Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 0006138 ( Pmc/Corpus ); précédent : 0006137; suivant : 0006139 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">The ATP-dependent RNA helicase HrpB plays an important role in motility and biofilm formation in
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
</title>
<author>
<name sortKey="Granato, Lais Moreira" sort="Granato, Lais Moreira" uniqKey="Granato L" first="Laís Moreira" last="Granato">Laís Moreira Granato</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Universidade Estadual de Campinas/UNICAMP, Instituto de Biologia, P.O. Box 6010, Campinas, SP 13083-970 Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Picchi, Simone Cristina" sort="Picchi, Simone Cristina" uniqKey="Picchi S" first="Simone Cristina" last="Picchi">Simone Cristina Picchi</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Andrade, Maxuel De Oliveira" sort="Andrade, Maxuel De Oliveira" uniqKey="Andrade M" first="Maxuel De Oliveira" last="Andrade">Maxuel De Oliveira Andrade</name>
<affiliation>
<nlm:aff id="Aff3">Citrus Research and Educational Center, Department of Microbiology and Cell Science, University of Florida, IFAS, 700 Experiment Station Road, Lake Alfred, FL 33850 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Takita, Marco Aurelio" sort="Takita, Marco Aurelio" uniqKey="Takita M" first="Marco Aurélio" last="Takita">Marco Aurélio Takita</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="De Souza, Alessandra Alves" sort="De Souza, Alessandra Alves" uniqKey="De Souza A" first="Alessandra Alves" last="De Souza">Alessandra Alves De Souza</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Nian" sort="Wang, Nian" uniqKey="Wang N" first="Nian" last="Wang">Nian Wang</name>
<affiliation>
<nlm:aff id="Aff3">Citrus Research and Educational Center, Department of Microbiology and Cell Science, University of Florida, IFAS, 700 Experiment Station Road, Lake Alfred, FL 33850 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Machado, Marcos Antonio" sort="Machado, Marcos Antonio" uniqKey="Machado M" first="Marcos Antonio" last="Machado">Marcos Antonio Machado</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">27005008</idno>
<idno type="pmc">4804567</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4804567</idno>
<idno type="RBID">PMC:4804567</idno>
<idno type="doi">10.1186/s12866-016-0655-1</idno>
<date when="2016">2016</date>
<idno type="wicri:Area/Pmc/Corpus">000613</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">The ATP-dependent RNA helicase HrpB plays an important role in motility and biofilm formation in
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
</title>
<author>
<name sortKey="Granato, Lais Moreira" sort="Granato, Lais Moreira" uniqKey="Granato L" first="Laís Moreira" last="Granato">Laís Moreira Granato</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Universidade Estadual de Campinas/UNICAMP, Instituto de Biologia, P.O. Box 6010, Campinas, SP 13083-970 Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Picchi, Simone Cristina" sort="Picchi, Simone Cristina" uniqKey="Picchi S" first="Simone Cristina" last="Picchi">Simone Cristina Picchi</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Andrade, Maxuel De Oliveira" sort="Andrade, Maxuel De Oliveira" uniqKey="Andrade M" first="Maxuel De Oliveira" last="Andrade">Maxuel De Oliveira Andrade</name>
<affiliation>
<nlm:aff id="Aff3">Citrus Research and Educational Center, Department of Microbiology and Cell Science, University of Florida, IFAS, 700 Experiment Station Road, Lake Alfred, FL 33850 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Takita, Marco Aurelio" sort="Takita, Marco Aurelio" uniqKey="Takita M" first="Marco Aurélio" last="Takita">Marco Aurélio Takita</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="De Souza, Alessandra Alves" sort="De Souza, Alessandra Alves" uniqKey="De Souza A" first="Alessandra Alves" last="De Souza">Alessandra Alves De Souza</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Wang, Nian" sort="Wang, Nian" uniqKey="Wang N" first="Nian" last="Wang">Nian Wang</name>
<affiliation>
<nlm:aff id="Aff3">Citrus Research and Educational Center, Department of Microbiology and Cell Science, University of Florida, IFAS, 700 Experiment Station Road, Lake Alfred, FL 33850 USA</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Machado, Marcos Antonio" sort="Machado, Marcos Antonio" uniqKey="Machado M" first="Marcos Antonio" last="Machado">Marcos Antonio Machado</name>
<affiliation>
<nlm:aff id="Aff1">Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">BMC Microbiology</title>
<idno type="eISSN">1471-2180</idno>
<imprint>
<date when="2016">2016</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>RNA helicases are enzymes that catalyze the separation of double-stranded RNA (dsRNA) using the free energy of ATP binding and hydrolysis. DEAD/DEAH families participate in many different aspects of RNA metabolism, including RNA synthesis, RNA folding, RNA-RNA interactions, RNA localization and RNA degradation. Several important bacterial DEAD/DEAH-box RNA helicases have been extensively studied. In this study, we characterize the ATP-dependent RNA helicase encoded by the
<italic>hrpB</italic>
(XAC0293) gene using deletion and genetic complementation assays. We provide insights into the function of the
<italic>hrpB</italic>
gene in
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
by investigating the roles of
<italic>hrpB</italic>
in biofilm formation on abiotic surfaces and host leaves, cell motility, host virulence of the citrus canker bacterium and growth
<italic>in planta</italic>
.</p>
</sec>
<sec>
<title>Results</title>
<p>The
<italic>hrpB</italic>
gene is highly conserved in the sequenced strains of
<italic>Xanthomonas</italic>
. Mutation of the
<italic>hrpB</italic>
gene (
<italic>∆hrpB</italic>
) resulted in a significant reduction in biofilms on abiotic surfaces and host leaves.
<italic>∆hrpB</italic>
also exhibited increased cell dispersion on solid medium plates.
<italic>∆hrpB</italic>
showed reduced adhesion on biotic and abiotic surfaces and delayed development in disease symptoms when sprayed on susceptible citrus leaves. Quantitative reverse transcription-PCR assays indicated that deletion of
<italic>hrpB</italic>
reduced the expression of four type IV pili genes. The transcriptional start site of
<italic>fimA</italic>
(XAC3241) was determined using rapid amplification of 5′-cDNA Ends (5′RACE). Based on the results of
<italic>fimA</italic>
mRNA structure predictions, the
<italic>fimA</italic>
5′ UTR may contain three different loops. HrpB may be involved in alterations to the structure of
<italic>fimA</italic>
mRNA that promote the stability of
<italic>fimA</italic>
RNA.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>Our data show that
<italic>hrpB</italic>
is involved in adherence of
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
to different surfaces. In addition, to the best of our knowledge, this is the first time that a DEAH RNA helicase has been implicated in the regulation of type IV pili in
<italic>Xanthomonas</italic>
.</p>
</sec>
<sec>
<title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/s12866-016-0655-1) contains supplementary material, which is available to authorized users.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Silverman, E" uniqKey="Silverman E">E Silverman</name>
</author>
<author>
<name sortKey="Edwalds Gilbert, G" uniqKey="Edwalds Gilbert G">G Edwalds-Gilbert</name>
</author>
<author>
<name sortKey="Lin, Rj" uniqKey="Lin R">RJ Lin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cordin, O" uniqKey="Cordin O">O Cordin</name>
</author>
<author>
<name sortKey="Banroques, J" uniqKey="Banroques J">J Banroques</name>
</author>
<author>
<name sortKey="Tanner, Nk" uniqKey="Tanner N">NK Tanner</name>
</author>
<author>
<name sortKey="Linder, P" uniqKey="Linder P">P Linder</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tanner, Nk" uniqKey="Tanner N">NK Tanner</name>
</author>
<author>
<name sortKey="Linder, P" uniqKey="Linder P">P Linder</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Caruthers, Jm" uniqKey="Caruthers J">JM Caruthers</name>
</author>
<author>
<name sortKey="Mckay, Db" uniqKey="Mckay D">DB McKay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rocak, S" uniqKey="Rocak S">S Rocak</name>
</author>
<author>
<name sortKey="Linder, P" uniqKey="Linder P">P Linder</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Oun, S" uniqKey="Oun S">S Oun</name>
</author>
<author>
<name sortKey="Redder, P" uniqKey="Redder P">P Redder</name>
</author>
<author>
<name sortKey="Didier, J" uniqKey="Didier J">J Didier</name>
</author>
<author>
<name sortKey="Francois, P" uniqKey="Francois P">P François</name>
</author>
<author>
<name sortKey="Corvaglia, A" uniqKey="Corvaglia A">A Corvaglia</name>
</author>
<author>
<name sortKey="Buttazzoni, E" uniqKey="Buttazzoni E">E Buttazzoni</name>
</author>
<author>
<name sortKey="Giraud, C" uniqKey="Giraud C">C Giraud</name>
</author>
<author>
<name sortKey="Girard, M" uniqKey="Girard M">M Girard</name>
</author>
<author>
<name sortKey="Schrenzel, J" uniqKey="Schrenzel J">J Schrenzel</name>
</author>
<author>
<name sortKey="Linder, P" uniqKey="Linder P">P Linder</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gong, Z" uniqKey="Gong Z">Z Gong</name>
</author>
<author>
<name sortKey="Dong, C H" uniqKey="Dong C">C-H Dong</name>
</author>
<author>
<name sortKey="Lee, H" uniqKey="Lee H">H Lee</name>
</author>
<author>
<name sortKey="Zhu, J" uniqKey="Zhu J">J Zhu</name>
</author>
<author>
<name sortKey="Xiong, L" uniqKey="Xiong L">L Xiong</name>
</author>
<author>
<name sortKey="Gong, D" uniqKey="Gong D">D Gong</name>
</author>
<author>
<name sortKey="Stevenson, B" uniqKey="Stevenson B">B Stevenson</name>
</author>
<author>
<name sortKey="Zhu, J K" uniqKey="Zhu J">J-K Zhu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kaberdin, Vr" uniqKey="Kaberdin V">VR Kaberdin</name>
</author>
<author>
<name sortKey="Bl Si, U" uniqKey="Bl Si U">U Bläsi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Linder, P" uniqKey="Linder P">P Linder</name>
</author>
<author>
<name sortKey="Jankowsky, E" uniqKey="Jankowsky E">E Jankowsky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hunger, K" uniqKey="Hunger K">K Hunger</name>
</author>
<author>
<name sortKey="Beckering, Cl" uniqKey="Beckering C">CL Beckering</name>
</author>
<author>
<name sortKey="Wiegeshoff, F" uniqKey="Wiegeshoff F">F Wiegeshoff</name>
</author>
<author>
<name sortKey="Graumann, Pl" uniqKey="Graumann P">PL Graumann</name>
</author>
<author>
<name sortKey="Marahiel, Ma" uniqKey="Marahiel M">MA Marahiel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roos, S" uniqKey="Roos S">S Roos</name>
</author>
<author>
<name sortKey="Lindgren, S" uniqKey="Lindgren S">S Lindgren</name>
</author>
<author>
<name sortKey="Jonsson, H" uniqKey="Jonsson H">H Jonsson</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Markkula, A" uniqKey="Markkula A">A Markkula</name>
</author>
<author>
<name sortKey="Mattila, M" uniqKey="Mattila M">M Mattila</name>
</author>
<author>
<name sortKey="Lindstrom, M" uniqKey="Lindstrom M">M Lindström</name>
</author>
<author>
<name sortKey="Korkeala, H" uniqKey="Korkeala H">H Korkeala</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Koo, Jt" uniqKey="Koo J">JT Koo</name>
</author>
<author>
<name sortKey="Choe, J" uniqKey="Choe J">J Choe</name>
</author>
<author>
<name sortKey="Moseley, Sl" uniqKey="Moseley S">SL Moseley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Butland, G" uniqKey="Butland G">G Butland</name>
</author>
<author>
<name sortKey="Peregrin Alvarez, Jm" uniqKey="Peregrin Alvarez J">JM Peregrin-Alvarez</name>
</author>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Yang, W" uniqKey="Yang W">W Yang</name>
</author>
<author>
<name sortKey="Yang, X" uniqKey="Yang X">X Yang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Salman Dilgimen, A" uniqKey="Salman Dilgimen A">A Salman-Dilgimen</name>
</author>
<author>
<name sortKey="Hardy, Po" uniqKey="Hardy P">PO Hardy</name>
</author>
<author>
<name sortKey="Dresser, Ar" uniqKey="Dresser A">AR Dresser</name>
</author>
<author>
<name sortKey="Chaconas, G" uniqKey="Chaconas G">G Chaconas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gottwald, Tr" uniqKey="Gottwald T">TR Gottwald</name>
</author>
<author>
<name sortKey="Pierce, F" uniqKey="Pierce F">F Pierce</name>
</author>
<author>
<name sortKey="Graham, Jh" uniqKey="Graham J">JH Graham</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Graham, Jh" uniqKey="Graham J">JH Graham</name>
</author>
<author>
<name sortKey="Gottwal, Tr" uniqKey="Gottwal T">TR Gottwal</name>
</author>
<author>
<name sortKey="Cubero, J" uniqKey="Cubero J">J Cubero</name>
</author>
<author>
<name sortKey="Achor, Ds" uniqKey="Achor D">DS Achor</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rigano, La" uniqKey="Rigano L">LA Rigano</name>
</author>
<author>
<name sortKey="Siciliano, F" uniqKey="Siciliano F">F Siciliano</name>
</author>
<author>
<name sortKey="Enrique, R" uniqKey="Enrique R">R Enrique</name>
</author>
<author>
<name sortKey="Sendin, L" uniqKey="Sendin L">L Sendín</name>
</author>
<author>
<name sortKey="Filippone, P" uniqKey="Filippone P">P Filippone</name>
</author>
<author>
<name sortKey="Torres, Ps" uniqKey="Torres P">PS Torres</name>
</author>
<author>
<name sortKey="Questa, J" uniqKey="Questa J">J Qüesta</name>
</author>
<author>
<name sortKey="Dow, Jm" uniqKey="Dow J">JM Dow</name>
</author>
<author>
<name sortKey="Castagnaro, Ap" uniqKey="Castagnaro A">AP Castagnaro</name>
</author>
<author>
<name sortKey="Vojnov, Aa" uniqKey="Vojnov A">AA Vojnov</name>
</author>
<author>
<name sortKey="Marano, Mr" uniqKey="Marano M">MR Marano</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Malamud, F" uniqKey="Malamud F">F Malamud</name>
</author>
<author>
<name sortKey="Torres, Ps" uniqKey="Torres P">PS Torres</name>
</author>
<author>
<name sortKey="Roeschlin, R" uniqKey="Roeschlin R">R Roeschlin</name>
</author>
<author>
<name sortKey="Rigano, La" uniqKey="Rigano L">LA Rigano</name>
</author>
<author>
<name sortKey="Enrique, R" uniqKey="Enrique R">R Enrique</name>
</author>
<author>
<name sortKey="Bonomi, Hr" uniqKey="Bonomi H">HR Bonomi</name>
</author>
<author>
<name sortKey="Castagnaro, Ap" uniqKey="Castagnaro A">AP Castagnaro</name>
</author>
<author>
<name sortKey="Marano, Mr" uniqKey="Marano M">MR Marano</name>
</author>
<author>
<name sortKey="Vojnov, Aa" uniqKey="Vojnov A">AA Vojnov</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Wang, N" uniqKey="Wang N">N Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Wang, N" uniqKey="Wang N">N Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Costerton, Jw" uniqKey="Costerton J">JW Costerton</name>
</author>
<author>
<name sortKey="Lewandowski, Z" uniqKey="Lewandowski Z">Z Lewandowski</name>
</author>
<author>
<name sortKey="Caldwell, De" uniqKey="Caldwell D">DE Caldwell</name>
</author>
<author>
<name sortKey="Korber, Dr" uniqKey="Korber D">DR Korber</name>
</author>
<author>
<name sortKey="Lappin Scott, Hm" uniqKey="Lappin Scott H">HM Lappin-Scott</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Caserta, R" uniqKey="Caserta R">R Caserta</name>
</author>
<author>
<name sortKey="Takita, Ma" uniqKey="Takita M">MA Takita</name>
</author>
<author>
<name sortKey="Targon, Ml" uniqKey="Targon M">ML Targon</name>
</author>
<author>
<name sortKey="Rosselli Murai, Lk" uniqKey="Rosselli Murai L">LK Rosselli-Murai</name>
</author>
<author>
<name sortKey="De Souza, Ap" uniqKey="De Souza A">AP De Souza</name>
</author>
<author>
<name sortKey="Peroni, L" uniqKey="Peroni L">L Peroni</name>
</author>
<author>
<name sortKey="Stach Machado, Dr" uniqKey="Stach Machado D">DR Stach-Machado</name>
</author>
<author>
<name sortKey="Andrade, A" uniqKey="Andrade A">A Andrade</name>
</author>
<author>
<name sortKey="Labate, Ca" uniqKey="Labate C">CA Labate</name>
</author>
<author>
<name sortKey="Kitajima, Ew" uniqKey="Kitajima E">EW Kitajima</name>
</author>
<author>
<name sortKey="Machado, Ma" uniqKey="Machado M">MA Machado</name>
</author>
<author>
<name sortKey="De Souza, Aa" uniqKey="De Souza A">AA De Souza</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Da Silva, Acr" uniqKey="Da Silva A">ACR da Silva</name>
</author>
<author>
<name sortKey="Ferro, Ja" uniqKey="Ferro J">JA Ferro</name>
</author>
<author>
<name sortKey="Reinach, Fc" uniqKey="Reinach F">FC Reinach</name>
</author>
<author>
<name sortKey="Farah, Cs" uniqKey="Farah C">CS Farah</name>
</author>
<author>
<name sortKey="Furlan, Lr" uniqKey="Furlan L">LR Furlan</name>
</author>
<author>
<name sortKey="Quaggio, Rb" uniqKey="Quaggio R">RB Quaggio</name>
</author>
<author>
<name sortKey="Monteiro Vitorello, Cb" uniqKey="Monteiro Vitorello C">CB Monteiro-Vitorello</name>
</author>
<author>
<name sortKey="Van Sluys, Ma" uniqKey="Van Sluys M">MA Van Sluys</name>
</author>
<author>
<name sortKey="Almeida, Nf" uniqKey="Almeida N">NF Almeida</name>
</author>
<author>
<name sortKey="Alves, Lmc" uniqKey="Alves L">LMC Alves</name>
</author>
<author>
<name sortKey="Do Amaral, Am" uniqKey="Do Amaral A">AM do Amaral</name>
</author>
<author>
<name sortKey="Bertolini, Mc" uniqKey="Bertolini M">MC Bertolini</name>
</author>
<author>
<name sortKey="Camargo, Lea" uniqKey="Camargo L">LEA Camargo</name>
</author>
<author>
<name sortKey="Camarotte, G" uniqKey="Camarotte G">G Camarotte</name>
</author>
<author>
<name sortKey="Cannavan, F" uniqKey="Cannavan F">F Cannavan</name>
</author>
<author>
<name sortKey="Cardozo, J" uniqKey="Cardozo J">J Cardozo</name>
</author>
<author>
<name sortKey="Chambergo, F" uniqKey="Chambergo F">F Chambergo</name>
</author>
<author>
<name sortKey="Ciapina, Lp" uniqKey="Ciapina L">LP Ciapina</name>
</author>
<author>
<name sortKey="Cicarelli, Rmb" uniqKey="Cicarelli R">RMB Cicarelli</name>
</author>
<author>
<name sortKey="Coutinho, Ll" uniqKey="Coutinho L">LL Coutinho</name>
</author>
<author>
<name sortKey="Cursino Santos, Jr" uniqKey="Cursino Santos J">JR Cursino-Santos</name>
</author>
<author>
<name sortKey="El Dorry, H" uniqKey="El Dorry H">H El-Dorry</name>
</author>
<author>
<name sortKey="Faria, Jb" uniqKey="Faria J">JB Faria</name>
</author>
<author>
<name sortKey="Ferreira, Ajs" uniqKey="Ferreira A">AJS Ferreira</name>
</author>
<author>
<name sortKey="Ferreira, Rcc" uniqKey="Ferreira R">RCC Ferreira</name>
</author>
<author>
<name sortKey="Ferro, Mit" uniqKey="Ferro M">MIT Ferro</name>
</author>
<author>
<name sortKey="Formighieri, Ef" uniqKey="Formighieri E">EF Formighieri</name>
</author>
<author>
<name sortKey="Franco, Mc" uniqKey="Franco M">MC Franco</name>
</author>
<author>
<name sortKey="Greggio, Cc" uniqKey="Greggio C">CC Greggio</name>
</author>
<author>
<name sortKey="Gruber, A" uniqKey="Gruber A">A Gruber</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dunger, G" uniqKey="Dunger G">G Dunger</name>
</author>
<author>
<name sortKey="Guzzo, Cr" uniqKey="Guzzo C">CR Guzzo</name>
</author>
<author>
<name sortKey="Andrade, Mo" uniqKey="Andrade M">MO Andrade</name>
</author>
<author>
<name sortKey="Jones, Jb" uniqKey="Jones J">JB Jones</name>
</author>
<author>
<name sortKey="Farah, Cs" uniqKey="Farah C">CS Farah</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guzzo, Cr" uniqKey="Guzzo C">CR Guzzo</name>
</author>
<author>
<name sortKey="Salinas, Rk" uniqKey="Salinas R">RK Salinas</name>
</author>
<author>
<name sortKey="Andrade, Mo" uniqKey="Andrade M">MO Andrade</name>
</author>
<author>
<name sortKey="Farah, Cs" uniqKey="Farah C">CS Farah</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guzzo, Cr" uniqKey="Guzzo C">CR Guzzo</name>
</author>
<author>
<name sortKey="Dunger, G" uniqKey="Dunger G">G Dunger</name>
</author>
<author>
<name sortKey="Salinas, Rk" uniqKey="Salinas R">RK Salinas</name>
</author>
<author>
<name sortKey="Farah, Cs" uniqKey="Farah C">CS Farah</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Finn, Rda" uniqKey="Finn R">RDA Finn</name>
</author>
<author>
<name sortKey="Bateman, J" uniqKey="Bateman J">J Bateman</name>
</author>
<author>
<name sortKey="Clements, P" uniqKey="Clements P">P Clements</name>
</author>
<author>
<name sortKey="Coggill, Ry" uniqKey="Coggill R">RY Coggill</name>
</author>
<author>
<name sortKey="Eberhardt, Sr" uniqKey="Eberhardt S">SR Eberhardt</name>
</author>
<author>
<name sortKey="Eddy, A" uniqKey="Eddy A">A Eddy</name>
</author>
<author>
<name sortKey="Heger, K" uniqKey="Heger K">K Heger</name>
</author>
<author>
<name sortKey="Hetherington, L" uniqKey="Hetherington L">L Hetherington</name>
</author>
<author>
<name sortKey="Holm, J" uniqKey="Holm J">J Holm</name>
</author>
<author>
<name sortKey="Mistry, Ell" uniqKey="Mistry E">ELL Mistry</name>
</author>
<author>
<name sortKey="Sonnhammer, J" uniqKey="Sonnhammer J">J Sonnhammer</name>
</author>
<author>
<name sortKey="Tate, Mrd" uniqKey="Tate M">MRD Tate</name>
</author>
<author>
<name sortKey="Finn, A" uniqKey="Finn A">A Finn</name>
</author>
<author>
<name sortKey="Bateman, J" uniqKey="Bateman J">J Bateman</name>
</author>
<author>
<name sortKey="Clements, P" uniqKey="Clements P">P Clements</name>
</author>
<author>
<name sortKey="Coggill, Ry" uniqKey="Coggill R">RY Coggill</name>
</author>
<author>
<name sortKey="Eberhardt, Sr" uniqKey="Eberhardt S">SR Eberhardt</name>
</author>
<author>
<name sortKey="Eddy, A" uniqKey="Eddy A">A Eddy</name>
</author>
<author>
<name sortKey="Heger, K" uniqKey="Heger K">K Heger</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Xu, Y" uniqKey="Xu Y">Y Xu</name>
</author>
<author>
<name sortKey="Xu, X" uniqKey="Xu X">X Xu</name>
</author>
<author>
<name sortKey="Lan, R" uniqKey="Lan R">R Lan</name>
</author>
<author>
<name sortKey="Xiong, Y" uniqKey="Xiong Y">Y Xiong</name>
</author>
<author>
<name sortKey="Ye, C" uniqKey="Ye C">C Ye</name>
</author>
<author>
<name sortKey="Ren, Z" uniqKey="Ren Z">Z Ren</name>
</author>
<author>
<name sortKey="Liu, L" uniqKey="Liu L">L Liu</name>
</author>
<author>
<name sortKey="Zhao, A" uniqKey="Zhao A">A Zhao</name>
</author>
<author>
<name sortKey="Wu, Lf" uniqKey="Wu L">LF Wu</name>
</author>
<author>
<name sortKey="Xu, J" uniqKey="Xu J">J Xu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chiang, P" uniqKey="Chiang P">P Chiang</name>
</author>
<author>
<name sortKey="Sampaleanu, Lm" uniqKey="Sampaleanu L">LM Sampaleanu</name>
</author>
<author>
<name sortKey="Ayers, M" uniqKey="Ayers M">M Ayers</name>
</author>
<author>
<name sortKey="Pahuta, M" uniqKey="Pahuta M">M Pahuta</name>
</author>
<author>
<name sortKey="Howell, Pl" uniqKey="Howell P">PL Howell</name>
</author>
<author>
<name sortKey="Burrows, Ll" uniqKey="Burrows L">LL Burrows</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zuker, M" uniqKey="Zuker M">M Zuker</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gottig, N" uniqKey="Gottig N">N Gottig</name>
</author>
<author>
<name sortKey="Garavaglia, Bs" uniqKey="Garavaglia B">BS Garavaglia</name>
</author>
<author>
<name sortKey="Garofalo, Cg" uniqKey="Garofalo C">CG Garofalo</name>
</author>
<author>
<name sortKey="Orellano, Eg" uniqKey="Orellano E">EG Orellano</name>
</author>
<author>
<name sortKey="Ottado, J" uniqKey="Ottado J">J Ottado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Py, B" uniqKey="Py B">B Py</name>
</author>
<author>
<name sortKey="Higgins, Cf" uniqKey="Higgins C">CF Higgins</name>
</author>
<author>
<name sortKey="Krisch, Hm" uniqKey="Krisch H">HM Krisch</name>
</author>
<author>
<name sortKey="Carpousis, Aj" uniqKey="Carpousis A">AJ Carpousis</name>
</author>
<author>
<name sortKey="Carpousis, Aj" uniqKey="Carpousis A">AJ Carpousis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Khemici, V" uniqKey="Khemici V">V Khemici</name>
</author>
<author>
<name sortKey="Toesca, I" uniqKey="Toesca I">I Toesca</name>
</author>
<author>
<name sortKey="Poljak, L" uniqKey="Poljak L">L Poljak</name>
</author>
<author>
<name sortKey="Vanzo, Nf" uniqKey="Vanzo N">NF Vanzo</name>
</author>
<author>
<name sortKey="Carpousis, Aj" uniqKey="Carpousis A">AJ Carpousis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Danhorn, T" uniqKey="Danhorn T">T Danhorn</name>
</author>
<author>
<name sortKey="Fuqua, C" uniqKey="Fuqua C">C Fuqua</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guo, Y" uniqKey="Guo Y">Y Guo</name>
</author>
<author>
<name sortKey="Sagaram, Us" uniqKey="Sagaram U">US Sagaram</name>
</author>
<author>
<name sortKey="Kim, J" uniqKey="Kim J">J Kim</name>
</author>
<author>
<name sortKey="Wang, N" uniqKey="Wang N">N Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Yan, Q" uniqKey="Yan Q">Q Yan</name>
</author>
<author>
<name sortKey="Wang, N" uniqKey="Wang N">N Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zimaro, T" uniqKey="Zimaro T">T Zimaro</name>
</author>
<author>
<name sortKey="Thomas, L" uniqKey="Thomas L">L Thomas</name>
</author>
<author>
<name sortKey="Marondedze, C" uniqKey="Marondedze C">C Marondedze</name>
</author>
<author>
<name sortKey="Sgro, Gg" uniqKey="Sgro G">GG Sgro</name>
</author>
<author>
<name sortKey="Garofalo, Cg" uniqKey="Garofalo C">CG Garofalo</name>
</author>
<author>
<name sortKey="Ficarra, Fa" uniqKey="Ficarra F">FA Ficarra</name>
</author>
<author>
<name sortKey="Gehring, C" uniqKey="Gehring C">C Gehring</name>
</author>
<author>
<name sortKey="Ottado, J" uniqKey="Ottado J">J Ottado</name>
</author>
<author>
<name sortKey="Gottig, N" uniqKey="Gottig N">N Gottig</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Wang, N" uniqKey="Wang N">N Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gury, J" uniqKey="Gury J">J Gury</name>
</author>
<author>
<name sortKey="Barthelmebs, L" uniqKey="Barthelmebs L">L Barthelmebs</name>
</author>
<author>
<name sortKey="Cavin, Jf" uniqKey="Cavin J">JF Cavin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tu Quoc, Ph" uniqKey="Tu Quoc P">PH Tu Quoc</name>
</author>
<author>
<name sortKey="Genevaux, P" uniqKey="Genevaux P">P Genevaux</name>
</author>
<author>
<name sortKey="Pajunen, M" uniqKey="Pajunen M">M Pajunen</name>
</author>
<author>
<name sortKey="Savilahti, H" uniqKey="Savilahti H">H Savilahti</name>
</author>
<author>
<name sortKey="Georgopoulos, C" uniqKey="Georgopoulos C">C Georgopoulos</name>
</author>
<author>
<name sortKey="Schrenzel, J" uniqKey="Schrenzel J">J Schrenzel</name>
</author>
<author>
<name sortKey="Kelley, Wl" uniqKey="Kelley W">WL Kelley</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Andrade, Mo" uniqKey="Andrade M">MO Andrade</name>
</author>
<author>
<name sortKey="Farah, Cs" uniqKey="Farah C">CS Farah</name>
</author>
<author>
<name sortKey="Wang, N" uniqKey="Wang N">N Wang</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Babitzke, P" uniqKey="Babitzke P">P Babitzke</name>
</author>
<author>
<name sortKey="Romeo, T" uniqKey="Romeo T">T Romeo</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Richards, J" uniqKey="Richards J">J Richards</name>
</author>
<author>
<name sortKey="Luciano, Dj" uniqKey="Luciano D">DJ Luciano</name>
</author>
<author>
<name sortKey="Belasco, Jg" uniqKey="Belasco J">JG Belasco</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Deana, A" uniqKey="Deana A">A Deana</name>
</author>
<author>
<name sortKey="Belasco, Jg" uniqKey="Belasco J">JG Belasco</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arnold, Te" uniqKey="Arnold T">TE Arnold</name>
</author>
<author>
<name sortKey="Yu, J" uniqKey="Yu J">J Yu</name>
</author>
<author>
<name sortKey="Belasco, Jg" uniqKey="Belasco J">JG Belasco</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Matsunaga, J" uniqKey="Matsunaga J">J Matsunaga</name>
</author>
<author>
<name sortKey="Simons, El" uniqKey="Simons E">EL Simons</name>
</author>
<author>
<name sortKey="Simons, Rw" uniqKey="Simons R">RW Simons</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hanahan, D" uniqKey="Hanahan D">D Hanahan</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="El Yacoubi, B" uniqKey="El Yacoubi B">B El Yacoubi</name>
</author>
<author>
<name sortKey="Brunings, Am" uniqKey="Brunings A">AM Brunings</name>
</author>
<author>
<name sortKey="Yuan, Q" uniqKey="Yuan Q">Q Yuan</name>
</author>
<author>
<name sortKey="Shankar, S" uniqKey="Shankar S">S Shankar</name>
</author>
<author>
<name sortKey="Gabriel, Dw" uniqKey="Gabriel D">DW Gabriel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sambrook, J" uniqKey="Sambrook J">J Sambrook</name>
</author>
<author>
<name sortKey="Fritsch, E" uniqKey="Fritsch E">E Fritsch</name>
</author>
<author>
<name sortKey="Maniatis, T" uniqKey="Maniatis T">T Maniatis</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Souza, Dp" uniqKey="Souza D">DP Souza</name>
</author>
<author>
<name sortKey="Andrade, Mo" uniqKey="Andrade M">MO Andrade</name>
</author>
<author>
<name sortKey="Alvarez Martinez, Ce" uniqKey="Alvarez Martinez C">CE Alvarez-Martinez</name>
</author>
<author>
<name sortKey="Arantes, Gm" uniqKey="Arantes G">GM Arantes</name>
</author>
<author>
<name sortKey="Farah, Cs" uniqKey="Farah C">CS Farah</name>
</author>
<author>
<name sortKey="Salinas, Rk" uniqKey="Salinas R">RK Salinas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Li, J" uniqKey="Li J">J Li</name>
</author>
<author>
<name sortKey="Wang, N" uniqKey="Wang N">N Wang</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">BMC Microbiol</journal-id>
<journal-id journal-id-type="iso-abbrev">BMC Microbiol</journal-id>
<journal-title-group>
<journal-title>BMC Microbiology</journal-title>
</journal-title-group>
<issn pub-type="epub">1471-2180</issn>
<publisher>
<publisher-name>BioMed Central</publisher-name>
<publisher-loc>London</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">27005008</article-id>
<article-id pub-id-type="pmc">4804567</article-id>
<article-id pub-id-type="publisher-id">655</article-id>
<article-id pub-id-type="doi">10.1186/s12866-016-0655-1</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>The ATP-dependent RNA helicase HrpB plays an important role in motility and biofilm formation in
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Granato</surname>
<given-names>Laís Moreira</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Picchi</surname>
<given-names>Simone Cristina</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Andrade</surname>
<given-names>Maxuel de Oliveira</given-names>
</name>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Takita</surname>
<given-names>Marco Aurélio</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>de Souza</surname>
<given-names>Alessandra Alves</given-names>
</name>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Nian</given-names>
</name>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<contrib-id contrib-id-type="orcid">http://orcid.org/0000-0001-9780-3990</contrib-id>
<name>
<surname>Machado</surname>
<given-names>Marcos Antonio</given-names>
</name>
<address>
<email>marcos@centrodecitricultura.br</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<aff id="Aff1">
<label></label>
Centro de Citricultura Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis, SP 13490-970 Brazil</aff>
<aff id="Aff2">
<label></label>
Universidade Estadual de Campinas/UNICAMP, Instituto de Biologia, P.O. Box 6010, Campinas, SP 13083-970 Brazil</aff>
<aff id="Aff3">
<label></label>
Citrus Research and Educational Center, Department of Microbiology and Cell Science, University of Florida, IFAS, 700 Experiment Station Road, Lake Alfred, FL 33850 USA</aff>
</contrib-group>
<pub-date pub-type="epub">
<day>23</day>
<month>3</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="pmc-release">
<day>23</day>
<month>3</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="collection">
<year>2016</year>
</pub-date>
<volume>16</volume>
<elocation-id>55</elocation-id>
<history>
<date date-type="received">
<day>30</day>
<month>6</month>
<year>2015</year>
</date>
<date date-type="accepted">
<day>2</day>
<month>3</month>
<year>2016</year>
</date>
</history>
<permissions>
<copyright-statement>© Granato et al. 2016</copyright-statement>
<license license-type="OpenAccess">
<license-p>
<bold>Open Access</bold>
This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<abstract id="Abs1">
<sec>
<title>Background</title>
<p>RNA helicases are enzymes that catalyze the separation of double-stranded RNA (dsRNA) using the free energy of ATP binding and hydrolysis. DEAD/DEAH families participate in many different aspects of RNA metabolism, including RNA synthesis, RNA folding, RNA-RNA interactions, RNA localization and RNA degradation. Several important bacterial DEAD/DEAH-box RNA helicases have been extensively studied. In this study, we characterize the ATP-dependent RNA helicase encoded by the
<italic>hrpB</italic>
(XAC0293) gene using deletion and genetic complementation assays. We provide insights into the function of the
<italic>hrpB</italic>
gene in
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
by investigating the roles of
<italic>hrpB</italic>
in biofilm formation on abiotic surfaces and host leaves, cell motility, host virulence of the citrus canker bacterium and growth
<italic>in planta</italic>
.</p>
</sec>
<sec>
<title>Results</title>
<p>The
<italic>hrpB</italic>
gene is highly conserved in the sequenced strains of
<italic>Xanthomonas</italic>
. Mutation of the
<italic>hrpB</italic>
gene (
<italic>∆hrpB</italic>
) resulted in a significant reduction in biofilms on abiotic surfaces and host leaves.
<italic>∆hrpB</italic>
also exhibited increased cell dispersion on solid medium plates.
<italic>∆hrpB</italic>
showed reduced adhesion on biotic and abiotic surfaces and delayed development in disease symptoms when sprayed on susceptible citrus leaves. Quantitative reverse transcription-PCR assays indicated that deletion of
<italic>hrpB</italic>
reduced the expression of four type IV pili genes. The transcriptional start site of
<italic>fimA</italic>
(XAC3241) was determined using rapid amplification of 5′-cDNA Ends (5′RACE). Based on the results of
<italic>fimA</italic>
mRNA structure predictions, the
<italic>fimA</italic>
5′ UTR may contain three different loops. HrpB may be involved in alterations to the structure of
<italic>fimA</italic>
mRNA that promote the stability of
<italic>fimA</italic>
RNA.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>Our data show that
<italic>hrpB</italic>
is involved in adherence of
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
to different surfaces. In addition, to the best of our knowledge, this is the first time that a DEAH RNA helicase has been implicated in the regulation of type IV pili in
<italic>Xanthomonas</italic>
.</p>
</sec>
<sec>
<title>Electronic supplementary material</title>
<p>The online version of this article (doi:10.1186/s12866-016-0655-1) contains supplementary material, which is available to authorized users.</p>
</sec>
</abstract>
<kwd-group xml:lang="en">
<title>Keywords</title>
<kwd>RNA helicase</kwd>
<kwd>
<italic>Xanthomonas citri</italic>
</kwd>
<kwd>Biofilm</kwd>
<kwd>Citrus canker</kwd>
<kwd>Type IV pili</kwd>
</kwd-group>
<custom-meta-group>
<custom-meta>
<meta-name>issue-copyright-statement</meta-name>
<meta-value>© The Author(s) 2016</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="Sec1" sec-type="introduction">
<title>Background</title>
<p>RNA helicases are enzymes that catalyze the ATP-dependent separation of double-stranded RNA (dsRNA). RNA helicases are found in all kingdoms of life [
<xref ref-type="bibr" rid="CR1">1</xref>
,
<xref ref-type="bibr" rid="CR2">2</xref>
]. DEAD-box proteins, which are named for their highly conserved motif I residues (Asp-Glu-Ala-Asp), and the related DEAH, DExH and DExD families, which are commonly referred to collectively as the DExD/H helicase family, share eight conserved motifs [
<xref ref-type="bibr" rid="CR3">3</xref>
<xref ref-type="bibr" rid="CR5">5</xref>
] that have been shown to be involved in the activities and regulation of ATPases and helicases [
<xref ref-type="bibr" rid="CR6">6</xref>
].</p>
<p>DExD/H proteins participate in many different parts of RNA metabolism, including RNA synthesis, RNA folding, RNA-RNA interactions, RNA localization and RNA degradation [
<xref ref-type="bibr" rid="CR6">6</xref>
<xref ref-type="bibr" rid="CR9">9</xref>
]. Several bacterial DEAD/DEAH-box proteins have been characterized and found to be involved in different phenotypes. For example, in
<italic>Bacillus subtilis</italic>
, two cold-induced putative RNA-helicases, CshA and CshB, are thought to be essential for cold adaption, during which they work in conjunction with cold-shock proteins to rescue misfolded mRNA molecules and to maintain proper initiation of translation at low temperatures [
<xref ref-type="bibr" rid="CR10">10</xref>
]. Mutation of the
<italic>cshA</italic>
DEAD-box gene in
<italic>Staphylococcus aureus</italic>
resulted in the dysregulation of biofilm formation and hemolysis via modulation of
<italic>agr</italic>
mRNA stability [
<xref ref-type="bibr" rid="CR6">6</xref>
]. Furthermore, the putative DEAD-box helicase AggH is important during auto-aggregation [
<xref ref-type="bibr" rid="CR11">11</xref>
] in
<italic>Lactobacillus reuteri</italic>
. In
<italic>Listeria monocytogenes</italic>
, four putative DEAD-box RNA helicases (lmo0866, lmo1246, lmo1450 and lmo1722) are required for growth and motility [
<xref ref-type="bibr" rid="CR12">12</xref>
].</p>
<p>HrpA, a DEAH-box RNA helicase in
<italic>Escherichia coli</italic>
, is involved in processing
<italic>daa</italic>
mRNA from a fimbrial operon. This processing event results in a stable mRNA and the up-regulation of
<italic>daa</italic>
expression relative to the levels of other proteins that are encoded by the polycistronic transcript [
<xref ref-type="bibr" rid="CR13">13</xref>
]. The HrpA protein also appears to be involved in physical interactions with a variety of ribosomal proteins in
<italic>E. coli</italic>
either directly or indirectly through RNA interactions [
<xref ref-type="bibr" rid="CR14">14</xref>
,
<xref ref-type="bibr" rid="CR15">15</xref>
], consistent with a possible translational-level regulatory role [
<xref ref-type="bibr" rid="CR8">8</xref>
].</p>
<p>In our previous study, we screened
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
(
<italic>X. citri</italic>
) for mutants that were associated with effects on biofilm and identified
<italic>hrpB</italic>
 (XAC0293), which encodes a probable DEAH-box RNA helicase. The function of RNA helicases in the Gram negative bacteria
<italic>X. citri</italic>
has not been explored.
<italic>X. citri</italic>
causes citrus canker, one of the most economically damaging diseases that affects citrus [
<xref ref-type="bibr" rid="CR16">16</xref>
,
<xref ref-type="bibr" rid="CR17">17</xref>
]. It is spread by wind-blown rain and invades the host directly through natural openings, such as stomata, and through wounds [
<xref ref-type="bibr" rid="CR16">16</xref>
]. Previous studies have shown that
<italic>X. citri</italic>
forms biofilms on leaf surface [
<xref ref-type="bibr" rid="CR18">18</xref>
<xref ref-type="bibr" rid="CR21">21</xref>
], which increases the epiphytic survival of the bacteria and plays an important role in the invasion of host intercellular spaces by
<italic>X. citri</italic>
[
<xref ref-type="bibr" rid="CR18">18</xref>
,
<xref ref-type="bibr" rid="CR22">22</xref>
].</p>
<p>Biofilms are communities of bacterial cells that are embedded in a matrix of extracellular polymeric compounds that are attached to a surface [
<xref ref-type="bibr" rid="CR23">23</xref>
]. Biofilm formation is a dynamic and complex process that generally includes the initial attachment of cells to the surface at the substratum, physiological changes within the organism, multiplication of the cells to form microcolonies and the maturation of the biofilm [
<xref ref-type="bibr" rid="CR21">21</xref>
]. The stable adhesion of the bacteria to the surface is a key step in biofilm formation, and type IV pili (T4P) genes are thought to be important for cell-to-cell aggregation and adherence to surfaces [
<xref ref-type="bibr" rid="CR24">24</xref>
]. The
<italic>X. citri</italic>
strain 306 contains a functional T4P [
<xref ref-type="bibr" rid="CR25">25</xref>
]. The FimA proteins (XAC3241 and XAC3240), which form the major pilin subunit [
<xref ref-type="bibr" rid="CR26">26</xref>
], are produced through the secretion and polymerization of pilin subunits via a process that depends on PilB, a hexameric ATPase that is associated with the bacterial inner membrane [
<xref ref-type="bibr" rid="CR27">27</xref>
]. Pilus retraction is powered by another ATPase, PilT/PilU [
<xref ref-type="bibr" rid="CR28">28</xref>
].</p>
<p>In this study, we showed that the
<italic>hrpB</italic>
(XAC0293) gene plays an important role in adherence and biofilm development in
<italic>X. citri</italic>
and that its deletion reduced the expression of type IV pili genes. Our study sheds light on the involvement of DEAH-box proteins in adhesion, biofilm formation and pathogenicity in plant-pathogen bacteria.</p>
</sec>
<sec id="Sec2" sec-type="results">
<title>Results</title>
<sec id="Sec3">
<title>
<italic>XAC0293</italic>
/
<italic>hrpB</italic>
encodes a putative ATP-dependent RNA helicase that is involved in RNA metabolism</title>
<p>The XAC0293 open reading frame (ORF) is 2501 bp in length and is located within the genome at position 348799–351300 (Fig. 
<xref rid="Fig1" ref-type="fig">1</xref>
). The adjacent genes upstream (XAC0294) and downstream (XAC0292) of this location are in the same orientation and encode hypothetical proteins. XAC0293 was annotated as an 833 amino acid-long ATP-dependent RNA helicase, and the predicted pI and molecular weight (MW) of this amino acid are 9.49 and 90.9 kD (
<ext-link ext-link-type="uri" xlink:href="http://web.expasy.org/compute_pi/">http://web.expasy.org/compute_pi/</ext-link>
), respectively. The protein XAC0293 shares 42 % identity with the
<italic>Escherichia coli</italic>
RNA helicase HrpB, the function of which has not been described. A domain structure analysis performed using the Pfam database showed that XAC0293 contains four domains that are associated with DEAD/H-box RNA helicase proteins, including a DEAD-like helicase superfamily domain (DEXDc) at the N-terminal, a helicase superfamily c-terminal domain (HELICc), a helicase-associated domain (HA2), and an ATP-dependent helicase C-terminal domain (HrpB_c) at its C-terminal. The HrpB protein also contains two predicted ATP-binding sites, one Mg
<sup>++</sup>
-binding site and one nucleotide-binding region. Protein BLAST showed that XAC0293 is highly conserved in other
<italic>Xanthomonas</italic>
species (Fig. 
<xref rid="Fig2" ref-type="fig">2</xref>
), including
<italic>X. campestris</italic>
pv.
<italic>vesicatoria</italic>
str. 85–10 (97 % identity),
<italic>X. oryzae</italic>
pv.
<italic>oryzae</italic>
KACC 10331 (95 % identity),
<italic>X. campestris</italic>
pv.
<italic>campestris</italic>
str. ATCC 33913 (91 % identity), and
<italic>Xylella fastidiosa</italic>
(72 % identity) (Table 
<xref rid="Tab1" ref-type="table">1</xref>
). In addition, a total of four ATP-dependent RNA helicases were identified in
<italic>X. citri</italic>
, including Xac0293, Xac3122, Xac2390, and Xac0442. Among these, both Xac0293 and Xac0442 are DEAD-box helicases.
<fig id="Fig1">
<label>Fig. 1</label>
<caption>
<p>
<bold>a</bold>
Schematic diagram of the
<italic>hrpB</italic>
(XAC0293) gene in the
<italic>X. citri</italic>
subsp.
<italic>citri</italic>
strain 306 genome and the lengths of the open reading frames [
<xref ref-type="bibr" rid="CR29">29</xref>
].
<bold>b</bold>
Domain structure analyses of
<italic>hrp</italic>
<italic>B</italic>
in
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
and
<italic>E. coli</italic>
. The domain structure predictions were performed using the Pfam protein families database. Domain symbols: DExDc, DEAD-like helicase superfamily; HELICc, Helicase superfamily c-terminal domain; HA2, Helicase-associated domain; and HrpB_c, ATP-dependent helicase C-terminal domain</p>
</caption>
<graphic xlink:href="12866_2016_655_Fig1_HTML" id="MO1"></graphic>
</fig>
<fig id="Fig2">
<label>Fig. 2</label>
<caption>
<p>Sequence alignments of HrpB homologs. The * indicates the presence of a conserved motif. The ATP-binding region (GAGKT) that characterizes the DEAD-like helicase superfamily is indicated by a box. Abbreviations are as follows: ECHrpB,
<italic>Escherichia coli</italic>
str. K-12 str. DH10B; Xf1229,
<italic>Xylella fastidiosa</italic>
9a5c; Xcc0275,
<italic>Xanthomonas campestris</italic>
pv.
<italic>campestris</italic>
str. ATCC 33913; Xoo4533,
<italic>Xanthomonas oryzae</italic>
pv.
<italic>oryzae</italic>
KACC 10331; Xac0293,
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
; and Xcv0300,
<italic>Xanthomonas campestris</italic>
pv.
<italic>vesicatoria</italic>
str. 85–10</p>
</caption>
<graphic xlink:href="12866_2016_655_Fig2_HTML" id="MO2"></graphic>
</fig>
<table-wrap id="Tab1">
<label>Table 1</label>
<caption>
<p>Protein alignments of
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
in different bacteria</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="2">Strains</th>
<th rowspan="2">Proteins</th>
<th colspan="2">XAC0293 (
<italic>hrpB</italic>
)</th>
</tr>
<tr>
<th>E- value</th>
<th>Max ident</th>
</tr>
</thead>
<tbody>
<tr>
<td>
<italic>Xanthomonas campestris</italic>
pv.
<italic>vesicatoria</italic>
str. 85–10</td>
<td>ATP-dependent helicase HrpB</td>
<td char="." align="char">0.0</td>
<td>97 %</td>
</tr>
<tr>
<td>
<italic>Xanthomonas oryzae</italic>
pv.
<italic>oryzae</italic>
KACC 10331</td>
<td>ATP-dependent RNA helicase</td>
<td char="." align="char">0.0</td>
<td>95 %</td>
</tr>
<tr>
<td>
<italic>Xanthomonas campestris</italic>
pv.
<italic>campestris</italic>
str. ATCC 33913</td>
<td>ATP-dependent RNA helicase</td>
<td char="." align="char">0.0</td>
<td>91 %</td>
</tr>
<tr>
<td>
<italic>Xylella fastidiosa</italic>
9a5c</td>
<td>ATP-dependent helicase</td>
<td char="." align="char">0.0</td>
<td>72 %</td>
</tr>
<tr>
<td>
<italic>Escherichia coli</italic>
str. K-12 substr. DH10B</td>
<td>ATP-dependent helicase HrpB</td>
<td char="." align="char">0.0</td>
<td>42 %</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
<sec id="Sec4">
<title>Mutation of
<italic>hrpB</italic>
affected biofilm formation on abiotic surfaces and host leaves in
<italic>X. citri</italic>
</title>
<p>To study the function of
<italic>hrpB</italic>
, we used an allelic exchange protocol to produce an
<italic>hrpB</italic>
mutant (∆
<italic>hrpB</italic>
) of
<italic>X. citri</italic>
strain 306, which was confirmed using PCR. The growth curve of the mutant was not different from that in the wild-type (data not shown). Biofilm development was examined in polystyrene plates and glass tubes and on sweet orange leaves. A significant reduction in biofilm formation was observed in ∆
<italic>hrpB</italic>
after 48 h of growth in NB medium containing 1 % glucose compared to the wild-type and complemented strains (Fig. 
<xref rid="Fig3" ref-type="fig">3a</xref>
). Crystal violet staining was over 5 times more intense in the
<italic>X. citri</italic>
wild-type strain than in the ∆
<italic>hrpB</italic>
strain. Similar results were observed in attachment to abiotic and leaf surfaces. The ∆
<italic>hrpB</italic>
strain formed over 4 times less biofilm on host leaves (OD590 = 0.54 ± 0.20) than the wild-type strain (OD590 = 2.19 ± 0.45), and the complemented strain, ∆
<italic>hrpB</italic>
-p53
<italic>hrpB</italic>
, formed levels similar to the wild-type strain (Fig. 
<xref rid="Fig3" ref-type="fig">3b</xref>
). No difference was observed in xanthan gum production between the wild-type and mutant
<italic>hrpB</italic>
strains under the tested conditions (data not shown). These findings suggest that the
<italic>hrpB</italic>
gene is involved in cell adhesion and, consequently, biofilm formation in
<italic>X. citri</italic>
.
<fig id="Fig3">
<label>Fig. 3</label>
<caption>
<p>Biofilm formation by
<italic>X. citri</italic>
subsp.
<italic>citri</italic>
strain 306 and its derivatives.
<bold>a</bold>
Biofilm formation on abiotic surfaces.
<bold>b</bold>
Biofilm formation on citrus abaxial leaf surfaces. The results of the biofilm formation assays were quantified by measuring the optical density after dissolution in ethanol-acetone (70:30, v/v). Values are expressed as the means ± standard deviation. * indicates significantly different p-values (p ≤ 0.05) according to Tukey’s tests</p>
</caption>
<graphic xlink:href="12866_2016_655_Fig3_HTML" id="MO3"></graphic>
</fig>
</p>
</sec>
<sec id="Sec5">
<title>Deletion of
<italic>XAC0293</italic>
/
<italic>hrpB</italic>
resulted in increased motility</title>
<p>RNA helicases have previously been reported to be involved in bacterial motility [
<xref ref-type="bibr" rid="CR12">12</xref>
,
<xref ref-type="bibr" rid="CR30">30</xref>
]. The ∆
<italic>hrpB</italic>
and wild-type strains were both tested to determine their motility on 0.5 % agar SB medium, which is used in sliding analyses in
<italic>X. citri</italic>
. In
<italic>X. citri</italic>
, sliding motility was promoted by EPS and inhibited by type IV pili [
<xref ref-type="bibr" rid="CR19">19</xref>
,
<xref ref-type="bibr" rid="CR27">27</xref>
]. Deletion of
<italic>hrpB</italic>
increased cell dispersion in
<italic>X. citri</italic>
on SB medium plates (
<italic>P</italic>
<0.05, turkey test) (Fig. 
<xref rid="Fig4" ref-type="fig">4a</xref>
). On the plate, the diameters of the growth zones that resulted from migration away from the inoculation points on the agar surface were approximately 1.41 cm for ∆
<italic>hrpB</italic>
and 0.61 cm for the wild-type strain after 48 h at 28 °C (Fig. 
<xref rid="Fig4" ref-type="fig">4b</xref>
). Swimming analyses were also performed, but no difference was observed between the mutant and wild-type strains (data not shown). The complemented strain showed results similar to those of the wild-type strain, indicating that the motility phenotype of the mutant was restored (Fig. 
<xref rid="Fig4" ref-type="fig">4a and b</xref>
). Growth curve assays were performed, and no difference was observed between the strains, indicating that the difference observed in the motility assays was not related to growth.
<fig id="Fig4">
<label>Fig. 4</label>
<caption>
<p>Sliding motility in
<italic>X. citri</italic>
subsp.
<italic>citri</italic>
strains.
<bold>a</bold>
<italic>hrpB</italic>
showed an increase in motility that could be restored to wild-type levels by the introduction of a plasmid containing the intact
<italic>hrpB</italic>
gene.
<bold>b</bold>
Measurements of the diameters of cell spread on plates. Cells were inoculated from bacterial cultures at exponential stage onto SB plates that were supplemented with 0.50 % agar. The assays were photographed and measured after 48 h of incubation at 28 °C. Abbreviations: wt-p53, wild-type strain 306 with empty vector pUFR053; ∆
<italic>hrpB</italic>
,
<italic>hrpB</italic>
mutant; and ∆
<italic>hrpB</italic>
-p53
<italic>hrpB</italic>
, complemented
<italic>hrpB</italic>
mutant. Values are expressed as the means ± standard deviations of three independent experiments. Different letters indicate significantly different p-values (p ≤ 0.05) in Tukey’s tests</p>
</caption>
<graphic xlink:href="12866_2016_655_Fig4_HTML" id="MO4"></graphic>
</fig>
</p>
</sec>
<sec id="Sec6">
<title>HrpB is important to
<italic>X. citri</italic>
survival on host leaves and contributes to virulence</title>
<p>The data from the motility and biofilm formation assays together indicated that there was a reduction in adhesion that could lead to decreased survival in
<italic>X. citri</italic>
on its sweet orange host. Populations of different strains were quantified at different post-spraying time points on citrus leaf surfaces. At seven days after the initial inoculation, the ∆
<italic>hrpB</italic>
population was smaller than the population of the wild-type strain 306 (Fig. 
<xref rid="Fig5" ref-type="fig">5b</xref>
). Delayed symptoms were observed in the ∆
<italic>hrpB</italic>
strain compared to the wild-type strain. At 21 days post-inoculation (dpi), the number of canker lesions on leaves infected with ∆
<italic>hrpB</italic>
was significantly less than the number on leaves inoculated with the wild-type strain (Fig. 
<xref rid="Fig5" ref-type="fig">5a</xref>
). Symptoms induced by ∆
<italic>hrpB</italic>
could be restored to wild-type levels by complementation with plasmid-borne
<italic>hrpB</italic>
(Fig. 
<xref rid="Fig5" ref-type="fig">5b</xref>
). However, there was no difference between the wild-type and the ∆
<italic>hrpB</italic>
strains in growth or symptom development when they were inoculated into the host leaves via infiltration using a low concentration of bacteria (Additional file
<xref rid="MOESM1" ref-type="media">1</xref>
: Figure S1). These findings suggest that
<italic>hrpB</italic>
plays an important role in the initial stages of infection in leaves, probably before entry of the pathogen into host plant intercellular spaces.
<fig id="Fig5">
<label>Fig. 5</label>
<caption>
<p>Pathogenicity assay and growth of
<italic>X. citri</italic>
subsp.
<italic>citri</italic>
strains in planta.
<bold>a</bold>
Symptoms were analyzed on the lower the surfaces of sweet orange leaves at 21 days post-inoculation (d.p.i.).
<bold>b</bold>
<italic>In vivo</italic>
bacterial growth in populations of wild-type, ∆
<italic>hrpB</italic>
and a complementary strain of
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
(
<italic>X. citri</italic>
) that were inoculated on the sweet orange leaves by spraying the leaves with bacteria at a concentration of 10
<sup>8</sup>
 CFU/mL. Bacterial cells were extracted from the leaves at different time points after inoculation. The leaves were homogenized in MgCl
<sub>2</sub>
and then plated on appropriate media after serial dilution. Colonies were counted after a 2-day incubation at 28 °C. Abbreviations: wt-p53, wild-type strain 306 with empty vector pUFR053; ∆
<italic>hrpB</italic>
,
<italic>hrpB</italic>
mutant; and ∆
<italic>hrpB</italic>
-p53
<italic>hrpB</italic>
, complemented
<italic>hrpB</italic>
mutant. Values are expressed as the means ± standard deviations of three independent experiments</p>
</caption>
<graphic xlink:href="12866_2016_655_Fig5_HTML" id="MO5"></graphic>
</fig>
</p>
</sec>
<sec id="Sec7">
<title>HrpB regulates the expression of type IV pili (T4P) genes</title>
<p>To gain new insights into the roles of
<italic>hrpB</italic>
in biofilm formation and to explain the reduction observed in adherence in the
<italic>hrpB</italic>
mutant, we performed qRT-PCR assays using total RNA from wild-type and ∆
<italic>hrpB</italic>
strains that were grown in NB medium and in orange leaves that were inoculated by spraying. We determined the expression levels of four type IV pili genes (T4P) based on our results and previous studies that showed that mutations in type IV pilus gene are associated with increased motility and decreased biofilms [
<xref ref-type="bibr" rid="CR26">26</xref>
,
<xref ref-type="bibr" rid="CR27">27</xref>
]. The genes
<italic>fimA</italic>
<sub>XAC3241</sub>
and
<italic>fimA2</italic>
<sub>XAC3240</sub>
, which encode for the major pilin subunit [
<xref ref-type="bibr" rid="CR26">26</xref>
], and
<italic>pilB</italic>
<sub>XAC3239,</sub>
an ATPase gene that is required for T4P polymerization [
<xref ref-type="bibr" rid="CR27">27</xref>
], may belong to the same operon that exhibited lower expression levels in the ∆
<italic>hrpB</italic>
strain than in the wild-type strain on NB medium (Fig. 
<xref rid="Fig6" ref-type="fig">6a</xref>
). On the other hand, the expression of
<italic>pilT</italic>
<sub>XAC2924</sub>
, an ATPase that is essential for T4P biogenesis [
<xref ref-type="bibr" rid="CR31">31</xref>
], was not different from that observed in the wild-type (Fig. 
<xref rid="Fig6" ref-type="fig">6a</xref>
). Likewise, qRT-PCR results from an analysis of
<italic>X. citri</italic>
recovered from leaves showed that there were no changes in the expression of the studied genes between ∆
<italic>hrpB</italic>
and the wild-type strain at 1 dpi. However, as shown in Fig. 
<xref rid="Fig6" ref-type="fig">6b</xref>
, at 3 and 7 dpi, the expression levels of
<italic>fimA</italic>
,
<italic>fimA2</italic>
and
<italic>pilB</italic>
were reduced in the ∆
<italic>hrpB</italic>
strain compared to the wild-type strain. Analysis of the results from qRT-PCR suggested that the ∆
<italic>hrpB</italic>
phenotype reflects the impaired expression of
<italic>fimA</italic>
,
<italic>fimA2</italic>
, and
<italic>pilB</italic>
, which encode the essential components of the type IV pili machinery.
<fig id="Fig6">
<label>Fig. 6</label>
<caption>
<p>Comparison of type IV pili gene expression (using qRT-PCR) in the wild-type and the ∆
<italic>hrpB</italic>
bacteria that were cultured in NB medium and
<italic>in planta</italic>
.
<bold>a</bold>
Relative expression levels on NB medium.
<bold>b</bold>
Relative expression levels
<italic>in planta</italic>
. The data are presented as the ratio (Log
<sub>2</sub>
-fold change) of the transcript number in ∆
<italic>hrpB</italic>
compared to the number in wild-type. The DNA gyrase subunit A-encoding gene
<italic>gyrA</italic>
was used as an endogenous control. Both qRT-PCR assays were repeated twice with similar results, and three independent biological replicates were performed each time</p>
</caption>
<graphic xlink:href="12866_2016_655_Fig6_HTML" id="MO6"></graphic>
</fig>
</p>
</sec>
<sec id="Sec8">
<title>Mapping of the 5′ untranslated region of the
<italic>fimA</italic>
(XAC3241) transcript</title>
<p>Previous studies have suggested that RNA helicases act by unwinding the secondary structure of the 5′ UTR in the target mRNA, which enables binding and scanning by the small ribosomal subunit to the start codon, AUG [
<xref ref-type="bibr" rid="CR1">1</xref>
,
<xref ref-type="bibr" rid="CR2">2</xref>
]. To determine the mechanism by which HrpB acts on the
<italic>fimA</italic>
transcript, we mapped the 5′-UTR of the
<italic>fimA</italic>
mRNA to check the presence of putative secondary structures in this region. The 5′ UTR of
<italic>fimA</italic>
was determined using rapid amplification of 5′-cDNA ends (5′RACE). The RACE PCR product was sequenced to identify the specific transcriptional start site of
<italic>fimA</italic>
, which is located 113 nucleotides upstream of the first codon (Fig. 
<xref rid="Fig7" ref-type="fig">7a</xref>
). Analysis of the 5' RACE results showed that the −35 and −10 regions were the locations for the ribosome binding site and the first codon for
<italic>fimA</italic>
<sub>XAC3241</sub>
in
<italic>X. citri</italic>
(Fig. 
<xref rid="Fig7" ref-type="fig">7b</xref>
). Mfold [
<xref ref-type="bibr" rid="CR32">32</xref>
] was used to predict the RNA structure of this region, and the analysis suggested that the
<italic>fimA</italic>
5′ UTR may contain three different loops (Fig. 
<xref rid="Fig8" ref-type="fig">8a</xref>
).
<fig id="Fig7">
<label>Fig. 7</label>
<caption>
<p>Identification of the
<italic>fimA</italic>
(XAC3241) transcriptional start site in
<italic>X. citri</italic>
subsp.
<italic>citri</italic>
. The transcriptional start site was determined using 5′ RACE.
<bold>a</bold>
A specific PCR product was detected after amplification was performed using reverse-transcribed cDNA with gene-specific primers for the
<italic>pilA</italic>
gene and with the adapter primers SP2 and SP1 (Roche).
<bold>b</bold>
Sequencing of the PCR products showed that the nucleotide indicated by arrow is the transcription start site of
<italic>fimA</italic>
in
<italic>X. citri</italic>
. The +1 nucleotide is indicated with an arrow, and the −35 and −10 sequences are shown in bold and italic, respectively. ATG is indicated in red, and the specific primer used to amplify the fragment is shown in bold. The letters represent the hairpins that were identified in the RNA: a = 1
<sup>st</sup>
hairpin, b = 2
<sup>nd</sup>
hairpin and c = 3
<sup>rd</sup>
hairpin</p>
</caption>
<graphic xlink:href="12866_2016_655_Fig7_HTML" id="MO7"></graphic>
</fig>
<fig id="Fig8">
<label>Fig. 8</label>
<caption>
<p>Analysis of
<italic>fimA</italic>
(XAC3241) mRNA stability.
<bold>a</bold>
The predicted secondary structure of the
<italic>fimA</italic>
5′ untranslated region was obtained using MFold software [
<xref ref-type="bibr" rid="CR32">32</xref>
]. The first codon, AUG, is shown in a red box.
<bold>b</bold>
Analysis of
<italic>fimA</italic>
mRNA abundance in the wild-type, ∆
<italic>hrpB</italic>
and complementation (∆
<italic>hrpB</italic>
-p53
<italic>hrpB</italic>
) strains was performed using RT-PCR. Analysis of the wild-type, ∆
<italic>hrpB</italic>
and complementation (∆
<italic>hrpB</italic>
-p53
<italic>hrpB</italic>
) strains that were grown in NB medium to OD 600 nm = 0.5 and then treated with 10 mg/mL ciprofloxacin before being harvested at several time points.
<italic>fimA</italic>
mRNA stability was then determined in the wild-type and ∆
<italic>hrpB</italic>
strains using RT-PCR. Total RNA was isolated, and 2 mg of RNA was used to synthesize the cDNA that was used for RT-PCR in 25 mL reactions. The reactions were subjected to PCR amplification for 22 cycles. Ten microliters of each reaction was resolved on a 1.5 % agarose gel. The stability of the
<italic>fimA</italic>
transcript was evaluated, and
<italic>gyrA</italic>
was used as the control to normalize the
<italic>fimA</italic>
amplification products</p>
</caption>
<graphic xlink:href="12866_2016_655_Fig8_HTML" id="MO8"></graphic>
</fig>
</p>
</sec>
<sec id="Sec9">
<title>Effects of
<italic>hrpB</italic>
on
<italic>fimA</italic>
transcript stability</title>
<p>Because the qRT-PCR analysis showed that there were lower levels of the transcripts of the
<italic>fimA</italic>
,
<italic>fimA2</italic>
and
<italic>pilB</italic>
genes in ∆
<italic>hrpB</italic>
cells that were grown in rich medium and on plant surfaces, we next analyzed the stability of the
<italic>fimA</italic>
(XAC3241) transcript in the wild-type and ∆
<italic>hrpB</italic>
strains. To measure the stability of the
<italic>fimA</italic>
mRNA in the wild-type and ∆
<italic>hrpB</italic>
strains, the abundance of the
<italic>fimA</italic>
transcript was analyzed using the
<italic>gyrA</italic>
transcript as a control in RT-PCR. Prior to the reactions, transcription was blocked by adding 10 μg/mL ciprofloxacin (Sigma, USA) to the
<italic>X. citri</italic>
cell cultures. The relative abundance of the
<italic>fimA</italic>
transcripts was estimated from the specific PCR products that were observed on the agarose gels in comparison to the abundance of the control. The data showed that there was a significant reduction in the abundance of the
<italic>fimA</italic>
mRNA after 10 and 15 min in ∆
<italic>hrpB</italic>
compared to the wild-type strain (Fig. 
<xref rid="Fig8" ref-type="fig">8b</xref>
). These results revealed that the
<italic>fimA</italic>
transcript may be more stable in wild-type
<italic>X. citri</italic>
strains than in the
<italic>hrpB</italic>
mutant. This reduced stability may contribute to the differences observed in
<italic>fimA</italic>
transcript levels between the ∆
<italic>hrpB</italic>
and the wild-type
<italic>X. citri</italic>
strains in the qRT-PCR experiments (Fig. 
<xref rid="Fig6" ref-type="fig">6</xref>
).</p>
</sec>
</sec>
<sec id="Sec10" sec-type="discussion">
<title>Discussion</title>
<p>Stable adhesion to an appropriate surface is the first step in biofilm formation [
<xref ref-type="bibr" rid="CR33">33</xref>
]. The ability of
<italic>X. citri</italic>
to form biofilms enhances the epiphytic persistence of this species on host leaves, which plays an important role in the early stages of infection [
<xref ref-type="bibr" rid="CR18">18</xref>
,
<xref ref-type="bibr" rid="CR21">21</xref>
]. The present study indicates that a putative DEAH-box ATP-dependent RNA helicase, HrpB, may perform many roles in
<italic>X. citri</italic>
because it is important for adherence to surfaces and motility and for the epiphytic survival of the bacteria on citrus leaves, which results in a reduction in the development of symptoms. The phenotype changes observed in ∆
<italic>hrpB</italic>
may be caused by the positive regulation of T4P genes, such as
<italic>fimA</italic>
(XAC3241), by the HrpB protein in wild-type
<italic>X. citri</italic>
. Our results show that the predicted HrpB protein in
<italic>X. citri</italic>
exhibits several characteristics that are considered typical for RNA helicases [
<xref ref-type="bibr" rid="CR2">2</xref>
,
<xref ref-type="bibr" rid="CR4">4</xref>
]. These include a DEAH-like helicase superfamily domain and the presence of an ATP-binding region (GAGKT) (Fig. 
<xref rid="Fig1" ref-type="fig">1</xref>
). Previous studies have suggested that DExD/H-box RNA helicases may be essential to these processes [
<xref ref-type="bibr" rid="CR34">34</xref>
]. The observed
<italic>hrpB</italic>
mutants may be caused by the presence of multiple DEAD-box RNA helicases in
<italic>X. citri</italic>
, such as Xac0293 and Xac0442. Interestingly, four DEAD-box helicases, SrmB, RhlE, CsdA, and RhlB, are present in
<italic>E.coli</italic>
, and RhlB, RhlE, and CsdA are interchangeable for certain functions [
<xref ref-type="bibr" rid="CR35">35</xref>
].</p>
<p>In plant-bacteria interactions, biofilm formation has been implicated in the virulence of several bacterial pathogens [
<xref ref-type="bibr" rid="CR36">36</xref>
], including
<italic>X. citri</italic>
[
<xref ref-type="bibr" rid="CR18">18</xref>
,
<xref ref-type="bibr" rid="CR21">21</xref>
,
<xref ref-type="bibr" rid="CR37">37</xref>
,
<xref ref-type="bibr" rid="CR38">38</xref>
]. Different genes have been found to be important for biofilm formation in
<italic>X. citri</italic>
[
<xref ref-type="bibr" rid="CR20">20</xref>
,
<xref ref-type="bibr" rid="CR21">21</xref>
,
<xref ref-type="bibr" rid="CR33">33</xref>
,
<xref ref-type="bibr" rid="CR38">38</xref>
<xref ref-type="bibr" rid="CR40">40</xref>
]. However, to the best of our knowledge,
<italic>hrpB</italic>
(XAC0293) has not been previously reported to play a role in biofilm formation in
<italic>Xanthomonas</italic>
. In
<italic>X. citri</italic>
, deletion of
<italic>hrpB</italic>
resulted in a decrease in cell adhesion and consequently less biofilm compared to a wild-type strain on both abiotic and biotic surfaces (Fig. 
<xref rid="Fig3" ref-type="fig">3</xref>
). The ∆
<italic>hrpB</italic>
mutant also showed a reduction in population on leaf surfaces when spray inoculated and a delay in canker development (Fig. 
<xref rid="Fig5" ref-type="fig">5</xref>
). Similar phenotypes were also observed in other
<italic>X. citri</italic>
mutants, including type 4 pilus mutants [
<xref ref-type="bibr" rid="CR18">18</xref>
,
<xref ref-type="bibr" rid="CR41">41</xref>
]. As expected, no difference was observed in symptoms when the
<italic>hrpB</italic>
mutant cells infiltrated into the host the leaves (Additional file 
<xref rid="MOESM1" ref-type="media">1</xref>
: Figure S1). Similar results were previously reported in
<italic>X. citri</italic>
T4P mutants, indicating that T4P plays an important role in the adherence and epiphytic stages of canker disease but not in the mesophyll stage, whereas other mechanisms, such as the type III secretion system, have been shown to be involved [
<xref ref-type="bibr" rid="CR26">26</xref>
]. The reduction in adhesion was also observed as a significant increase in sliding motility on a semisolid medium (Fig. 
<xref rid="Fig4" ref-type="fig">4</xref>
). The faster movement of the cells may be attributed to a lack of cell-to-cell aggregation. A similar phenotype was observed in
<italic>X. citri</italic>
when the hemagglutinin-like adhesins that are involved in cell-to-cell aggregation were mutated [
<xref ref-type="bibr" rid="CR33">33</xref>
]. In addition, it has been shown that in
<italic>X. citri</italic>
, sliding motility is inhibited by surface structures, such as T4P, possibly as a result of the increased interactions between the bacterial cells and the substrate [
<xref ref-type="bibr" rid="CR19">19</xref>
,
<xref ref-type="bibr" rid="CR21">21</xref>
,
<xref ref-type="bibr" rid="CR27">27</xref>
,
<xref ref-type="bibr" rid="CR41">41</xref>
]. Therefore,
<italic>fimA</italic>
(XAC3241) and
<italic>pilB</italic>
(XAC3239) mutants showed increased sliding motility and reduced biofilm formation [
<xref ref-type="bibr" rid="CR26">26</xref>
,
<xref ref-type="bibr" rid="CR27">27</xref>
]. Taken together, these results are in agreement with our data, in which we verified that
<italic>hrpB</italic>
mutation resulted in the repression of TP4 genes, a reduction in adhesion and an increase in movement (Fig. 
<xref rid="Fig6" ref-type="fig">6</xref>
).</p>
<p>RNA helicases participate in many aspects of RNA metabolism and have been shown to be involved in different phenotypes, including phenolic acid metabolism [
<xref ref-type="bibr" rid="CR42">42</xref>
], cold adaption [
<xref ref-type="bibr" rid="CR10">10</xref>
], auto-aggregation [
<xref ref-type="bibr" rid="CR11">11</xref>
], motility [
<xref ref-type="bibr" rid="CR30">30</xref>
] and biofilm formation [
<xref ref-type="bibr" rid="CR43">43</xref>
]. One of the main functions of DEAD/DEAH-box RNA helicases is the binding and remodeling of the secondary structures of RNA molecules. Our results show that the
<italic>fimA</italic>
5′ UTR contains three different loops in its structure. These loops could impair the initiation of translation in
<italic>X. citri</italic>
cells (Fig. 
<xref rid="Fig7" ref-type="fig">7</xref>
). Studies of mRNA regulation have shown that mRNA secondary structures in the 5′ UTR can dramatically influence the initiation of translation [
<xref ref-type="bibr" rid="CR44">44</xref>
]. Thus, the interaction between HrpB and
<italic>fimA</italic>
leader sequences may function by unwinding the secondary structure in the 5′ UTR of the mRNA to enable binding and scanning by the small ribosomal subunit to the start codon, AUG, resulting in an increase in the translation efficiency of this mRNA in
<italic>X. citri</italic>
cells. It has been shown in
<italic>Bacillus subtilis</italic>
that two cold-induced putative DEAD-box RNA helicases, CshA and CshB, destabilize the secondary structures in mRNA that prevent the initiation of translation so that the single-stranded mRNA can be successively bound by cold shock proteins to prevent refolding until translation is initiated at the ribosome [
<xref ref-type="bibr" rid="CR10">10</xref>
]. Similarly, in
<italic>E. coli</italic>
, a DEAH-box RNA helicase that is involved in the processing of the mRNA of a fimbrial operon is required to alter the RNA structure element that is upstream of the processing site, which consequently increases the stability and translation of the fimbrial transcript [
<xref ref-type="bibr" rid="CR13">13</xref>
]. These results suggest that the degree to which translation is inhibited in the
<italic>hrpB</italic>
mutant was correlated with the 5′ UTR secondary structure of the
<italic>fimA</italic>
mRNA.</p>
<p>Translational repression often leads to the rapid decay of mRNA [
<xref ref-type="bibr" rid="CR45">45</xref>
]. When the translation of mRNA is inhibited, transcripts are generally more susceptible to degradation by RNase E [
<xref ref-type="bibr" rid="CR46">46</xref>
]. Consistent with these findings, an assay used to assess
<italic>fimA</italic>
stability revealed that the mRNA of ∆
<italic>hrpB</italic>
was less stable than that of the wild- type (Fig. 
<xref rid="Fig8" ref-type="fig">8</xref>
), which would account for the reduced steady-state levels of the mRNA. These data were then reinforced by our qRT-PCR data. These findings allowed us to speculate about different possibilities that might explain
<italic>fimA</italic>
mRNA decay observed in the mutant. Our first hypothesis was that HrpB may unwind the loops in the 5′ UTR of the
<italic>fimA</italic>
mRNA to enable ribosomal binding, which protects the mRNA against decay. Previous studies have indicated that ribosome binding to a ribosome-binding site (RBS) assists in protecting mRNAs from attack by ribonucleases [
<xref ref-type="bibr" rid="CR44">44</xref>
,
<xref ref-type="bibr" rid="CR46">46</xref>
]. This notion is supported by studies that have examined the influence of RBS mutations on RNA decay [
<xref ref-type="bibr" rid="CR47">47</xref>
]. For example, experiments in both
<italic>E. coli</italic>
and
<italic>B. subtilis</italic>
have shown that a variety of mRNAs can be significantly destabilized by mutations in the Shine-Dalgarno element that interfere with ribosome binding by markedly reducing complementarity to 16S rRNA [
<xref ref-type="bibr" rid="CR46">46</xref>
,
<xref ref-type="bibr" rid="CR48">48</xref>
]. Conversely, mutations that improve ribosome binding can prolong mRNA longevity [
<xref ref-type="bibr" rid="CR49">49</xref>
]. Furthermore, a second possibility that may explain the reduced abundance of transcripts in ∆
<italic>hrpB</italic>
would be that HrpB is associated with the recruitment of other regulatory factors. In studies of other DExD/H RNA helicases, it has been proposed that when one of these factors binds to a 5′UTR, it may modulate its activity physically to recruit a complex of proteins, which could potentially defend the 5′mRNA against decay [
<xref ref-type="bibr" rid="CR1">1</xref>
,
<xref ref-type="bibr" rid="CR13">13</xref>
]. However, to fully understand the role of HrpB in
<italic>fimA</italic>
mRNA stability, the factors that interact with this putative ATP-dependent RNA helicase need be identified and characterized. The third hypothesis involves the affinity of some ribonucleases to double-stranded RNA. Double-stranded RNAs are targeted by specific ribonucleases, such as RNAse III [
<xref ref-type="bibr" rid="CR49">49</xref>
]. If HrpB destabilizes the loops in the 5′UTR of the
<italic>fimA</italic>
mRNA, the putative ribonuclease would not be able to bind to its target, and HrpB could thereby prevent the degradation of the mRNA.</p>
<p>The ATP-dependent RNA helicase HrpB appears to positively regulate the
<italic>fimA</italic>
mRNA in addition to other genes in the same operon that are involved in adherence, biofilm formation, motility and the development of citrus canker disease. Further biochemical studies are required to determine the mechanisms involving the HrpB protein in this process. To the best of our knowledge, this is the first time that a DEAH-box RNA helicase has been implicated in the regulation of type IV pili genes in
<italic>Xanthomonas</italic>
and the first time that a RNA helicase has been shown to be important for motility, biofilm formation and epiphytical survival.</p>
</sec>
<sec id="Sec11" sec-type="conclusion">
<title>Conclusions</title>
<p>In this work, we characterized the
<italic>hrpB</italic>
gene, which encodes an ATP-dependent RNA helicase, in
<italic>X. citri.</italic>
We demonstrate that the HrpB protein in
<italic>X. citri</italic>
is involved in biofilm formation, motility and survival on leaf tissues. Quantitative reverse transcription-PCR assays indicated that deletion of
<italic>hrpB</italic>
reduced the expression of three IV pili genes, including
<italic>fimA</italic>
. The
<italic>fimA</italic>
mRNA predicted structure indicated that the
<italic>fimA</italic>
5′ UTR may contain three different loops. The ATP-dependent RNA helicase HrpB appears to positively regulate the abundance of the mRNA of
<italic>fimA</italic>
by promoting the stability of the
<italic>fimA</italic>
RNA.</p>
</sec>
<sec id="Sec12" sec-type="materials|methods">
<title>Methods</title>
<sec id="Sec13">
<title>Bacterial strains and growth conditions</title>
<p>The bacterial strains and plasmids used in this study are listed in Table 
<xref rid="Tab2" ref-type="table">2</xref>
.
<italic>E. coli</italic>
DH5α cells were grown at 37 °C in Luria-Bertani (LB) medium (1 (w/v) tryptone, 0.5 (w/v) yeast extract, and 1 % (w/v) sodium chloride, pH 7.5) shaking at 200 rpm or on plates.
<italic>X. citri</italic>
wild-type (ampicillin-resistant) [
<xref ref-type="bibr" rid="CR25">25</xref>
] and mutant strains were grown at 28 °C in nutrient broth (NB; Difco, Detroit, MI) shaking at 200 rpm or on nutrient agar (NA; Difco, Detroit, MI) plates. When required, antibiotics were added at the following concentrations: ampicillin (Ap) 100 μg/mL and gentamycin (Gm) 5 μg/mL.
<table-wrap id="Tab2">
<label>Table 2</label>
<caption>
<p>Strains and plasmids used in this study</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Strains and plasmids</th>
<th>Characteristics</th>
<th>Reference or source</th>
</tr>
</thead>
<tbody>
<tr>
<td colspan="3">Strains</td>
</tr>
<tr>
<td>
<italic>Escherichia coli</italic>
</td>
<td></td>
<td>[
<xref ref-type="bibr" rid="CR50">50</xref>
]</td>
</tr>
<tr>
<td>DH5α</td>
<td>F-
<italic>recA</italic>
1
<italic> endA</italic>
1
<italic>hsdR</italic>
17
<italic>supE</italic>
44 thi-1
<italic>gyrA</italic>
96 real1 ∆ (
<italic>argE</italic>
-
<italic>lacZ</italic>
YA) 169 Ø lazA ∆ M15</td>
<td>Promega</td>
</tr>
<tr>
<td colspan="3">
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
</td>
</tr>
<tr>
<td>306</td>
<td>Syn.
<italic>X. axonopodis</italic>
pv.
<italic>citri</italic>
strain 306; wild-type, Rf
<sup>r</sup>
, Ap
<sup>r</sup>
</td>
<td>[
<xref ref-type="bibr" rid="CR25">25</xref>
,
<xref ref-type="bibr" rid="CR51">51</xref>
]</td>
</tr>
<tr>
<td>
<italic>hrpB</italic>
(
<italic>hrpB</italic>
-)</td>
<td>
<italic>hrpB</italic>
(XAC0293): pNPTS138 derivative</td>
<td>This study</td>
</tr>
<tr>
<td>
<italic>hrpB</italic>
-p53
<italic>hrpB</italic>
(
<italic>hrpB</italic>
+)</td>
<td>
<italic>hrpB</italic>
(XAC0293) contained in pUFR053, Gm
<sup>r</sup>
</td>
<td>This study</td>
</tr>
<tr>
<td colspan="3">Plasmids</td>
</tr>
<tr>
<td>pGEM T-Easy</td>
<td>PCR cloning and sequencing vector,
<italic>lacZ</italic>
, Ap
<sup>r</sup>
</td>
<td>Promega</td>
</tr>
<tr>
<td>pNPTS138</td>
<td>Km
<sup>r</sup>
,
<italic>sacB</italic>
,
<italic>lacZ</italic>
α
<sup>+</sup>
</td>
<td>M. R. Alley, unpublished</td>
</tr>
<tr>
<td>pUFR053</td>
<td>IncW Mob
<sup>+</sup>
<italic>mob</italic>
(P)
<italic>lacZ</italic>
α
<sup>+</sup>
Par+, Cm
<sup>r</sup>
, Gm
<sup>r</sup>
, Km
<sup>r</sup>
, shuttle vector</td>
<td>[
<xref ref-type="bibr" rid="CR52">52</xref>
]</td>
</tr>
<tr>
<td>pNPTS_
<italic>hrpB</italic>
</td>
<td>
<italic>hrpB</italic>
(XAC0293) gene cloning on pNPTS138</td>
<td>This study</td>
</tr>
<tr>
<td>p53_
<italic>hrpB</italic>
</td>
<td>
<italic>hrpB</italic>
(XAC0293) gene cloning on pUFR053</td>
<td>This study</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<p>Ap
<sup>r</sup>
, Cm
<sup>r</sup>
, Gm
<sup>r</sup>
, Km
<sup>r</sup>
, and Rf
<sup>r</sup>
indicate resistance to ampicillin, chloromycetin, gentamicin, kanamycin and rifamycin, respectively</p>
</table-wrap-foot>
</table-wrap>
</p>
</sec>
<sec id="Sec14">
<title>DNA manipulations</title>
<p>Bacterial genomic DNA and plasmid DNA were extracted using a Wizard genomic DNA purification kit and a Wizard miniprep DNA purification system according to the manufacturer’s instructions (Promega, Madison, WI, USA). The concentration and purity of the DNA were determined using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). PCR was performed using standard procedures [
<xref ref-type="bibr" rid="CR53">53</xref>
] with Pfu DNA polymerase (Promega Corporation, Madison, WI). The restriction digestions and DNA ligations were performed according to the manufacturer’s instructions (New England Biolabs, USA).</p>
</sec>
<sec id="Sec15">
<title>Construction of the
<italic>hrpB</italic>
deletion mutant and the complemented strain of
<italic>X. citri</italic>
</title>
<p>To construct the
<italic>hrpB</italic>
deletion mutant, approximately 1 kb of the upstream and downstream regions of the
<italic>hrpB</italic>
gene (XAC0293) was amplified using PCR from genomic DNA obtained from
<italic>X. citri</italic>
strain 306 using the following primer pairs: 0293mF1Hind (5′ CGTGTTCACCGAGGACAGTGGCCTG 3′) and 0293mR1Bam (5′ ATAAGGATCCAAAAGCGGGGTCGGTCATGC 3′); and 0293F2Bam (5′ CTATGGATCCGGCACCTGAAACACATGGACC 3′) and 0293mR2Hind (5′ GAATAAGCTTTGCTGCCGGTGGTGGATTGTG 3′), respectively. The PCR products were digested with
<italic>Bam</italic>
H1, and both fragments were ligated to produce a deletion construct. The resulting fragment was cloned into the pNPTS138 suicide vector (M. R. Alley, unpublished) to generate pNPTS_
<italic>hrpB</italic>
(Table 
<xref rid="Tab2" ref-type="table">2</xref>
) using the restriction enzymes
<italic>Eco</italic>
R1 and
<italic>Hin</italic>
dIII. The plasmids were introduced into
<italic>E. coli</italic>
by heat-shock at 42 °C according to standard procedures [
<xref ref-type="bibr" rid="CR53">53</xref>
] and into
<italic>X. citri</italic>
by electroporation [
<xref ref-type="bibr" rid="CR54">54</xref>
]. The wild-type copy was replaced with the deleted version after two recombination events as previously described [
<xref ref-type="bibr" rid="CR55">55</xref>
]. All of the obtained clones were confirmed using PCR.</p>
<p>To complement the
<italic>hrpB</italic>
knockout mutant, a 2800bp DNA fragment containing the entire
<italic>hrpB</italic>
gene plus approximately 300 bp of neighboring region was amplified by PCR using total DNA obtained from the
<italic>X. citri</italic>
wild-type strain 306 as the template and the specific primer pair 0293_p53_F (5′AGGAAAAACATATGGGTACCTTTCCGATCTCCCCGTTATTGCC 3′) and 0293_p53_R (5′AGGAAGGATCCTGCGGTACCGGTGCCACGTGGTTTTGCTCTGT 3′). The amplified DNA fragment was cloned into pUFR053 [
<xref ref-type="bibr" rid="CR52">52</xref>
] at the
<italic>Kpn</italic>
I restriction site to obtain the recombinant plasmid p53_hrpB (Table 
<xref rid="Tab2" ref-type="table">2</xref>
), which was used for genetic complementation. The construction was confirmed using sequencing. The recombinant plasmid p53_
<italic>hrpB</italic>
was transferred into ∆
<italic>hrpB</italic>
using electroporation, and cells were selected on NA using gentamicin, resulting in the strain ∆
<italic>hrpB</italic>
-p53
<italic>hrpB</italic>
(
<italic>hrpB</italic>
+) (Table 
<xref rid="Tab2" ref-type="table">2</xref>
).</p>
</sec>
<sec id="Sec16">
<title>Biofilm formation assays</title>
<p>Biofilms that formed on polystyrene and glass surfaces were examined as previously described [
<xref ref-type="bibr" rid="CR56">56</xref>
], with modifications. After 24, 48 and 72 h of incubation, optical density was measured at 590 nm, and the data were normalized at an OD of 600 nm. Quantitative measurements of 24 replicates were performed for each
<italic>X. citri</italic>
evaluated strain. Assays of biofilm formation on leaf surfaces were performed as previously described [
<xref ref-type="bibr" rid="CR22">22</xref>
]. Briefly, a 20 μL volume of each bacterial suspension (10
<sup>8</sup>
 CFU/mL) was incubated on the abaxial surface of Valencia sweet orange leaves, which were maintained at 28 °C in a humidified chamber. At 24, 48 and 72 h after the start of incubation, biofilm formation was visualized on the leaf surfaces using crystal violet staining. Leaf discs from staining spots were excised, dissolved in 1 mL ethanol:acetone (70:30, v/v) and quantified by measuring the optical density at 590 nm. Data from both experiments were statistically analyzed using one-way analysis of variance (ANOVA) (
<italic>p</italic>
 < 0.05), and values are expressed as the means ± standard deviations.</p>
</sec>
<sec id="Sec17">
<title>Motility assays</title>
<p>To test cell motility, bacteria were grown overnight in NB medium. A 3 μL volume of bacterial cultures with OD 600 = 0.3 was then spotted onto the surface of a plate containing SB medium plus 0.5 % (wt/vol) agar (Difco, Franklin Lakes, NJ) [
<xref ref-type="bibr" rid="CR27">27</xref>
] for the sliding motility tests or NYGB medium 0.25 % (wt/vol) agar [
<xref ref-type="bibr" rid="CR19">19</xref>
] for the swimming motility tests. Plates were incubated at 28 °C for 48 h. The diameters of the circular halos that were occupied by the strains were measured, and the resulting values were taken to indicate the motility of
<italic>X. citri</italic>
strains. The experiments were repeated three times with three replicates each time. The diameter measurements were statistically analyzed using one-way analysis of variance (ANOVA) (
<italic>p</italic>
 < 0.05), and the values are expressed as the means ± standard deviations of three independent experiments.</p>
</sec>
<sec id="Sec18">
<title>Pathogenicity assays</title>
<p>Pathogenicity assays were performed as previously described [
<xref ref-type="bibr" rid="CR39">39</xref>
]. Briefly, fully expanded, immature leaves were obtained from young (approximately 10-week-old) sweet orange (
<italic>Citrus sinensis</italic>
cv. Valencia) plants that were prepared in a quarantined greenhouse at the Citrus Research and Education Center (Lake Alfred, FL).
<italic>X. citri</italic>
strains (
<italic>X. citri</italic>
306 wild-type, Δ
<italic>hrpB</italic>
and ∆
<italic>hrpB</italic>
-p53
<italic>hrpB</italic>
) that were grown in selective antibiotic NB medium overnight at 28 °C were centrifuged at 4800 rpm and then resuspended in 1 % phosphate buffer (pH 7.0). Bacterial suspensions from each strain were inoculated by pressure infiltration (10
<sup>5</sup>
 CFU/ml) and spraying (10
<sup>8</sup>
 CFU/mL). Phosphate buffer was used as the control in non-infected plants. All plant inoculations involved a minimum of three immature leaves from each plant, and three plants were inoculated for each bacterial strain. The plants were kept in a greenhouse at the Citrus Research and Educational Center (Lake Alfred, FL, USA) at a temperature of 28 ± 4 °C in high humidity for 21 days. Disease symptoms were photographed at 7, 14 and 21 days post-inoculation, and both tests were independently repeated two times.</p>
</sec>
<sec id="Sec19">
<title>Epiphytic growth on citrus leaves</title>
<p>To obtain measurements to analyze bacterial epiphytic survival, populations of the pathogen were isolated from the leaves that were inoculated by spraying as described above. At 0, 7, 14 and 21 days post-inoculation, three leaves with similar sizes were randomly collected from three different plants. The leaves were immersed in 10 mL of 1 % phosphate buffer in Falcon flasks (50 mL). Bacterial cells were collected and then vortexed for three minutes to homogenize the tissue. Epiphytic bacterial numbers were determined in serial dilutions of these suspension and then plated on NA medium with the appropriate antibiotics. Colonies were counted after 2 days of incubation at 28 °C. The assays were independently repeated two times with three replicates.</p>
</sec>
<sec id="Sec20">
<title>RNA extraction and quantitative reverse-transcription polymerase chain reaction (qRT-PCR)</title>
<p>To quantitatively analyze gene expression, we used RNA obtained from
<italic>X. citri</italic>
wild-type and
<italic>hrpB</italic>
mutant (Δ
<italic>hrpB</italic>
) strains using two methods: NB medium and the leaves of sweet orange plants that were inoculated by spraying. For the experiments performed using NB medium, the strains were grown in 10 mL of NB at 28 °C while shaking, and both bacterial cultures were collected in the middle exponential stage (OD = 0.8). RNA was immediately stabilized by mixing it with 2 volumes of RNA-protecting bacterial reagent (Qiagen, CA, USA. It was then incubated at room temperature for 5 min. Bacterial cells were centrifuged at 5,000 × g for 10 min, and the cell pellets were then treated with lysozyme. RNA extraction was then performed using an RNeasy minikit (Qiagen, Valencia, CA). For the epiphytical assays, 3 different plants were inoculated with each strain at 10
<sup>8</sup>
 CFU/mL. At different timepoints after infection (1, 3 and 7 days after inoculation), three leaves were collected from each plant to perform RNA extraction using a RNase plant mini kit (Qiagen, CA, USA). Contaminated genomic DNA was removed from the RNA during both experiments by processing the preparation using a TURBO DNA-free kit (Ambion, TX, USA), and RNA purity and quantity was determined using a ND-8000 Nanodrop spectrophotometer (NanoDrop Technologies, U.S.A.). For qRT-PCR assays, 4 genes in the T4P system (XAC3241, XAC3240, XAC3239 and XAC2924) were chosen for gene expression analyses using the primers shown in Table 
<xref rid="Tab3" ref-type="table">3</xref>
. Reverse transcription was performed using an iScript cDNA Synthesis kit (Bio-Rad) according to the manufacturer’s protocol. Quantitative amplification of the resulting cDNA (1 μg) was performed using 0.3 mM of each primer (Table 
<xref rid="Tab3" ref-type="table">3</xref>
) and SYBR Green/ROX qPCR Master Mix (Qiagen) according to the kit instructions in an ABI7300 Real-Time System (Applied Biosystems). Relative expression was evaluated using the 2
<sup>–∆∆CT</sup>
method.
<italic>gyrA</italic>
was used as the endogenous control. Both types of quantitative real-time PCR experiments were performed using three biological replicates.
<table-wrap id="Tab3">
<label>Table 3</label>
<caption>
<p>Primers used for qRT-PCR</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Genes</th>
<th>Sequences</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="2">
<italic>gyrA</italic>
(XAC1631)</td>
<td>F, GCCTACATTTTGACGGCCAC</td>
</tr>
<tr>
<td>R, ACCGACGAAGTGCTGTTGAT</td>
</tr>
<tr>
<td rowspan="2">
<italic>fimA</italic>
(XAC3241)</td>
<td>F, GAAGCAACAGGGTTTCACGC</td>
</tr>
<tr>
<td>R, TATGTTGCCAAGTCGCAGGT</td>
</tr>
<tr>
<td rowspan="2">
<italic>fimA2</italic>
(XAC3240)</td>
<td>F, TAGCAGTCGCAGTCAAACCA</td>
</tr>
<tr>
<td>R, TTGCGGGATCGCTATGGAAG</td>
</tr>
<tr>
<td rowspan="2">
<italic>pilB</italic>
(XAC3239)</td>
<td>F, ATTGCTGGCCGAAGGATTCA</td>
</tr>
<tr>
<td>R, TAATGCCGATGACCGACGAG</td>
</tr>
<tr>
<td rowspan="2">
<italic>pilT</italic>
(XAC2924)</td>
<td>F, GAATTCCTCGTAATCGCGCC</td>
</tr>
<tr>
<td>R, CAGGTCCGATGCCTTGTTCT</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
<sec id="Sec21">
<title>5′ - RACE</title>
<p>The transcriptional start site of
<italic>fimA</italic>
(XAC3241) was determined using a 3′/5′ RACE Kit (Roche) according to the manufacturer’s instructions. Briefly, total RNA was obtained from
<italic>X. citri</italic>
wild-type cell cultures that were grown in NB medium to an OD 600 of 1.0. After treating the RNA using a TURBO DNA-free kit (Ambion, TX, USA), the RNA was reverse-transcribed using a gene-specific primer (SP1, Table 
<xref rid="Tab4" ref-type="table">4</xref>
) and then purified before a poly(dA) tail was added to its 3′ end in a reaction with a terminal transferase enzyme. The resulting cDNA was amplified using PCR with the poly-dT primer that was provided in the kit, which anneals at the poly(dA) tail, and a gene-specific primer (SP2, Table 
<xref rid="Tab4" ref-type="table">4</xref>
) that was complementary to a region upstream of the original cDNA primer. The amplicons obtained from the first PCR were submitted to a second-round PCR reaction using the poly dT primer and a distinct gene-specific nested primer (SP3, Table 
<xref rid="Tab4" ref-type="table">4</xref>
) that was internal to the first primer. The PCR products were ligated into the pGEM-T vector (Promega), and three distinct clones were sequenced.
<table-wrap id="Tab4">
<label>Table 4</label>
<caption>
<p>Primers used for 5′- RACE</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Primers</th>
<th>Sequences</th>
</tr>
</thead>
<tbody>
<tr>
<td>SP1</td>
<td>CATAGTTCTGATACTGGGGCAGC</td>
</tr>
<tr>
<td>SP2</td>
<td>GGCCAGACCAGCAGTGACCTG</td>
</tr>
<tr>
<td>SP3</td>
<td>TCGTATTGCGTTTTACCCGG</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
<sec id="Sec22">
<title>mRNA stability assay</title>
<p>Bacterial cultures of
<italic>X. citri</italic>
subsp.
<italic>citri</italic>
wild-type, ∆
<italic>hrpB</italic>
and the complementation strain (Δ
<italic>hrpB-</italic>
p53
<italic>hrpB)</italic>
were grown at 28 °C in NB medium to an OD 600 nm of 0.5 and then treated with ciprofloxacin at a final concentration of 10 mg/ml to inhibit transcription. Samples were collected at 0, 5, 10 and 15 min after treatment with ciprofloxacin. The cells were harvested by centrifugation at 5,000 rpm and used immediately to extract RNA using a RNeasy Mini kit (Qiagen, CA, U.S.A.). Total RNA samples were treated with Turbo RNase-free DNase (Ambion) and quantified using a Nanodrop. A total of 2 μg of treated RNA was used for reverse transcription using an iScript cDNA Synthesis kit (Bio-Rad) according to the manufacturer’s protocol. Reactions were subjected to PCR amplification for 22 cycles using 0.3 mM of each of two primers,
<italic>fimA</italic>
F (5′ GAAGCAACAGGGTTTCACGC 3′) and
<italic>fimA</italic>
R (5′TATGTTGCCAAGTCGCAGG 3′), and
<italic>Taq</italic>
2x Master Mix (Biolabs). Ten microliters of each reaction was resolved in a 1.5 % agarose gel. Analyses of
<italic>gyrA</italic>
were performed and used as the controls for normalizing the
<italic>fimA</italic>
amplified products.</p>
</sec>
</sec>
</body>
<back>
<app-group>
<app id="App1">
<sec id="Sec23">
<title>Additional file</title>
<p>
<media position="anchor" xlink:href="12866_2016_655_MOESM1_ESM.png" id="MOESM1">
<label>Additional file 1: Figure S1.</label>
<caption>
<p>Pathogenicity assay of
<italic>X. citri</italic>
subsp.
<italic>citri</italic>
strains in planta. Symptoms were analyzed on the lower the surfaces of sweet orange leaves at 21 days post-inoculation (d.p.i.) of wild-type, ∆
<italic>hrpB</italic>
and a complementary strain of
<italic>X. citri</italic>
that were inoculated on the sweet orange leaves by infiltration the leaves with bacteria at a concentration of 10
<sup>5</sup>
 CFU/mL. Abbreviations: wt-p53, wild-type strain 306 with empty vector pUFR053; ∆
<italic>hrpB</italic>
,
<italic>hrpB</italic>
mutant; and ∆
<italic>hrpB</italic>
-p53
<italic>hrpB</italic>
, complemented
<italic>hrpB</italic>
mutant. (PNG 1241 kb)</p>
</caption>
</media>
</p>
</sec>
</app>
</app-group>
<fn-group>
<fn>
<p>
<bold>Competing interests</bold>
</p>
<p>The authors declare that they have no competing interests.</p>
</fn>
<fn>
<p>
<bold>Authors’ contributions</bold>
</p>
<p>AAS, MAT, SCP and MAM conceived the project. LMG, MAO and SCP designed and performed the experiments. LMG, MAO, AAS, MAT and NW analyzed the data and wrote the paper. All authors read and approved the final manuscript.</p>
</fn>
</fn-group>
<ack>
<title>Acknowledgements</title>
<p>This work has been supported by INCT Citrus and a CAPES/PSDE fellowship (99999.002657/2014–07). LMG is a CAPES PhD fellow. MAM and AAS are recipients of research fellowships from CNPq.</p>
</ack>
<ref-list id="Bib1">
<title>References</title>
<ref id="CR1">
<label>1.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Silverman</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Edwalds-Gilbert</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>RJ</given-names>
</name>
</person-group>
<article-title>DExD/H-box proteins and their partners: helping RNA helicases unwind</article-title>
<source>Gene</source>
<year>2003</year>
<volume>312</volume>
<fpage>1</fpage>
<lpage>16</lpage>
<pub-id pub-id-type="doi">10.1016/S0378-1119(03)00626-7</pub-id>
<pub-id pub-id-type="pmid">12909336</pub-id>
</element-citation>
</ref>
<ref id="CR2">
<label>2.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cordin</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Banroques</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Tanner</surname>
<given-names>NK</given-names>
</name>
<name>
<surname>Linder</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>The DEAD-box protein family of RNA helicases</article-title>
<source>Gene</source>
<year>2006</year>
<volume>367</volume>
<fpage>17</fpage>
<lpage>37</lpage>
<pub-id pub-id-type="doi">10.1016/j.gene.2005.10.019</pub-id>
<pub-id pub-id-type="pmid">16337753</pub-id>
</element-citation>
</ref>
<ref id="CR3">
<label>3.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tanner</surname>
<given-names>NK</given-names>
</name>
<name>
<surname>Linder</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>DExD/H box RNA helicases: from generic motors to specific dissociation functions</article-title>
<source>Mol Cell</source>
<year>2001</year>
<volume>8</volume>
<fpage>251</fpage>
<lpage>262</lpage>
<pub-id pub-id-type="doi">10.1016/S1097-2765(01)00329-X</pub-id>
<pub-id pub-id-type="pmid">11545728</pub-id>
</element-citation>
</ref>
<ref id="CR4">
<label>4.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Caruthers</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>McKay</surname>
<given-names>DB</given-names>
</name>
</person-group>
<article-title>Helicase structure and mechanism</article-title>
<source>Curr Opin Struct Biol</source>
<year>2002</year>
<volume>12</volume>
<fpage>123</fpage>
<lpage>133</lpage>
<pub-id pub-id-type="doi">10.1016/S0959-440X(02)00298-1</pub-id>
<pub-id pub-id-type="pmid">11839499</pub-id>
</element-citation>
</ref>
<ref id="CR5">
<label>5.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rocak</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Linder</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>DEAD-box proteins: the driving forces behind RNA metabolism</article-title>
<source>Nat Rev Mol Cell Biol</source>
<year>2004</year>
<volume>5</volume>
<issue>March</issue>
<fpage>232</fpage>
<lpage>241</lpage>
<pub-id pub-id-type="doi">10.1038/nrm1335</pub-id>
<pub-id pub-id-type="pmid">14991003</pub-id>
</element-citation>
</ref>
<ref id="CR6">
<label>6.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oun</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Redder</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Didier</surname>
<given-names>J</given-names>
</name>
<name>
<surname>François</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Corvaglia</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Buttazzoni</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Giraud</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Girard</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Schrenzel</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Linder</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>The CshA DEAD-box RNA helicase is important for quorum sensing control in
<italic>Staphylococcus aureus</italic>
</article-title>
<source>RNA Biol</source>
<year>2013</year>
<volume>10</volume>
<issue>1</issue>
<fpage>157</fpage>
<lpage>165</lpage>
<pub-id pub-id-type="doi">10.4161/rna.22899</pub-id>
<pub-id pub-id-type="pmid">23229022</pub-id>
</element-citation>
</ref>
<ref id="CR7">
<label>7.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gong</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Dong</surname>
<given-names>C-H</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Stevenson</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>J-K</given-names>
</name>
</person-group>
<article-title>A DEAD box RNA helicase is essential for mRNA export and important for development and stress responses in Arabidopsis</article-title>
<source>Plant Cell</source>
<year>2005</year>
<volume>17</volume>
<issue>January</issue>
<fpage>256</fpage>
<lpage>267</lpage>
<pub-id pub-id-type="doi">10.1105/tpc.104.027557</pub-id>
<pub-id pub-id-type="pmid">15598798</pub-id>
</element-citation>
</ref>
<ref id="CR8">
<label>8.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaberdin</surname>
<given-names>VR</given-names>
</name>
<name>
<surname>Bläsi</surname>
<given-names>U</given-names>
</name>
</person-group>
<article-title>Bacterial helicases in post-transcriptional control</article-title>
<source>Biochim Biophys Acta - Gene Regul Mech</source>
<year>1829</year>
<volume>2013</volume>
<fpage>878</fpage>
<lpage>883</lpage>
</element-citation>
</ref>
<ref id="CR9">
<label>9.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Linder</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Jankowsky</surname>
<given-names>E</given-names>
</name>
</person-group>
<article-title>From unwinding to clamping - the DEAD box RNA helicase family</article-title>
<source>Nat Rev Mol Cell Biol</source>
<year>2011</year>
<volume>12</volume>
<fpage>505</fpage>
<lpage>516</lpage>
<pub-id pub-id-type="doi">10.1038/nrm3154</pub-id>
<pub-id pub-id-type="pmid">21779027</pub-id>
</element-citation>
</ref>
<ref id="CR10">
<label>10.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hunger</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Beckering</surname>
<given-names>CL</given-names>
</name>
<name>
<surname>Wiegeshoff</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Graumann</surname>
<given-names>PL</given-names>
</name>
<name>
<surname>Marahiel</surname>
<given-names>MA</given-names>
</name>
</person-group>
<article-title>Cold-induced putative DEAD box RNA helicases CshA and CshB are essential for cold adaptation and interact with cold shock protein B in
<italic>Bacillus subtilis</italic>
</article-title>
<source>J Bacteriol</source>
<year>2006</year>
<volume>188</volume>
<fpage>240</fpage>
<lpage>248</lpage>
<pub-id pub-id-type="doi">10.1128/JB.188.1.240-248.2006</pub-id>
<pub-id pub-id-type="pmid">16352840</pub-id>
</element-citation>
</ref>
<ref id="CR11">
<label>11.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roos</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Lindgren</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Jonsson</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Autoaggregation of
<italic>Lactobacillus reuteri</italic>
is mediated by a putative DEAD-box helicase</article-title>
<source>Mol Microbiol</source>
<year>1999</year>
<volume>32</volume>
<fpage>427</fpage>
<lpage>436</lpage>
<pub-id pub-id-type="doi">10.1046/j.1365-2958.1999.01363.x</pub-id>
<pub-id pub-id-type="pmid">10231497</pub-id>
</element-citation>
</ref>
<ref id="CR12">
<label>12.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Markkula</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Mattila</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Lindström</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Korkeala</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Genes encoding putative DEAD-box RNA helicases in
<italic>Listeria monocytogenes</italic>
EGD-e are needed for growth and motility at 3 °C</article-title>
<source>Environ Microbiol</source>
<year>2012</year>
<volume>14</volume>
<fpage>2223</fpage>
<lpage>32</lpage>
<pub-id pub-id-type="doi">10.1111/j.1462-2920.2012.02761.x</pub-id>
<pub-id pub-id-type="pmid">22564273</pub-id>
</element-citation>
</ref>
<ref id="CR13">
<label>13.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koo</surname>
<given-names>JT</given-names>
</name>
<name>
<surname>Choe</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Moseley</surname>
<given-names>SL</given-names>
</name>
</person-group>
<article-title>HrpA, a DEAH-box RNA helicase, is involved in mRNA processing of a fimbrial operon in
<italic>Escherichia coli</italic>
</article-title>
<source>Mol Microbiol</source>
<year>2004</year>
<volume>52</volume>
<fpage>1813</fpage>
<lpage>1826</lpage>
<pub-id pub-id-type="doi">10.1111/j.1365-2958.2004.04099.x</pub-id>
<pub-id pub-id-type="pmid">15186427</pub-id>
</element-citation>
</ref>
<ref id="CR14">
<label>14.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Butland</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Peregrin-Alvarez</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>W</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>X</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Interaction network containing conserved and essential protein complexes in
<italic>Escherichia coli</italic>
</article-title>
<source>Nature</source>
<year>2005</year>
<volume>433</volume>
<issue>February</issue>
<fpage>531</fpage>
<lpage>37</lpage>
<pub-id pub-id-type="doi">10.1038/nature03239</pub-id>
<pub-id pub-id-type="pmid">15690043</pub-id>
</element-citation>
</ref>
<ref id="CR15">
<label>15.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salman-Dilgimen</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Hardy</surname>
<given-names>PO</given-names>
</name>
<name>
<surname>Dresser</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Chaconas</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>HrpA, a DEAH-Box RNA helicase, is involved in global gene regulation in the Lyme disease spirochete</article-title>
<source>PLoS One</source>
<year>2011</year>
<volume>6</volume>
<fpage>e22168</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0022168</pub-id>
<pub-id pub-id-type="pmid">21814569</pub-id>
</element-citation>
</ref>
<ref id="CR16">
<label>16.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gottwald</surname>
<given-names>TR</given-names>
</name>
<name>
<surname>Pierce</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Graham</surname>
<given-names>JH</given-names>
</name>
</person-group>
<article-title>Citrus canker: the pathogen and its impact plant health progress plant health progress</article-title>
<source>Plant Heal Prog</source>
<year>2002</year>
<volume>1993</volume>
<fpage>August</fpage>
</element-citation>
</ref>
<ref id="CR17">
<label>17.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Graham</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Gottwal</surname>
<given-names>TR</given-names>
</name>
<name>
<surname>Cubero</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Achor</surname>
<given-names>DS</given-names>
</name>
</person-group>
<article-title>
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
 : factors affecting successful eradication of citrus canker</article-title>
<source>Mol Plant Pathol</source>
<year>2004</year>
<volume>5</volume>
<fpage>1</fpage>
<lpage>15</lpage>
<pub-id pub-id-type="doi">10.1046/j.1364-3703.2004.00197.x</pub-id>
<pub-id pub-id-type="pmid">20565577</pub-id>
</element-citation>
</ref>
<ref id="CR18">
<label>18.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rigano</surname>
<given-names>LA</given-names>
</name>
<name>
<surname>Siciliano</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Enrique</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Sendín</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Filippone</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Torres</surname>
<given-names>PS</given-names>
</name>
<name>
<surname>Qüesta</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Dow</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Castagnaro</surname>
<given-names>AP</given-names>
</name>
<name>
<surname>Vojnov</surname>
<given-names>AA</given-names>
</name>
<name>
<surname>Marano</surname>
<given-names>MR</given-names>
</name>
</person-group>
<article-title>Biofilm formation, epiphytic fitness, and canker development in
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
</article-title>
<source>Mol Plant Microbe Interact</source>
<year>2007</year>
<volume>20</volume>
<fpage>1222</fpage>
<lpage>30</lpage>
<pub-id pub-id-type="doi">10.1094/MPMI-20-10-1222</pub-id>
<pub-id pub-id-type="pmid">17918624</pub-id>
</element-citation>
</ref>
<ref id="CR19">
<label>19.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Malamud</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Torres</surname>
<given-names>PS</given-names>
</name>
<name>
<surname>Roeschlin</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Rigano</surname>
<given-names>LA</given-names>
</name>
<name>
<surname>Enrique</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Bonomi</surname>
<given-names>HR</given-names>
</name>
<name>
<surname>Castagnaro</surname>
<given-names>AP</given-names>
</name>
<name>
<surname>Marano</surname>
<given-names>MR</given-names>
</name>
<name>
<surname>Vojnov</surname>
<given-names>AA</given-names>
</name>
</person-group>
<article-title>The
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
flagellum is required for mature biofilm and canker development</article-title>
<source>Microbiology</source>
<year>2011</year>
<volume>157</volume>
<issue>Pt 3</issue>
<fpage>819</fpage>
<lpage>29</lpage>
<pub-id pub-id-type="doi">10.1099/mic.0.044255-0</pub-id>
<pub-id pub-id-type="pmid">21109564</pub-id>
</element-citation>
</ref>
<ref id="CR20">
<label>20.</label>
<mixed-citation publication-type="other">Malamud F, Homem RA, Conforte VP, Yaryura PM, Castagnaro AP, Marano MR, et al. Identification and characterization of biofilm formation-defective mutants of
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
. Microbiology. 2013.</mixed-citation>
</ref>
<ref id="CR21">
<label>21.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>Genome-wide mutagenesis of
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
reveals novel genetic determinants and regulation mechanisms of biofilm formation</article-title>
<source>PLoS One</source>
<year>2011</year>
<volume>6</volume>
<fpage>e21804</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0021804</pub-id>
<pub-id pub-id-type="pmid">21750733</pub-id>
</element-citation>
</ref>
<ref id="CR22">
<label>22.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>Foliar application of biofilm formation-inhibiting compounds enhances control of citrus canker caused by
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
</article-title>
<source>Phytopathology</source>
<year>2014</year>
<volume>104</volume>
<fpage>134</fpage>
<lpage>42</lpage>
<pub-id pub-id-type="doi">10.1094/PHYTO-04-13-0100-R</pub-id>
<pub-id pub-id-type="pmid">23901828</pub-id>
</element-citation>
</ref>
<ref id="CR23">
<label>23.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Costerton</surname>
<given-names>JW</given-names>
</name>
<name>
<surname>Lewandowski</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Caldwell</surname>
<given-names>DE</given-names>
</name>
<name>
<surname>Korber</surname>
<given-names>DR</given-names>
</name>
<name>
<surname>Lappin-Scott</surname>
<given-names>HM</given-names>
</name>
</person-group>
<article-title>Microbial biofilms</article-title>
<source>Annu Rev Microbiol</source>
<year>1995</year>
<volume>49</volume>
<fpage>711</fpage>
<lpage>45</lpage>
<pub-id pub-id-type="doi">10.1146/annurev.mi.49.100195.003431</pub-id>
<pub-id pub-id-type="pmid">8561477</pub-id>
</element-citation>
</ref>
<ref id="CR24">
<label>24.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Caserta</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Takita</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Targon</surname>
<given-names>ML</given-names>
</name>
<name>
<surname>Rosselli-Murai</surname>
<given-names>LK</given-names>
</name>
<name>
<surname>De Souza</surname>
<given-names>AP</given-names>
</name>
<name>
<surname>Peroni</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Stach-Machado</surname>
<given-names>DR</given-names>
</name>
<name>
<surname>Andrade</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Labate</surname>
<given-names>CA</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>EW</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>De Souza</surname>
<given-names>AA</given-names>
</name>
</person-group>
<article-title>Expression of
<italic>Xylella fastidiosa</italic>
fimbrial and afimbrial proteins durine biofilm formation</article-title>
<source>Appl Environ Microbiol</source>
<year>2010</year>
<volume>76</volume>
<fpage>4250</fpage>
<lpage>4259</lpage>
<pub-id pub-id-type="doi">10.1128/AEM.02114-09</pub-id>
<pub-id pub-id-type="pmid">20472735</pub-id>
</element-citation>
</ref>
<ref id="CR25">
<label>25.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>da Silva</surname>
<given-names>ACR</given-names>
</name>
<name>
<surname>Ferro</surname>
<given-names>JA</given-names>
</name>
<name>
<surname>Reinach</surname>
<given-names>FC</given-names>
</name>
<name>
<surname>Farah</surname>
<given-names>CS</given-names>
</name>
<name>
<surname>Furlan</surname>
<given-names>LR</given-names>
</name>
<name>
<surname>Quaggio</surname>
<given-names>RB</given-names>
</name>
<name>
<surname>Monteiro-Vitorello</surname>
<given-names>CB</given-names>
</name>
<name>
<surname>Van Sluys</surname>
<given-names>MA</given-names>
</name>
<name>
<surname>Almeida</surname>
<given-names>NF</given-names>
</name>
<name>
<surname>Alves</surname>
<given-names>LMC</given-names>
</name>
<name>
<surname>do Amaral</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Bertolini</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Camargo</surname>
<given-names>LEA</given-names>
</name>
<name>
<surname>Camarotte</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Cannavan</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Cardozo</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Chambergo</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Ciapina</surname>
<given-names>LP</given-names>
</name>
<name>
<surname>Cicarelli</surname>
<given-names>RMB</given-names>
</name>
<name>
<surname>Coutinho</surname>
<given-names>LL</given-names>
</name>
<name>
<surname>Cursino-Santos</surname>
<given-names>JR</given-names>
</name>
<name>
<surname>El-Dorry</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Faria</surname>
<given-names>JB</given-names>
</name>
<name>
<surname>Ferreira</surname>
<given-names>AJS</given-names>
</name>
<name>
<surname>Ferreira</surname>
<given-names>RCC</given-names>
</name>
<name>
<surname>Ferro</surname>
<given-names>MIT</given-names>
</name>
<name>
<surname>Formighieri</surname>
<given-names>EF</given-names>
</name>
<name>
<surname>Franco</surname>
<given-names>MC</given-names>
</name>
<name>
<surname>Greggio</surname>
<given-names>CC</given-names>
</name>
<name>
<surname>Gruber</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Comparison of the genomes of two
<italic>Xanthomonas</italic>
pathogens with differing host specificities</article-title>
<source>Nature</source>
<year>2002</year>
<volume>417</volume>
<issue>May</issue>
<fpage>459</fpage>
<lpage>463</lpage>
<pub-id pub-id-type="doi">10.1038/417459a</pub-id>
<pub-id pub-id-type="pmid">12024217</pub-id>
</element-citation>
</ref>
<ref id="CR26">
<label>26.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dunger</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Guzzo</surname>
<given-names>CR</given-names>
</name>
<name>
<surname>Andrade</surname>
<given-names>MO</given-names>
</name>
<name>
<surname>Jones</surname>
<given-names>JB</given-names>
</name>
<name>
<surname>Farah</surname>
<given-names>CS</given-names>
</name>
</person-group>
<article-title>
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
type IV Pilus is required for twitching motility, biofilm development, and adherence</article-title>
<source>Mol Plant Microbe Interact</source>
<year>2014</year>
<volume>27</volume>
<fpage>1132</fpage>
<lpage>47</lpage>
<pub-id pub-id-type="doi">10.1094/MPMI-06-14-0184-R</pub-id>
<pub-id pub-id-type="pmid">25180689</pub-id>
</element-citation>
</ref>
<ref id="CR27">
<label>27.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guzzo</surname>
<given-names>CR</given-names>
</name>
<name>
<surname>Salinas</surname>
<given-names>RK</given-names>
</name>
<name>
<surname>Andrade</surname>
<given-names>MO</given-names>
</name>
<name>
<surname>Farah</surname>
<given-names>CS</given-names>
</name>
</person-group>
<article-title>PILZ protein structure and interactions with PILB and the FIMX EAL domain: implications for control of type IV pilus biogenesis</article-title>
<source>J Mol Biol</source>
<year>2009</year>
<volume>393</volume>
<fpage>848</fpage>
<lpage>866</lpage>
<pub-id pub-id-type="doi">10.1016/j.jmb.2009.07.065</pub-id>
<pub-id pub-id-type="pmid">19646999</pub-id>
</element-citation>
</ref>
<ref id="CR28">
<label>28.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guzzo</surname>
<given-names>CR</given-names>
</name>
<name>
<surname>Dunger</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Salinas</surname>
<given-names>RK</given-names>
</name>
<name>
<surname>Farah</surname>
<given-names>CS</given-names>
</name>
</person-group>
<article-title>Structure of the PilZ-FimXEAL-c-di-GMP complex responsible for the regulation of bacterial type IV pilus biogenesis</article-title>
<source>J Mol Biol</source>
<year>2013</year>
<volume>425</volume>
<fpage>2174</fpage>
<lpage>2197</lpage>
<pub-id pub-id-type="doi">10.1016/j.jmb.2013.03.021</pub-id>
<pub-id pub-id-type="pmid">23507310</pub-id>
</element-citation>
</ref>
<ref id="CR29">
<label>29.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Finn</surname>
<given-names>RDA</given-names>
</name>
<name>
<surname>Bateman</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Clements</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Coggill</surname>
<given-names>RY</given-names>
</name>
<name>
<surname>Eberhardt</surname>
<given-names>SR</given-names>
</name>
<name>
<surname>Eddy</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Heger</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Hetherington</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Holm</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Mistry</surname>
<given-names>ELL</given-names>
</name>
<name>
<surname>Sonnhammer</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Tate</surname>
<given-names>MRD</given-names>
</name>
<name>
<surname>Finn</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Bateman</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Clements</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Coggill</surname>
<given-names>RY</given-names>
</name>
<name>
<surname>Eberhardt</surname>
<given-names>SR</given-names>
</name>
<name>
<surname>Eddy</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Heger</surname>
<given-names>K</given-names>
</name>
</person-group>
<source>Hetherington M</source>
<year>2014</year>
</element-citation>
</ref>
<ref id="CR30">
<label>30.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Lan</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Ye</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>LF</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>An O island 172 encoded RNA helicase regulates the motility of
<italic>Escherichia coli</italic>
O157:H7</article-title>
<source>PLoS One</source>
<year>2013</year>
<volume>8</volume>
<fpage>1</fpage>
<lpage>9</lpage>
</element-citation>
</ref>
<ref id="CR31">
<label>31.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chiang</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Sampaleanu</surname>
<given-names>LM</given-names>
</name>
<name>
<surname>Ayers</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Pahuta</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Howell</surname>
<given-names>PL</given-names>
</name>
<name>
<surname>Burrows</surname>
<given-names>LL</given-names>
</name>
</person-group>
<article-title>Functional role of conserved residues in the characteristics secretion NTPase motifs of the
<italic>Pseudomonas aeruginosa</italic>
type IV pilus motor proteins PilB, PilT and PilU</article-title>
<source>Microbiology</source>
<year>2008</year>
<volume>154</volume>
<fpage>114</fpage>
<lpage>126</lpage>
<pub-id pub-id-type="doi">10.1099/mic.0.2007/011320-0</pub-id>
<pub-id pub-id-type="pmid">18174131</pub-id>
</element-citation>
</ref>
<ref id="CR32">
<label>32.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zuker</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Mfold web server for nucleic acid folding and hybridization prediction</article-title>
<source>Nucleic Acids Res</source>
<year>2003</year>
<volume>31</volume>
<fpage>3406</fpage>
<lpage>3415</lpage>
<pub-id pub-id-type="doi">10.1093/nar/gkg595</pub-id>
<pub-id pub-id-type="pmid">12824337</pub-id>
</element-citation>
</ref>
<ref id="CR33">
<label>33.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gottig</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Garavaglia</surname>
<given-names>BS</given-names>
</name>
<name>
<surname>Garofalo</surname>
<given-names>CG</given-names>
</name>
<name>
<surname>Orellano</surname>
<given-names>EG</given-names>
</name>
<name>
<surname>Ottado</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>A filamentous hemagglutinin-like protein of
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
, the phytopathogen responsible for citrus canker, is involved in bacterial virulence</article-title>
<source>PLoS One</source>
<year>2009</year>
<volume>4</volume>
<fpage>e4358</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0004358</pub-id>
<pub-id pub-id-type="pmid">19194503</pub-id>
</element-citation>
</ref>
<ref id="CR34">
<label>34.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Py</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Higgins</surname>
<given-names>CF</given-names>
</name>
<name>
<surname>Krisch</surname>
<given-names>HM</given-names>
</name>
<name>
<surname>Carpousis</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Carpousis</surname>
<given-names>AJ</given-names>
</name>
</person-group>
<article-title>A DEAD-box RNA helicase in the
<italic>Escherichia coli</italic>
RNA degradosome</article-title>
<source>Lett to Nat</source>
<year>1996</year>
<volume>381</volume>
<fpage>169</fpage>
<lpage>172</lpage>
<pub-id pub-id-type="doi">10.1038/381169a0</pub-id>
</element-citation>
</ref>
<ref id="CR35">
<label>35.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khemici</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Toesca</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Poljak</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Vanzo</surname>
<given-names>NF</given-names>
</name>
<name>
<surname>Carpousis</surname>
<given-names>AJ</given-names>
</name>
</person-group>
<article-title>The RNase E of
<italic>Escherichia coli</italic>
has at least two binding sites for DEAD-box RNA helicases: functional replacement of RhlB by RhlE</article-title>
<source>Mol Microbiol</source>
<year>2004</year>
<volume>54</volume>
<fpage>1422</fpage>
<lpage>1430</lpage>
<pub-id pub-id-type="doi">10.1111/j.1365-2958.2004.04361.x</pub-id>
<pub-id pub-id-type="pmid">15554979</pub-id>
</element-citation>
</ref>
<ref id="CR36">
<label>36.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Danhorn</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Fuqua</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Biofilm formation by plant-associated bacteria</article-title>
<source>Annu Rev Microbiol</source>
<year>2007</year>
<volume>61</volume>
<fpage>401</fpage>
<lpage>422</lpage>
<pub-id pub-id-type="doi">10.1146/annurev.micro.61.080706.093316</pub-id>
<pub-id pub-id-type="pmid">17506679</pub-id>
</element-citation>
</ref>
<ref id="CR37">
<label>37.</label>
<mixed-citation publication-type="other">Gottig N, Garavaglia BS, Garofalo CG, Zimaro T, Sgro GG, Ficarra FA, Dunger G. Mechanisms of infection used by
<italic>Xanthomonas axonopodi</italic>
s pv.
<italic>citri</italic>
in citrus canker disease. 2010:196–204.</mixed-citation>
</ref>
<ref id="CR38">
<label>38.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Sagaram</surname>
<given-names>US</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>Requirement of the
<italic>galU</italic>
gene for polysaccharide production by and pathogenicity and growth In Planta of
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
</article-title>
<source>Appl Environ Microbiol</source>
<year>2010</year>
<volume>76</volume>
<fpage>2234</fpage>
<lpage>42</lpage>
<pub-id pub-id-type="doi">10.1128/AEM.02897-09</pub-id>
<pub-id pub-id-type="pmid">20118360</pub-id>
</element-citation>
</ref>
<ref id="CR39">
<label>39.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yan</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>The ColR/ColS two-component system plays multiple roles in the pathogenicity of the citrus canker pathogen
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
</article-title>
<source>J Bacteriol</source>
<year>2011</year>
<volume>193</volume>
<fpage>1590</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="doi">10.1128/JB.01415-10</pub-id>
<pub-id pub-id-type="pmid">21257774</pub-id>
</element-citation>
</ref>
<ref id="CR40">
<label>40.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zimaro</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Thomas</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Marondedze</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Sgro</surname>
<given-names>GG</given-names>
</name>
<name>
<surname>Garofalo</surname>
<given-names>CG</given-names>
</name>
<name>
<surname>Ficarra</surname>
<given-names>FA</given-names>
</name>
<name>
<surname>Gehring</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ottado</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Gottig</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>The type III protein secretion system contributes to
<italic>Xanthomonas citr</italic>
i subsp.
<italic>citri</italic>
biofilm formation</article-title>
<source>BMC Microbiol</source>
<year>2014</year>
<volume>14</volume>
<fpage>96</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2180-14-96</pub-id>
<pub-id pub-id-type="pmid">24742141</pub-id>
</element-citation>
</ref>
<ref id="CR41">
<label>41.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>The gpsX gene encoding a glycosyltransferase is important for polysaccharide production and required for full virulence in
<italic>Xanthomonas citri</italic>
subsp.
<italic>citri</italic>
</article-title>
<source>BMC Microbiol</source>
<year>2012</year>
<volume>12</volume>
<fpage>31</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2180-12-31</pub-id>
<pub-id pub-id-type="pmid">22404966</pub-id>
</element-citation>
</ref>
<ref id="CR42">
<label>42.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gury</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Barthelmebs</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Cavin</surname>
<given-names>JF</given-names>
</name>
</person-group>
<article-title>Random transposon mutagenesis of
<italic>Lactobacillus plantarum</italic>
by using the pGh9:ISS1 vector to clone genes involved in the regulation of phenolic acid metabolism</article-title>
<source>Arch Microbiol</source>
<year>2004</year>
<volume>182</volume>
<fpage>337</fpage>
<lpage>345</lpage>
<pub-id pub-id-type="doi">10.1007/s00203-004-0705-1</pub-id>
<pub-id pub-id-type="pmid">15375644</pub-id>
</element-citation>
</ref>
<ref id="CR43">
<label>43.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tu Quoc</surname>
<given-names>PH</given-names>
</name>
<name>
<surname>Genevaux</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Pajunen</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Savilahti</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Georgopoulos</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Schrenzel</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Kelley</surname>
<given-names>WL</given-names>
</name>
</person-group>
<article-title>Isolation and characterization of biofilm formation-defective mutants of
<italic>Staphylococcus aureus</italic>
</article-title>
<source>Infect Immun</source>
<year>2007</year>
<volume>75</volume>
<fpage>1079</fpage>
<lpage>1088</lpage>
<pub-id pub-id-type="doi">10.1128/IAI.01143-06</pub-id>
<pub-id pub-id-type="pmid">17158901</pub-id>
</element-citation>
</ref>
<ref id="CR44">
<label>44.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Andrade</surname>
<given-names>MO</given-names>
</name>
<name>
<surname>Farah</surname>
<given-names>CS</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>The post-transcriptional regulator
<italic>rsmA/csrA</italic>
activates T3SS by stabilizing the 5′ UTR of
<italic>hrpG</italic>
, the master regulator of
<italic>hrp/hrc</italic>
genes, in
<italic>Xanthomonas</italic>
</article-title>
<source>PLoS Pathog</source>
<year>2014</year>
<volume>10</volume>
<fpage>1</fpage>
<lpage>19</lpage>
</element-citation>
</ref>
<ref id="CR45">
<label>45.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Babitzke</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Romeo</surname>
<given-names>T</given-names>
</name>
</person-group>
<article-title>CsrB sRNA family: sequestration of RNA-binding regulatory proteins</article-title>
<source>Curr Opin Microbiol</source>
<year>2007</year>
<volume>10</volume>
<fpage>156</fpage>
<lpage>163</lpage>
<pub-id pub-id-type="doi">10.1016/j.mib.2007.03.007</pub-id>
<pub-id pub-id-type="pmid">17383221</pub-id>
</element-citation>
</ref>
<ref id="CR46">
<label>46.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Richards</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Luciano</surname>
<given-names>DJ</given-names>
</name>
<name>
<surname>Belasco</surname>
<given-names>JG</given-names>
</name>
</person-group>
<article-title>Influence of translation on RppH-dependent mRNA degradation in
<italic>Escherichia coli</italic>
</article-title>
<source>Mol Microbiol</source>
<year>2013</year>
<volume>86</volume>
<fpage>1063</fpage>
<lpage>1072</lpage>
<pub-id pub-id-type="doi">10.1111/mmi.12040</pub-id>
<pub-id pub-id-type="pmid">22989003</pub-id>
</element-citation>
</ref>
<ref id="CR47">
<label>47.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deana</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Belasco</surname>
<given-names>JG</given-names>
</name>
</person-group>
<article-title>Lost in translation: the influence of ribosomes on bacterial mRNA decay</article-title>
<source>Genes Dev</source>
<year>2005</year>
<volume>19</volume>
<fpage>2526</fpage>
<lpage>2533</lpage>
<pub-id pub-id-type="doi">10.1101/gad.1348805</pub-id>
<pub-id pub-id-type="pmid">16264189</pub-id>
</element-citation>
</ref>
<ref id="CR48">
<label>48.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arnold</surname>
<given-names>TE</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Belasco</surname>
<given-names>JG</given-names>
</name>
</person-group>
<article-title>mRNA stabilization by the
<italic>ompA</italic>
5′ untranslated region: two protective elements hinder distinct pathways for mRNA degradation</article-title>
<source>RNA</source>
<year>1998</year>
<volume>4</volume>
<fpage>319</fpage>
<lpage>330</lpage>
<pub-id pub-id-type="pmid">9510333</pub-id>
</element-citation>
</ref>
<ref id="CR49">
<label>49.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsunaga</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Simons</surname>
<given-names>EL</given-names>
</name>
<name>
<surname>Simons</surname>
<given-names>RW</given-names>
</name>
</person-group>
<article-title>
<italic>Escherichia coli</italic>
RNase III (rnc) autoregulation occurs independently of rnc gene translation</article-title>
<source>Mol Microbiol</source>
<year>1997</year>
<volume>26</volume>
<fpage>1125</fpage>
<lpage>1135</lpage>
<pub-id pub-id-type="doi">10.1046/j.1365-2958.1997.6652007.x</pub-id>
<pub-id pub-id-type="pmid">9426147</pub-id>
</element-citation>
</ref>
<ref id="CR50">
<label>50.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hanahan</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Studies on transformation of
<italic>Escherichia coli</italic>
with plasmids</article-title>
<source>J Mol Biol</source>
<year>1983</year>
<volume>166</volume>
<fpage>557</fpage>
<lpage>580</lpage>
<pub-id pub-id-type="doi">10.1016/S0022-2836(83)80284-8</pub-id>
<pub-id pub-id-type="pmid">6345791</pub-id>
</element-citation>
</ref>
<ref id="CR51">
<label>51.</label>
<mixed-citation publication-type="other">Schaad NW, Postnikova E, Lacy GH, Sechler A, Agarkova I, Stromberg PE, Stromberg VK, Vidaver AK: Reclassification of
<italic>Xanthomonas campestris</italic>
pv.
<italic>citri</italic>
(ex Hasse 1915) Dye 1978 forms A, B/C/D, and E as
<italic>X. smithii</italic>
subsp.
<italic>citri</italic>
(ex Hasse) sp. nov. nom. rev. comb. nov.,
<italic>X. fuscans</italic>
subsp.
<italic>aurantifolii</italic>
(ex Gabriel 1989) sp. nov. nom. rev. comb. nov., and X. Syst Appl Microbiol. 2005;28:494–518.</mixed-citation>
</ref>
<ref id="CR52">
<label>52.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>El Yacoubi</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Brunings</surname>
<given-names>AM</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Shankar</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Gabriel</surname>
<given-names>DW</given-names>
</name>
</person-group>
<article-title>In planta horizontal transfer of a major pathogenicity effector gene</article-title>
<source>Appl Environ Microbiol</source>
<year>2007</year>
<volume>73</volume>
<fpage>1612</fpage>
<lpage>21</lpage>
<pub-id pub-id-type="doi">10.1128/AEM.00261-06</pub-id>
<pub-id pub-id-type="pmid">17220258</pub-id>
</element-citation>
</ref>
<ref id="CR53">
<label>53.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Sambrook</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Fritsch</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Maniatis</surname>
<given-names>T</given-names>
</name>
</person-group>
<source>Molecular Cloning</source>
<year>2012</year>
<edition>4</edition>
<publisher-loc>New York</publisher-loc>
<publisher-name>Cold Spring Harbor Laboratory Press</publisher-name>
</element-citation>
</ref>
<ref id="CR54">
<label>54.</label>
<mixed-citation publication-type="other">Amaral AM, Toledo CP, Baptista JC, Machado MA. Transformation of
<italic>Xanthomonas</italic>
<italic> axonopodis</italic>
pv.
<italic>citri</italic>
by Electroporation. 2005, 30:1995–1997.</mixed-citation>
</ref>
<ref id="CR55">
<label>55.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Souza</surname>
<given-names>DP</given-names>
</name>
<name>
<surname>Andrade</surname>
<given-names>MO</given-names>
</name>
<name>
<surname>Alvarez-Martinez</surname>
<given-names>CE</given-names>
</name>
<name>
<surname>Arantes</surname>
<given-names>GM</given-names>
</name>
<name>
<surname>Farah</surname>
<given-names>CS</given-names>
</name>
<name>
<surname>Salinas</surname>
<given-names>RK</given-names>
</name>
</person-group>
<article-title>A component of the Xanthomonadaceae type IV secretion system combines a VirB7 motif with a N0 domain found in outer membrane transport proteins</article-title>
<source>PLoS Pathog</source>
<year>2011</year>
<volume>7</volume>
<fpage>e1002031</fpage>
<pub-id pub-id-type="doi">10.1371/journal.ppat.1002031</pub-id>
<pub-id pub-id-type="pmid">21589901</pub-id>
</element-citation>
</ref>
<ref id="CR56">
<label>56.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>N</given-names>
</name>
</person-group>
<article-title>The
<italic>wxacO</italic>
gene of
<italic>Xanthomonas citr</italic>
i ssp.
<italic>citri</italic>
encodes a protein with a role in lipopolysaccharide biosynthesis, biofilm formation, stress tolerance and virulence</article-title>
<source>Mol Plant Pathol</source>
<year>2011</year>
<volume>12</volume>
<fpage>381</fpage>
<lpage>396</lpage>
<pub-id pub-id-type="doi">10.1111/j.1364-3703.2010.00681.x</pub-id>
<pub-id pub-id-type="pmid">21453433</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 0006138 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 0006138 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024