from the root tip [
<xref ref-type="bibr" rid="CR70">70</xref>
,
<xref ref-type="bibr" rid="CR71">71</xref>
]. With the same expression profile (cluster A) was a putative homolog of
<italic>UBC32</italic>
, highly induced under drought stress [
<xref ref-type="bibr" rid="CR72">72</xref>
]. Recently, functional studies in tomato revealed that UBC32 is involved in the regulation of fruit ripening [
<xref ref-type="bibr" rid="CR73">73</xref>
] and, it is possible that it plays a similar function in cork oak acorn development. Carbohydrate metabolism-related transcripts with homologies to
<italic>β-AMYLASE</italic>
genes, which are described as contributing to osmoprotection during desiccation [
<xref ref-type="bibr" rid="CR74">74</xref>
], were also found differentially expressed during acorn development. While some of the amylase transcripts, e.g. homologous to the
<italic>A. thaliana</italic>
chloroplast
<italic>β-AMYLASEs BAM1/BAMY7</italic>
, were up-regulated from the early to middle stages, other transcripts with homology to
<italic>β-AMYLASEs BAM5</italic>
or
<italic>BAM6</italic>
were up-regulated in later stages up to S8, being almost absent in earlier stages. The significance of these divergent expression patterns is not currently clear. It is possible that different roles related for instance to hormone signalling and/or acquisition of desiccation tolerance involving the accumulation of soluble sugars through starch degradation [
<xref ref-type="bibr" rid="CR75">75</xref>
] are played by these enzymes during seed development.</p>
<p>Specific to cluster D are two transcripts putatively related to abscisic acid (ABA) signalling/responses, homologs of
<italic>PHS1</italic>
and
<italic>ABI3. PHS1</italic>
is a negative regulator of ABA signalling involved in the regulation of stomatal aperture [
<xref ref-type="bibr" rid="CR76">76</xref>
]. Its expression pattern under different stresses vary significantly among species but it has been associated to drought responses [
<xref ref-type="bibr" rid="CR77">77</xref>
]. Like in barley, we detected low expression of this transcript in early acorn development and its putative involvement in the regulation of starch synthesis during endosperm development [
<xref ref-type="bibr" rid="CR77">77</xref>
,
<xref ref-type="bibr" rid="CR78">78</xref>
] may explain its up-regulation in later stages of seed development (S5). With the same expression profile is a homolog of a well characterized gene related to acquisition of tolerance to seed desiccation,
<italic>ABI3</italic>
, putatively encoding a TF expressed in seeds that mediates ABA responses. In
<italic>Arabidopsis</italic>
,
<italic>ABI3</italic>
is required during seed maturation for the accumulation of seed storage proteins, dormancy onset and maintenance and for the acquisition of seed desiccation tolerance [
<xref ref-type="bibr" rid="CR79">79</xref>
,
<xref ref-type="bibr" rid="CR80">80</xref>
]. Our results seem in agreement with a tight regulation of the mechanisms controlled by
<italic>ABI3</italic>
during cork oak seed development towards maturation, such as ABA responsiveness and synthesis and accumulation of proline in order to increase stress tolerance in the embryo [
<xref ref-type="bibr" rid="CR81">81</xref>
]. The expression profile of
<italic>ABI3</italic>
seems consistent with alterations in ABA content as described for the recalcitrant seeds (desiccation-sensitive) of
<italic>Quercus robur</italic>
[
<xref ref-type="bibr" rid="CR82">82</xref>
,
<xref ref-type="bibr" rid="CR83">83</xref>
] and corresponding ABA-induced processes along development. Like
<italic>PHS1</italic>
and
<italic>ABI3</italic>
, an homolog of the
<italic>EARLY RESPONSIVE TO DEHYDRATION 15 (ERD15</italic>
) is up-regulated in stage S5 (cluster E).
<italic>ERD</italic>
genes are rapidly activated by dehydration and the encoded proteins constitute the first line of defense against drought stress [
<xref ref-type="bibr" rid="CR84">84</xref>
,
<xref ref-type="bibr" rid="CR85">85</xref>
]. In
<italic>Arabidopsis ERD15</italic>
is a common regulator of the ABA response and salicylic acid (SA)-dependent pathway [
<xref ref-type="bibr" rid="CR86">86</xref>
] encoding a protein with functions in stress responses, including drought [
<xref ref-type="bibr" rid="CR87">87</xref>
].</p>
<p>During the last stage of acorn development (S8, cluster F) several transcripts protrude from the list of DEGs annotated as related to water responses. A homolog of
<italic>LTP3</italic>
, known in
<italic>Arabidopsis</italic>
to be highly expressed in mature siliques and induced by drought [
<xref ref-type="bibr" rid="CR88">88</xref>
,
<xref ref-type="bibr" rid="CR89">89</xref>
], was specific to the late stages of acorn development. The
<italic>Arabidopsis LTP3</italic>
positively regulates the plant response to drought stress through the transcriptional activation of the cuticular wax biosynthesis to avoid dehydration [
<xref ref-type="bibr" rid="CR88">88</xref>
,
<xref ref-type="bibr" rid="CR89">89</xref>
]. Also well represented in cluster F are the
<italic>LATE EMBRYOGENESIS ABUNDANT</italic>
(
<italic>LEA</italic>
), the protein family to which
<italic>DI21</italic>
belongs, as well as
<italic>XERO1</italic>
and
<italic>LEA4–5</italic>
. This protein family plays major roles in desiccation tolerance [
<xref ref-type="bibr" rid="CR90">90</xref>
] and is characteristically accumulated in the last stages of seed development [
<xref ref-type="bibr" rid="CR91">91</xref>
] as also observed in our data. The
<italic>Arabidopsis XERO1</italic>
was only detected in seeds whereas
<italic>DI21</italic>
was detected ubiquitously [
<xref ref-type="bibr" rid="CR92">92</xref>
].
<italic>LEA4-5</italic>
highly accumulates during late
<italic>Arabidopsis</italic>
embryogenesis and in dry seeds, and upon constitutive expression it confers tolerance to severe drought [
<xref ref-type="bibr" rid="CR91">91</xref>
]. In oil palm
<italic>LEA4</italic>
is solely expressed in the mesocarp, and similarly to what we have obtained in the cork oak acorns, it is expressed in the late stages of fruit development, being probably involved in plant adaptation and stress (drought) responsive pathway [
<xref ref-type="bibr" rid="CR93">93</xref>
]. Also
<italic>DI21</italic>
is known to be up-regulated under abiotic stresses and
<italic>XERO1</italic>
is thought to protect cellular components from dehydration stress [
<xref ref-type="bibr" rid="CR92">92</xref>
]. Accumulation of LEA proteins during seed maturation and in response to altered water status was previously observed in oak species [
<xref ref-type="bibr" rid="CR82">82</xref>
,
<xref ref-type="bibr" rid="CR94">94</xref>
,
<xref ref-type="bibr" rid="CR95">95</xref>
]. However, their effect in increasing drought tolerance in oaks is not as extensive as in non-recalcitrant seeds [
<xref ref-type="bibr" rid="CR83">83</xref>
]. Another worth mentioning transcript putatively related to desiccation tolerance and up-regulated in the last stage of the acorn development is a homolog of the
<italic>UGT74E2</italic>
, encoding a hydrogen peroxide–responsive UDP-glucosyltransferase. Ectopic expression of
<italic>UGT74E2</italic>
was associated to changes in plant architecture and to an increased tolerance to drought and salt stresses [
<xref ref-type="bibr" rid="CR96">96</xref>
]. Increased tolerance to abiotic stresses, such as drought, was also verified in transgenic tobacco plants overexpressing the cotton type 3 metallothionein (
<italic>GhMT3a</italic>
) [
<xref ref-type="bibr" rid="CR97">97</xref>
], a homolog of which was also identified up-regulated in late acorn development. Interestingly, many members of this group are associated with fruit ripening [
<xref ref-type="bibr" rid="CR98">98</xref>
<xref ref-type="bibr" rid="CR101">101</xref>
]. Like in the cork oak acorns, also in apple and kiwifruit
<italic>MT3</italic>
was barely detected in young fruits but accumulated later with fruit development and fruit ripening [
<xref ref-type="bibr" rid="CR98">98</xref>
,
<xref ref-type="bibr" rid="CR100">100</xref>
] suggesting a role in the ripening process, as well as in setting drought tolerance in this phase of development.</p>
</sec>
<sec id="Sec15">
<title>Transcriptional regulators during acorn development</title>
<p>Transcriptional regulators are crucial for plant developmental processes through their function in the regulation of gene expression, and fruit and seed development is no exception. In
<italic>Arabidopsis</italic>
which, like cork oak, has dry fruits, it has been revealed that the core and extended genetic network controlling fruit development consists entirely of interactions among transcription factors [
<xref ref-type="bibr" rid="CR46">46</xref>
]. In fact, we found a significant number of differentially expressed transcripts coding for putative transcription factors and other transcriptional regulators along the acorn developmental stages covered by our analysis. However, our results support a slightly more prominent role of these transcripts in early development (S1 and S2) becoming less represented towards acorn maturity. In fact, it is during this stage that the transcription machinery seems more active as evidenced by the higher number of expressed transcripts.</p>
<p>Genes of the auxin response factor family (
<italic>ARFs</italic>
) are key regulators of auxin-modulated gene expression and can either activate or repress transcription of auxin-responsive genes [
<xref ref-type="bibr" rid="CR102">102</xref>
]. A putative ortholog of
<italic>ARF4</italic>
was found specifically expressed in cluster A, suggesting an important role in the initial phase of the acorn development. In tomato,
<italic>ARF4</italic>
was described to repress the expression of auxin-responsive genes, playing a key role in the control of sugar metabolism during fruit development, through the regulation of photosynthetic activity as well as chlorophyll and starch accumulation [
<xref ref-type="bibr" rid="CR103">103</xref>
]. Moreover, it was found highly expressed in the pericarp tissues of immature fruit and then undergoing a marked decline at the onset of ripening associated with the increase in sugar content accumulation [
<xref ref-type="bibr" rid="CR103">103</xref>
]. It is possible that the transcript identified in our data has similar functions in the cork oak acorn development. Interestingly,
<italic>ARF4</italic>
is a putative target gene of ta-siRNAs produced from cleavage of the ta-siRNA locus 3 (TAS3) directed by miR390 which was reported as differentially expressed in cork oak tissues [
<xref ref-type="bibr" rid="CR104">104</xref>
].</p>
<p>Two putative class II
<italic>KNOTTED1</italic>
-like homeobox (
<italic>KNOX2</italic>
) genes were also up-regulated in the early stages of acorn development, one in S1 (
<italic>KNAT3</italic>
) and the other one in S2 (
<italic>KNAT4</italic>
).
<italic>KNAT3</italic>
was previously reported to have a role in seed development, specifically in embryo sac development and during megagametogenesis [
<xref ref-type="bibr" rid="CR105">105</xref>
]. More recently, KNOX2 TFs were shown to have a critical role in establishing an alternation of generations in land plants by preventing the haploid-specific body plan from developing in the diploid plant body [
<xref ref-type="bibr" rid="CR106">106</xref>
], which appears consistent with the up-regulated expression of cork oak putative
<italic>KNOX2</italic>
genes in early acorn developmental stages.</p>
<p>One putative
<italic>MYB</italic>
and one putative
<italic>MYB</italic>
-related transcripts, homologs of the Arabidopsis
<italic>MYB36</italic>
and
<italic>PRX72</italic>
, respectively, were specifically detected in the early and mid-stages of acorn development (cluster A and C, respectively). MYB transcription factors have diverse functions in plants including development, secondary metabolism, hormone signal transduction, disease resistance and abiotic stress tolerance [
<xref ref-type="bibr" rid="CR107">107</xref>
,
<xref ref-type="bibr" rid="CR108">108</xref>
].
<italic>MYB36</italic>
belongs to the
<italic>R2R3-MYB</italic>
gene family [
<xref ref-type="bibr" rid="CR109">109</xref>
], which members have been described as the primary regulators of fruit flavonoid biosynthesis [
<xref ref-type="bibr" rid="CR110">110</xref>
], among other functions [
<xref ref-type="bibr" rid="CR111">111</xref>
]. Within the major flavonoid compounds present in flowers and fruits, the proanthocyanidins are astringent compounds that can offer protection during the early stages of fruit development against herbivory and pathogen attack [
<xref ref-type="bibr" rid="CR112">112</xref>
,
<xref ref-type="bibr" rid="CR113">113</xref>
]. The specific presence of this transcript in the first stage of fruit development here analysed would be consistent with such a function in cork oak acorns, however, other roles should not be excluded. Our study also showed that the cork oak putative homolog to
<italic>AtPRX72</italic>
was expressed in a specific stage of acorn developmental, S3S4 (cluster C). This may be related to the significant increase in the size of the acorn from this point onwards, and therefore increased cell wall expansion processes, but it can be also due to an increase in hardiness of the fruit, suggesting that this gene may function in the lignification process in cork oak acorn, consistent with previously described roles [
<xref ref-type="bibr" rid="CR114">114</xref>
<xref ref-type="bibr" rid="CR117">117</xref>
].</p>
<p>Transcripts identified as specifically expressed in the last stages of development, included a putative transcription factor gene of the
<italic>FAR1</italic>
family, similar to the
<italic>FRS4</italic>
, which is a homolog of
<italic>FHY3</italic>
. Several studies report that FHY3 and FAR1 are required for regulating various aspects of plant processes, such as far-red-mediated seedling de-etiolation, the circadian clock, chloroplast division, and chlorophyll biosynthesis [
<xref ref-type="bibr" rid="CR118">118</xref>
<xref ref-type="bibr" rid="CR124">124</xref>
]. Tang
<italic>et al</italic>
. [
<xref ref-type="bibr" rid="CR125">125</xref>
] have recently reported that knock-out mutants of FHY3 and/or FAR1 have reduced sensitivity to ABA-mediated inhibition of seed germination and seedling growth, lose water faster, and are less tolerant to drought stress than are wild type plants. Given the significance of drought tolerance traits for the successful cork oak natural regeneration process, it is tempting to consider that the putative homolog of
<italic>FRS4</italic>
in the cork oak mature acorn may be involved in conferring tolerance to water stress conditions. However, other roles are also possible [
<xref ref-type="bibr" rid="CR126">126</xref>
].</p>
<p>Another family of proteins described as transcriptional regulators (
<ext-link ext-link-type="uri" xlink:href="http://plntfdb.bio.uni-potsdam.de/">http://plntfdb.bio.uni-potsdam.de/</ext-link>
), the
<italic>OLEOSINS</italic>
(
<italic>OLEO1</italic>
and
<italic>OLEO4</italic>
) were also found specifically up-regulated in the last stages of the acorn development (S5 and S8). This is in accordance with the reported function of these plant specific genes in the control of oil body structure and accumulation of seed reserves, affecting seed germination and embryo phenotypes [
<xref ref-type="bibr" rid="CR127">127</xref>
,
<xref ref-type="bibr" rid="CR128">128</xref>
]. Recent work in different species showed an increase in their accumulation during seed development [
<xref ref-type="bibr" rid="CR129">129</xref>
<xref ref-type="bibr" rid="CR131">131</xref>
].</p>
<p>Several members of two major families of TFs were present in all stages of the acorn development, bHLH and NAC. As an example of a putative bHLH TF gene, a homolog of the
<italic>Arabidopsis bHLH GLABRA3</italic>
(
<italic>GL3</italic>
), was up-regulated during the late stages of the acorn development (S5 and S8- cluster E) when the acorn pericarp starts to become visible out of the cupule and turning brown. If the function of this transcript is conserved, then it is tempting to speculate that its up-regulation during late acorn development is related to the regulation of anthocyanin biosynthesis [
<xref ref-type="bibr" rid="CR132">132</xref>
,
<xref ref-type="bibr" rid="CR133">133</xref>
] that occurs during this phase, and that it may play an important function in seed dispersal by attracting herbivores. Putative NAC family members were also found along different stages of the acorn development. This family of TFs plays important roles in responses to plant biotic and abiotic stress [
<xref ref-type="bibr" rid="CR134">134</xref>
,
<xref ref-type="bibr" rid="CR135">135</xref>
] but also in developmental processes such as seed and embryo development [
<xref ref-type="bibr" rid="CR135">135</xref>
,
<xref ref-type="bibr" rid="CR136">136</xref>
]. Our data revealed three different up-regulated transcripts coding for the NAC protein family at the S1 developmental stage, two at S2 and S5 and one in both S5 and S8. One of these transcripts up-regulated in S1,
<italic>RD26</italic>
, has been mentioned above in relation to response to water [
<xref ref-type="bibr" rid="CR61">61</xref>
,
<xref ref-type="bibr" rid="CR63">63</xref>
].</p>
</sec>
</sec>
<sec id="Sec16" sec-type="conclusion">
<title>Conclusions</title>
<p>In summary, our analysis allowed to cluster transcripts differentially expressed along acorn development in different profiles showing up-regulation in specific stages of development. While the DE transcripts putatively coding for transcriptional regulators associated to several biological processes were found up-regulated in given developmental stages throughout the whole acorn developmental process, other transcripts involved in specific processes such as response to water or carbohydrate metabolism were over-represented in particular stages. Future functional analysis of genes of interest identified in this work will be important to devise successful strategies for regeneration and breeding of this important species. This is especially important when considering the climate changes predicted for the Mediterranean region in the near future [
<xref ref-type="bibr" rid="CR137">137</xref>
,
<xref ref-type="bibr" rid="CR138">138</xref>
] and the fact that drought is the main selection agent in Mediterranean ecosystems [
<xref ref-type="bibr" rid="CR21">21</xref>
,
<xref ref-type="bibr" rid="CR28">28</xref>
]. Additionally, this dataset significantly contributes to increase the still scarce information on cork oak genomics providing tools for further molecular dissection of cork oak biology.</p>
</sec>
<sec id="Sec17" sec-type="materials|methods">
<title>Methods</title>
<sec id="Sec18">
<title>Plant material</title>
<p>Acorns were collected between mid June and late November 2009 from cork oak trees growing in private properties at six different locations in the South and Centre of Portugal: Quinta da Serra (Vila Nogueira de Azeitão), Alter do Chão, São Brás de Alportel, Monchique, Calhariz (Santarém) and Abrantes, after obtaining the required permissions. Samples were collected in accordance with the Portuguese legislation (Decree-laws n.° 169/2001 and n.° 155/2004) for cork oak. The term acorn is here used to refer the whole structure consisting of the pericarp and all the tissues enclosed by the pericarp including the seed. Acorns in the early stages of development (S1 to S4, Fig. 
<xref rid="Fig1" ref-type="fig">1a</xref>
), were collected from 1 to 8 trees in each location and were immediately frozen in liquid nitrogen. To obtain the samples at S5 developmental stage and subsequent stages, branches bearing the acorns were kept at 4 ° C for up to 24 h before collecting the acorns and freezing in liquid nitrogen. In S8 stage samples, approximately 1/3 of the acorn part opposite to the embryo radicle was removed to minimize the presence of polysaccharides that could compromise the purity of isolated RNA. Additionally, some acorns from stage S3, S4, S5 and S8 were opened for embryo isolation (Fig. 
<xref rid="Fig1" ref-type="fig">1b</xref>
); embryos from S8 stage were isolated by excising the embryo axis but excluding most cotyledonal tissue. In each collection, acorns and isolated embryos were carefully observed for evaluation and documentation of the developmental stage.</p>
</sec>
<sec id="Sec19">
<title>RNA extraction</title>
<p>Frozen samples were first ground in a mill (M 20 Universal mill, Ika) previously cooled with liquid nitrogen and then transferred to a cooled mortar and reduced to a fine powder. Total RNA was isolated following a protocol described by Reid
<italic>et al</italic>
. with some minor modifications [
<xref ref-type="bibr" rid="CR139">139</xref>
]. RNA isolation was performed separately by developmental stage, date of collection and mother tree.</p>
<p>Total RNA was purified using the RNeasy MinElute Cleanup kit (Qiagen) with on-column DNase I treatment (Qiagen RNase-Free DNase Set) and only samples with A
<sub>260/280</sub>
 > 1.8 were used for further steps. RNA integrity was assessed in 1 % (w/v) agarose gels after ethidium bromide staining and for a rigorous assessment of RNA quality, the RNA samples were run on a RNA Pico6000 chip in Agilent 2100 Bioanalyzer RNA (Agilent). Additionally, each sample was quantified by fluorescence with the Quant-iT Ribogreen RNA Assay kit (Invitrogen).</p>
</sec>
<sec id="Sec20">
<title>Preparation of cDNA libraries and RNA-Seq</title>
<p>Two normalized and 5 non-normalized cDNA libraries were prepared. Normalized libraries were prepared with RNA isolated from acorn tissues or from isolated embryos, collected from a total of 5 and 3 trees, respectively. In each library, a pool of 2 μg total RNA containing equal amounts of RNA extracted from the several acorn (from S1 to S5, S7 and S8) or embryo developmental stages (from S3 to S5 and S8) was prepared. Double stranded cDNA was obtained using SMART technology [
<xref ref-type="bibr" rid="CR140">140</xref>
] and the normalization was performed with the Duplex-Specific Nuclease (DSN) technology [
<xref ref-type="bibr" rid="CR141">141</xref>
].</p>
<p>The 5 non-normalized cDNA libraries corresponded to different acorn developmental stages (S1, S2, S3 + S4, S5 and S8) collected from 7 different trees. For each library, a pool of total RNA was prepared containing 50 μg of total RNA. MicroPoly(A)Purist kit (Ambion) was used to isolate mRNA from each total RNA pool and 200 ng of mRNA were fragmented and used as template for double stranded cDNA production using cDNA Synthesis System Kit (Roche) followed by adaptor ligation.</p>
<p>Pyrosequencing of the normalized and non-normalized libraries was performed in the Titanium GS-FLX (454-Roche) at Biocant (Cantanhede, Portugal).</p>
<p>The data were deposited in the European Nucleotide Archive (ENA) under the accession number PRJEB6178/ERP005652. For each non-normalized library the accession numbers are the following: [ENA: ERX455655 for S1, ENA: ERX455656 for S2, ENA: ERX455657 for S3S4, ENA: ERX455658 for S5 and ENA: ERX455659 for S8]. For the normalized libraries [ENA: ERX455660 and ENA: ERX455661] are the accession numbers of the acorn and isolated embryo libraries, respectively.</p>
</sec>
<sec id="Sec21">
<title>Reads pre-processing, de novo assembly and transcriptome annotation</title>
<p>The full workflow is schematized in the Additional file
<xref rid="MOESM16" ref-type="media">16</xref>
. First, the raw reads were filtered by SeqTrimNext [
<xref ref-type="bibr" rid="CR142">142</xref>
] to remove adapter sequences and low quality/complexity sequences, which included fragments (window of 15 nts) with a quality value lower than 20, more than an 80 % of indeterminations, or 75 % of polyA or polyT sequences. Fragments with an E-value < 1e
<sup>-10</sup>
and 85 % identity to contaminants such as plastids, mitochondria, ribosome and virus/bacteria sequences, were trimmed. Final sequences shorter than 40 nts were also excluded. RNA-Seq data was
<italic>de novo</italic>
assembled using MIRA version 3.4.0 [
<xref ref-type="bibr" rid="CR50">50</xref>
] and Newbler version 2.6 [
<xref ref-type="bibr" rid="CR49">49</xref>
]. MIRA was executed with the default 454 settings and without clipping steps. Newbler was executed with the default parameters. The individual assemblies were merged with CAP3 with default options and an identity threshold of 95 %.</p>
<p>Transcripts were compared with the Uniprot and Trembl databases using NCBI Blastx with an E-value of 1e
<sup>-6</sup>
. Only full-length plant proteins were included in the target database. “
<italic>Full Lengther Next</italic>
” scripts (
<ext-link ext-link-type="uri" xlink:href="https://rubygems.org/gems/full_lengther_next">https://rubygems.org/gems/full_lengther_next</ext-link>
) were used to compare the aligned regions in query and target, in order to determine the right translation frame and classify the transcripts as complete, internal or terminal. These translated proteins constitute the
<italic>Q. suber</italic>
proteome used in subsequent comparisons. For those transcripts without any alignment, the program runs an Open Reading Frame (ORF) prediction step. Novel ORFs with a result higher than 0.7 (default threshold) were annotated as novel transcripts. The conserved motifs and structures in the sequences of these novel transcripts were identified by comparison against the motifs databases in EBI Interpro (
<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/interpro/interproscan.html">http://www.ebi.ac.uk/interpro/interproscan.html</ext-link>
). Transcripts were compared with the NCBI non-redundant (nr) and
<italic>Arabidopsis</italic>
TAIR protein databases using NCBI Blastx with an E-value of 1e
<sup>-10</sup>
. Results were imported in Blast2GO [
<xref ref-type="bibr" rid="CR143">143</xref>
] to annotate the gene ontology terms, enzymatic protein codes and KEGG pathways. The reads of each transcript belonging to the same pathway were summed up. For each pathway, the number of reads in each stage was transformed in Z-scores, clustered, and plotted in a heatmap using Mayday [
<xref ref-type="bibr" rid="CR144">144</xref>
]. Gene ontology terms and NCBI COGs (Clusters of Orthologous Groups of proteins) associated to each
<italic>Arabidopsis</italic>
gene were downloaded from TAIR (
<ext-link ext-link-type="uri" xlink:href="http://www.arabidopsis.org/">www.arabidopsis.org</ext-link>
) and NCBI (
<ext-link ext-link-type="uri" xlink:href="ftp://ftp.ncbi.nih.gov/pub/COG/KOG/">ftp://ftp.ncbi.nih.gov/pub/COG/KOG/</ext-link>
), and associated back to the original
<italic>Q. suber</italic>
transcript.</p>
<p>The transcriptomes of other Fagaceae species were downloaded from NCBI and Fagaceae Genomics Project (
<ext-link ext-link-type="uri" xlink:href="http://www.fagaceae.org/">www.fagaceae.org</ext-link>
). The proteome for each of them was built in a similar way as for
<italic>Q. suber</italic>
by comparison with the Uniprot and Trembl full plant proteins using the Full Lengther Next scripts. Proteomes were compared by pairs using NCBI Blastp. Proteins in a query species were considered as having an orthologous in a target species if they shared both a minimal identity and coverage of 70 %.</p>
<p>An alignment of the reads obtained from 19 normalized cork oak cDNA libraries prepared from different tissues and made available by [
<xref ref-type="bibr" rid="CR45">45</xref>
], against the reads obtained from the normalized libraries described in this work, was performed to identify the transcripts specifically expressed in fruit and seed tissues. The
<italic>de novo</italic>
transcripts without aligned reads were considered as fruit and seed specific.</p>
</sec>
<sec id="Sec22">
<title>Expression analysis and differentially expressed gene (DEG) clustering</title>
<p>The CLC Genomics Workbench (
<ext-link ext-link-type="uri" xlink:href="http://www.clcbio.com/">http://www.clcbio.com</ext-link>
), version 6.7.2, was used to quantify the expression of the RNA-Seq data in four steps. Firstly, the reads from each of the five non-normalized libraries were aligned to the 80,357 contigs in the
<italic>Q. suber</italic>
assembly using the default scoring values and ignoring reads not uniquely mapping. Secondly, the number of aligned reads in each library was normalized by quartile normalization to take into account the different total number of reads per library. Third, a statistical analysis that compares the expected versus observed proportions of mapped reads by Kal’s z-test [
<xref ref-type="bibr" rid="CR145">145</xref>
] implemented in CLC software between consecutive acorn developmental stages was used to identify the differentially expressed genes (DEGs). Finally, p-values were False Discovery Rate (FDR) corrected. Transcripts with a FDR value lower than 0.01 were considered as differentially expressed (DE).</p>
<p>DEGs were divided in 6 clusters according to the normalized number of aligned reads in each stage by Neural Gas clustering implemented in Mayday [
<xref ref-type="bibr" rid="CR144">144</xref>
] based on Euclidian correlation between expression values. Neural Gas is an alternative to K-means clustering that resulted in clusters with a better balance of members. The list of transcripts in each cluster was used in Blast2GO to identify the enriched GO terms. Blast2GO enrichment analysis was based on a F-fisher test (FDR < 0.05). The relation among GO terms was assigned using REVIGO with the Resvik algorithm option [
<xref ref-type="bibr" rid="CR146">146</xref>
] and R treemap library. DEGs annotated as related to response to water, including water transport and water deprivation were identified. We used the Plant Transcription Factor database (PLNTFDB,
<ext-link ext-link-type="uri" xlink:href="http://plntfdb.bio.uni-potsdam.de/">http://plntfdb.bio.uni-potsdam.de/</ext-link>
) as reference to identify the TFs and other transcriptional regulators in our transcriptome. The database contains close to 30 K protein sequences of experimentally-identified elements from diverse plant species, and their classification in families according to their protein domains by HMM methods. The transcript sequences of the DEGs were aligned to the PLNTFDB using Blastx and a minimum E-value of 1e
<sup>-10</sup>
. We considered any transcript with a result under that threshold as a TF/transcriptional regulator, and annotated it within the family of the homologous with a lower E-value.</p>
</sec>
<sec id="Sec23">
<title>Quantitative RT-PCR analysis</title>
<p>Reverse transcription quantitative real-time PCR (RT-qPCR) of a set of 20 DEGs was carried out to validate the expression profile obtained by 454 sequencing (Table 
<xref rid="Tab6" ref-type="table">6</xref>
). RNA samples were first treated with TURBO DNase (Ambion) and afterwards all cDNAs were synthesized from 1.5 μg of total RNA using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) with the anchored-oligo(dT)
<sub>18</sub>
primers. Specific primers were designed using Geneious software [
<xref ref-type="bibr" rid="CR147">147</xref>
]. Quantitative real-time PCR experiments were then performed in LightCycler 480 (Roche) using SYBR Green I Master (Roche) and 96-well plates. For the genes tested, 3 biological replicates were used and the reaction mixtures were performed in a final volume of 16 μl containing 8 μl of 2× SYBR Green I Master, 400 nM of each primer and 1.5 μl of cDNA as template. The amplification program was the same for all genes tested: 95 ° C for 10 min, 45 cycles of 10 s at 95 ° C, 20 s at 60 ° C and 10 s at 72 ° C, except for
<italic>β-AMYLASE 1</italic>
(
<italic>BAM1</italic>
),
<italic>GALACTINOL SYNTHASE 2</italic>
(
<italic>GolS2</italic>
) and
<italic>CALCIUM DEPENDENT PROTEIN KINASE 10</italic>
(
<italic>CPK10</italic>
) for which the annealing temperature was 62 ° C. A calibrator sample was used in each plate to normalize the values obtained and the potential differences among plates. Normalization was carried out with two reference genes
<italic>ACTIN</italic>
(
<italic>ACT</italic>
) and
<italic>CLATHRIN ADAPTOR COMPLEXES</italic>
(
<italic>CAC</italic>
) [
<xref ref-type="bibr" rid="CR139">139</xref>
]. Normalized relative quantities were obtained through the formula
<inline-formula id="IEq3">
<alternatives>
<tex-math id="M5">\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ NRQ=\frac{{E_{goi}}^{\varLambda Ct,goi}}{f\sqrt{{\displaystyle {\prod}_{\mathrm{o}}^f{E}_{re{f}_{\mathrm{o}}}^{\varDelta Ct,re{f}_{\mathrm{o}}}}}} $$\end{document}</tex-math>
<mml:math id="M6">
<mml:mi>N</mml:mi>
<mml:mi>R</mml:mi>
<mml:mi>Q</mml:mi>
<mml:mo>=</mml:mo>
<mml:mfrac>
<mml:msup>
<mml:msub>
<mml:mi>E</mml:mi>
<mml:mrow>
<mml:mi>g</mml:mi>
<mml:mi>o</mml:mi>
<mml:mi>i</mml:mi>
</mml:mrow>
</mml:msub>
<mml:mrow>
<mml:mi>Λ</mml:mi>
<mml:mi>C</mml:mi>
<mml:mi>t</mml:mi>
<mml:mo>,</mml:mo>
<mml:mi>g</mml:mi>
<mml:mi>o</mml:mi>
<mml:mi>i</mml:mi>
</mml:mrow>
</mml:msup>
<mml:mrow>
<mml:mi>f</mml:mi>
<mml:msqrt>
<mml:mstyle displaystyle="true">
<mml:msubsup>
<mml:mo stretchy="true"></mml:mo>
<mml:mi mathvariant="normal">o</mml:mi>
<mml:mi>f</mml:mi>
</mml:msubsup>
<mml:mrow>
<mml:msubsup>
<mml:mi>E</mml:mi>
<mml:mrow>
<mml:mi>r</mml:mi>
<mml:mi>e</mml:mi>
<mml:msub>
<mml:mi>f</mml:mi>
<mml:mi mathvariant="normal">o</mml:mi>
</mml:msub>
</mml:mrow>
<mml:mrow>
<mml:mi>Δ</mml:mi>
<mml:mi>C</mml:mi>
<mml:mi>t</mml:mi>
<mml:mo>,</mml:mo>
<mml:mi>r</mml:mi>
<mml:mi>e</mml:mi>
<mml:msub>
<mml:mi>f</mml:mi>
<mml:mi mathvariant="normal">o</mml:mi>
</mml:msub>
</mml:mrow>
</mml:msubsup>
</mml:mrow>
</mml:mstyle>
</mml:msqrt>
</mml:mrow>
</mml:mfrac>
</mml:math>
<inline-graphic xlink:href="12870_2015_534_Article_IEq3.gif"></inline-graphic>
</alternatives>
</inline-formula>
, where E is the efficiency of the amplification for each primer pair in each tissue,
<italic>f</italic>
the number of reference genes used to normalize the data,
<italic>goi</italic>
and
<italic>ref</italic>
are the gene of interest and the reference gene, respectively, and ΔCt is the Ct of the calibrator minus the Ct value of the sample in test [
<xref ref-type="bibr" rid="CR148">148</xref>
<xref ref-type="bibr" rid="CR150">150</xref>
]. The data obtained from the RNA-Seq experiment and the RT-qPCR were compared. From the RNA-Seq a logarithmic ratio of base 2 between the counts of a gene in each developmental stage and the mean counts of the same gene in all developmental stages were made. A similar approach was followed for the data obtained by RT-qPCR by doing a logarithmic ratio of base 2 between the normalized quantities of the gene of interest in each developmental stage and the mean normalized quantities of the same gene in all developmental stages in analysis. For genes where the RNA-Seq values were zero in some of the developmental stages, a value of 1 was added to all the RNA-Seq results of those genes to avoid dividing by zero [
<xref ref-type="bibr" rid="CR151">151</xref>
].</p>
</sec>
<sec id="Sec24">
<title>Availability of supporting data</title>
<p>The data sets supporting the results of this article are available in the European Nucleotide Archive (ENA) under the accession number PRJEB6178,
<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/ena/data/view/PRJEB6178">http://www.ebi.ac.uk/ena/data/view/PRJEB6178</ext-link>
. The reads libraries are also available in the ENA repository,
<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/ena/data/view/ERX455655-ERX455661">http://www.ebi.ac.uk/ena/data/view/ERX455655-ERX455661</ext-link>
. The cork oak transcriptome assembly performed in this work is directly available in ENA,
<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/ena/data/view/HABZ01000000">http://www.ebi.ac.uk/ena/data/view/HABZ01000000</ext-link>
, as well as each of the individual contigs,
<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/ena/data/view/HABZ01000001-HABZ01080357">http://www.ebi.ac.uk/ena/data/view/HABZ01000001-HABZ01080357</ext-link>
.</p>
</sec>
</sec>
</body>
<back>
<app-group>
<app id="App1">
<sec id="Sec25">
<title>Additional files</title>
<p>
<media position="anchor" xlink:href="12870_2015_534_MOESM1_ESM.xls" id="MOESM1">
<label>Additional file 1: File S1.</label>
<caption>
<p>
<italic>Quercus suber</italic>
transcript classification and predicted function. Annotation and classification of the assembled transcripts using Full Lengther Next scripts and functional annotation using the Uniprot database. Annotation and characterization (against the motifs databases from EBI Interpro) of the transcripts specific to the cork oak acorn.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM2_ESM.pdf" id="MOESM2">
<label>Additional file 2: Table S1.</label>
<caption>
<p>Comparison of the transcriptomes of several
<italic>Fagaceae</italic>
tree species with full length plant proteins in UniprotKB. Transcriptomes were retrieved from the UniprotKB database.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM3_ESM.pdf" id="MOESM3">
<label>Additional file 3: Table S2.</label>
<caption>
<p>Identification of shared proteins among some members of the
<italic>Fagaceae</italic>
family. Sequences from a query species (rows) with homologous in a different target species (columns). Proteins were considered homologous between the query and target species if they share a minimal identity and coverage of 70 %.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM4_ESM.pdf" id="MOESM4">
<label>Additional file 4: Figure S1.</label>
<caption>
<p>Quality assessment of the gene annotation. (A) Species with the best BLASTX alignment of each query sequence. (B) Values of similitude from Blastx alignments. (C) Number of gene ontology (GO) terms per sequence length.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM5_ESM.xlsx" id="MOESM5">
<label>Additional file 5: File S2.</label>
<caption>
<p>Functional annotation of
<italic>Quercus suber</italic>
transcripts. Annotation was based on the homologous in NCBI and
<italic>Arabidopsis</italic>
(TAIR) databases using Blastx with an E-value of 1e
<sup>-10</sup>
and results were submitted in Blast2GO to annotate gene ontology (GO) terms.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM6_ESM.xlsx" id="MOESM6">
<label>Additional file 6 File S3.</label>
<caption>
<p>Classification of Orthologous Groups (COG). Analysis of the COGs present in data retrieved from
<italic>Q. suber</italic>
, CODB (Cork oak Database),
<italic>Q. petraea</italic>
and
<italic>Q. robur</italic>
and association to each
<italic>Arabidopsis</italic>
gene.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM7_ESM.pdf" id="MOESM7">
<label>Additional file 7: Figure S2.</label>
<caption>
<p>Distribution of Clusters of Orthologs Groups (COGs) between different species of the
<italic>Quercus</italic>
genus:
<italic>Q. suber</italic>
,
<italic>Q. petraea</italic>
and
<italic>Q. robur</italic>
and the data from the Cork Oak Database (CODB).</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM8_ESM.pdf" id="MOESM8">
<label>Additional file 8: Table S3.</label>
<caption>
<p>Biological domain of the clusters of Orthologous Groups of proteins (COGs) specific to
<italic>Q. suber</italic>
.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM9_ESM.xlsx" id="MOESM9">
<label>Additional file 9: File S4.</label>
<caption>
<p>Number of cork oak transcripts in KEGG level 2 and 3 pathways. Expression of each pathway was quantified as the sum of the counts (mapped reads) of all the transcripts belonging to it.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM10_ESM.pdf" id="MOESM10">
<label>Additional file 10: Figure S3.</label>
<caption>
<p>Venn diagram showing the number of transcripts expressed in the different acorn developmental stages.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM11_ESM.xlsx" id="MOESM11">
<label>Additional file 11: File S5.</label>
<caption>
<p>Identification of the genes differentially expressed during acorn development by Z-test. Results of the clustering, fold-change and functional annotation (NCBI, TAIR, UNIPROT) of the differentially expressed genes (DEGs) in consecutive stages of acorn development. Annotation of the DEGs specific to the cork oak acorn.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM12_ESM.xlsx" id="MOESM12">
<label>Additional file 12: File S6.</label>
<caption>
<p>Enrichment analysis of the differentially expressed genes (DEGs). Comparison of the DEGs with the complete transcriptome evidencing the gene ontology (GO) terms over-represented in all the clusters and separately in each cluster.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM13_ESM.pdf" id="MOESM13">
<label>Additional file 13: Figure S4.</label>
<caption>
<p>Treemap of the GO terms from the DEGs. The area of each cell is proportional to the number of genes annotated with that term.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM14_ESM.xlsx" id="MOESM14">
<label>Additional file 14: File S7.</label>
<caption>
<p>Differentially expressed genes related to response to water, water deprivation or water transport. Cluster annotation, Uniprot locus, association with
<italic>Arabidopis</italic>
homologs, normalized counts in each acorn developmental stage, fold-change between consecutive stages, stage expression factor (SEF) and contigs specific to each cluster.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM15_ESM.xlsx" id="MOESM15">
<label>Additional file 15: File S8.</label>
<caption>
<p>Differentially expressed genes annotated as transcription factors and transcriptional regulators. Cluster annotation, Uniprot locus, association with
<italic>Arabidopis</italic>
homologs, normalized counts in each acorn developmental stage, fold-change between consecutive stages, stage expression factor (SEF) and contigs specific to each cluster.</p>
</caption>
</media>
<media position="anchor" xlink:href="12870_2015_534_MOESM16_ESM.pdf" id="MOESM16">
<label>Additional file 16: Figure S5.</label>
<caption>
<p>Workflow of the 454 sequencing data analyses. After sequencing, the raw reads obtained were pre-processed to remove non desired sequences, including low quality sequences and contaminants. The clean reads from all libraries were then assembled using two different assemblers and then joined using CAP3. The obtained contigs that were then associated to gene ontology (GO) terms and searched for transcription factors. After mapping the differentially expressed genes (DEGs) along cork oak acorn development were identified.</p>
</caption>
</media>
</p>
</sec>
</app>
</app-group>
<glossary>
<title>Abbreviations</title>
<def-list>
<def-item>
<term>DE</term>
<def>
<p>Differentially expressed</p>
</def>
</def-item>
<def-item>
<term>DEGs</term>
<def>
<p>Differentially expressed genes</p>
</def>
</def-item>
<def-item>
<term>ESTs</term>
<def>
<p>Expressed sequence tags</p>
</def>
</def-item>
<def-item>
<term>TF</term>
<def>
<p>Transcription factor.</p>
</def>
</def-item>
</def-list>
</glossary>
<fn-group>
<fn>
<p>Andreia Miguel and José de Vega-Bartol contributed equally to this work.</p>
</fn>
<fn>
<p>
<bold>Competing interest</bold>
</p>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</fn>
<fn>
<p>
<bold>Authors’ contributions</bold>
</p>
<p>This study was conceived by CMM, MCV and JL and directed by CMM. Collection and identification of field material was performed by AM, LM, MCV, JL and CMM. Sample preparation and nucleic acid isolation were performed by AM and TS. RT-qPCR was performed by AM and LM. Data analysis and biological interpretation of results were conducted by AM, JVB, IC and CMM. AM, JVB and CMM wrote the paper. All authors read and approved the final manuscript.</p>
</fn>
</fn-group>
<ack>
<title>Acknowledgements</title>
<p>This project was funded by “Fundação para a Ciência e a Tecnologia” (FCT) through projects PEst-OE/EQB/LA0004/2011 and Research unit GREEN-it “Bioresources for Sustainability” (UID/Multi/04551/2013), SOBREIRO/0029/2009, IF/01168/2013, the doctoral fellowship to Andreia Miguel (SFRH/BD/44474/2008) and the post-doctoral fellowship to Liliana Marum (BPD/47679/2008).</p>
</ack>
<ref-list id="Bib1">
<title>References</title>
<ref id="CR1">
<label>1.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ruan</surname>
<given-names>YL</given-names>
</name>
<name>
<surname>Patrick</surname>
<given-names>JW</given-names>
</name>
<name>
<surname>Bouzayen</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Osorio</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Fernie</surname>
<given-names>AR</given-names>
</name>
</person-group>
<article-title>Molecular regulation of seed and fruit set</article-title>
<source>Trends Plant Sci</source>
<year>2012</year>
<volume>17</volume>
<fpage>656</fpage>
<lpage>65</lpage>
<pub-id pub-id-type="pmid">22776090</pub-id>
</element-citation>
</ref>
<ref id="CR2">
<label>2.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alba</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Payton</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Fei</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>McQuinn</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Debbie</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>GB</given-names>
</name>
<name>
<surname>Tanksley</surname>
<given-names>SD</given-names>
</name>
<name>
<surname>Giovannoni</surname>
<given-names>JJ</given-names>
</name>
</person-group>
<article-title>Transcriptome and selected metabolite analyses reveal multiple points of ethylene control during tomato fruit development</article-title>
<source>Plant Cell</source>
<year>2005</year>
<volume>17</volume>
<fpage>2954</fpage>
<lpage>65</lpage>
<pub-id pub-id-type="pmid">16243903</pub-id>
</element-citation>
</ref>
<ref id="CR3">
<label>3.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rocco</surname>
<given-names>M</given-names>
</name>
<name>
<surname>D’Ambrosio</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Arena</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Mirelle</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Scaloni</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Marra</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Proteomic analysis of tomato fruits from two ecotypes during ripening</article-title>
<source>Proteomics</source>
<year>2006</year>
<volume>6</volume>
<fpage>3781</fpage>
<lpage>91</lpage>
<pub-id pub-id-type="pmid">16739135</pub-id>
</element-citation>
</ref>
<ref id="CR4">
<label>4.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mintz-Oron</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Mandel</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Rogachev</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Feldberg</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Lotan</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Yativ</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Jetter</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Venger</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Adato</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Aharoni</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Gene expression and metabolism in tomato fruit surface tissues</article-title>
<source>Plant Physiol</source>
<year>2008</year>
<volume>147</volume>
<fpage>823</fpage>
<lpage>51</lpage>
<pub-id pub-id-type="pmid">18441227</pub-id>
</element-citation>
</ref>
<ref id="CR5">
<label>5.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vriezen</surname>
<given-names>WH</given-names>
</name>
<name>
<surname>Feron</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Maretto</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Keijman</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Mariani</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Changes in tomato ovary transcriptome demonstrate complex hormonal regulation of fruit set</article-title>
<source>New Phytol</source>
<year>2008</year>
<volume>177</volume>
<fpage>60</fpage>
<lpage>76</lpage>
<pub-id pub-id-type="pmid">18028300</pub-id>
</element-citation>
</ref>
<ref id="CR6">
<label>6.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karlova</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Rosin</surname>
<given-names>FM</given-names>
</name>
<name>
<surname>Busscher-Lange</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Parapunova</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Phuc</surname>
<given-names>TD</given-names>
</name>
<name>
<surname>Fernie</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Fraser</surname>
<given-names>PD</given-names>
</name>
<name>
<surname>Baxter</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Angenent</surname>
<given-names>GC</given-names>
</name>
<name>
<surname>Maagd</surname>
<given-names>RA</given-names>
</name>
</person-group>
<article-title>Transcriptome and metabolite profiling show that APETALA2a is a major regulator of tomato fruit ripening</article-title>
<source>Plant Cell</source>
<year>2011</year>
<volume>23</volume>
<fpage>923</fpage>
<lpage>41</lpage>
<pub-id pub-id-type="pmid">21398570</pub-id>
</element-citation>
</ref>
<ref id="CR7">
<label>7.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Osorio</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Alba</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Damasceno</surname>
<given-names>CMB</given-names>
</name>
<name>
<surname>Lopez-Casado</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Lohse</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Zanor</surname>
<given-names>MI</given-names>
</name>
<name>
<surname>Tohge</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Usadel</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Rose</surname>
<given-names>JKC</given-names>
</name>
<name>
<surname>Fei</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Giovannoni</surname>
<given-names>JJ</given-names>
</name>
<name>
<surname>Fernie</surname>
<given-names>AR</given-names>
</name>
</person-group>
<article-title>Systems biology of tomato fruit development: Combined transcript, protein, and metabolite analysis of tomato transcription factor (nor, rin) and ethylene receptor (Nr) mutants reveals novel regulatory interactions</article-title>
<source>Plant Physiol</source>
<year>2011</year>
<volume>157</volume>
<fpage>405</fpage>
<lpage>25</lpage>
<pub-id pub-id-type="pmid">21795583</pub-id>
</element-citation>
</ref>
<ref id="CR8">
<label>8.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Goes</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Iandolino</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Al-kayal</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Bohlmann</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Cushman</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Lim</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Ergul</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Figueroa</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Kabuloglu</surname>
<given-names>EK</given-names>
</name>
<name>
<surname>Osborne</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Rowe</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Tattersall</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Leslie</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Baek</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Cramer</surname>
<given-names>GR</given-names>
</name>
<name>
<surname>Cushman</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Cook</surname>
<given-names>DR</given-names>
</name>
</person-group>
<article-title>Characterizing the grape transcriptome. Analysis of Expressed Sequence Tags from multiple Vitis species and development of a compendium of gene expression during berry development</article-title>
<source>Plant Physiol</source>
<year>2005</year>
<volume>139</volume>
<fpage>574</fpage>
<lpage>97</lpage>
<pub-id pub-id-type="pmid">16219919</pub-id>
</element-citation>
</ref>
<ref id="CR9">
<label>9.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peng</surname>
<given-names>FY</given-names>
</name>
<name>
<surname>Reid</surname>
<given-names>KE</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Schlosser</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Lijavetzky</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Holt</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Martínez Zapater</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Jones</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Marra</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Bohlmann</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Lund</surname>
<given-names>ST</given-names>
</name>
</person-group>
<article-title>Generation of ESTs in
<italic>Vitis vinifera</italic>
wine grape (Cabernet Sauvignon) and table grape (Muscat Hamburg) and discovery of new candidate genes with potential roles in berry development</article-title>
<source>Gene</source>
<year>2007</year>
<volume>402</volume>
<fpage>40</fpage>
<lpage>50</lpage>
<pub-id pub-id-type="pmid">17761391</pub-id>
</element-citation>
</ref>
<ref id="CR10">
<label>10.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sweetman</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Wong</surname>
<given-names>DC</given-names>
</name>
<name>
<surname>Ford</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Drew</surname>
<given-names>DP</given-names>
</name>
</person-group>
<article-title>Transcriptome analysis at four developmental stages of grape berry (
<italic>Vitis vinifera</italic>
cv. Shiraz) provides insights into regulated and coordinated gene expression</article-title>
<source>BMC Genomics</source>
<year>2012</year>
<volume>13</volume>
<fpage>691</fpage>
<pub-id pub-id-type="pmid">23227855</pub-id>
</element-citation>
</ref>
<ref id="CR11">
<label>11.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rowland</surname>
<given-names>LJ</given-names>
</name>
<name>
<surname>Alkharouf</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Darwish</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Ogden</surname>
<given-names>EL</given-names>
</name>
<name>
<surname>Polashock</surname>
<given-names>JJ</given-names>
</name>
<name>
<surname>Bassil</surname>
<given-names>NV</given-names>
</name>
<name>
<surname>Main</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation</article-title>
<source>BMC Plant Biol</source>
<year>2012</year>
<volume>12</volume>
<fpage>46</fpage>
<pub-id pub-id-type="pmid">22471859</pub-id>
</element-citation>
</ref>
<ref id="CR12">
<label>12.</label>
<mixed-citation publication-type="other">Gupta V, Estrada AD, Blakley I, Reid R, Patel K, Meyer MD, et al. RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing. Gigascience. 2015;4.</mixed-citation>
</ref>
<ref id="CR13">
<label>13.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yu</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Da</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>X</given-names>
</name>
</person-group>
<article-title>Transcriptome changes during fruit development and ripening of sweet orange (
<italic>Citrus sinensis</italic>
)</article-title>
<source>BMC Genomics</source>
<year>2012</year>
<volume>13</volume>
<fpage>10</fpage>
<pub-id pub-id-type="pmid">22230690</pub-id>
</element-citation>
</ref>
<ref id="CR14">
<label>14.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Clepet</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Joobeur</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Jublot</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Truniger</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Boualem</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Hernandez-Gonzalez</surname>
<given-names>ME</given-names>
</name>
<name>
<surname>Dolcet-Sanjuan</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Portnoy</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Mascarell-Creus</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Caño-Delgado</surname>
<given-names>AI</given-names>
</name>
<name>
<surname>Katzir</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Bendahmane</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Giovannoni</surname>
<given-names>JJ</given-names>
</name>
<name>
<surname>Aranda</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Garcia-Mas</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Fei</surname>
<given-names>Z</given-names>
</name>
</person-group>
<article-title>Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon</article-title>
<source>BMC Genomics</source>
<year>2011</year>
<volume>12</volume>
<fpage>252</fpage>
<pub-id pub-id-type="pmid">21599934</pub-id>
</element-citation>
</ref>
<ref id="CR15">
<label>15.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moore</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Vrebalov</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Payton</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Giovannoni</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Use of genomics tools to isolate key ripening genes and analyse fruit maturation in tomato</article-title>
<source>J Exp Bot</source>
<year>2002</year>
<volume>53</volume>
<fpage>2023</fpage>
<lpage>30</lpage>
<pub-id pub-id-type="pmid">12324526</pub-id>
</element-citation>
</ref>
<ref id="CR16">
<label>16.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fei</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Alba</surname>
<given-names>RM</given-names>
</name>
<name>
<surname>White</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Ronning</surname>
<given-names>CM</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>GB</given-names>
</name>
<name>
<surname>Tanksley</surname>
<given-names>SD</given-names>
</name>
<name>
<surname>Giovannoni</surname>
<given-names>JJ</given-names>
</name>
</person-group>
<article-title>Comprehensive EST analysis of tomato and comparative genomics of fruit ripening</article-title>
<source>Plant J</source>
<year>2004</year>
<volume>40</volume>
<fpage>47</fpage>
<lpage>59</lpage>
<pub-id pub-id-type="pmid">15361140</pub-id>
</element-citation>
</ref>
<ref id="CR17">
<label>17.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Park</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Sugimoto</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Larson</surname>
<given-names>MD</given-names>
</name>
<name>
<surname>Beaudry</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Nocker</surname>
<given-names>SV</given-names>
</name>
</person-group>
<article-title>Identification of genes with potential roles in apple fruit development and biochemistry through large-scale statistical analysis of Expressed Sequence Tags</article-title>
<source>Plant Physiol</source>
<year>2006</year>
<volume>141</volume>
<fpage>811</fpage>
<lpage>24</lpage>
<pub-id pub-id-type="pmid">16825339</pub-id>
</element-citation>
</ref>
<ref id="CR18">
<label>18.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Xin</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Abdullah</surname>
<given-names>MMB</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Al-Mssallem</surname>
<given-names>IS</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Large-scale collection and annotation of gene models for date palm (
<italic>Phoenix dactylifera</italic>
, L.)</article-title>
<source>Plant Mol Biol</source>
<year>2012</year>
<volume>79</volume>
<fpage>521</fpage>
<lpage>36</lpage>
<pub-id pub-id-type="pmid">22736259</pub-id>
</element-citation>
</ref>
<ref id="CR19">
<label>19.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bugalho</surname>
<given-names>MN</given-names>
</name>
<name>
<surname>Caldeira</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Pereira</surname>
<given-names>JS</given-names>
</name>
<name>
<surname>Aronson</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Pausas</surname>
<given-names>JG</given-names>
</name>
</person-group>
<article-title>Mediterranean cork oak savannas require human use to sustain biodiversity and ecosystem services</article-title>
<source>Front Ecol Environ</source>
<year>2011</year>
<volume>9</volume>
<fpage>278</fpage>
<lpage>86</lpage>
</element-citation>
</ref>
<ref id="CR20">
<label>20.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Aronson</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Pereira</surname>
<given-names>JS</given-names>
</name>
<name>
<surname>Pausas</surname>
<given-names>JG</given-names>
</name>
</person-group>
<source>Cork Oak Woodlands on the Edge: Ecology, Adaptive Management, and Restoration</source>
<year>2009</year>
<publisher-loc>Washington DC</publisher-loc>
<publisher-name>Island Press</publisher-name>
<fpage>11</fpage>
<lpage>21</lpage>
</element-citation>
</ref>
<ref id="CR21">
<label>21.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ramírez-Valiente</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Lorenzo</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Soto</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Valladares</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Gil</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Aranda</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Elucidating the role of genetic drift and natural selection in cork oak differentiation regarding drought tolerance</article-title>
<source>Mol Ecol</source>
<year>2009</year>
<volume>18</volume>
<fpage>3803</fpage>
<lpage>15</lpage>
<pub-id pub-id-type="pmid">19732337</pub-id>
</element-citation>
</ref>
<ref id="CR22">
<label>22.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Silva</surname>
<given-names>SP</given-names>
</name>
<name>
<surname>Sabino</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Fernandes</surname>
<given-names>EM</given-names>
</name>
<name>
<surname>Correlo</surname>
<given-names>VM</given-names>
</name>
<name>
<surname>Boesel</surname>
<given-names>LF</given-names>
</name>
<name>
<surname>Reis</surname>
<given-names>RL</given-names>
</name>
</person-group>
<article-title>Cork: properties, capabilities and applications</article-title>
<source>Int Mater Rev</source>
<year>2005</year>
<volume>50</volume>
<fpage>345</fpage>
<lpage>65</lpage>
</element-citation>
</ref>
<ref id="CR23">
<label>23.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corti</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>Ricerche sul ciclo riproduttivo di specie del genere Quercus della Flora Italiana. II. Contributo alla biologia e allla sistematica di
<italic>Q. suber</italic>
L. e in particolare della forma a sviluppo biennale della ghianda</article-title>
<source>Ann Acad Ital Sci For</source>
<year>1955</year>
<volume>4</volume>
<fpage>55</fpage>
<lpage>133</lpage>
</element-citation>
</ref>
<ref id="CR24">
<label>24.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Merouani</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Apolinário</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Almeida</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Pereira</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Morphological and physiological maturation of acorns of cork oak (
<italic>Quercus suber</italic>
L.)</article-title>
<source>Seed Sci Technol</source>
<year>2003</year>
<volume>31</volume>
<fpage>111</fpage>
<lpage>24</lpage>
</element-citation>
</ref>
<ref id="CR25">
<label>25.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Díaz-Fernández</surname>
<given-names>PM</given-names>
</name>
<name>
<surname>Climent</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Gil</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Biennial acorn maturation and its relationship with flowering phenology in Iberian populations of
<italic>Quercus suber</italic>
</article-title>
<source>Trees</source>
<year>2004</year>
<volume>18</volume>
<fpage>615</fpage>
<lpage>21</lpage>
</element-citation>
</ref>
<ref id="CR26">
<label>26.</label>
<mixed-citation publication-type="other">Vinagre PR, Santos L, Nóbrega F, Varela MC: Estudos comparativos entre as duas primeiras frutificações do sobreiro: bastão e lande. In Sociedade Portuguesa de Ciências Florestais (ed) Proceedings of the V Congresso Nacional Florestal, 16-19 May 2005 (Insituto Politécnico de Viseu, Portugal).</mixed-citation>
</ref>
<ref id="CR27">
<label>27.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pons</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Pausas</surname>
<given-names>JG</given-names>
</name>
</person-group>
<article-title>The coexistence of acorns with different maturation patterns explains acorn production variability in cork oak</article-title>
<source>Oecologia</source>
<year>2012</year>
<volume>169</volume>
<fpage>723</fpage>
<lpage>31</lpage>
<pub-id pub-id-type="pmid">22246473</pub-id>
</element-citation>
</ref>
<ref id="CR28">
<label>28.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ramírez-Valiente</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Valladares</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Gil</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Aranda</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Population differences in juvenile survival under increasing drought are mediated by seed size in cork oak (
<italic>Quercus suber</italic>
L.)</article-title>
<source>For Ecol Manage</source>
<year>2009</year>
<volume>257</volume>
<fpage>1676</fpage>
<lpage>83</lpage>
</element-citation>
</ref>
<ref id="CR29">
<label>29.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bonito</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Varone</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Gratani</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Relationship between acorn size and seedling morphological and physiological traits of
<italic>Quercus ilex</italic>
L. from different climates</article-title>
<source>Photosynthetica</source>
<year>2011</year>
<volume>49</volume>
<fpage>75</fpage>
<lpage>86</lpage>
</element-citation>
</ref>
<ref id="CR30">
<label>30.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moles</surname>
<given-names>AT</given-names>
</name>
<name>
<surname>Westoby</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Seedling survival and seed size: a synthesis of the literature</article-title>
<source>J Ecol</source>
<year>2004</year>
<volume>92</volume>
<fpage>372</fpage>
<lpage>83</lpage>
</element-citation>
</ref>
<ref id="CR31">
<label>31.</label>
<mixed-citation publication-type="other">Leishman MR, Wright IJ, Moles AT, Westoby M: The evolutionary ecology of seed size. In Fenner M (ed) Seeds: the ecology of regeneration in plant communities. CABI Publishing, Wallingford, UK; 2000:31–58.</mixed-citation>
</ref>
<ref id="CR32">
<label>32.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gómez</surname>
<given-names>JM</given-names>
</name>
</person-group>
<article-title>Bigger is not always better: conflicting selective pressures on seed size in
<italic>Quercus ilex</italic>
</article-title>
<source>Evolution</source>
<year>2004</year>
<volume>58</volume>
<fpage>71</fpage>
<lpage>80</lpage>
<pub-id pub-id-type="pmid">15058720</pub-id>
</element-citation>
</ref>
<ref id="CR33">
<label>33.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boavida</surname>
<given-names>LC</given-names>
</name>
<name>
<surname>Varela</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Feijó</surname>
<given-names>JA</given-names>
</name>
</person-group>
<article-title>Sexual reproduction in the cork oak (Quercus suber L.). I. The progamic phase</article-title>
<source>Sex Plant Reprod</source>
<year>1999</year>
<volume>11</volume>
<fpage>347</fpage>
<lpage>53</lpage>
</element-citation>
</ref>
<ref id="CR34">
<label>34.</label>
<mixed-citation publication-type="other">Belletti P: Seed and seedling management in cork oak. In Management and long term storage of cork-oak acorns. The research of European Community DIVAPRA, Turin; 2001:1–9.</mixed-citation>
</ref>
<ref id="CR35">
<label>35.</label>
<mixed-citation publication-type="other">Belletti P, Monteleone I, Cartarasa M: Cork-oak and stone-oak seed management aimed at implementing nursery production of seedlings. In Nursery production and stand establishment of broad-leaves to promote sustainable forest management. Edited by Ciccarese L, Lucci S, Mattsson A, APAT – Italy`s agency for the protection of the environment and for technical services, Rome; 2004:21–24.</mixed-citation>
</ref>
<ref id="CR36">
<label>36.</label>
<mixed-citation publication-type="other">Pausas JG, Marañón T, Caldeira M, Pons J: Natural Regeneration. In Cork Oak Woodlands on the Edge. Volume 1. Edited by Aronson J, Pereira JS, Pausas JG. Island Press, Washington DC; 2009:115–125.</mixed-citation>
</ref>
<ref id="CR37">
<label>37.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elena-Rosello</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Rio</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Valdecantos</surname>
<given-names>JG</given-names>
</name>
<name>
<surname>Santamaria</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Ecological aspects of the floral phenology of the cork-oak (
<italic>Q. suber</italic>
. L): why do annual and biennial biotypes appear?</article-title>
<source>Ann For Sci</source>
<year>1993</year>
<volume>50</volume>
<fpage>114</fpage>
<lpage>21</lpage>
</element-citation>
</ref>
<ref id="CR38">
<label>38.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boavida</surname>
<given-names>LC</given-names>
</name>
<name>
<surname>Silva</surname>
<given-names>JP</given-names>
</name>
<name>
<surname>Feijó</surname>
<given-names>JA</given-names>
</name>
</person-group>
<article-title>Sexual reproduction in the cork oak (Quercus suber L). II. Crossing intra- and interspecific barriers</article-title>
<source>Sex Plant Reprod</source>
<year>2001</year>
<volume>14</volume>
<fpage>143</fpage>
<lpage>52</lpage>
</element-citation>
</ref>
<ref id="CR39">
<label>39.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Varela</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Valdiviesso</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>Phenological phases of
<italic>Quercus suber</italic>
L. flowering</article-title>
<source>For Genet</source>
<year>1996</year>
<volume>3</volume>
<fpage>93</fpage>
<lpage>102</lpage>
</element-citation>
</ref>
<ref id="CR40">
<label>40.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rocheta</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Sobral</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Magalhães</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Amorim</surname>
<given-names>MI</given-names>
</name>
<name>
<surname>Ribeiro</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Pinheiro</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Egas</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Morais-Cecílio</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Costa</surname>
<given-names>MMR</given-names>
</name>
</person-group>
<article-title>Comparative transcriptomic analysis of male and female flowers of monoecious
<italic>Quercus suber</italic>
</article-title>
<source>Front Plant Sci</source>
<year>2014</year>
<volume>5</volume>
<fpage>1</fpage>
<lpage>16</lpage>
</element-citation>
</ref>
<ref id="CR41">
<label>41.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Borgardt</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Nixon</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>A comparative flower and fruit anatomical study of
<italic>Quercus acutissima</italic>
, a biennial-fruiting oak from the
<italic>Cerris</italic>
group (Fagaceae)</article-title>
<source>Am J Bot</source>
<year>2003</year>
<volume>90</volume>
<fpage>1567</fpage>
<lpage>84</lpage>
<pub-id pub-id-type="pmid">21653332</pub-id>
</element-citation>
</ref>
<ref id="CR42">
<label>42.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ueno</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Le Provost</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Léger</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Klopp</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Noirot</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Frigerio</surname>
<given-names>J-M</given-names>
</name>
<name>
<surname>Salin</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Salse</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Abrouk</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Murat</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Brendel</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Derory</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Abadie</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Léger</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Cabane</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Barré</surname>
<given-names>A</given-names>
</name>
<name>
<surname>de Daruvar</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Couloux</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Wincker</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Reviron</surname>
<given-names>M-P</given-names>
</name>
<name>
<surname>Kremer</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Plomion</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Bioinformatic analysis of ESTs collected by Sanger and pyrosequencing methods for a keystone forest tree species: oak</article-title>
<source>BMC Genomics</source>
<year>2010</year>
<volume>11</volume>
<fpage>650</fpage>
<pub-id pub-id-type="pmid">21092232</pub-id>
</element-citation>
</ref>
<ref id="CR43">
<label>43.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ueno</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Klopp</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Leplé</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Derory</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Noirot</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Léger</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Prince</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Kremer</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Plomion</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Le Provost</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Transcriptional profiling of bud dormancy induction and release in oak by next-generation sequencing</article-title>
<source>BMC Genomics</source>
<year>2013</year>
<volume>14</volume>
<fpage>236</fpage>
<pub-id pub-id-type="pmid">23575249</pub-id>
</element-citation>
</ref>
<ref id="CR44">
<label>44.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rampant</surname>
<given-names>PF</given-names>
</name>
<name>
<surname>Lesur</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Boussardon</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Bitton</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Martin-Magniette</surname>
<given-names>M-L</given-names>
</name>
<name>
<surname>Bodénès</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Le Provost</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Bergès</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Fluch</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Kremer</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Plomion</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Analysis of BAC end sequences in oak, a keystone forest tree species, providing insight into the composition of its genome</article-title>
<source>BMC Genomics</source>
<year>2011</year>
<volume>12</volume>
<fpage>292</fpage>
<pub-id pub-id-type="pmid">21645357</pub-id>
</element-citation>
</ref>
<ref id="CR45">
<label>45.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pereira-Leal</surname>
<given-names>JB</given-names>
</name>
<name>
<surname>Abreu</surname>
<given-names>IA</given-names>
</name>
<name>
<surname>Alabaça</surname>
<given-names>CS</given-names>
</name>
<name>
<surname>Almeida</surname>
<given-names>MH</given-names>
</name>
<name>
<surname>Almeida</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Almeida</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Amorim</surname>
<given-names>MI</given-names>
</name>
<name>
<surname>Araújo</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Azevedo</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Badia</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Batista</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Bohn</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Capote</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Carrasquinho</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Chaves</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Coelho</surname>
<given-names>AC</given-names>
</name>
<name>
<surname>Costa</surname>
<given-names>MM</given-names>
</name>
<name>
<surname>Costa</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Cravador</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Egas</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Faro</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Fortes</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Fortunato</surname>
<given-names>AS</given-names>
</name>
<name>
<surname>Gaspar</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Gonçalves</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Graça</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Horta</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Inácio</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Leitão</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Lino-Neto</surname>
<given-names>T</given-names>
</name>
<etal></etal>
</person-group>
<article-title>A comprehensive assessment of the transcriptome of cork oak (
<italic>Quercus suber</italic>
) through EST sequencing</article-title>
<source>BMC Genomics</source>
<year>2014</year>
<volume>15</volume>
<fpage>371</fpage>
<pub-id pub-id-type="pmid">24885229</pub-id>
</element-citation>
</ref>
<ref id="CR46">
<label>46.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seymour</surname>
<given-names>GB</given-names>
</name>
<name>
<surname>Østergaard</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Chapman</surname>
<given-names>NH</given-names>
</name>
<name>
<surname>Knapp</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Martin</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Fruit development and ripening</article-title>
<source>Annu Rev Plant Biol</source>
<year>2013</year>
<volume>64</volume>
<fpage>219</fpage>
<lpage>41</lpage>
<pub-id pub-id-type="pmid">23394500</pub-id>
</element-citation>
</ref>
<ref id="CR47">
<label>47.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Van der Pijl</surname>
<given-names>L</given-names>
</name>
</person-group>
<source>Principles of Dispersal in Higher Plants. Volume 26</source>
<year>1982</year>
<publisher-loc>Berlin Heidelberg</publisher-loc>
<publisher-name>Springer</publisher-name>
</element-citation>
</ref>
<ref id="CR48">
<label>48.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chan</surname>
<given-names>YH</given-names>
</name>
</person-group>
<article-title>Biostatistics 104: Correlational Analysis</article-title>
<source>Singapore Med J</source>
<year>2003</year>
<volume>44</volume>
<fpage>614</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">14770254</pub-id>
</element-citation>
</ref>
<ref id="CR49">
<label>49.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Margulies</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Egholm</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Altman</surname>
<given-names>WE</given-names>
</name>
<name>
<surname>Attiya</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Bader</surname>
<given-names>JS</given-names>
</name>
<name>
<surname>Bemben</surname>
<given-names>LA</given-names>
</name>
<name>
<surname>Berka</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Braverman</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y-J</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Dewell</surname>
<given-names>SB</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Fierro</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Gomes</surname>
<given-names>XV</given-names>
</name>
<name>
<surname>Godwin</surname>
<given-names>BC</given-names>
</name>
<name>
<surname>He</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Helgesen</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Ho</surname>
<given-names>CH</given-names>
</name>
<name>
<surname>Ho</surname>
<given-names>CH</given-names>
</name>
<name>
<surname>Irzyk</surname>
<given-names>GP</given-names>
</name>
<name>
<surname>Jando</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>Alenquer</surname>
<given-names>MLI</given-names>
</name>
<name>
<surname>Jarvie</surname>
<given-names>TP</given-names>
</name>
<name>
<surname>Jirage</surname>
<given-names>KB</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>J-B</given-names>
</name>
<name>
<surname>Knight</surname>
<given-names>JR</given-names>
</name>
<name>
<surname>Lanza</surname>
<given-names>JR</given-names>
</name>
<name>
<surname>Leamon</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Lefkowitz</surname>
<given-names>SM</given-names>
</name>
<name>
<surname>Lei</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Genome sequencing in microfabricated high-density picolitre reactors</article-title>
<source>Nature</source>
<year>2005</year>
<volume>437</volume>
<fpage>376</fpage>
<lpage>80</lpage>
<pub-id pub-id-type="pmid">16056220</pub-id>
</element-citation>
</ref>
<ref id="CR50">
<label>50.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chevreux</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Pfisterer</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Drescher</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Driesel</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Müller</surname>
<given-names>WEG</given-names>
</name>
<name>
<surname>Wetter</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Suhai</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Using the miraEST assembler for reliable and automated mRNA transcript assembly and SNP detection in sequenced ESTs</article-title>
<source>Genome Res</source>
<year>2004</year>
<volume>14</volume>
<fpage>1147</fpage>
<lpage>59</lpage>
<pub-id pub-id-type="pmid">15140833</pub-id>
</element-citation>
</ref>
<ref id="CR51">
<label>51.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weber</surname>
<given-names>APM</given-names>
</name>
<name>
<surname>Weber</surname>
<given-names>KL</given-names>
</name>
<name>
<surname>Carr</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Wilkerson</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ohlrogge</surname>
<given-names>JB</given-names>
</name>
</person-group>
<article-title>Sampling the Arabidopsis transcriptome with massively parallel pyrosequencing</article-title>
<source>Plant Physiol</source>
<year>2007</year>
<volume>144</volume>
<fpage>32</fpage>
<lpage>42</lpage>
<pub-id pub-id-type="pmid">17351049</pub-id>
</element-citation>
</ref>
<ref id="CR52">
<label>52.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Blaxter</surname>
<given-names>ML</given-names>
</name>
</person-group>
<article-title>Comparing de novo assemblers for 454 transcriptome data</article-title>
<source>BMC Genomics</source>
<year>2010</year>
<volume>11</volume>
<fpage>571</fpage>
<pub-id pub-id-type="pmid">20950480</pub-id>
</element-citation>
</ref>
<ref id="CR53">
<label>53.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garg</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Patel</surname>
<given-names>RK</given-names>
</name>
<name>
<surname>Jhanwar</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Priya</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Bhattacharjee</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Yadav</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Bhatia</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Chattopadhyay</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Tyagi</surname>
<given-names>AK</given-names>
</name>
<name>
<surname>Jain</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Gene discovery and tissue-specific transcriptome analysis in chickpea with massively parallel pyrosequencing and web resource development</article-title>
<source>Plant Physiol</source>
<year>2011</year>
<volume>156</volume>
<fpage>1661</fpage>
<lpage>78</lpage>
<pub-id pub-id-type="pmid">21653784</pub-id>
</element-citation>
</ref>
<ref id="CR54">
<label>54.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mundry</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Bornberg-Bauer</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Sammeth</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Feulner</surname>
<given-names>PGD</given-names>
</name>
</person-group>
<article-title>Evaluating characteristics of de novo assembly software on 454 transcriptome data: a simulation approach</article-title>
<source>PLoS One</source>
<year>2012</year>
<volume>7</volume>
<pub-id pub-id-type="pmid">22384018</pub-id>
</element-citation>
</ref>
<ref id="CR55">
<label>55.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Madan</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>CAP3: A DNA sequence assembly program</article-title>
<source>Genome Res</source>
<year>1999</year>
<volume>9</volume>
<fpage>868</fpage>
<lpage>77</lpage>
<pub-id pub-id-type="pmid">10508846</pub-id>
</element-citation>
</ref>
<ref id="CR56">
<label>56.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koch</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Sucrose metabolism: regulatory mechanisms and pivotal roles in sugar sensing and plant development</article-title>
<source>Curr Opin Plant Biol</source>
<year>2004</year>
<volume>7</volume>
<fpage>235</fpage>
<lpage>46</lpage>
<pub-id pub-id-type="pmid">15134743</pub-id>
</element-citation>
</ref>
<ref id="CR57">
<label>57.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baroja-Fernández</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Muñoz</surname>
<given-names>FJ</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Bahaji</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Almagro</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Montero</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Etxeberria</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Hidalgo</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Sesma</surname>
<given-names>MT</given-names>
</name>
<name>
<surname>Pozueta-Romero</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Sucrose synthase activity in the
<italic>sus1/sus2/sus3/sus4 Arabidopsis</italic>
mutant is sufficient to support normal cellulose and starch production</article-title>
<source>Proc Natl Acad Sci U S A</source>
<year>2012</year>
<volume>109</volume>
<fpage>321</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="pmid">22184213</pub-id>
</element-citation>
</ref>
<ref id="CR58">
<label>58.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bray</surname>
<given-names>EA</given-names>
</name>
</person-group>
<article-title>Genes commonly regulated by water-deficit stress in
<italic>Arabidopsis thaliana</italic>
</article-title>
<source>J Exp Bot</source>
<year>2004</year>
<volume>55</volume>
<fpage>2331</fpage>
<lpage>41</lpage>
<pub-id pub-id-type="pmid">15448178</pub-id>
</element-citation>
</ref>
<ref id="CR59">
<label>59.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Le</surname>
<given-names>BH</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Bui</surname>
<given-names>AQ</given-names>
</name>
<name>
<surname>Wagmaister</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Henry</surname>
<given-names>KF</given-names>
</name>
<name>
<surname>Pelletier</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Kwong</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Belmonte</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Kirkbride</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Horvath</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Drews</surname>
<given-names>GN</given-names>
</name>
<name>
<surname>Fischer</surname>
<given-names>RL</given-names>
</name>
<name>
<surname>Okamuro</surname>
<given-names>JK</given-names>
</name>
<name>
<surname>Harada</surname>
<given-names>JJ</given-names>
</name>
<name>
<surname>Goldberg</surname>
<given-names>RB</given-names>
</name>
</person-group>
<article-title>Global analysis of gene activity during
<italic>Arabidopsis</italic>
seed development and identification of seed-specific transcription factors</article-title>
<source>Proc Natl Acad Sci U S A</source>
<year>2010</year>
<volume>107</volume>
<fpage>8063</fpage>
<lpage>70</lpage>
<pub-id pub-id-type="pmid">20385809</pub-id>
</element-citation>
</ref>
<ref id="CR60">
<label>60.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Barnabás</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Jäger</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Fehér</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>The effect of drought and heat stress on reproductive processes in cereals</article-title>
<source>Plant, Cell Environ</source>
<year>2008</year>
<volume>31</volume>
<fpage>11</fpage>
<lpage>38</lpage>
<pub-id pub-id-type="pmid">17971069</pub-id>
</element-citation>
</ref>
<ref id="CR61">
<label>61.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fujita</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Fujita</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Maruyama</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Seki</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hiratsu</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Ohme-Takagi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Tran</surname>
<given-names>L-SP</given-names>
</name>
<name>
<surname>Yamaguchi-Shinozaki</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Shinozaki</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway</article-title>
<source>Plant J</source>
<year>2004</year>
<volume>39</volume>
<fpage>863</fpage>
<lpage>76</lpage>
<pub-id pub-id-type="pmid">15341629</pub-id>
</element-citation>
</ref>
<ref id="CR62">
<label>62.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamaguchi-Shinozaki</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Shinozaki</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>The plant hormone abscisic acid mediates the drought-induced expression but not the seed-specific expression of rd22, a gene responsive to dehydration stress in
<italic>Arabidopsis thaliana</italic>
</article-title>
<source>MGG Mol Gen Genet</source>
<year>1993</year>
<volume>238</volume>
<fpage>17</fpage>
<lpage>25</lpage>
</element-citation>
</ref>
<ref id="CR63">
<label>63.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tran</surname>
<given-names>LP</given-names>
</name>
<name>
<surname>Nakashima</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Sakuma</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Simpson</surname>
<given-names>SD</given-names>
</name>
<name>
<surname>Fujita</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Maruyama</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Fujita</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Seki</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Shinozaki</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Yamaguchi-shinozaki</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 Promoter</article-title>
<source>Plant Cell</source>
<year>2004</year>
<volume>16</volume>
<fpage>2481</fpage>
<lpage>98</lpage>
<pub-id pub-id-type="pmid">15319476</pub-id>
</element-citation>
</ref>
<ref id="CR64">
<label>64.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Singh</surname>
<given-names>AK</given-names>
</name>
<name>
<surname>Sharma</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Pal</surname>
<given-names>AK</given-names>
</name>
<name>
<surname>Acharya</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Ahuja</surname>
<given-names>PS</given-names>
</name>
</person-group>
<article-title>Genome-wide organization and expression profiling of the NAC transcription factor family in potato (
<italic>Solanum tuberosum</italic>
L.)</article-title>
<source>DNA Res</source>
<year>2013</year>
<volume>20</volume>
<fpage>403</fpage>
<lpage>23</lpage>
<pub-id pub-id-type="pmid">23649897</pub-id>
</element-citation>
</ref>
<ref id="CR65">
<label>65.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Genome-scale identification of soybean BURP domain-containing genes and their expression under stress treatments</article-title>
<source>BMC Plant Biol</source>
<year>2010</year>
<volume>10</volume>
<fpage>197</fpage>
<pub-id pub-id-type="pmid">20836857</pub-id>
</element-citation>
</ref>
<ref id="CR66">
<label>66.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Park</surname>
<given-names>MY</given-names>
</name>
<name>
<surname>Chung</surname>
<given-names>MS</given-names>
</name>
<name>
<surname>Koh</surname>
<given-names>HS</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>DJ</given-names>
</name>
<name>
<surname>Ahn</surname>
<given-names>SJ</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>CS</given-names>
</name>
</person-group>
<article-title>Isolation and functional characterization of the Arabidopsis salt-tolerance 32 (AtSAT32) gene associated with salt tolerance and ABA signaling</article-title>
<source>Physiol Plant</source>
<year>2009</year>
<volume>135</volume>
<fpage>426</fpage>
<lpage>35</lpage>
<pub-id pub-id-type="pmid">19210750</pub-id>
</element-citation>
</ref>
<ref id="CR67">
<label>67.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Fan</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Overexpression of
<italic>AtHsp90.2</italic>
,
<italic>AtHsp90.5</italic>
and
<italic>AtHsp90.7</italic>
in
<italic>Arabidopsis thaliana</italic>
enhances plant sensitivity to salt and drought stresses</article-title>
<source>Planta</source>
<year>2009</year>
<volume>229</volume>
<fpage>955</fpage>
<lpage>64</lpage>
<pub-id pub-id-type="pmid">19148673</pub-id>
</element-citation>
</ref>
<ref id="CR68">
<label>68.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>EY</given-names>
</name>
<name>
<surname>Seo</surname>
<given-names>YS</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>KY</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>SJ</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>WT</given-names>
</name>
</person-group>
<article-title>Overexpression of
<italic>CaDSR6</italic>
increases tolerance to drought and salt stresses in transgenic
<italic>Arabidopsis</italic>
plants</article-title>
<source>Gene</source>
<year>2014</year>
<volume>552</volume>
<fpage>146</fpage>
<lpage>54</lpage>
<pub-id pub-id-type="pmid">25234727</pub-id>
</element-citation>
</ref>
<ref id="CR69">
<label>69.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matus</surname>
<given-names>JT</given-names>
</name>
<name>
<surname>Aquea</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Espinoza</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Vega</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Cavallini</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Santo</surname>
<given-names>SD</given-names>
</name>
<name>
<surname>Cañón</surname>
<given-names>P</given-names>
</name>
<name>
<surname>de la Guardia</surname>
<given-names>AR-H</given-names>
</name>
<name>
<surname>Serrano</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Tornielli</surname>
<given-names>GB</given-names>
</name>
<name>
<surname>Arce-Johnson</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Inspection of the grapevine BURP superfamily highlights an expansion of
<italic>RD22</italic>
genes with distinctive expression features in berry development and ABA-mediated stress responses</article-title>
<source>PLoS One</source>
<year>2014</year>
<volume>9</volume>
<pub-id pub-id-type="pmid">25330210</pub-id>
</element-citation>
</ref>
<ref id="CR70">
<label>70.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Terasaka</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Blakeslee</surname>
<given-names>JJ</given-names>
</name>
<name>
<surname>Titapiwatanakun</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Peer</surname>
<given-names>WA</given-names>
</name>
<name>
<surname>Bandyopadhyay</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Makam</surname>
<given-names>SN</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>OR</given-names>
</name>
<name>
<surname>Richards</surname>
<given-names>EL</given-names>
</name>
<name>
<surname>Murphy</surname>
<given-names>AS</given-names>
</name>
<name>
<surname>Sato</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Yazaki</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin transport in
<italic>Arabidopsis thaliana</italic>
roots</article-title>
<source>Plant Cell</source>
<year>2005</year>
<volume>17</volume>
<fpage>2922</fpage>
<lpage>39</lpage>
<pub-id pub-id-type="pmid">16243904</pub-id>
</element-citation>
</ref>
<ref id="CR71">
<label>71.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tripathi</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Syed</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Laxmi</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Chattopadhyay</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Role of CIPK6 in root growth and auxin transport</article-title>
<source>Plant Signal Behav</source>
<year>2009</year>
<volume>4</volume>
<fpage>663</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="pmid">19820350</pub-id>
</element-citation>
</ref>
<ref id="CR72">
<label>72.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cui</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>Q</given-names>
</name>
</person-group>
<article-title>Arabidopsis ubiquitin conjugase UBC32 is an ERAD component that functions in brassinosteroid-mediated salt stress tolerance</article-title>
<source>Plant Cell</source>
<year>2012</year>
<volume>24</volume>
<fpage>233</fpage>
<lpage>44</lpage>
<pub-id pub-id-type="pmid">22214659</pub-id>
</element-citation>
</ref>
<ref id="CR73">
<label>73.</label>
<mixed-citation publication-type="other">Wang Y, Wang W, Cai J, Zhang Y, Qin G, Tian S. Tomato nuclear proteome reveals the involvement of specific E2 ubiquitin-conjugating enzymes in fruit ripening. Genome Biol. 2014;15.</mixed-citation>
</ref>
<ref id="CR74">
<label>74.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaplan</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Guy</surname>
<given-names>CL</given-names>
</name>
</person-group>
<article-title>β-Amylase induction and the protective role of maltose during temperature shock</article-title>
<source>Plant Physiol</source>
<year>2004</year>
<volume>135</volume>
<fpage>1674</fpage>
<lpage>84</lpage>
<pub-id pub-id-type="pmid">15247404</pub-id>
</element-citation>
</ref>
<ref id="CR75">
<label>75.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moore</surname>
<given-names>JP</given-names>
</name>
<name>
<surname>Le</surname>
<given-names>NT</given-names>
</name>
<name>
<surname>Brandt</surname>
<given-names>WF</given-names>
</name>
<name>
<surname>Driouich</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Farrant</surname>
<given-names>JM</given-names>
</name>
</person-group>
<article-title>Towards a systems-based understanding of plant desiccation tolerance</article-title>
<source>Trends Plant Sci</source>
<year>2009</year>
<volume>14</volume>
<fpage>110</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="pmid">19179102</pub-id>
</element-citation>
</ref>
<ref id="CR76">
<label>76.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Quettier</surname>
<given-names>AL</given-names>
</name>
<name>
<surname>Bertrand</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Habricot</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Miginiac</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Agnes</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Jeannette</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Maldiney</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>The
<italic>phs1-3</italic>
mutation in a putative dual-specificity protein tyrosine phosphatase gene provokes hypersensitive responses to abscisic acid in
<italic>Arabidopsis thaliana</italic>
</article-title>
<source>Plant J</source>
<year>2006</year>
<volume>47</volume>
<fpage>711</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">16889651</pub-id>
</element-citation>
</ref>
<ref id="CR77">
<label>77.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>QT</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>XW</given-names>
</name>
<name>
<surname>Lan</surname>
<given-names>XJ</given-names>
</name>
<name>
<surname>Pu</surname>
<given-names>ZE</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>YM</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>ZX</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>YL</given-names>
</name>
</person-group>
<article-title>Structure and expression of barley starch phosphorylase genes</article-title>
<source>Planta</source>
<year>2013</year>
<volume>238</volume>
<fpage>1081</fpage>
<lpage>93</lpage>
</element-citation>
</ref>
<ref id="CR78">
<label>78.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Satoh</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Shibahara</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Tokunaga</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Nishi</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Tasaki</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hwang</surname>
<given-names>S-K</given-names>
</name>
<name>
<surname>Okita</surname>
<given-names>TW</given-names>
</name>
<name>
<surname>Kaneko</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Fujita</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Yoshida</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hosaka</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Sato</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Utsumi</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Ohdan</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Nakamura</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Mutation of the plastidial alpha-glucan phosphorylase gene in rice affects the synthesis and structure of starch in the endosperm</article-title>
<source>Plant Cell</source>
<year>2008</year>
<volume>20</volume>
<fpage>1833</fpage>
<lpage>49</lpage>
<pub-id pub-id-type="pmid">18621947</pub-id>
</element-citation>
</ref>
<ref id="CR79">
<label>79.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parcy</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Valon</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Raynal</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Gaubier-Comella</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Delseny</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Giraudat</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Regulation of gene expression programs during Arabidopsis seed development: roles of the ABI3 locus and of endogenous abscisic acid</article-title>
<source>Plant Cell</source>
<year>1994</year>
<volume>6</volume>
<fpage>1567</fpage>
<lpage>82</lpage>
<pub-id pub-id-type="pmid">7827492</pub-id>
</element-citation>
</ref>
<ref id="CR80">
<label>80.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>H-Q</given-names>
</name>
<name>
<surname>Luan</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>He</surname>
<given-names>Z-H</given-names>
</name>
</person-group>
<article-title>Auxin controls seed dormancy through stimulation of abscisic acid signaling by inducing ARF-mediated
<italic>ABI3</italic>
activation in
<italic>Arabidopsis</italic>
</article-title>
<source>Proc Natl Acad Sci U S A</source>
<year>2013</year>
<volume>110</volume>
<fpage>15485</fpage>
<lpage>90</lpage>
<pub-id pub-id-type="pmid">23986496</pub-id>
</element-citation>
</ref>
<ref id="CR81">
<label>81.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hare</surname>
<given-names>PD</given-names>
</name>
<name>
<surname>Cress</surname>
<given-names>WA</given-names>
</name>
<name>
<surname>van Staden</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Proline synthesis and degradation: a model system for elucidating stress-related signal transduction</article-title>
<source>J Exp Bot</source>
<year>1999</year>
<volume>50</volume>
<fpage>413</fpage>
<lpage>34</lpage>
</element-citation>
</ref>
<ref id="CR82">
<label>82.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Prewein</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Endemann</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Reinöhl</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Salaj</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Sunderlikova</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Wilhelm</surname>
<given-names>E</given-names>
</name>
</person-group>
<article-title>Physiological and morphological characteristics during development of pedunculate oak (
<italic>Quercus robur</italic>
L.) zygotic embryos</article-title>
<source>Trees</source>
<year>2005</year>
<volume>20</volume>
<fpage>53</fpage>
<lpage>60</lpage>
</element-citation>
</ref>
<ref id="CR83">
<label>83.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Finch-Savage</surname>
<given-names>WE</given-names>
</name>
<name>
<surname>Clay</surname>
<given-names>HA</given-names>
</name>
</person-group>
<article-title>Evidence that ethylene, light and abscisic acid interact to inhibit germination in the recalcitrant seeds of
<italic>Quercus robur</italic>
L</article-title>
<source>J Exp Bot</source>
<year>1994</year>
<volume>45</volume>
<fpage>1295</fpage>
<lpage>9</lpage>
</element-citation>
</ref>
<ref id="CR84">
<label>84.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kiyosue</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Yamaguchi-Shinozaki</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Shinozaki</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Cloning of cDNAs for genes that are early-responsive to dehydration stress (ERDs) in
<italic>Arabidopsis thaliana</italic>
L.: identification of three ERDs as HSP cognate genes</article-title>
<source>Plant Mol Biol</source>
<year>1994</year>
<volume>25</volume>
<fpage>791</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="pmid">8075396</pub-id>
</element-citation>
</ref>
<ref id="CR85">
<label>85.</label>
<mixed-citation publication-type="other">Alves MS, Fietto LG: Functional Diversity of Early Responsive to Dehydration (ERD) Genes in Soybean. In A Comprehensive Survey of International Soybean Research - Genetics, Physiology, Agronomy and Nitrogen Relationships. Edited by E. J.; 2013:475–487.</mixed-citation>
</ref>
<ref id="CR86">
<label>86.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kariola</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Brader</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Helenius</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Heino</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Palva</surname>
<given-names>ET</given-names>
</name>
</person-group>
<article-title>
<italic>EARLY RESPONSIVE TO DEHYDRATION 15</italic>
, a negative regulator of abscisic acid responses in Arabidopsis</article-title>
<source>Plant Physiol</source>
<year>2006</year>
<volume>142</volume>
<fpage>1559</fpage>
<lpage>73</lpage>
<pub-id pub-id-type="pmid">17056758</pub-id>
</element-citation>
</ref>
<ref id="CR87">
<label>87.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aalto</surname>
<given-names>MK</given-names>
</name>
<name>
<surname>Helenius</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Kariola</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Pennanen</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Heino</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Hõrak</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Puzõrjova</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Kollist</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Palva</surname>
<given-names>ET</given-names>
</name>
</person-group>
<article-title>ERD15-An attenuator of plant ABA responses and stomatal aperture</article-title>
<source>Plant Sci</source>
<year>2012</year>
<volume>182</volume>
<fpage>19</fpage>
<lpage>28</lpage>
<pub-id pub-id-type="pmid">22118612</pub-id>
</element-citation>
</ref>
<ref id="CR88">
<label>88.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seo</surname>
<given-names>PJ</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>SB</given-names>
</name>
<name>
<surname>Suh</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>M-J</given-names>
</name>
<name>
<surname>Go</surname>
<given-names>YS</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>C-M</given-names>
</name>
</person-group>
<article-title>The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in
<italic>Arabidopsis</italic>
</article-title>
<source>Plant Cell</source>
<year>2011</year>
<volume>23</volume>
<fpage>1138</fpage>
<lpage>52</lpage>
<pub-id pub-id-type="pmid">21398568</pub-id>
</element-citation>
</ref>
<ref id="CR89">
<label>89.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>
<italic>Lipid transfer protein 3</italic>
as a target of MYB96 mediates freezing and drought stress in
<italic>Arabidopsis</italic>
</article-title>
<source>J Exp Bot</source>
<year>2013</year>
<volume>64</volume>
<fpage>1755</fpage>
<lpage>67</lpage>
<pub-id pub-id-type="pmid">23404903</pub-id>
</element-citation>
</ref>
<ref id="CR90">
<label>90.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Candat</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Paszkiewicz</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Neveu</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Gautier</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Logan</surname>
<given-names>DC</given-names>
</name>
<name>
<surname>Avelange-Macherel</surname>
<given-names>M-H</given-names>
</name>
<name>
<surname>Macherel</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>The ubiquitous distribution of Late Embryogenesis Abundant proteins across cell compartments in Arabidopsis offers tailored protection against abiotic stress</article-title>
<source>Plant Cell</source>
<year>2014</year>
<volume>26</volume>
<fpage>1</fpage>
<lpage>20</lpage>
<pub-id pub-id-type="pmid">24481071</pub-id>
</element-citation>
</ref>
<ref id="CR91">
<label>91.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Olvera-Carrillo</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Campos</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Reyes</surname>
<given-names>JL</given-names>
</name>
<name>
<surname>Garciarrubio</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Covarrubias</surname>
<given-names>AA</given-names>
</name>
</person-group>
<article-title>Functional analysis of the group 4 late embryogenesis abundant proteins reveals their relevance in the adaptive response during water deficit in Arabidopsis</article-title>
<source>Plant Physiol</source>
<year>2010</year>
<volume>154</volume>
<fpage>373</fpage>
<lpage>90</lpage>
<pub-id pub-id-type="pmid">20668063</pub-id>
</element-citation>
</ref>
<ref id="CR92">
<label>92.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hundertmark</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hincha</surname>
<given-names>DK</given-names>
</name>
</person-group>
<article-title>LEA (late embryogenesis abundant) proteins and their encoding genes in
<italic>Arabidopsis thaliana</italic>
</article-title>
<source>BMC Genomics</source>
<year>2008</year>
<volume>9</volume>
<fpage>118</fpage>
<pub-id pub-id-type="pmid">18318901</pub-id>
</element-citation>
</ref>
<ref id="CR93">
<label>93.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hualkasin</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Thongin</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Petsean</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Phongdara</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Nakkaew</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Molecular cloning and characterization of the late embryogenesis abundant group 4 (
<italic>EgLEA4</italic>
) gene from oil palm (
<italic>Elaeis guineensis</italic>
Jacq)</article-title>
<source>Songklanakarin J Sci Technol</source>
<year>2013</year>
<volume>35</volume>
<fpage>275</fpage>
<lpage>85</lpage>
</element-citation>
</ref>
<ref id="CR94">
<label>94.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sunderlíková</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Wilhelm</surname>
<given-names>E</given-names>
</name>
</person-group>
<article-title>High accumulation of legumin and Lea-like mRNAs during maturation is associated with increased conversion frequency of somatic embryos from pedunculate oak (
<italic>Quercus robur</italic>
L.)</article-title>
<source>Protoplasma</source>
<year>2002</year>
<volume>220</volume>
<fpage>97</fpage>
<lpage>103</lpage>
<pub-id pub-id-type="pmid">12417941</pub-id>
</element-citation>
</ref>
<ref id="CR95">
<label>95.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sunderlíková</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Salaj</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Kopecky</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Salaj</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Wilhem</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Matusíková</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Dehydrin genes and their expression in recalcitrant oak (
<italic>Quercus robur</italic>
) embryos</article-title>
<source>Plant Cell Rep</source>
<year>2009</year>
<volume>28</volume>
<fpage>1011</fpage>
<lpage>21</lpage>
<pub-id pub-id-type="pmid">19466427</pub-id>
</element-citation>
</ref>
<ref id="CR96">
<label>96.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tognetti</surname>
<given-names>VB</given-names>
</name>
<name>
<surname>Van Aken</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Morreel</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Vandenbroucke</surname>
<given-names>K</given-names>
</name>
<name>
<surname>van de Cotte</surname>
<given-names>B</given-names>
</name>
<name>
<surname>De Clercq</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Chiwocha</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Fenske</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Prinsen</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Boerjan</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Genty</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Stubbs</surname>
<given-names>KA</given-names>
</name>
<name>
<surname>Inzé</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Van Breusegem</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Perturbation of indole-3-butyric acid homeostasis by the UDP-glucosyltransferase
<italic>UGT74E2</italic>
modulates
<italic>Arabidopsis</italic>
architecture and water stress tolerance</article-title>
<source>Plant Cell</source>
<year>2010</year>
<volume>22</volume>
<fpage>2660</fpage>
<lpage>79</lpage>
<pub-id pub-id-type="pmid">20798329</pub-id>
</element-citation>
</ref>
<ref id="CR97">
<label>97.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xue</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Cotton metallothionein GhMT3a, a reactive oxygen species scavenger, increased tolerance against abiotic stress in transgenic tobacco and yeast</article-title>
<source>J Exp Bot</source>
<year>2009</year>
<volume>60</volume>
<fpage>339</fpage>
<lpage>49</lpage>
<pub-id pub-id-type="pmid">19033550</pub-id>
</element-citation>
</ref>
<ref id="CR98">
<label>98.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reid</surname>
<given-names>SJ</given-names>
</name>
<name>
<surname>Ross</surname>
<given-names>GS</given-names>
</name>
</person-group>
<article-title>Up-regulation of two cDNA clones encoding metallothionein-like proteins in apple fruit during cool storage</article-title>
<source>Physiol Plant</source>
<year>1997</year>
<volume>100</volume>
<fpage>183</fpage>
<lpage>9</lpage>
</element-citation>
</ref>
<ref id="CR99">
<label>99.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abdullah</surname>
<given-names>SNA</given-names>
</name>
<name>
<surname>Cheah</surname>
<given-names>SC</given-names>
</name>
<name>
<surname>Murphy</surname>
<given-names>DJ</given-names>
</name>
</person-group>
<article-title>Isolation and characterisation of two divergent type 3 metallothioneins from oil palm,
<italic>Elaeis guineensis</italic>
</article-title>
<source>Plant Physiol Biochem</source>
<year>2002</year>
<volume>40</volume>
<fpage>255</fpage>
<lpage>63</lpage>
</element-citation>
</ref>
<ref id="CR100">
<label>100.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ledger</surname>
<given-names>SE</given-names>
</name>
<name>
<surname>Gardner</surname>
<given-names>RC</given-names>
</name>
</person-group>
<article-title>Cloning and characterization of five cDNAs for genes differentially expressed during fruit development of kiwifruit (
<italic>Actinidia deliciosa</italic>
var.
<italic>deliciosa</italic>
)</article-title>
<source>Plant Mol Biol</source>
<year>1994</year>
<volume>25</volume>
<fpage>877</fpage>
<lpage>86</lpage>
<pub-id pub-id-type="pmid">8075403</pub-id>
</element-citation>
</ref>
<ref id="CR101">
<label>101.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dabrowska</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Mierek-Adamska</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Goc</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Plant metallothioneins: Putative functions identified by promoter analysis in silico</article-title>
<source>Acta Biol Cracoviensia Ser Bot</source>
<year>2012</year>
<volume>54</volume>
<fpage>109</fpage>
<lpage>20</lpage>
</element-citation>
</ref>
<ref id="CR102">
<label>102.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liscum</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Reed</surname>
<given-names>JW</given-names>
</name>
</person-group>
<article-title>Genetics of Aux / IAA and ARF action in plant growth and development</article-title>
<source>Plant Mol Biol</source>
<year>2002</year>
<volume>49</volume>
<fpage>387</fpage>
<lpage>400</lpage>
<pub-id pub-id-type="pmid">12036262</pub-id>
</element-citation>
</ref>
<ref id="CR103">
<label>103.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sagar</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Chervin</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Mila</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Hao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Roustan</surname>
<given-names>J-P</given-names>
</name>
<name>
<surname>Benichou</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Gibon</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Biais</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Maury</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Latché</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Pech</surname>
<given-names>J-C</given-names>
</name>
<name>
<surname>Bouzayen</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Zouine</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>SlARF4, an auxin response factor involved in the control of sugar metabolism during tomato fruit development</article-title>
<source>Plant Physiol</source>
<year>2013</year>
<volume>161</volume>
<fpage>1362</fpage>
<lpage>74</lpage>
<pub-id pub-id-type="pmid">23341361</pub-id>
</element-citation>
</ref>
<ref id="CR104">
<label>104.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chaves</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>YC</given-names>
</name>
<name>
<surname>Pinto-Ricardo</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Van de Peer</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Miguel</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>miRNA profiling in leaf and cork tissues of
<italic>Quercus suber</italic>
reveals novel miRNAs and tissue-specific expression patterns</article-title>
<source>Tree Genet Genomes</source>
<year>2014</year>
<volume>10</volume>
<fpage>721</fpage>
<lpage>37</lpage>
</element-citation>
</ref>
<ref id="CR105">
<label>105.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pagnussat</surname>
<given-names>GC</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>H-J</given-names>
</name>
<name>
<surname>Sundaresan</surname>
<given-names>V</given-names>
</name>
</person-group>
<article-title>Cell-fate switch of synergid to egg cell in
<italic>Arabidopsis</italic>
eostre mutant embryo sacs arises from misexpression of the BEL1-like homeodomain gene
<italic>BLH1</italic>
</article-title>
<source>Plant Cell</source>
<year>2007</year>
<volume>19</volume>
<fpage>3578</fpage>
<lpage>92</lpage>
<pub-id pub-id-type="pmid">18055603</pub-id>
</element-citation>
</ref>
<ref id="CR106">
<label>106.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sakakibara</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Ando</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Yip</surname>
<given-names>HK</given-names>
</name>
<name>
<surname>Tamada</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Hiwatashi</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Murata</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Deguchi</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Hasebe</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Bowman</surname>
<given-names>JL</given-names>
</name>
</person-group>
<article-title>KNOX2 genes regulate the haploid-to-diploid morphological transition in land plants</article-title>
<source>Science</source>
<year>2013</year>
<volume>339</volume>
<fpage>1067</fpage>
<lpage>70</lpage>
<pub-id pub-id-type="pmid">23449590</pub-id>
</element-citation>
</ref>
<ref id="CR107">
<label>107.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Allan</surname>
<given-names>AC</given-names>
</name>
<name>
<surname>Hellens</surname>
<given-names>RP</given-names>
</name>
<name>
<surname>Laing</surname>
<given-names>WA</given-names>
</name>
</person-group>
<article-title>MYB transcription factors that colour our fruit</article-title>
<source>Trends Plant Sci</source>
<year>2008</year>
<volume>13</volume>
<fpage>99</fpage>
<lpage>102</lpage>
<pub-id pub-id-type="pmid">18280199</pub-id>
</element-citation>
</ref>
<ref id="CR108">
<label>108.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cominelli</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Tonelli</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>A new role for plant R2R3-MYB transcription factors in cell cycle regulation</article-title>
<source>Cell Res</source>
<year>2009</year>
<volume>19</volume>
<fpage>1231</fpage>
<lpage>2</lpage>
<pub-id pub-id-type="pmid">19881525</pub-id>
</element-citation>
</ref>
<ref id="CR109">
<label>109.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vimolmangkang</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Korban</surname>
<given-names>SS</given-names>
</name>
</person-group>
<article-title>An apple MYB transcription factor,
<italic>MdMYB3</italic>
, is involved in regulation of anthocyanin biosynthesis and flower development</article-title>
<source>BMC Plant Biol</source>
<year>2013</year>
<volume>13</volume>
<fpage>176</fpage>
<pub-id pub-id-type="pmid">24199943</pub-id>
</element-citation>
</ref>
<ref id="CR110">
<label>110.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zoratti</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Karppinen</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Luengo Escobar</surname>
<given-names>A</given-names>
</name>
<name>
<surname>HÃggman</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Jaakola</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Light-controlled flavonoid biosynthesis in fruits</article-title>
<source>Front Plant Sci</source>
<year>2014</year>
<volume>5</volume>
<fpage>1</fpage>
<lpage>16</lpage>
</element-citation>
</ref>
<ref id="CR111">
<label>111.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stracke</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Werber</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Weisshaar</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>The
<italic>R2R3-MYB</italic>
gene family in
<italic>Arabidopsis thaliana</italic>
</article-title>
<source>Curr Opin Plant Biol</source>
<year>2001</year>
<volume>4</volume>
<fpage>447</fpage>
<lpage>56</lpage>
<pub-id pub-id-type="pmid">11597504</pub-id>
</element-citation>
</ref>
<ref id="CR112">
<label>112.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koes</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Verweij</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Quattrocchio</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Flavonoids: a colorful model for the regulation and evolution of biochemical pathways</article-title>
<source>Trends Plant Sci</source>
<year>2005</year>
<volume>10</volume>
<fpage>236</fpage>
<lpage>42</lpage>
<pub-id pub-id-type="pmid">15882656</pub-id>
</element-citation>
</ref>
<ref id="CR113">
<label>113.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bogs</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Jaffé</surname>
<given-names>FW</given-names>
</name>
<name>
<surname>Takos</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Walker</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Robinson</surname>
<given-names>SP</given-names>
</name>
</person-group>
<article-title>The grapevine transcription factor VvMYBPA1 regulates proanthocyanidin synthesis during fruit development</article-title>
<source>Plant Physiol</source>
<year>2007</year>
<volume>143</volume>
<fpage>1347</fpage>
<lpage>61</lpage>
<pub-id pub-id-type="pmid">17208963</pub-id>
</element-citation>
</ref>
<ref id="CR114">
<label>114.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Armengaud</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Breitling</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Amtmann</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>The potassium-dependent transcriptome of Arabidopsis reveals a prominent role of jasmonic acid in nutrient signaling</article-title>
<source>Plant Physiol</source>
<year>2004</year>
<volume>136</volume>
<fpage>2556</fpage>
<lpage>76</lpage>
<pub-id pub-id-type="pmid">15347784</pub-id>
</element-citation>
</ref>
<ref id="CR115">
<label>115.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Valério</surname>
<given-names>L</given-names>
</name>
<name>
<surname>De Meyer</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Penel</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Dunand</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Expression analysis of the
<italic>Arabidopsis</italic>
peroxidase multigenic family</article-title>
<source>Phytochemistry</source>
<year>2004</year>
<volume>65</volume>
<fpage>1331</fpage>
<lpage>42</lpage>
<pub-id pub-id-type="pmid">15231406</pub-id>
</element-citation>
</ref>
<ref id="CR116">
<label>116.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Irshad</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Canut</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Borderies</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Pont-Lezica</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Jamet</surname>
<given-names>E</given-names>
</name>
</person-group>
<article-title>A new picture of cell wall protein dynamics in elongating cells of
<italic>Arabidopsis thaliana</italic>
: confirmed actors and newcomers</article-title>
<source>BMC Plant Biol</source>
<year>2008</year>
<volume>8</volume>
<fpage>94</fpage>
<pub-id pub-id-type="pmid">18796151</pub-id>
</element-citation>
</ref>
<ref id="CR117">
<label>117.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Herrero</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Fernández-Pérez</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Yebra</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Novo-Uzal</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Pomar</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Pedreño</surname>
<given-names></given-names>
</name>
<name>
<surname>Cuello</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Guéra</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Esteban-Carrasco</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Zapata</surname>
<given-names>JM</given-names>
</name>
</person-group>
<article-title>Bioinformatic and functional characterization of the basic peroxidase 72 from
<italic>Arabidopsis thaliana</italic>
involved in lignin biosynthesis</article-title>
<source>Planta</source>
<year>2013</year>
<volume>237</volume>
<fpage>1599</fpage>
<lpage>612</lpage>
<pub-id pub-id-type="pmid">23508663</pub-id>
</element-citation>
</ref>
<ref id="CR118">
<label>118.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hudson</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ringli</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Boylan</surname>
<given-names>MT</given-names>
</name>
<name>
<surname>Quail</surname>
<given-names>PH</given-names>
</name>
</person-group>
<article-title>The FAR1 locus encodes a novel nuclear protein specific to The FAR1 locus encodes a novel nuclear protein specific to phytochrome A signaling</article-title>
<source>Genes Dev</source>
<year>1999</year>
<volume>13</volume>
<fpage>2017</fpage>
<lpage>27</lpage>
<pub-id pub-id-type="pmid">10444599</pub-id>
</element-citation>
</ref>
<ref id="CR119">
<label>119.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Xing</surname>
<given-names>WD</given-names>
</name>
</person-group>
<article-title>
<italic>Arabidopsis</italic>
FHY3 defines a key phytochrome A signaling component directly interacting with its homologous partner FAR1</article-title>
<source>EMBO J</source>
<year>2002</year>
<volume>21</volume>
<fpage>1339</fpage>
<lpage>49</lpage>
<pub-id pub-id-type="pmid">11889039</pub-id>
</element-citation>
</ref>
<ref id="CR120">
<label>120.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Allen</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Koustenis</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Theodorou</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Somers</surname>
<given-names>DE</given-names>
</name>
<name>
<surname>Kay</surname>
<given-names>SA</given-names>
</name>
<name>
<surname>Whitelam</surname>
<given-names>GC</given-names>
</name>
<name>
<surname>Devlin</surname>
<given-names>PF</given-names>
</name>
</person-group>
<article-title>
<italic>Arabidopsis</italic>
FHY3 specifically gates phytochrome signaling to the circadian clock</article-title>
<source>Plant Cell</source>
<year>2006</year>
<volume>18</volume>
<fpage>2506</fpage>
<lpage>16</lpage>
<pub-id pub-id-type="pmid">17012604</pub-id>
</element-citation>
</ref>
<ref id="CR121">
<label>121.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Casola</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ripoll</surname>
<given-names>DR</given-names>
</name>
<name>
<surname>Feschotte</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Transposase-Derived transcription factors regulate light signaling in
<italic>Arabidopsis</italic>
</article-title>
<source>Science</source>
<year>2008</year>
<volume>318</volume>
<fpage>1302</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="pmid">18033885</pub-id>
</element-citation>
</ref>
<ref id="CR122">
<label>122.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Siddiqui</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Teng</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Wan</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Lau</surname>
<given-names>O-S</given-names>
</name>
<name>
<surname>Ouyang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Wan</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Devlin</surname>
<given-names>PF</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>XW</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Coordinated transcriptional regulation underlying the circadian clock in
<italic>Arabidopsis</italic>
</article-title>
<source>Nat Cell Biol</source>
<year>2011</year>
<volume>3</volume>
<fpage>616</fpage>
<lpage>22</lpage>
<pub-id pub-id-type="pmid">21499259</pub-id>
</element-citation>
</ref>
<ref id="CR123">
<label>123.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ouyang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Mo</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Wan</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>XW</given-names>
</name>
</person-group>
<article-title>Genome-Wide binding site analysis of FAR-RED ELONGATED HYPOCOTYL3 reveals its novel function in
<italic>Arabidopsis</italic>
development</article-title>
<source>Plant Cell</source>
<year>2011</year>
<volume>23</volume>
<fpage>2514</fpage>
<lpage>35</lpage>
<pub-id pub-id-type="pmid">21803941</pub-id>
</element-citation>
</ref>
<ref id="CR124">
<label>124.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Ji</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Jing</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>Transposase-derived proteins FHY3/FAR1 nteract with PHYTOCHROME-INTERACTING FACTOR1 to regulate chlorophyll biosynthesis by modulating
<italic>HEMB1</italic>
during deetiolation in
<italic>Arabidopsis</italic>
</article-title>
<source>Plant Cell</source>
<year>2012</year>
<volume>24</volume>
<fpage>1984</fpage>
<lpage>2000</lpage>
<pub-id pub-id-type="pmid">22634759</pub-id>
</element-citation>
</ref>
<ref id="CR125">
<label>125.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Ji</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Bao</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>R</given-names>
</name>
</person-group>
<article-title>FAR-RED ELONGATED HYPOCOTYL3 and FAR-RED IMPAIRED RESPONSE1 transcription factors integrate light and abscisic acid signaling in Arabidopsis</article-title>
<source>Plant Physiol</source>
<year>2013</year>
<volume>163</volume>
<fpage>857</fpage>
<lpage>66</lpage>
<pub-id pub-id-type="pmid">23946351</pub-id>
</element-citation>
</ref>
<ref id="CR126">
<label>126.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>H</given-names>
</name>
<name>
<surname>An</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Arabidopsis FRS4/CPD25 and FHY3/CPD45 work cooperatively to promote the expression of the chloroplast division gene
<italic>ARC5</italic>
and chloroplast division</article-title>
<source>Plant J</source>
<year>2013</year>
<volume>75</volume>
<fpage>795</fpage>
<lpage>807</lpage>
<pub-id pub-id-type="pmid">23662592</pub-id>
</element-citation>
</ref>
<ref id="CR127">
<label>127.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Siloto</surname>
<given-names>RMP</given-names>
</name>
<name>
<surname>Findlay</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Lopez-villalobos</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Yeung</surname>
<given-names>EC</given-names>
</name>
<name>
<surname>Nykiforuk</surname>
<given-names>CL</given-names>
</name>
<name>
<surname>Moloney</surname>
<given-names>MM</given-names>
</name>
</person-group>
<article-title>The accumulation of Oleosins determines the size of seed oilbodies in
<italic>Arabidopsis</italic>
</article-title>
<source>Plant Cell</source>
<year>2006</year>
<volume>18</volume>
<fpage>1961</fpage>
<lpage>74</lpage>
<pub-id pub-id-type="pmid">16877495</pub-id>
</element-citation>
</ref>
<ref id="CR128">
<label>128.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miquel</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Trigui</surname>
<given-names>G</given-names>
</name>
<name>
<surname>D’Andréa</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Kelemen</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Baud</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Berger</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Deruyffelaere</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Trubuil</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Lepiniec</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Dubreucq</surname>
<given-names>B</given-names>
</name>
</person-group>
<article-title>Specialization of oleosins in OB dynamics during seed development in
<italic>Arabidopsis thaliana</italic>
seeds</article-title>
<source>Plant Physiol</source>
<year>2014</year>
<volume>164</volume>
<fpage>1866</fpage>
<lpage>78</lpage>
<pub-id pub-id-type="pmid">24515832</pub-id>
</element-citation>
</ref>
<ref id="CR129">
<label>129.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>DD</given-names>
</name>
<name>
<surname>Fan</surname>
<given-names>YM</given-names>
</name>
</person-group>
<article-title>Cloning, characterisation, and expression analysis of an oleosin gene in coconut (
<italic>Cocos nucifera</italic>
L.) pulp</article-title>
<source>J Hortic Sci Biotechnol</source>
<year>2009</year>
<volume>84</volume>
<fpage>483</fpage>
<lpage>8</lpage>
</element-citation>
</ref>
<ref id="CR130">
<label>130.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Popluechai</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Froissard</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Jolivet</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Breviario</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Gatehouse</surname>
<given-names>AMR</given-names>
</name>
<name>
<surname>O’Donnell</surname>
<given-names>AG</given-names>
</name>
<name>
<surname>Chardot</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Kohli</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>
<italic>Jatropha curcas</italic>
oil body proteome and oleosins: L-form
<italic>JcOle3</italic>
as a potential phylogenetic marker</article-title>
<source>Plant Physiol Biochem</source>
<year>2011</year>
<volume>49</volume>
<fpage>352</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="pmid">21251844</pub-id>
</element-citation>
</ref>
<ref id="CR131">
<label>131.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Long</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Shockey</surname>
<given-names>JM</given-names>
</name>
</person-group>
<article-title>Identification, classification and differential expression of Oleosin genes in Tung Tree (
<italic>Vernicia fordii</italic>
)</article-title>
<source>PLoS One</source>
<year>2014</year>
<volume>9</volume>
<pub-id pub-id-type="pmid">24516650</pub-id>
</element-citation>
</ref>
<ref id="CR132">
<label>132.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Gonzalez</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Payne</surname>
<given-names>CT</given-names>
</name>
<name>
<surname>Lloyd</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>A network of redundant bHLH proteins functions in all TTG1-dependent pathways of
<italic>Arabidopsis</italic>
</article-title>
<source>Development</source>
<year>2003</year>
<volume>130</volume>
<fpage>4859</fpage>
<lpage>69</lpage>
<pub-id pub-id-type="pmid">12917293</pub-id>
</element-citation>
</ref>
<ref id="CR133">
<label>133.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feller</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Machemer</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Braun</surname>
<given-names>EL</given-names>
</name>
<name>
<surname>Grotewold</surname>
<given-names>E</given-names>
</name>
</person-group>
<article-title>Evolutionary and comparative analysis of MYB and bHLH plant transcription factors</article-title>
<source>Plant J</source>
<year>2011</year>
<volume>66</volume>
<fpage>94</fpage>
<lpage>116</lpage>
<pub-id pub-id-type="pmid">21443626</pub-id>
</element-citation>
</ref>
<ref id="CR134">
<label>134.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nakashima</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Takasaki</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Mizoi</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Shinozaki</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Yamaguchi-Shinozaki</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>NAC transcription factors in plant abiotic stress responses</article-title>
<source>Biochim Biophys Acta</source>
<year>1819</year>
<volume>2012</volume>
<fpage>97</fpage>
<lpage>103</lpage>
</element-citation>
</ref>
<ref id="CR135">
<label>135.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nuruzzaman</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Sharoni</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Kikuchi</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants</article-title>
<source>Front Microbiol</source>
<year>2013</year>
<volume>4</volume>
<fpage>248</fpage>
<pub-id pub-id-type="pmid">24058359</pub-id>
</element-citation>
</ref>
<ref id="CR136">
<label>136.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Olsen</surname>
<given-names>AN</given-names>
</name>
<name>
<surname>Ernst</surname>
<given-names>HA</given-names>
</name>
<name>
<surname>Lo</surname>
<given-names>LL</given-names>
</name>
<name>
<surname>Skriver</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>NAC transcription factors: structurally distinct, functionally diverse</article-title>
<source>Trends Plant Sci</source>
<year>2005</year>
<volume>10</volume>
<fpage>79</fpage>
<lpage>87</lpage>
<pub-id pub-id-type="pmid">15708345</pub-id>
</element-citation>
</ref>
<ref id="CR137">
<label>137.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Christensen</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Hewitson</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Busuioc</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Held</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Jones</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Kolli</surname>
<given-names>RK</given-names>
</name>
<name>
<surname>Kwon</surname>
<given-names>WT</given-names>
</name>
<name>
<surname>Laprise</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Magaña Rueda</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Mearns</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Menéndez</surname>
<given-names>CG</given-names>
</name>
<name>
<surname>Räisänen</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Rinke</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Sarr</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Whetton</surname>
<given-names>P</given-names>
</name>
</person-group>
<person-group person-group-type="editor">
<name>
<surname>Fu</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Giorgi</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Regional climate projections</article-title>
<source>Climate change 2007: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change</source>
<year>2007</year>
<publisher-loc>Cambridge</publisher-loc>
<publisher-name>University Press</publisher-name>
<fpage>872</fpage>
<lpage>9</lpage>
</element-citation>
</ref>
<ref id="CR138">
<label>138.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Giorgi</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Lionello</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Climate change projections for the Mediterranean region</article-title>
<source>Glob Planet Change</source>
<year>2008</year>
<volume>63</volume>
<fpage>90</fpage>
<lpage>104</lpage>
</element-citation>
</ref>
<ref id="CR139">
<label>139.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marum</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Miguel</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Ricardo</surname>
<given-names>CP</given-names>
</name>
<name>
<surname>Miguel</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Reference gene selection for quantitative real-time PCR normalization in
<italic>Quercus suber</italic>
</article-title>
<source>PLoS One</source>
<year>2012</year>
<volume>7</volume>
<fpage>1</fpage>
<lpage>10</lpage>
</element-citation>
</ref>
<ref id="CR140">
<label>140.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhu</surname>
<given-names>YY</given-names>
</name>
<name>
<surname>Machleder</surname>
<given-names>EM</given-names>
</name>
<name>
<surname>Chenchik</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Siebert</surname>
<given-names>PD</given-names>
</name>
</person-group>
<article-title>Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction</article-title>
<source>Biotechniques</source>
<year>2001</year>
<volume>30</volume>
<fpage>892</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="pmid">11314272</pub-id>
</element-citation>
</ref>
<ref id="CR141">
<label>141.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhulidov</surname>
<given-names>PA</given-names>
</name>
<name>
<surname>Bogdanova</surname>
<given-names>EA</given-names>
</name>
<name>
<surname>Shcheglov</surname>
<given-names>AS</given-names>
</name>
<name>
<surname>Vagner</surname>
<given-names>LL</given-names>
</name>
<name>
<surname>Khaspekov</surname>
<given-names>GL</given-names>
</name>
<name>
<surname>Kozhemyako</surname>
<given-names>VB</given-names>
</name>
<name>
<surname>Matz</surname>
<given-names>MV</given-names>
</name>
<name>
<surname>Meleshkevitch</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Moroz</surname>
<given-names>LL</given-names>
</name>
<name>
<surname>Lukyanov</surname>
<given-names>SA</given-names>
</name>
<name>
<surname>Shagin</surname>
<given-names>DA</given-names>
</name>
</person-group>
<article-title>Simple cDNA normalization using kamchatka crab duplex-specific nuclease</article-title>
<source>Nucleic Acids Res</source>
<year>2004</year>
<volume>32</volume>
<pub-id pub-id-type="pmid">14973331</pub-id>
</element-citation>
</ref>
<ref id="CR142">
<label>142.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Falgueras</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Lara</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Fernández-Pozo</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Cantón</surname>
<given-names>FR</given-names>
</name>
<name>
<surname>Pérez-Trabado</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Claros</surname>
<given-names>MG</given-names>
</name>
</person-group>
<article-title>SeqTrim: a high-throughput pipeline for pre-processing any type of sequence read</article-title>
<source>BMC Bioinformatics</source>
<year>2010</year>
<volume>11</volume>
<fpage>38</fpage>
<pub-id pub-id-type="pmid">20089148</pub-id>
</element-citation>
</ref>
<ref id="CR143">
<label>143.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Conesa</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Götz</surname>
<given-names>S</given-names>
</name>
<name>
<surname>García-Gómez</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Terol</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Talón</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Robles</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research</article-title>
<source>Bioinformatics</source>
<year>2005</year>
<volume>21</volume>
<fpage>3674</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="pmid">16081474</pub-id>
</element-citation>
</ref>
<ref id="CR144">
<label>144.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Battke</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Symons</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Nieselt</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Mayday–integrative analytics for expression data</article-title>
<source>BMC Bioinformatics</source>
<year>2010</year>
<volume>11</volume>
<fpage>121</fpage>
<pub-id pub-id-type="pmid">20214778</pub-id>
</element-citation>
</ref>
<ref id="CR145">
<label>145.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kal</surname>
<given-names>A</given-names>
</name>
<name>
<surname>van Zonneveld</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Benes</surname>
<given-names>V</given-names>
</name>
<name>
<surname>van den Berg</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Koerkamp</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Albermann</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Strack</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Ruijter</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Richter</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Dujon</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Ansorge</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Tabak</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Dynamics of gene expression revealed by comparison of serial analysis of gene expression transcript profiles from yeast grown on two different carbon sources</article-title>
<source>Mol Biol Cell</source>
<year>1999</year>
<volume>10</volume>
<fpage>1859</fpage>
<lpage>72</lpage>
<pub-id pub-id-type="pmid">10359602</pub-id>
</element-citation>
</ref>
<ref id="CR146">
<label>146.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Supek</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Bošnjak</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Škunca</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Šmuc</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>REVIGO summarizes and visualizes long lists of gene ontology terms</article-title>
<source>PLoS One</source>
<year>2011</year>
<volume>6</volume>
<pub-id pub-id-type="pmid">21789182</pub-id>
</element-citation>
</ref>
<ref id="CR147">
<label>147.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kearse</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Moir</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Wilson</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Stones-Havas</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Cheung</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Sturrock</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Buxton</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Cooper</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Markowitz</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Duran</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Thierer</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Ashton</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Meintjes</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Drummond</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data</article-title>
<source>Bioinformatics</source>
<year>2012</year>
<volume>28</volume>
<fpage>1647</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="pmid">22543367</pub-id>
</element-citation>
</ref>
<ref id="CR148">
<label>148.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pfaffl</surname>
<given-names>MW</given-names>
</name>
</person-group>
<article-title>A new mathematical model for relative quantification in real-time RT-PCR</article-title>
<source>Nucleic Acids Res</source>
<year>2001</year>
<volume>29</volume>
<pub-id pub-id-type="pmid">11328886</pub-id>
</element-citation>
</ref>
<ref id="CR149">
<label>149.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname>
<given-names>KJ</given-names>
</name>
<name>
<surname>Schmittgen</surname>
<given-names>TD</given-names>
</name>
</person-group>
<article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2^(-Delta Delta CT) Method</article-title>
<source>Methods</source>
<year>2001</year>
<volume>25</volume>
<fpage>402</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="pmid">11846609</pub-id>
</element-citation>
</ref>
<ref id="CR150">
<label>150.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hellemans</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Mortier</surname>
<given-names>G</given-names>
</name>
<name>
<surname>De Paepe</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Speleman</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Vandesompele</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data</article-title>
<source>Genome Biol</source>
<year>2007</year>
<volume>8</volume>
<fpage>R19</fpage>
<pub-id pub-id-type="pmid">17291332</pub-id>
</element-citation>
</ref>
<ref id="CR151">
<label>151.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stewart</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Rascón</surname>
<given-names>CA</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Nie</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Barry</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Chu</surname>
<given-names>L-F</given-names>
</name>
<name>
<surname>Ardalani</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Wagner</surname>
<given-names>RJ</given-names>
</name>
<name>
<surname>Probasco</surname>
<given-names>MD</given-names>
</name>
<name>
<surname>Bolin</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Leng</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Sengupta</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Volkmer</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Habermann</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>EM</given-names>
</name>
<name>
<surname>Thomson</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Dewey</surname>
<given-names>CN</given-names>
</name>
</person-group>
<article-title>Comparative RNA-seq analysis in the unsequenced axolotl: the oncogene burst highlights early gene expression in the blastema</article-title>
<source>PLoS Comput Biol</source>
<year>2013</year>
<volume>9</volume>
<fpage>1</fpage>
<lpage>15</lpage>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000630  | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000630  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024