Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.
***** Acces problem to record *****\

Identifieur interne : 000406 ( Pmc/Corpus ); précédent : 0004059; suivant : 0004070 ***** probable Xml problem with record *****

Links to Exploration step


Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Phylogenetic and Molecular Variability Studies Reveal a New Genetic Clade of
<italic>Citrus leprosis virus C</italic>
</title>
<author>
<name sortKey="Ramos Gonzalez, Pedro Luis" sort="Ramos Gonzalez, Pedro Luis" uniqKey="Ramos Gonzalez P" first="Pedro Luis" last="Ramos-González">Pedro Luis Ramos-González</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-viruses-08-00153">Departamento de Bioquímica Fitopatológica, Instituto Biológico, São Paulo 04014-002, Brazil;
<email>onelio@protonmail.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chabi Jesus, Camila" sort="Chabi Jesus, Camila" uniqKey="Chabi Jesus C" first="Camila" last="Chabi-Jesus">Camila Chabi-Jesus</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-viruses-08-00153">Departamento de Bioquímica Fitopatológica, Instituto Biológico, São Paulo 04014-002, Brazil;
<email>onelio@protonmail.com</email>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af3-viruses-08-00153">Departamento de Microbiologia Agrícola, Escola Superior de Agricultura Luiz de Queiroz, Universidade de São Paulo, Piracicaba, São Paulo 13418-900, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Guerra Peraza, Orlene" sort="Guerra Peraza, Orlene" uniqKey="Guerra Peraza O" first="Orlene" last="Guerra-Peraza">Orlene Guerra-Peraza</name>
<affiliation>
<nlm:aff id="af2-viruses-08-00153">Departamento de Bioquímica Fitopatológica, Instituto Biológico, São Paulo 04014-002, Brazil;
<email>onelio@protonmail.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Breton, Michele Claire" sort="Breton, Michele Claire" uniqKey="Breton M" first="Michèle Claire" last="Breton">Michèle Claire Breton</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Arena, Gabriella Dias" sort="Arena, Gabriella Dias" uniqKey="Arena G" first="Gabriella Dias" last="Arena">Gabriella Dias Arena</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-viruses-08-00153">Instituto de Biologia, Universidade de Campinas, Campinas, São Paulo 13083-970, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Nunes, Maria Andreia" sort="Nunes, Maria Andreia" uniqKey="Nunes M" first="Maria Andreia" last="Nunes">Maria Andreia Nunes</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kitajima, Elliot Watanabe" sort="Kitajima, Elliot Watanabe" uniqKey="Kitajima E" first="Elliot Watanabe" last="Kitajima">Elliot Watanabe Kitajima</name>
<affiliation>
<nlm:aff id="af5-viruses-08-00153">Departamento de Fitopatologia e Nematologia, Escola Superior de Agricultura Luiz de Queiroz, Universidade de São Paulo, Piracicaba, São Paulo 13418-900, Brazil;
<email>ewkitaji@usp.br</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Machado, Marcos Antonio" sort="Machado, Marcos Antonio" uniqKey="Machado M" first="Marcos Antonio" last="Machado">Marcos Antonio Machado</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Freitas Astua, Juliana" sort="Freitas Astua, Juliana" uniqKey="Freitas Astua J" first="Juliana" last="Freitas-Astúa">Juliana Freitas-Astúa</name>
<affiliation>
<nlm:aff id="af2-viruses-08-00153">Departamento de Bioquímica Fitopatológica, Instituto Biológico, São Paulo 04014-002, Brazil;
<email>onelio@protonmail.com</email>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af6-viruses-08-00153">Embrapa Cassava and Fruits, Cruz das Almas, Bahia 44380-000, Brazil</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">27275832</idno>
<idno type="pmc">4926173</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4926173</idno>
<idno type="RBID">PMC:4926173</idno>
<idno type="doi">10.3390/v8060153</idno>
<date when="2016">2016</date>
<idno type="wicri:Area/Pmc/Corpus">000406</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Phylogenetic and Molecular Variability Studies Reveal a New Genetic Clade of
<italic>Citrus leprosis virus C</italic>
</title>
<author>
<name sortKey="Ramos Gonzalez, Pedro Luis" sort="Ramos Gonzalez, Pedro Luis" uniqKey="Ramos Gonzalez P" first="Pedro Luis" last="Ramos-González">Pedro Luis Ramos-González</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-viruses-08-00153">Departamento de Bioquímica Fitopatológica, Instituto Biológico, São Paulo 04014-002, Brazil;
<email>onelio@protonmail.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Chabi Jesus, Camila" sort="Chabi Jesus, Camila" uniqKey="Chabi Jesus C" first="Camila" last="Chabi-Jesus">Camila Chabi-Jesus</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af2-viruses-08-00153">Departamento de Bioquímica Fitopatológica, Instituto Biológico, São Paulo 04014-002, Brazil;
<email>onelio@protonmail.com</email>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af3-viruses-08-00153">Departamento de Microbiologia Agrícola, Escola Superior de Agricultura Luiz de Queiroz, Universidade de São Paulo, Piracicaba, São Paulo 13418-900, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Guerra Peraza, Orlene" sort="Guerra Peraza, Orlene" uniqKey="Guerra Peraza O" first="Orlene" last="Guerra-Peraza">Orlene Guerra-Peraza</name>
<affiliation>
<nlm:aff id="af2-viruses-08-00153">Departamento de Bioquímica Fitopatológica, Instituto Biológico, São Paulo 04014-002, Brazil;
<email>onelio@protonmail.com</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Breton, Michele Claire" sort="Breton, Michele Claire" uniqKey="Breton M" first="Michèle Claire" last="Breton">Michèle Claire Breton</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Arena, Gabriella Dias" sort="Arena, Gabriella Dias" uniqKey="Arena G" first="Gabriella Dias" last="Arena">Gabriella Dias Arena</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af4-viruses-08-00153">Instituto de Biologia, Universidade de Campinas, Campinas, São Paulo 13083-970, Brazil</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Nunes, Maria Andreia" sort="Nunes, Maria Andreia" uniqKey="Nunes M" first="Maria Andreia" last="Nunes">Maria Andreia Nunes</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Kitajima, Elliot Watanabe" sort="Kitajima, Elliot Watanabe" uniqKey="Kitajima E" first="Elliot Watanabe" last="Kitajima">Elliot Watanabe Kitajima</name>
<affiliation>
<nlm:aff id="af5-viruses-08-00153">Departamento de Fitopatologia e Nematologia, Escola Superior de Agricultura Luiz de Queiroz, Universidade de São Paulo, Piracicaba, São Paulo 13418-900, Brazil;
<email>ewkitaji@usp.br</email>
</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Machado, Marcos Antonio" sort="Machado, Marcos Antonio" uniqKey="Machado M" first="Marcos Antonio" last="Machado">Marcos Antonio Machado</name>
<affiliation>
<nlm:aff id="af1-viruses-08-00153">Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Freitas Astua, Juliana" sort="Freitas Astua, Juliana" uniqKey="Freitas Astua J" first="Juliana" last="Freitas-Astúa">Juliana Freitas-Astúa</name>
<affiliation>
<nlm:aff id="af2-viruses-08-00153">Departamento de Bioquímica Fitopatológica, Instituto Biológico, São Paulo 04014-002, Brazil;
<email>onelio@protonmail.com</email>
</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="af6-viruses-08-00153">Embrapa Cassava and Fruits, Cruz das Almas, Bahia 44380-000, Brazil</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Viruses</title>
<idno type="eISSN">1999-4915</idno>
<imprint>
<date when="2016">2016</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>
<italic>Citrus leprosis virus C</italic>
(CiLV-C) causes a severe disease affecting citrus orchards in the Western hemisphere. This study reveals the molecular variability of the virus by analyzing four genomic regions (
<italic>p29</italic>
,
<italic>p15</italic>
,
<italic>MP</italic>
and RNA2-intergenic region) distributed over its two RNAs. Nucleotide diversity (π) values were relatively low but statistically different over the analyzed genes and subpopulations, indicating their distinct evolutionary history. Values of π
<italic>
<sub>p</sub>
</italic>
<sub>29</sub>
and π
<italic>
<sub>MP</sub>
</italic>
were higher than those of π
<italic>
<sub>p</sub>
</italic>
<sub>15</sub>
and π
<sub>RNA2–IR,</sub>
whereas π
<italic>
<sub>MP</sub>
</italic>
was increased due to novel discovered isolates phylogenetically clustered in a divergent clade that we called SJP. Isolate BR_SP_SJP_01 RNA1 and RNA2 sequences, clade SJP, showed an identity of 85.6% and 88.4%, respectively, with those corresponding to CiLV-C, the type member of the genus
<italic>Cilevirus</italic>
, and its RNA2 5′-proximal region was revealed as a minor donor in a putative inter-clade recombination event. In addition to citrus, BR_SP_SJP_01 naturally infects the weed
<italic>Commelina benghalensis</italic>
and is efficiently transmitted by
<italic>Brevipalpus yothersi</italic>
mites. Our data demonstrated that negative selection was the major force operating in the evaluated viral coding regions and defined amino acids putatively relevant for the biological function of cilevirus proteins. This work provides molecular tools and sets up a framework for further epidemiological studies.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Roy, A" uniqKey="Roy A">A. Roy</name>
</author>
<author>
<name sortKey="Hartung, J S" uniqKey="Hartung J">J.S. Hartung</name>
</author>
<author>
<name sortKey="Schneider, W L" uniqKey="Schneider W">W.L. Schneider</name>
</author>
<author>
<name sortKey="Shao, J" uniqKey="Shao J">J. Shao</name>
</author>
<author>
<name sortKey="Leon, M G" uniqKey="Leon M">M.G. Leon</name>
</author>
<author>
<name sortKey="Melzer, M J" uniqKey="Melzer M">M.J. Melzer</name>
</author>
<author>
<name sortKey="Beard, J J" uniqKey="Beard J">J.J. Beard</name>
</author>
<author>
<name sortKey="Otero Colina, G" uniqKey="Otero Colina G">G. Otero-Colina</name>
</author>
<author>
<name sortKey="Bauchan, G R" uniqKey="Bauchan G">G.R. Bauchan</name>
</author>
<author>
<name sortKey="Ochoa, R" uniqKey="Ochoa R">R. Ochoa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitancourt, A" uniqKey="Bitancourt A">A. Bitancourt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitancourt, A" uniqKey="Bitancourt A">A. Bitancourt</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Fawcett, H S" uniqKey="Fawcett H">H.S. Fawcett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Spegazzini, C" uniqKey="Spegazzini C">C. Spegazzini</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Childers, C C" uniqKey="Childers C">C.C. Childers</name>
</author>
<author>
<name sortKey="Rodrigues, J C" uniqKey="Rodrigues J">J.C. Rodrigues</name>
</author>
<author>
<name sortKey="Derrick, K S" uniqKey="Derrick K">K.S. Derrick</name>
</author>
<author>
<name sortKey="Achor, D S" uniqKey="Achor D">D.S. Achor</name>
</author>
<author>
<name sortKey="French, J V" uniqKey="French J">J.V. French</name>
</author>
<author>
<name sortKey="Welbourn, W C" uniqKey="Welbourn W">W.C. Welbourn</name>
</author>
<author>
<name sortKey="Ochoa, R" uniqKey="Ochoa R">R. Ochoa</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bastianel, M" uniqKey="Bastianel M">M. Bastianel</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Machado, M A" uniqKey="Machado M">M.A. Machado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Caceres, S" uniqKey="Caceres S">S. Cáceres</name>
</author>
<author>
<name sortKey="Aguirre, A" uniqKey="Aguirre A">A. Aguirre</name>
</author>
<author>
<name sortKey="Costa, N" uniqKey="Costa N">N. Costa</name>
</author>
<author>
<name sortKey="De Coll, O" uniqKey="De Coll O">O. de Coll</name>
</author>
<author>
<name sortKey="Gonzales Segnana, L" uniqKey="Gonzales Segnana L">L. Gonzáles Segnana</name>
</author>
<author>
<name sortKey="Fari A, N" uniqKey="Fari A N">N. Fariña</name>
</author>
<author>
<name sortKey="Tassi, A D" uniqKey="Tassi A">A.D. Tassi</name>
</author>
<author>
<name sortKey="Calegario, R F" uniqKey="Calegario R">R.F. Calegario</name>
</author>
<author>
<name sortKey="Moraes, G J De" uniqKey="Moraes G">G.J.de Moraes</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Castillo, I I" uniqKey="Castillo I">I.I. Castillo</name>
</author>
<author>
<name sortKey="Diaz, L F" uniqKey="Diaz L">L.F. Diaz</name>
</author>
<author>
<name sortKey="Mendez, W" uniqKey="Mendez W">W. Mendez</name>
</author>
<author>
<name sortKey="Otero Colina, G" uniqKey="Otero Colina G">G. Otero-Colina</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Locali Fabris, E C" uniqKey="Locali Fabris E">E.C. Locali-Fabris</name>
</author>
<author>
<name sortKey="Moraes, G J" uniqKey="Moraes G">G.J. Moraes</name>
</author>
<author>
<name sortKey="Calegario, R F" uniqKey="Calegario R">R.F. Calegario</name>
</author>
<author>
<name sortKey="Tassi, A D" uniqKey="Tassi A">A.D. Tassi</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Leon, G A" uniqKey="Leon G">G.A. Leon</name>
</author>
<author>
<name sortKey="Realpe, C E" uniqKey="Realpe C">C.E. Realpe</name>
</author>
<author>
<name sortKey="Garzon, P A" uniqKey="Garzon P">P.A. Garzon</name>
</author>
<author>
<name sortKey="Rodriguez, J A" uniqKey="Rodriguez J">J.A. Rodriguez</name>
</author>
<author>
<name sortKey="Moreno, M G" uniqKey="Moreno M">M.G. Moreno</name>
</author>
<author>
<name sortKey="Childers, C C" uniqKey="Childers C">C.C. Childers</name>
</author>
<author>
<name sortKey="Achor, D" uniqKey="Achor D">D. Achor</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Antonioli Luizon, R" uniqKey="Antonioli Luizon R">R. Antonioli-Luizon</name>
</author>
<author>
<name sortKey="Salaroli, R B" uniqKey="Salaroli R">R.B. Salaroli</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dominguez, F" uniqKey="Dominguez F">F. Dominguez</name>
</author>
<author>
<name sortKey="Bernal, A" uniqKey="Bernal A">A. Bernal</name>
</author>
<author>
<name sortKey="Childers, C C" uniqKey="Childers C">C.C. Childers</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="De Dominguez, F S" uniqKey="De Dominguez F">F.S. de Dominguez</name>
</author>
<author>
<name sortKey="Bernal, A" uniqKey="Bernal A">A. Bernal</name>
</author>
<author>
<name sortKey="Childers, C C" uniqKey="Childers C">C.C. Childers</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Cruz Jaramillo, J L" uniqKey="Cruz Jaramillo J">J.L. Cruz-Jaramillo</name>
</author>
<author>
<name sortKey="Ruiz Medrano, R" uniqKey="Ruiz Medrano R">R. Ruiz-Medrano</name>
</author>
<author>
<name sortKey="Rojas Morales, L" uniqKey="Rojas Morales L">L. Rojas-Morales</name>
</author>
<author>
<name sortKey="L Pez Buenfil, J A" uniqKey="L Pez Buenfil J">J.A. López-Buenfil</name>
</author>
<author>
<name sortKey="Morales Galvan, O" uniqKey="Morales Galvan O">O. Morales-Galván</name>
</author>
<author>
<name sortKey="Chavarin Palacio, C" uniqKey="Chavarin Palacio C">C. Chavarín-Palacio</name>
</author>
<author>
<name sortKey="Ramirez Pool, J A" uniqKey="Ramirez Pool J">J.A. Ramírez-Pool</name>
</author>
<author>
<name sortKey="Xoconostle Cazares, B" uniqKey="Xoconostle Cazares B">B. Xoconostle-Cázares</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roy, A" uniqKey="Roy A">A. Roy</name>
</author>
<author>
<name sortKey="Stone, A L" uniqKey="Stone A">A.L. Stone</name>
</author>
<author>
<name sortKey="Shao, J" uniqKey="Shao J">J. Shao</name>
</author>
<author>
<name sortKey="Otero Colina, G" uniqKey="Otero Colina G">G. Otero-Colina</name>
</author>
<author>
<name sortKey="Wei, G" uniqKey="Wei G">G. Wei</name>
</author>
<author>
<name sortKey="Choudhary, N" uniqKey="Choudhary N">N. Choudhary</name>
</author>
<author>
<name sortKey="Achor, D" uniqKey="Achor D">D. Achor</name>
</author>
<author>
<name sortKey="Levy, L" uniqKey="Levy L">L. Levy</name>
</author>
<author>
<name sortKey="Nakhla, M K" uniqKey="Nakhla M">M.K. Nakhla</name>
</author>
<author>
<name sortKey="Hartung, J S" uniqKey="Hartung J">J.S. Hartung</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roy, A" uniqKey="Roy A">A. Roy</name>
</author>
<author>
<name sortKey="Choudhary, N" uniqKey="Choudhary N">N. Choudhary</name>
</author>
<author>
<name sortKey="Guillermo, L M" uniqKey="Guillermo L">L.M. Guillermo</name>
</author>
<author>
<name sortKey="Shao, J" uniqKey="Shao J">J. Shao</name>
</author>
<author>
<name sortKey="Govindarajulu, A" uniqKey="Govindarajulu A">A. Govindarajulu</name>
</author>
<author>
<name sortKey="Achor, D" uniqKey="Achor D">D. Achor</name>
</author>
<author>
<name sortKey="Wei, G" uniqKey="Wei G">G. Wei</name>
</author>
<author>
<name sortKey="Picton, D D" uniqKey="Picton D">D.D. Picton</name>
</author>
<author>
<name sortKey="Levy, L" uniqKey="Levy L">L. Levy</name>
</author>
<author>
<name sortKey="Nakhla, M K" uniqKey="Nakhla M">M.K. Nakhla</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rodrigues, J C V" uniqKey="Rodrigues J">J.C.V. Rodrigues</name>
</author>
<author>
<name sortKey="Zuniga Reyes, J A" uniqKey="Zuniga Reyes J">J.A. Zuniga Reyes</name>
</author>
<author>
<name sortKey="Achor, D S" uniqKey="Achor D">D.S. Achor</name>
</author>
<author>
<name sortKey="Childers, C C" uniqKey="Childers C">C.C. Childers</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="G Mez, E C" uniqKey="G Mez E">E.C. Gómez</name>
</author>
<author>
<name sortKey="Vargas, M R" uniqKey="Vargas M">M.R. Vargas</name>
</author>
<author>
<name sortKey="Rivadameira, C" uniqKey="Rivadameira C">C. Rivadameira</name>
</author>
<author>
<name sortKey="Locali, E C" uniqKey="Locali E">E.C. Locali</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Astua Monge, G" uniqKey="Astua Monge G">G. Astúa-Monge</name>
</author>
<author>
<name sortKey="Rodrigues, J C V" uniqKey="Rodrigues J">J.C.V. Rodrigues</name>
</author>
<author>
<name sortKey="Mesa Cobo, N C" uniqKey="Mesa Cobo N">N.C. Mesa Cobo</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Le N, M G" uniqKey="Le N M">M.G. León</name>
</author>
<author>
<name sortKey="Becerra, C H" uniqKey="Becerra C">C.H. Becerra</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Salaroli, R B" uniqKey="Salaroli R">R.B. Salaroli</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Araya Gonzales, J" uniqKey="Araya Gonzales J">J. Araya-Gonzáles</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mejia, L" uniqKey="Mejia L">L. Mejia</name>
</author>
<author>
<name sortKey="Paniagua, A" uniqKey="Paniagua A">A. Paniagua</name>
</author>
<author>
<name sortKey="Cruz, N" uniqKey="Cruz N">N. Cruz</name>
</author>
<author>
<name sortKey="Porras, M" uniqKey="Porras M">M. Porras</name>
</author>
<author>
<name sortKey="Palmieri, M" uniqKey="Palmieri M">M. Palmieri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Melzer, M J" uniqKey="Melzer M">M.J. Melzer</name>
</author>
<author>
<name sortKey="Sether, D M" uniqKey="Sether D">D.M. Sether</name>
</author>
<author>
<name sortKey="Borth, W B" uniqKey="Borth W">W.B. Borth</name>
</author>
<author>
<name sortKey="Hu, J S" uniqKey="Hu J">J.S. Hu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Melzer, M J" uniqKey="Melzer M">M.J. Melzer</name>
</author>
<author>
<name sortKey="Simbajon, N" uniqKey="Simbajon N">N. Simbajon</name>
</author>
<author>
<name sortKey="Carillo, J" uniqKey="Carillo J">J. Carillo</name>
</author>
<author>
<name sortKey="Borth, W B" uniqKey="Borth W">W.B. Borth</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Neupane, K R" uniqKey="Neupane K">K.R. Neupane</name>
</author>
<author>
<name sortKey="Hu, J S" uniqKey="Hu J">J.S. Hu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bastianel, M" uniqKey="Bastianel M">M. Bastianel</name>
</author>
<author>
<name sortKey="Novelli, V M" uniqKey="Novelli V">V.M. Novelli</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Kubo, K S" uniqKey="Kubo K">K.S. Kubo</name>
</author>
<author>
<name sortKey="Bassanezi, R B" uniqKey="Bassanezi R">R.B. Bassanezi</name>
</author>
<author>
<name sortKey="Machado, M A" uniqKey="Machado M">M.A. Machado</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rodrigues, J C V" uniqKey="Rodrigues J">J.C.V. Rodrigues</name>
</author>
<author>
<name sortKey="Childers, C C" uniqKey="Childers C">C.C. Childers</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Chagas, C M" uniqKey="Chagas C">C.M. Chagas</name>
</author>
<author>
<name sortKey="Rodrigues, J C" uniqKey="Rodrigues J">J.C. Rodrigues</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Beard, J J" uniqKey="Beard J">J.J. Beard</name>
</author>
<author>
<name sortKey="Ochoa, R" uniqKey="Ochoa R">R. Ochoa</name>
</author>
<author>
<name sortKey="Braswell, W E" uniqKey="Braswell W">W.E. Braswell</name>
</author>
<author>
<name sortKey="Bauchan, G R" uniqKey="Bauchan G">G.R. Bauchan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Garita, L" uniqKey="Garita L">L. Garita</name>
</author>
<author>
<name sortKey="Tassi, A D" uniqKey="Tassi A">A.D. Tassi</name>
</author>
<author>
<name sortKey="Calegario, R F" uniqKey="Calegario R">R.F. Calegario</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Carbonell, S A M" uniqKey="Carbonell S">S.A.M. Carbonell</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Garita, L C" uniqKey="Garita L">L.C. Garita</name>
</author>
<author>
<name sortKey="Tassi, A D" uniqKey="Tassi A">A.D. Tassi</name>
</author>
<author>
<name sortKey="Calegario, R F" uniqKey="Calegario R">R.F. Calegario</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Salaroli, R B" uniqKey="Salaroli R">R.B. Salaroli</name>
</author>
<author>
<name sortKey="Romao, G O" uniqKey="Romao G">G.O. Romão</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Afonso, C L" uniqKey="Afonso C">C.L. Afonso</name>
</author>
<author>
<name sortKey="Amarasinghe, G K" uniqKey="Amarasinghe G">G.K. Amarasinghe</name>
</author>
<author>
<name sortKey="Banyai, K" uniqKey="Banyai K">K. Bányai</name>
</author>
<author>
<name sortKey="Bao, Y" uniqKey="Bao Y">Y. Bào</name>
</author>
<author>
<name sortKey="Basler, C F" uniqKey="Basler C">C.F. Basler</name>
</author>
<author>
<name sortKey="Bavari, S" uniqKey="Bavari S">S. Bavari</name>
</author>
<author>
<name sortKey="Bejerman, N" uniqKey="Bejerman N">N. Bejerman</name>
</author>
<author>
<name sortKey="Blasdell, K R" uniqKey="Blasdell K">K.R. Blasdell</name>
</author>
<author>
<name sortKey="Briand, F X" uniqKey="Briand F">F.-X. Briand</name>
</author>
<author>
<name sortKey="Briese, T" uniqKey="Briese T">T. Briese</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Locali Fabris, E C" uniqKey="Locali Fabris E">E.C. Locali-Fabris</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Machado, M A" uniqKey="Machado M">M.A. Machado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Dietzgen, R G" uniqKey="Dietzgen R">R.G. Dietzgen</name>
</author>
<author>
<name sortKey="Kuhn, J H" uniqKey="Kuhn J">J.H. Kuhn</name>
</author>
<author>
<name sortKey="Clawson, A N" uniqKey="Clawson A">A.N. Clawson</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Goodin, M M" uniqKey="Goodin M">M.M. Goodin</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Kondo, H" uniqKey="Kondo H">H. Kondo</name>
</author>
<author>
<name sortKey="Wetzel, T" uniqKey="Wetzel T">T. Wetzel</name>
</author>
<author>
<name sortKey="Whitfield, A E" uniqKey="Whitfield A">A.E. Whitfield</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roy, A" uniqKey="Roy A">A. Roy</name>
</author>
<author>
<name sortKey="Leon, M G" uniqKey="Leon M">M.G. Leon</name>
</author>
<author>
<name sortKey="Stone, A L" uniqKey="Stone A">A.L. Stone</name>
</author>
<author>
<name sortKey="Schneider, W L" uniqKey="Schneider W">W.L. Schneider</name>
</author>
<author>
<name sortKey="Hartung, J" uniqKey="Hartung J">J. Hartung</name>
</author>
<author>
<name sortKey="Brlansky, R H" uniqKey="Brlansky R">R.H. Brlansky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Locali Fabris, E C" uniqKey="Locali Fabris E">E.C. Locali-Fabris</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Souza, A A" uniqKey="Souza A">A.A. Souza</name>
</author>
<author>
<name sortKey="Takita, M A" uniqKey="Takita M">M.A. Takita</name>
</author>
<author>
<name sortKey="Astua Monge, G" uniqKey="Astua Monge G">G. Astúa-Monge</name>
</author>
<author>
<name sortKey="Antonioli Luizon, R" uniqKey="Antonioli Luizon R">R. Antonioli-Luizon</name>
</author>
<author>
<name sortKey="Rodrigues, V" uniqKey="Rodrigues V">V. Rodrigues</name>
</author>
<author>
<name sortKey="Targon, M L" uniqKey="Targon M">M.L. Targon</name>
</author>
<author>
<name sortKey="Machado, M A" uniqKey="Machado M">M.A. Machado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kuchibhatla, D B" uniqKey="Kuchibhatla D">D.B. Kuchibhatla</name>
</author>
<author>
<name sortKey="Sherman, W A" uniqKey="Sherman W">W.A. Sherman</name>
</author>
<author>
<name sortKey="Chung, B Y W" uniqKey="Chung B">B.Y.W. Chung</name>
</author>
<author>
<name sortKey="Cook, S" uniqKey="Cook S">S. Cook</name>
</author>
<author>
<name sortKey="Schneider, G" uniqKey="Schneider G">G. Schneider</name>
</author>
<author>
<name sortKey="Eisenhaber, B" uniqKey="Eisenhaber B">B. Eisenhaber</name>
</author>
<author>
<name sortKey="Karlin, D G" uniqKey="Karlin D">D.G. Karlin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pascon, R C" uniqKey="Pascon R">R.C. Pascon</name>
</author>
<author>
<name sortKey="Kitajima, J P" uniqKey="Kitajima J">J.P. Kitajima</name>
</author>
<author>
<name sortKey="Breton, M C" uniqKey="Breton M">M.C. Breton</name>
</author>
<author>
<name sortKey="Assumpcao, L" uniqKey="Assumpcao L">L. Assumpção</name>
</author>
<author>
<name sortKey="Greggio, C" uniqKey="Greggio C">C. Greggio</name>
</author>
<author>
<name sortKey="Zanca, A S" uniqKey="Zanca A">A.S. Zanca</name>
</author>
<author>
<name sortKey="Okura, V K" uniqKey="Okura V">V.K. Okura</name>
</author>
<author>
<name sortKey="Alegria, M C" uniqKey="Alegria M">M.C. Alegria</name>
</author>
<author>
<name sortKey="Camargo, M E" uniqKey="Camargo M">M.E. Camargo</name>
</author>
<author>
<name sortKey="Silva, G G" uniqKey="Silva G">G.G. Silva</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Weeks, A R" uniqKey="Weeks A">A.R. Weeks</name>
</author>
<author>
<name sortKey="Marec, F" uniqKey="Marec F">F. Marec</name>
</author>
<author>
<name sortKey="Breeuwer, J A" uniqKey="Breeuwer J">J.A. Breeuwer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Childers, C C" uniqKey="Childers C">C.C. Childers</name>
</author>
<author>
<name sortKey="French, J V" uniqKey="French J">J.V. French</name>
</author>
<author>
<name sortKey="Rodrigues, J C" uniqKey="Rodrigues J">J.C. Rodrigues</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Alberti, G" uniqKey="Alberti G">G. Alberti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Domingo Calap, P" uniqKey="Domingo Calap P">P. Domingo-Calap</name>
</author>
<author>
<name sortKey="Sanjuan, R" uniqKey="Sanjuan R">R. Sanjuán</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gibbs, A" uniqKey="Gibbs A">A. Gibbs</name>
</author>
<author>
<name sortKey="Calisher, C" uniqKey="Calisher C">C. Calisher</name>
</author>
<author>
<name sortKey="Garcia Arenal, F" uniqKey="Garcia Arenal F">F. García-Arenal</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Simon Loriere, E" uniqKey="Simon Loriere E">E. Simon-Loriere</name>
</author>
<author>
<name sortKey="Holmes, E C" uniqKey="Holmes E">E.C. Holmes</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bujarski, J J" uniqKey="Bujarski J">J.J. Bujarski</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roossinck, M J" uniqKey="Roossinck M">M.J. Roossinck</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sztuba Soli Ska, J" uniqKey="Sztuba Soli Ska J">J. Sztuba-Solińska</name>
</author>
<author>
<name sortKey="Urbanowicz, A" uniqKey="Urbanowicz A">A. Urbanowicz</name>
</author>
<author>
<name sortKey="Figlerowicz, M" uniqKey="Figlerowicz M">M. Figlerowicz</name>
</author>
<author>
<name sortKey="Bujarski, J J" uniqKey="Bujarski J">J.J. Bujarski</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Greenbaum, B D" uniqKey="Greenbaum B">B.D. Greenbaum</name>
</author>
<author>
<name sortKey="Li, O T" uniqKey="Li O">O.T. Li</name>
</author>
<author>
<name sortKey="Poon, L L" uniqKey="Poon L">L.L. Poon</name>
</author>
<author>
<name sortKey="Levine, A J" uniqKey="Levine A">A.J. Levine</name>
</author>
<author>
<name sortKey="Rabadan, R" uniqKey="Rabadan R">R. Rabadan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Garcia Arenal, F" uniqKey="Garcia Arenal F">F. García-Arenal</name>
</author>
<author>
<name sortKey="Fraile, A" uniqKey="Fraile A">A. Fraile</name>
</author>
<author>
<name sortKey="Malpica, J M" uniqKey="Malpica J">J.M. Malpica</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gutierrez, S" uniqKey="Gutierrez S">S. Gutiérrez</name>
</author>
<author>
<name sortKey="Michalakis, Y" uniqKey="Michalakis Y">Y. Michalakis</name>
</author>
<author>
<name sortKey="Blanc, S" uniqKey="Blanc S">S. Blanc</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Acosta Leal, R" uniqKey="Acosta Leal R">R. Acosta-Leal</name>
</author>
<author>
<name sortKey="Duffy, S" uniqKey="Duffy S">S. Duffy</name>
</author>
<author>
<name sortKey="Xiong, Z" uniqKey="Xiong Z">Z. Xiong</name>
</author>
<author>
<name sortKey="Hammond, R W" uniqKey="Hammond R">R.W. Hammond</name>
</author>
<author>
<name sortKey="Elena, S F" uniqKey="Elena S">S.F. Elena</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Neves, M F" uniqKey="Neves M">M.F. Neves</name>
</author>
<author>
<name sortKey="Trombin, V G" uniqKey="Trombin V">V.G. Trombin</name>
</author>
<author>
<name sortKey="Lopes, F F" uniqKey="Lopes F">F.F. Lopes</name>
</author>
<author>
<name sortKey="Kalaki, R" uniqKey="Kalaki R">R. Kalaki</name>
</author>
<author>
<name sortKey="Milan, P" uniqKey="Milan P">P. Milan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nunes, M A" uniqKey="Nunes M">M.A. Nunes</name>
</author>
<author>
<name sortKey="Bergamini, M P" uniqKey="Bergamini M">M.P. Bergamini</name>
</author>
<author>
<name sortKey="Coerini, L F" uniqKey="Coerini L">L.F. Coerini</name>
</author>
<author>
<name sortKey="Bastianel, M" uniqKey="Bastianel M">M. Bastianel</name>
</author>
<author>
<name sortKey="Novelli, V M" uniqKey="Novelli V">V.M. Novelli</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guerra, A" uniqKey="Guerra A">A. Guerra</name>
</author>
<author>
<name sortKey="Manjunath, K" uniqKey="Manjunath K">K. Manjunath</name>
</author>
<author>
<name sortKey="Rangel, E" uniqKey="Rangel E">E. Rangel</name>
</author>
<author>
<name sortKey="Brlansky, R H" uniqKey="Brlansky R">R.H. Brlansky</name>
</author>
<author>
<name sortKey="Lee, R F" uniqKey="Lee R">R.F. Lee</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Locali, E C" uniqKey="Locali E">E.C. Locali</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="De Souza, A A" uniqKey="De Souza A">A.A. de Souza</name>
</author>
<author>
<name sortKey="Takita, M A" uniqKey="Takita M">M.A. Takita</name>
</author>
<author>
<name sortKey="Astua Monge, G" uniqKey="Astua Monge G">G. Astúa-Monge</name>
</author>
<author>
<name sortKey="Antonioli, R" uniqKey="Antonioli R">R. Antonioli</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Machado, M A" uniqKey="Machado M">M.A. Machado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Untergasser, A" uniqKey="Untergasser A">A. Untergasser</name>
</author>
<author>
<name sortKey="Cutcutache, I" uniqKey="Cutcutache I">I. Cutcutache</name>
</author>
<author>
<name sortKey="Koressaar, T" uniqKey="Koressaar T">T. Koressaar</name>
</author>
<author>
<name sortKey="Ye, J" uniqKey="Ye J">J. Ye</name>
</author>
<author>
<name sortKey="Faircloth, B C" uniqKey="Faircloth B">B.C. Faircloth</name>
</author>
<author>
<name sortKey="Remm, M" uniqKey="Remm M">M. Remm</name>
</author>
<author>
<name sortKey="Rozen, S G" uniqKey="Rozen S">S.G. Rozen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Edgar, R C" uniqKey="Edgar R">R.C. Edgar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tamura, K" uniqKey="Tamura K">K. Tamura</name>
</author>
<author>
<name sortKey="Stecher, G" uniqKey="Stecher G">G. Stecher</name>
</author>
<author>
<name sortKey="Peterson, D" uniqKey="Peterson D">D. Peterson</name>
</author>
<author>
<name sortKey="Filipski, A" uniqKey="Filipski A">A. Filipski</name>
</author>
<author>
<name sortKey="Kumar, S" uniqKey="Kumar S">S. Kumar</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Librado, P" uniqKey="Librado P">P. Librado</name>
</author>
<author>
<name sortKey="Rozas, J" uniqKey="Rozas J">J. Rozas</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Delport, W" uniqKey="Delport W">W. Delport</name>
</author>
<author>
<name sortKey="Poon, A F" uniqKey="Poon A">A.F. Poon</name>
</author>
<author>
<name sortKey="Frost, S D" uniqKey="Frost S">S.D. Frost</name>
</author>
<author>
<name sortKey="Kosakovsky Pond, S L" uniqKey="Kosakovsky Pond S">S.L. Kosakovsky Pond</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kosakovsky Pond, S L" uniqKey="Kosakovsky Pond S">S.L. Kosakovsky Pond</name>
</author>
<author>
<name sortKey="Posada, D" uniqKey="Posada D">D. Posada</name>
</author>
<author>
<name sortKey="Gravenor, M B" uniqKey="Gravenor M">M.B. Gravenor</name>
</author>
<author>
<name sortKey="Woelk, C H" uniqKey="Woelk C">C.H. Woelk</name>
</author>
<author>
<name sortKey="Frost, S D W" uniqKey="Frost S">S.D.W. Frost</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Martin, D P" uniqKey="Martin D">D.P. Martin</name>
</author>
<author>
<name sortKey="Murrell, B" uniqKey="Murrell B">B. Murrell</name>
</author>
<author>
<name sortKey="Golden, M" uniqKey="Golden M">M. Golden</name>
</author>
<author>
<name sortKey="Khoosal, A" uniqKey="Khoosal A">A. Khoosal</name>
</author>
<author>
<name sortKey="Muhire, B" uniqKey="Muhire B">B. Muhire</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pei, J" uniqKey="Pei J">J. Pei</name>
</author>
<author>
<name sortKey="Grishin, N V" uniqKey="Grishin N">N.V. Grishin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Notredame, C" uniqKey="Notredame C">C. Notredame</name>
</author>
<author>
<name sortKey="Higgins, D G" uniqKey="Higgins D">D.G. Higgins</name>
</author>
<author>
<name sortKey="Heringa, J" uniqKey="Heringa J">J. Heringa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Robert, X" uniqKey="Robert X">X. Robert</name>
</author>
<author>
<name sortKey="Gouet, P" uniqKey="Gouet P">P. Gouet</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zerbino, D R" uniqKey="Zerbino D">D.R. Zerbino</name>
</author>
<author>
<name sortKey="Birney, E" uniqKey="Birney E">E. Birney</name>
</author>
</analytic>
</biblStruct>
<biblStruct></biblStruct>
<biblStruct></biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Knudsen, T" uniqKey="Knudsen T">T. Knudsen</name>
</author>
<author>
<name sortKey="Knudsen, B" uniqKey="Knudsen B">B. Knudsen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Tamura, K" uniqKey="Tamura K">K. Tamura</name>
</author>
<author>
<name sortKey="Nei, M" uniqKey="Nei M">M. Nei</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hasegawa, M" uniqKey="Hasegawa M">M. Hasegawa</name>
</author>
<author>
<name sortKey="Kishino, H" uniqKey="Kishino H">H. Kishino</name>
</author>
<author>
<name sortKey="Yano, T" uniqKey="Yano T">T. Yano</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pond, S L" uniqKey="Pond S">S.L. Pond</name>
</author>
<author>
<name sortKey="Frost, S D" uniqKey="Frost S">S.D. Frost</name>
</author>
<author>
<name sortKey="Muse, S V" uniqKey="Muse S">S.V. Muse</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rozanov, M N" uniqKey="Rozanov M">M.N. Rozanov</name>
</author>
<author>
<name sortKey="Koonin, E V" uniqKey="Koonin E">E.V. Koonin</name>
</author>
<author>
<name sortKey="Gorbalenya, A E" uniqKey="Gorbalenya A">A.E. Gorbalenya</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wierzchoslawski, R" uniqKey="Wierzchoslawski R">R. Wierzchoslawski</name>
</author>
<author>
<name sortKey="Dzianott, A" uniqKey="Dzianott A">A. Dzianott</name>
</author>
<author>
<name sortKey="Bujarski, J" uniqKey="Bujarski J">J. Bujarski</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Wierzchoslawski, R" uniqKey="Wierzchoslawski R">R. Wierzchoslawski</name>
</author>
<author>
<name sortKey="Dzianott, A" uniqKey="Dzianott A">A. Dzianott</name>
</author>
<author>
<name sortKey="Kunimalayan, S" uniqKey="Kunimalayan S">S. Kunimalayan</name>
</author>
<author>
<name sortKey="Bujarski, J J" uniqKey="Bujarski J">J.J. Bujarski</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Martin, S" uniqKey="Martin S">S. Martin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Rubio, L" uniqKey="Rubio L">L. Rubio</name>
</author>
<author>
<name sortKey="Ayll N, M A" uniqKey="Ayll N M">M.A. Ayllón</name>
</author>
<author>
<name sortKey="Kong, P" uniqKey="Kong P">P. Kong</name>
</author>
<author>
<name sortKey="Fernandez, A" uniqKey="Fernandez A">A. Fernández</name>
</author>
<author>
<name sortKey="Polek, M" uniqKey="Polek M">M. Polek</name>
</author>
<author>
<name sortKey="Guerri, J" uniqKey="Guerri J">J. Guerri</name>
</author>
<author>
<name sortKey="Moreno, P" uniqKey="Moreno P">P. Moreno</name>
</author>
<author>
<name sortKey="Falk, B W" uniqKey="Falk B">B.W. Falk</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vives, M C" uniqKey="Vives M">M.C. Vives</name>
</author>
<author>
<name sortKey="Rubio, L" uniqKey="Rubio L">L. Rubio</name>
</author>
<author>
<name sortKey="Galipienso, L" uniqKey="Galipienso L">L. Galipienso</name>
</author>
<author>
<name sortKey="Navarro, L" uniqKey="Navarro L">L. Navarro</name>
</author>
<author>
<name sortKey="Moreno, P" uniqKey="Moreno P">P. Moreno</name>
</author>
<author>
<name sortKey="Guerri, J" uniqKey="Guerri J">J. Guerri</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hartung, J S" uniqKey="Hartung J">J.S. Hartung</name>
</author>
<author>
<name sortKey="Roy, A" uniqKey="Roy A">A. Roy</name>
</author>
<author>
<name sortKey="Fu, S" uniqKey="Fu S">S. Fu</name>
</author>
<author>
<name sortKey="Shao, J" uniqKey="Shao J">J. Shao</name>
</author>
<author>
<name sortKey="Schneider, W L" uniqKey="Schneider W">W.L. Schneider</name>
</author>
<author>
<name sortKey="Brlansky, R H" uniqKey="Brlansky R">R.H. Brlansky</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bastianel, M" uniqKey="Bastianel M">M. Bastianel</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Nicolini, F" uniqKey="Nicolini F">F. Nicolini</name>
</author>
<author>
<name sortKey="Segatti, N" uniqKey="Segatti N">N. Segatti</name>
</author>
<author>
<name sortKey="Novelli, V M" uniqKey="Novelli V">V.M. Novelli</name>
</author>
<author>
<name sortKey="Rodrigues, V" uniqKey="Rodrigues V">V. Rodrigues</name>
</author>
<author>
<name sortKey="Medina, C L" uniqKey="Medina C">C.L. Medina</name>
</author>
<author>
<name sortKey="Machado, M A" uniqKey="Machado M">M.A. Machado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arena, G D" uniqKey="Arena G">G.D. Arena</name>
</author>
<author>
<name sortKey="Bergamini, M P" uniqKey="Bergamini M">M.P. Bergamini</name>
</author>
<author>
<name sortKey="Tassi, A D" uniqKey="Tassi A">A.D. Tassi</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Kubo, K S" uniqKey="Kubo K">K.S. Kubo</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nunes, M A" uniqKey="Nunes M">M.A. Nunes</name>
</author>
<author>
<name sortKey="Lameiro, P" uniqKey="Lameiro P">P. Lameiro</name>
</author>
<author>
<name sortKey="Calegario, R F" uniqKey="Calegario R">R.F. Calegario</name>
</author>
<author>
<name sortKey="Bergamini, M" uniqKey="Bergamini M">M. Bergamini</name>
</author>
<author>
<name sortKey="Fender, L" uniqKey="Fender L">L. Fender</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Bastianel, M" uniqKey="Bastianel M">M. Bastianel</name>
</author>
<author>
<name sortKey="Novelli, V M" uniqKey="Novelli V">V.M. Novelli</name>
</author>
<author>
<name sortKey="Freita Astua, J" uniqKey="Freita Astua J">J. Freita-Astua</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Pu, Y" uniqKey="Pu Y">Y. Pu</name>
</author>
<author>
<name sortKey="Kikuchi, A" uniqKey="Kikuchi A">A. Kikuchi</name>
</author>
<author>
<name sortKey="Moriyasu, Y" uniqKey="Moriyasu Y">Y. Moriyasu</name>
</author>
<author>
<name sortKey="Tomaru, M" uniqKey="Tomaru M">M. Tomaru</name>
</author>
<author>
<name sortKey="Jin, Y" uniqKey="Jin Y">Y. Jin</name>
</author>
<author>
<name sortKey="Suga, H" uniqKey="Suga H">H. Suga</name>
</author>
<author>
<name sortKey="Hagiwara, K" uniqKey="Hagiwara K">K. Hagiwara</name>
</author>
<author>
<name sortKey="Akita, F" uniqKey="Akita F">F. Akita</name>
</author>
<author>
<name sortKey="Shimizu, T" uniqKey="Shimizu T">T. Shimizu</name>
</author>
<author>
<name sortKey="Netsu, O" uniqKey="Netsu O">O. Netsu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sin, S H" uniqKey="Sin S">S.-H. Sin</name>
</author>
<author>
<name sortKey="Mcnulty, B C" uniqKey="Mcnulty B">B.C. McNulty</name>
</author>
<author>
<name sortKey="Kennedy, G G" uniqKey="Kennedy G">G.G. Kennedy</name>
</author>
<author>
<name sortKey="Moyer, J W" uniqKey="Moyer J">J.W. Moyer</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mushegian, A R" uniqKey="Mushegian A">A.R. Mushegian</name>
</author>
<author>
<name sortKey="Elena, S F" uniqKey="Elena S">S.F. Elena</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Weber, P H" uniqKey="Weber P">P.H. Weber</name>
</author>
<author>
<name sortKey="Bujarski, J J" uniqKey="Bujarski J">J.J. Bujarski</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arrivabem, F" uniqKey="Arrivabem F">F. Arrivabem</name>
</author>
<author>
<name sortKey="Rodrigues, V" uniqKey="Rodrigues V">V. Rodrigues</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
<author>
<name sortKey="Bastianel, M" uniqKey="Bastianel M">M. Bastianel</name>
</author>
<author>
<name sortKey="Locali Fabris, E C" uniqKey="Locali Fabris E">E.C. Locali-Fabris</name>
</author>
<author>
<name sortKey="Antonioli Luizon, R" uniqKey="Antonioli Luizon R">R. Antonioli-Luizon</name>
</author>
<author>
<name sortKey="Novelli, V M" uniqKey="Novelli V">V.M. Novelli</name>
</author>
<author>
<name sortKey="Kitajima, E W" uniqKey="Kitajima E">E.W. Kitajima</name>
</author>
<author>
<name sortKey="Machado, M A" uniqKey="Machado M">M.A. Machado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sanchez Velazquez, E J" uniqKey="Sanchez Velazquez E">E.J. Sánchez-Velázquez</name>
</author>
<author>
<name sortKey="Santillan Galicia, M T" uniqKey="Santillan Galicia M">M.T. Santillán-Galicia</name>
</author>
<author>
<name sortKey="Novelli, V M" uniqKey="Novelli V">V.M. Novelli</name>
</author>
<author>
<name sortKey="Nunes, M A" uniqKey="Nunes M">M.A. Nunes</name>
</author>
<author>
<name sortKey="Mora Aguilera, G" uniqKey="Mora Aguilera G">G. Mora-Aguilera</name>
</author>
<author>
<name sortKey="Valdez Carrasco, J M" uniqKey="Valdez Carrasco J">J.M. Valdez-Carrasco</name>
</author>
<author>
<name sortKey="Otero Colina, G" uniqKey="Otero Colina G">G. Otero-Colina</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astúa</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Viruses</journal-id>
<journal-id journal-id-type="iso-abbrev">Viruses</journal-id>
<journal-id journal-id-type="publisher-id">viruses</journal-id>
<journal-title-group>
<journal-title>Viruses</journal-title>
</journal-title-group>
<issn pub-type="epub">1999-4915</issn>
<publisher>
<publisher-name>MDPI</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">27275832</article-id>
<article-id pub-id-type="pmc">4926173</article-id>
<article-id pub-id-type="doi">10.3390/v8060153</article-id>
<article-id pub-id-type="publisher-id">viruses-08-00153</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Phylogenetic and Molecular Variability Studies Reveal a New Genetic Clade of
<italic>Citrus leprosis virus C</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Ramos-González</surname>
<given-names>Pedro Luis</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-08-00153">1</xref>
<xref ref-type="aff" rid="af2-viruses-08-00153">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chabi-Jesus</surname>
<given-names>Camila</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-08-00153">1</xref>
<xref ref-type="aff" rid="af2-viruses-08-00153">2</xref>
<xref ref-type="aff" rid="af3-viruses-08-00153">3</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Guerra-Peraza</surname>
<given-names>Orlene</given-names>
</name>
<xref ref-type="aff" rid="af2-viruses-08-00153">2</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Breton</surname>
<given-names>Michèle Claire</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-08-00153">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Arena</surname>
<given-names>Gabriella Dias</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-08-00153">1</xref>
<xref ref-type="aff" rid="af4-viruses-08-00153">4</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Nunes</surname>
<given-names>Maria Andreia</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-08-00153">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kitajima</surname>
<given-names>Elliot Watanabe</given-names>
</name>
<xref ref-type="aff" rid="af5-viruses-08-00153">5</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Machado</surname>
<given-names>Marcos Antonio</given-names>
</name>
<xref ref-type="aff" rid="af1-viruses-08-00153">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Freitas-Astúa</surname>
<given-names>Juliana</given-names>
</name>
<xref ref-type="aff" rid="af2-viruses-08-00153">2</xref>
<xref ref-type="aff" rid="af6-viruses-08-00153">6</xref>
<xref rid="c1-viruses-08-00153" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<contrib-group>
<contrib contrib-type="editor">
<name>
<surname>Hohn</surname>
<given-names>Thomas</given-names>
</name>
<role>Academic Editor</role>
</contrib>
</contrib-group>
<aff id="af1-viruses-08-00153">
<label>1</label>
Laboratório de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, São Paulo 13490-970, Brazil;
<email>plrg1970@gmail.com</email>
(P.L.R.-G.);
<email>millachabi@yahoo.com.br</email>
(C.C.-J.);
<email>mbreton@uol.com.br</email>
(M.C.B.);
<email>gaby.arena@gmail.com</email>
(G.D.A.);
<email>mandreian@yahoo.com</email>
(M.A.N.);
<email>marcos@centrodecitricultura.br</email>
(M.A.M.)</aff>
<aff id="af2-viruses-08-00153">
<label>2</label>
Departamento de Bioquímica Fitopatológica, Instituto Biológico, São Paulo 04014-002, Brazil;
<email>onelio@protonmail.com</email>
</aff>
<aff id="af3-viruses-08-00153">
<label>3</label>
Departamento de Microbiologia Agrícola, Escola Superior de Agricultura Luiz de Queiroz, Universidade de São Paulo, Piracicaba, São Paulo 13418-900, Brazil</aff>
<aff id="af4-viruses-08-00153">
<label>4</label>
Instituto de Biologia, Universidade de Campinas, Campinas, São Paulo 13083-970, Brazil</aff>
<aff id="af5-viruses-08-00153">
<label>5</label>
Departamento de Fitopatologia e Nematologia, Escola Superior de Agricultura Luiz de Queiroz, Universidade de São Paulo, Piracicaba, São Paulo 13418-900, Brazil;
<email>ewkitaji@usp.br</email>
</aff>
<aff id="af6-viruses-08-00153">
<label>6</label>
Embrapa Cassava and Fruits, Cruz das Almas, Bahia 44380-000, Brazil</aff>
<author-notes>
<corresp id="c1-viruses-08-00153">
<label>*</label>
Correspondence:
<email>juliana.astua@embrapa.br</email>
; Tel.: +55-11-5087-1767</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>06</day>
<month>6</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="collection">
<month>6</month>
<year>2016</year>
</pub-date>
<volume>8</volume>
<issue>6</issue>
<elocation-id>153</elocation-id>
<history>
<date date-type="received">
<day>11</day>
<month>3</month>
<year>2016</year>
</date>
<date date-type="accepted">
<day>24</day>
<month>5</month>
<year>2016</year>
</date>
</history>
<permissions>
<copyright-statement>© 2016 by the authors; licensee MDPI, Basel, Switzerland.</copyright-statement>
<copyright-year>2016</copyright-year>
<license>
<license-p>
<pmc-comment>CREATIVE COMMONS</pmc-comment>
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
).</license-p>
</license>
</permissions>
<abstract>
<p>
<italic>Citrus leprosis virus C</italic>
(CiLV-C) causes a severe disease affecting citrus orchards in the Western hemisphere. This study reveals the molecular variability of the virus by analyzing four genomic regions (
<italic>p29</italic>
,
<italic>p15</italic>
,
<italic>MP</italic>
and RNA2-intergenic region) distributed over its two RNAs. Nucleotide diversity (π) values were relatively low but statistically different over the analyzed genes and subpopulations, indicating their distinct evolutionary history. Values of π
<italic>
<sub>p</sub>
</italic>
<sub>29</sub>
and π
<italic>
<sub>MP</sub>
</italic>
were higher than those of π
<italic>
<sub>p</sub>
</italic>
<sub>15</sub>
and π
<sub>RNA2–IR,</sub>
whereas π
<italic>
<sub>MP</sub>
</italic>
was increased due to novel discovered isolates phylogenetically clustered in a divergent clade that we called SJP. Isolate BR_SP_SJP_01 RNA1 and RNA2 sequences, clade SJP, showed an identity of 85.6% and 88.4%, respectively, with those corresponding to CiLV-C, the type member of the genus
<italic>Cilevirus</italic>
, and its RNA2 5′-proximal region was revealed as a minor donor in a putative inter-clade recombination event. In addition to citrus, BR_SP_SJP_01 naturally infects the weed
<italic>Commelina benghalensis</italic>
and is efficiently transmitted by
<italic>Brevipalpus yothersi</italic>
mites. Our data demonstrated that negative selection was the major force operating in the evaluated viral coding regions and defined amino acids putatively relevant for the biological function of cilevirus proteins. This work provides molecular tools and sets up a framework for further epidemiological studies.</p>
</abstract>
<kwd-group>
<kwd>cilevirus</kwd>
<kwd>citrus leprosis</kwd>
<kwd>
<italic>Brevipalpus</italic>
-transmitted viruses</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec id="sec1-viruses-08-00153">
<title>1. Introduction</title>
<p>Citrus leprosis is considered a re-emerging and serious viral disease threatening citrus production [
<xref rid="B1-viruses-08-00153" ref-type="bibr">1</xref>
]. The infection decreases plant lifespan and affects fruit quality, reducing yields and increasing production costs of citrus orchards. Endemic in the Americas, leprosis was first observed in Florida, USA, São Paulo State, Brazil, and restricted areas of Argentina and Paraguay at the beginning of the 20th century [
<xref rid="B2-viruses-08-00153" ref-type="bibr">2</xref>
,
<xref rid="B3-viruses-08-00153" ref-type="bibr">3</xref>
,
<xref rid="B4-viruses-08-00153" ref-type="bibr">4</xref>
,
<xref rid="B5-viruses-08-00153" ref-type="bibr">5</xref>
]. After the 1960s, the disease disappeared from Florida [
<xref rid="B6-viruses-08-00153" ref-type="bibr">6</xref>
], but in the Southern region of South America it became prevalent occurring in most of the Brazilian citrus growing areas [
<xref rid="B7-viruses-08-00153" ref-type="bibr">7</xref>
,
<xref rid="B8-viruses-08-00153" ref-type="bibr">8</xref>
]. More recently, Bolivia, Colombia, Venezuela, all of the Central American countries and Mexico have been incorporated to the citrus leprosis distribution map [
<xref rid="B9-viruses-08-00153" ref-type="bibr">9</xref>
,
<xref rid="B10-viruses-08-00153" ref-type="bibr">10</xref>
,
<xref rid="B11-viruses-08-00153" ref-type="bibr">11</xref>
,
<xref rid="B12-viruses-08-00153" ref-type="bibr">12</xref>
,
<xref rid="B13-viruses-08-00153" ref-type="bibr">13</xref>
,
<xref rid="B14-viruses-08-00153" ref-type="bibr">14</xref>
,
<xref rid="B15-viruses-08-00153" ref-type="bibr">15</xref>
,
<xref rid="B16-viruses-08-00153" ref-type="bibr">16</xref>
,
<xref rid="B17-viruses-08-00153" ref-type="bibr">17</xref>
,
<xref rid="B18-viruses-08-00153" ref-type="bibr">18</xref>
,
<xref rid="B19-viruses-08-00153" ref-type="bibr">19</xref>
]. Outside of mainland America, symptoms associated with citrus leprosis have been confirmed only in Hawaii, USA [
<xref rid="B20-viruses-08-00153" ref-type="bibr">20</xref>
,
<xref rid="B21-viruses-08-00153" ref-type="bibr">21</xref>
].</p>
<p>Viruses causing citrus leprosis show bacilliform particles and are persistently transmitted by false spider mites of the genus
<italic>Brevipalpus</italic>
(Acari:
<italic>Tenuipalpidae</italic>
) [
<xref rid="B22-viruses-08-00153" ref-type="bibr">22</xref>
,
<xref rid="B23-viruses-08-00153" ref-type="bibr">23</xref>
,
<xref rid="B24-viruses-08-00153" ref-type="bibr">24</xref>
,
<xref rid="B25-viruses-08-00153" ref-type="bibr">25</xref>
]. They induce localized necrotic or chlorotic lesions around the mite-feeding sites and viral systemic movement has not been reported in any of their known natural or experimental hosts (
<xref ref-type="fig" rid="viruses-08-00153-f001">Figure 1</xref>
a) [
<xref rid="B26-viruses-08-00153" ref-type="bibr">26</xref>
,
<xref rid="B27-viruses-08-00153" ref-type="bibr">27</xref>
]. Citrus leprosis associated viruses display heterogeneous genomic features so they are taxonomically classified in three distinct genera:
<italic>Cilevirus</italic>
,
<italic>Higrevirus</italic>
and
<italic>Dichorhavirus</italic>
[
<xref rid="B20-viruses-08-00153" ref-type="bibr">20</xref>
,
<xref rid="B28-viruses-08-00153" ref-type="bibr">28</xref>
,
<xref rid="B29-viruses-08-00153" ref-type="bibr">29</xref>
,
<xref rid="B30-viruses-08-00153" ref-type="bibr">30</xref>
]. During replication these viruses induce either nuclear or cytoplasmic cellular malformations, distinguishing two forms of the disease: the nuclear and cytoplasmic types, respectively. By far these two features are the most extensively used to differentiate the citrus leprosis causal agents [
<xref rid="B22-viruses-08-00153" ref-type="bibr">22</xref>
,
<xref rid="B24-viruses-08-00153" ref-type="bibr">24</xref>
].</p>
<p>Occurrence of leprosis of the nuclear type in Panama and in some regions of Brazil was reported, although the molecular identity of the associated viruses was not identified [
<xref rid="B22-viruses-08-00153" ref-type="bibr">22</xref>
]. In Mexico and Colombia, this type of the disease was reported as caused by two closely related citrus strains of the species
<italic>Orchid fleck virus</italic>
(OFV) (synonym citrus leprosis virus nuclear type (CiLV-N) and citrus necrotic spot virus (CiNSV)), which is considered the type member of the genus
<italic>Dichorhavirus</italic>
(bipartite, negative-sense (−) single-stranded (ss) RNA) [
<xref rid="B12-viruses-08-00153" ref-type="bibr">12</xref>
,
<xref rid="B13-viruses-08-00153" ref-type="bibr">13</xref>
,
<xref rid="B30-viruses-08-00153" ref-type="bibr">30</xref>
,
<xref rid="B31-viruses-08-00153" ref-type="bibr">31</xref>
]. In spite of that, the typical and prevalent leprosis in citrus orchards from Mexico to Argentina is of the cytoplasmic type caused by isolates of
<italic>Citrus leprosis virus C</italic>
(CiLV-C, type species of the genus
<italic>Cilevirus</italic>
, bipartite positive-sense (+) ssRNA genome) [
<xref rid="B22-viruses-08-00153" ref-type="bibr">22</xref>
,
<xref rid="B29-viruses-08-00153" ref-type="bibr">29</xref>
]. In some areas of Colombia, cytoplasmic leprosis is also caused by isolates of
<italic>Citrus leprosis virus C 2</italic>
(CiLV-C2, a proposed member of the cilevirus genus). A related isolate of CiLV-C2, found infecting ornamental hibiscus (
<italic>Hibiscus</italic>
sp.) in Hawaii (CiLV-C2 Hw), shows a global amino acid identity of 92% with CiLV-C2 [
<xref rid="B21-viruses-08-00153" ref-type="bibr">21</xref>
]. In Hawaii, leprosis-like symptoms in
<italic>Citrus volkameriana</italic>
trees are associated to the presence of
<italic>Hibiscus green spot virus 2</italic>
(HGSV-2) [
<xref rid="B20-viruses-08-00153" ref-type="bibr">20</xref>
], the type and single member of the genus
<italic>Higrevirus</italic>
(tripartite (+) ssRNA genome).</p>
<p>Each genomic component of CiLV-C contains a cap structure at the 5′ region and a poly(A) tail at the 3′-terminal. RNA1 (8.7 kb) encodes for two open reading frames (ORFs) identified as the RNA-dependent RNA polymerase and the putative coat protein (
<italic>p29</italic>
), while RNA2 (4.9 kb) encodes for four ORFs recognized as
<italic>p15</italic>
,
<italic>p61</italic>
, putative movement protein (
<italic>MP</italic>
) and
<italic>p24</italic>
(
<xref ref-type="fig" rid="viruses-08-00153-f001">Figure 1</xref>
b) [
<xref rid="B32-viruses-08-00153" ref-type="bibr">32</xref>
]. MP shares a conserved domain with the 30K superfamily of viral plant movement proteins [
<xref rid="B32-viruses-08-00153" ref-type="bibr">32</xref>
], and P24 and P61 proteins show a distant homology with putative structural proteins encoded by blunerviruses and negeviruses [
<xref rid="B33-viruses-08-00153" ref-type="bibr">33</xref>
]. CiLV-C RNA1 acts as template for generation of the sub-genomic RNA1 (sgRNA1) of 0.7 kb specific for
<italic>p29</italic>
gene translation and RNA2 generates another three 3′-coterminal sgRNAs within 3 kb (sgRNA2), 1.5 kb (sgRNA3) and 0.6 kb (sgRNA4), probably involved in the expression of
<italic>p61</italic>
,
<italic>mp</italic>
and
<italic>p24</italic>
genes, respectively [
<xref rid="B34-viruses-08-00153" ref-type="bibr">34</xref>
]. RNA2 harbors a large intergenic region (IR) of circa 1130 nt in length, located between the
<italic>p15</italic>
and
<italic>p61</italic>
genes. Overall, CiLV-C2 shows a similar genome organization to CiLV-C and globally their genomes share 55% nucleotide identity. The lowest values of nucleotide identity among these viruses correspond to the stretch covering the
<italic>p15</italic>
and IR in the RNA2 molecule [
<xref rid="B21-viruses-08-00153" ref-type="bibr">21</xref>
].</p>
<p>Plant to plant transmission of viruses causing the cytoplasmic type of leprosis is known to be mainly mediated by the mite species
<italic>Brevipalpus yothersi</italic>
Baker (synonym
<italic>B. phoenicis</italic>
Geijskes citrus type) [
<xref rid="B1-viruses-08-00153" ref-type="bibr">1</xref>
,
<xref rid="B25-viruses-08-00153" ref-type="bibr">25</xref>
].
<italic>Brevipalpus</italic>
populations are mostly composed of females which reproduce by thelytokous parthenogenesis [
<xref rid="B35-viruses-08-00153" ref-type="bibr">35</xref>
].
<italic>B. yothersi</italic>
is worldwide distributed, polyphagous, and after a short period of virus acquisition during any of the four active phases of its life span, persistently transmits CiLV-C [
<xref rid="B36-viruses-08-00153" ref-type="bibr">36</xref>
,
<xref rid="B37-viruses-08-00153" ref-type="bibr">37</xref>
]. Evidence of transovarial transmission of the virus in mites has not been obtained, whereas viral multiplication in the vector has been suggested [
<xref rid="B1-viruses-08-00153" ref-type="bibr">1</xref>
].</p>
<p>Absence of proofreading activity in the RNA-dependent RNA polymerases leads to high mutation rates and potential generation of genetic diversity in RNA viruses [
<xref rid="B38-viruses-08-00153" ref-type="bibr">38</xref>
,
<xref rid="B39-viruses-08-00153" ref-type="bibr">39</xref>
]. Additionally, variability could be also introduced by recombination and reassortment among the segments of split genomes [
<xref rid="B40-viruses-08-00153" ref-type="bibr">40</xref>
,
<xref rid="B41-viruses-08-00153" ref-type="bibr">41</xref>
,
<xref rid="B42-viruses-08-00153" ref-type="bibr">42</xref>
,
<xref rid="B43-viruses-08-00153" ref-type="bibr">43</xref>
,
<xref rid="B44-viruses-08-00153" ref-type="bibr">44</xref>
]. However, continuous constraints on the population by bottlenecks both within hosts and when the virus is plant-to-plant transmitted may account for a genetic diversity lower than expected, as verified for many plant virus species [
<xref rid="B45-viruses-08-00153" ref-type="bibr">45</xref>
]. At the same time, changes in biotic or abiotic factors (e.g., interaction with new hosts or vectors) shape the virus population allowing the emergency of low frequency haplotypes. Those better adapted to the novel imposed selection pressures could be the potential origin of novel epidemics [
<xref rid="B46-viruses-08-00153" ref-type="bibr">46</xref>
,
<xref rid="B47-viruses-08-00153" ref-type="bibr">47</xref>
].</p>
<p>Leprosis is considered the main viral disease affecting citrus orchards in Brazil, the leading sweet orange producer in the world [
<xref rid="B48-viruses-08-00153" ref-type="bibr">48</xref>
]. Considering that extensive understanding about pathogens may positively impact disease management strategies [
<xref rid="B47-viruses-08-00153" ref-type="bibr">47</xref>
], we examined the population of leprosis associated viruses in Brazil. As a result, we identified the presence of CiLV-C as the only virus causing citrus leprosis in all analyzed samples, and detected the existence of a second clade within the screened population. Complete genomic sequence of one member of the new clade was obtained and characterized. The study identified codons under selection in the
<italic>p29</italic>
,
<italic>p15</italic>
and
<italic>MP</italic>
genes, which might be relevant during the replication cycle of cileviruses. It also allowed us to assess the genetic variability of CiLV-C and provided an insight into the evolutionary history of cileviruses. Moreover, we described primer pairs to differentially detect the presence of CiLV-C isolates belonging to the two phylogenetic clades identified in this work giving support for further epidemiological studies.</p>
</sec>
<sec id="sec2-viruses-08-00153">
<title>2. Materials and Methods</title>
<sec id="sec2dot1-viruses-08-00153">
<title>2.1. Leprosis Surveys, Virus Detection and Isolates</title>
<p>A total of 48 samples collected during 2012–2015 were analysed in this study (
<xref ref-type="table" rid="viruses-08-00153-t001">Table 1</xref>
). Among them, 45 samples corresponded to citrus (
<italic>Citrus sinensis</italic>
L. Osb.) leaves exhibiting necrotic or chlorotic symptoms were collected in commercial orchards or small private yards in all geographic regions throughout Brazil. A citrus sample from Argentina and two tropical spiderwort (
<italic>Commelina benghalensis</italic>
) plants exhibiting symptoms of CiLV-C infection [
<xref rid="B49-viruses-08-00153" ref-type="bibr">49</xref>
] were also included. Symptomatic leaf tissues were cut, ground in liquid nitrogen and kept at −80 °C until further processing.</p>
<p>All samples were assayed for detection of CiLV-C, CiLV-C2 and the citrus strain of OFV (synonym CiLV-N). Total RNA was obtained from approximately 100 mg of leaves using TRIZOL
<sup>®</sup>
Reagent and following the manufacturer’s recommendations (Life Technologies, Foster City, CA, USA). cDNA (500 ng of total RNA) were generated using RevertAid H Minus First Strand cDNA Synthesis Kit as described by the manufacturer (Thermo Scientific, Madison, WI, USA), using random hexamer primers. Three to five µL of the cDNA solution were taken for PCR using specific primers for the detection of CiLV-C, CiLV-C2 and CiLV-N [
<xref rid="B14-viruses-08-00153" ref-type="bibr">14</xref>
,
<xref rid="B31-viruses-08-00153" ref-type="bibr">31</xref>
,
<xref rid="B51-viruses-08-00153" ref-type="bibr">51</xref>
]. PCR products were separated on 1.0% agarose gels in 1X Tris-acetate-Ethylenediaminetetraacetic acid (TAE) and visualized with ethidium bromide (0.1 μg/mL).</p>
</sec>
<sec id="sec2dot2-viruses-08-00153">
<title>2.2. Sequencing of the RNA2-Intergenic Region and p29, p15 and Partial MP Genes of CiLV-C Isolates</title>
<p>To assess the molecular variability of CiLV-C, fragments of 864 nt spanning the ORF
<italic>p29</italic>
in RNA1, were amplified using the primer pair (5′-ATGAGTATCGTAACTTTCACTTTGAC-3′/5′-ACCAGAGATTAGCGATTCAAAA-3′). In RNA2, amplicons of 667 nt containing the ORF
<italic>p15</italic>
were amplified with primers (5′-TGTTCTAGGCTAATAACTCTCAA-3′/5′-CTGAAACAGCTCATGAAACA-3′), and for the IR fragments of
<italic>ca.</italic>
980 nt the following primers (5′-ACTTGTGTTTGTCATTTGCC-3′/5′-GCTTGATTTGTTGTAGGCTC-3′) were used. Primers were designed using Primer3 [
<xref rid="B52-viruses-08-00153" ref-type="bibr">52</xref>
] based on the CiLV-C genome sequence (GenBank accession numbers DQ352194 and DQ352195) [
<xref rid="B32-viruses-08-00153" ref-type="bibr">32</xref>
] (
<xref ref-type="fig" rid="viruses-08-00153-f001">Figure 1</xref>
b). Amplification was carried out in a 20 µL reaction containing 2 mM of corresponding primers, 1 U of GoTaq polymerase (Promega, Madison, WI, USA), 10 mM of deoxynucleotides (dNTP) mix and 25 mM of MgCl
<sub>2</sub>
. The thermal cycling was as follows: one cycle of 95 °C for 5 min and 35 cycles of 95 °C for 30 s, 54 °C for 30 s, 72 °C for 1 min. An additional final extension for 10 min at 72 °C was performed. Amplicons were purified using Promega Wizard SV and PCR clean-up system, ligated in the pGEM-T-easy vector (Promega) and transformed into chemically competent
<italic>Escherichia coli</italic>
DH5α. Recombinant plasmids were purified from bacteria cells using Wizard
<sup>®</sup>
Plus SV Minipreps DNA Purification System (Promega) and
<italic>Eco</italic>
RI digested to confirm the cloning of the expected amplicons. Three to six clones per each isolate and viral genome region were selected. Amplicons were sequenced using both the primers that generated them and the pUC/M13 forward and reverse primers by the Sanger method with the BigDye Terminator 3.1 kit (Perkin Elmer, Waltham , MA, USA) in an automated sequencer ABI Prism 3730 (Applied Biosystems, Foster City, CA, USA). No polymorphic sequences were detected in amplicons derived from each sample, indicating absence of mixed infections.</p>
</sec>
<sec id="sec2dot3-viruses-08-00153">
<title>2.3. Phylogenetic Analysis and Estimation of Population Genetic Parameters</title>
<p>Amplicon sequences were trimmed removing primer information. Multiple sequence alignments were performed using MUSCLE algorithm [
<xref rid="B53-viruses-08-00153" ref-type="bibr">53</xref>
] implemented in the Molecular Evolutionary Genetic Analysis (MEGA) software version 6.0 for Windows [
<xref rid="B54-viruses-08-00153" ref-type="bibr">54</xref>
]. Best fit nucleotide substitution models for each dataset were also estimated using MEGA6. Models with lowest Bayesian information criterion (BIC) score for
<italic>p29</italic>
,
<italic>p15</italic>
,
<italic>MP</italic>
, IR and the segment of the RNA2 encompassing the concatenated sequences of
<italic>p15</italic>
, IR and
<italic>MP</italic>
were Kimura-2 parameter + gamma distribution (K2 + G), Tamura 3-parameter (T92), K2, T92 + G, and Tamura Nei (TN93), respectively. Models were used for the estimation of nucleotide distances and phylogenetic relationships. Mean values of the genetic distances calculated within and between defined clades were compared using a Student´s
<italic>t</italic>
-test. Phylogenetic trees were inferred using both the neighbor-joining (NJ) and maximum likelihood methods using sequences generated in this work or available in the GenBank (
<xref ref-type="table" rid="viruses-08-00153-t001">Table 1</xref>
). The robustness of the inferred evolutionary relationships was assessed by 1000 bootstrapped replications. Nucleotide sequences from CiLV-C2 isolates Colombia and Hawaii were used as the out-groups for these analyses. The generated trees were edited using FigTree version 1.4.2 [
<xref rid="B55-viruses-08-00153" ref-type="bibr">55</xref>
]. Number of haplotypes (h), nucleotide and haplotype diversities(π and Hd, respectively) and the confidence intervals for π values (based on coalescent simulations, 10,000 replicates) were estimated using DnaSP software (version 5.10.01) [
<xref rid="B56-viruses-08-00153" ref-type="bibr">56</xref>
].</p>
</sec>
<sec id="sec2dot4-viruses-08-00153">
<title>2.4. Estimation of Natural Selection Pressure</title>
<p>Selection pressure on coding regions of CiLV-C (full length
<italic>p29</italic>
and
<italic>p15</italic>
genes and partial
<italic>MP</italic>
gene) was estimated calculating the ratio (ω) of non-synonymous (dN, non-conservative mutations)/synonymous (dS, silent mutations) nucleotide substitutions. dN and dS were estimated in MEGA6 [
<xref rid="B54-viruses-08-00153" ref-type="bibr">54</xref>
] using the bootstrap method (1000 replicates) and the Kumar model. Sites under selection were detected with SLAC (single likelihood ancestor counting), FEL (fixed effects likelihood) and REL (random effects likelihood) methods implemented in the HyPhy package [
<xref rid="B57-viruses-08-00153" ref-type="bibr">57</xref>
,
<xref rid="B58-viruses-08-00153" ref-type="bibr">58</xref>
]. Each method was run using the default cut-off values of probabilities and codons were considered under selection when indicated by at least two methods. The best-fit substitution model for each set of sequences was selected by the software and each haplotype was represented only once in the analyses. Before the analyses, alignments were assessed using a genetic algorithm for recombination detection (GARD) [
<xref rid="B59-viruses-08-00153" ref-type="bibr">59</xref>
] also implemented in the HyPhy package.</p>
</sec>
<sec id="sec2dot5-viruses-08-00153">
<title>2.5. Recombination Analyses</title>
<p>Putative recombination events amongst CiLV-C isolates were evaluated using different methods, namely recombination detection program (RDP), statistical tests for detecting gene conversion (GENECONV), MaxiChi, Chimera, SiScan, and 3Seq, implemented in the RDP Beta 4.66 [
<xref rid="B60-viruses-08-00153" ref-type="bibr">60</xref>
]. Alignments of nucleotide sequences (
<italic>p29</italic>
or those as result of concatenation of
<italic>p15</italic>
-IR-
<italic>MP</italic>
) produced in MEGA6 [
<xref rid="B54-viruses-08-00153" ref-type="bibr">54</xref>
] were run in RDP4 using the default settings (0.05
<italic>p</italic>
-value cut-off, standard Bonferroni correction, and the option ‘Reference sequence selection’ set as ‘internal references only’). Concatenated sequences derived from CiLV-C2 Colombia RNA2 were also included in this analysis to assess putative inter-species recombination. To omit unreliable signals, only those recombinant events supported by four or more methods were taken into account.</p>
</sec>
<sec id="sec2dot6-viruses-08-00153">
<title>2.6. Secondary Structure Prediction of P29 Proteins of Cileviruses</title>
<p>Predicted secondary structures of deduced amino acid sequences of the putative coat proteins (P29) from definitive and tentative members of the genus
<italic>Cilevirus i.e.</italic>
, CiLV-C (GenBank accession No. ABC75822), CiLV-C isolate BR_SP_SJP_01 (GenBank accession No. AKJ79133), CiLV-C2 isolate Colombia (GenBank accession No. ABA42876), and CiLV-C2 isolate Hawaii (GenBank accession No. AGM16552) were obtained using PROMALS (PROfile Multiple Alignment with predicted Local Structure) [
<xref rid="B61-viruses-08-00153" ref-type="bibr">61</xref>
]. The multiple alignment also included the P29 deduced amino acids sequences from several CiLV-C isolates identified in this work and was done using T-coffee [
<xref rid="B62-viruses-08-00153" ref-type="bibr">62</xref>
]. Secondary structure information and T-coffee alignment were edited using ESPript [
<xref rid="B63-viruses-08-00153" ref-type="bibr">63</xref>
]. PROMALS and T-coffee parameters were set as default.</p>
</sec>
<sec id="sec2dot7-viruses-08-00153">
<title>2.7. RT-PCR Test for Differential Detection of CiLV-C Clade-Specific Isolates</title>
<p>In order to differentially detect viruses of the clade SJP from those CiLV-C predominant isolates, two specific primer pairs for the
<italic>p29</italic>
genes of each kind of isolate were designed. Forward primers spanned a six nucleotide insertion observed in the
<italic>p29</italic>
of the CiLV-C isolates from the clade SJP. Target regions for reverse primers were conveniently selected in order to generate isolate-specific size amplicons. Primer sequences were as follow: p29CRD-F:
<sup>7938</sup>
CAGAAGGCCGAGGTTGTAAAG
<sup>7958</sup>
, p29CRD-R:
<sup>8267</sup>
GTAGTGATCACTGAACTCGAATACC
<sup>8244</sup>
, p29SJP-F:
<sup>7931</sup>
GTAAACAAAAGGTCGAGGTTGTCC
<sup>7954</sup>
and p29SJP-R:
<sup>8386</sup>
TCTGTTGTCTAGCAGCAAGTAATG
<sup>8363</sup>
. The abbreviations SJP or CRD in the name of primers indicate their specific targets, members of the clade SJP or the prevalent CiLV-C isolates, respectively. Validation of the test was performed with samples including isolates belonging to the two lineages and infecting different host plants (
<xref ref-type="table" rid="viruses-08-00153-t001">Table 1</xref>
). RT-PCR assays were carried out as aforementioned. PCR products were purified and sequenced to confirm their identities.</p>
</sec>
<sec id="sec2dot8-viruses-08-00153">
<title>2.8. Characterization of the Isolate BR_SP_SJP_01</title>
<p>For the complete genome sequencing of the isolate BR_SP_SJP_01, total RNA was extracted from approx. 500 mg of symptomatic sweet orange leaves collected from a tree in São José do Rio Preto, SP, Brazil; or
<italic>Arabidopsis thaliana</italic>
plants infested with mites reared onto symptomatic sweet orange fruits collected in the same tree. Samples were ground in presence of liquid nitrogen and total RNA extracts were obtained using TRIZOL
<sup>®</sup>
Reagent according to the manufacturer’s recommendation (Life Technologies). In the last washing step, ethanol 75% solution was replaced by ethanol 100%. RNA quantification and A
<sub>260</sub>
/A
<sub>280</sub>
ratios were estimated using the NanoDrop ND-8000 micro-spectrophotometer (Thermo Scientific, Waltham, MA, USA). Integrity of samples was verified by a Bioanalyser 2100 device (Agilent Technologies, Santa Clara, CA, USA). Samples were shipped to FASTERIS (Plan-les-Ouates, Switzerland), where small RNAs were separated and processed for sequencing using the high throughput Illumina GA IIX platform. High throughput sequencing of the small RNA fraction libraries of 20–25 nt from sweet orange and Arabidopsis plants generated 4,693,816 and 2,264,321 reads; respectively (
<xref ref-type="app" rid="app1-viruses-08-00153">Table S1</xref>
). Reads ranging from 20 to 25 nt from infected sweet orange and Arabidopsis were independently assembled in contigs using the Velvet Assembler [
<xref rid="B64-viruses-08-00153" ref-type="bibr">64</xref>
]. After the screening in the
<italic>A. thaliana</italic>
[
<xref rid="B65-viruses-08-00153" ref-type="bibr">65</xref>
] and citrus (
<italic>C. sinesis</italic>
_v1.0) [
<xref rid="B66-viruses-08-00153" ref-type="bibr">66</xref>
] genome sequence databases, contigs containing plant-derived information were excluded from the analysis and the rest were assembled using CLC genomics Workbench 6.05 [
<xref rid="B67-viruses-08-00153" ref-type="bibr">67</xref>
] and the CiLV-C genome (GenBank accession numbers DQ352194 and DQ352195) as reference [
<xref rid="B32-viruses-08-00153" ref-type="bibr">32</xref>
]. All sequences were assembled together and a set of 34 primer pairs (
<xref ref-type="app" rid="app1-viruses-08-00153">Table S2</xref>
) were designed from the obtained scaffold using Primer3 [
<xref rid="B52-viruses-08-00153" ref-type="bibr">52</xref>
]. cDNA synthetized from the diseased sweet orange RNA extract was used to generate overlapping amplicons of approx. 600 nt in length in order to close the sequencing gaps and confirm the next generation sequencing data. Amplicons were cloned and sequenced as formerly described. After final assembly, the full genome sequence of CiLV-C isolate BR_SP_SJP_01 was deposited in the GenBank database (accession numbers KP336746 and KP336747).</p>
<p>Using the genome of the isolate BR_SP_SJP_01 as reference, it was determined that 51.3% and 74.2% of 20–25 nt reads in the sweet orange and Arabidopsis libraries, respectively, mapped to the viral genome. Reads from sweet orange covered 98% and 86% of the RNA1 and RNA2, respectively; and those obtained from Arabidopsis provided 94% of the RNA1 and 98% of the RNA2 (
<xref ref-type="app" rid="app1-viruses-08-00153">Table S1</xref>
). In both libraries, the most abundant size class of viral derived small RNAs had 21 nt in length, followed by a second peak of 24 nt.</p>
<p>Transmission of the isolate BR_SP_SJP_01 was achieved using a
<italic>B. yothersi</italic>
isoline population obtained from a single female collected in Bahia State, Brazil. Unripe sweet orange fruits of
<italic>cv.</italic>
Pera were used as substrate for maintenance of non-viruliferous mite populations. Fruits were cleaned, dried, partially submerged in liquid paraffin to prevent desiccation, and surrounded by the pest adhesive barrier Biostop gum (Biocontrole, Indaiatuba, SP, Brazil). For CiLV-C isolate BR_SP_SJP_01 transmission, symptomatic orange fruits collected in São José do Rio Preto, SP were treated as described for the healthy ones, allowing the exposure of the symptomatic areas as feeding arenas. Healthy and diseased fruits were placed side by side to allow mite migration and further virus acquisition for a minimal period of three days. For virus inoculations in Arabidopsis and sweet orange plants, five adult viruliferous mites were transferred, with a small brush under a stereoscopic microscope, to each of three leaves per plant (rosette leaves in the case of Arabidopsis). Fifteen Arabidopsis and ten sweet orange plants were assayed in each of the three independent transmission experiments. As control, a plant of each species was inoculated with the same amount of mites from the non-viruliferous colony. After symptoms appeared, viral presence was confirmed by RT-PCR using primers specific for the detection of ORF
<italic>MP</italic>
[
<xref rid="B51-viruses-08-00153" ref-type="bibr">51</xref>
] and clade SJP-ORF
<italic>p29</italic>
(formerly described in
<xref ref-type="sec" rid="sec2dot7-viruses-08-00153">Section 2.7</xref>
). Arabidopsis Col-0 plants used in this experiment were obtained from seeds, which were planted in pots and kept at 4 °C in the dark. After four days, plants were allowed to grow at 22 ± 2 °C with a 12 h light cycle in an Adaptis-1000 environmentally controlled growth chamber (CONVIRON, Winnipeg, MB, Canada). Seedlings of sweet orange cv. Pera obtained from seeds were kept under greenhouse conditions.</p>
</sec>
</sec>
<sec id="sec3-viruses-08-00153">
<title>3. Results</title>
<sec id="sec3dot1-viruses-08-00153">
<title>3.1. CiLV-C Is the Prevalent Causal Agent of Citrus Leprosis in Brazil</title>
<p>The presence of citrus leprosis associated viruses was evaluated in a discrete set of 46 symptomatic sweet oranges trees of which 56% were from São Paulo State, the main sweet orange producing region in the world [
<xref rid="B48-viruses-08-00153" ref-type="bibr">48</xref>
]. None of the samples yielded PCR products for either CiLV-N or CiLV-C2, but all of them produced the expected 339 bp fragments when amplified using the specific primers to detect CiLV-C [
<xref rid="B51-viruses-08-00153" ref-type="bibr">51</xref>
] (
<xref ref-type="app" rid="app1-viruses-08-00153">Figure S1</xref>
). For further phylogenetic and population studies of CiLV-C, in addition to the
<italic>MP</italic>
gene fragment used for viral detection, another three genomic regions (complete
<italic>p29</italic>
gene in the RNA1, and complete
<italic>p15</italic>
and IR in the RNA2,
<xref ref-type="fig" rid="viruses-08-00153-f001">Figure 1</xref>
b) were amplified from 33 samples covering 22.3% of the viral genome. All recovered sequences and others retrieved from the GenBank database were compiled and, in total, 48, 47, 41 and 38 sequences were used in the
<italic>p29</italic>
,
<italic>MP</italic>
,
<italic>p15</italic>
and IR analyses, respectively (
<xref ref-type="table" rid="viruses-08-00153-t001">Table 1</xref>
).</p>
</sec>
<sec id="sec3dot2-viruses-08-00153">
<title>3.2. Phylogenetic Analysis of the p29 and MP Genes Indicate a Second Clade within the CiLV-C Population</title>
<p>Phylogenetic trees inferred from the complete nucleotide sequence of
<italic>p29</italic>
and the partial sequence of the
<italic>MP</italic>
(300 nt) using either neighbor joining and maximum likelihood methods showed the occurrence of two divergent clades within the CiLV-C population (
<xref ref-type="fig" rid="viruses-08-00153-f002">Figure 2</xref>
a,b). In these trees, most of the isolates grouped together with those with known full-length genomes
<italic>i.e.</italic>
, CiLV-C isolates PA01 and BR_SP_JBT_01 [
<xref rid="B32-viruses-08-00153" ref-type="bibr">32</xref>
,
<xref rid="B34-viruses-08-00153" ref-type="bibr">34</xref>
] and particularly with the isolate BR_SP_CRD_01, the type member of the cilevirus genus and up to now recognized as the only genotype of the species [
<xref rid="B8-viruses-08-00153" ref-type="bibr">8</xref>
,
<xref rid="B22-viruses-08-00153" ref-type="bibr">22</xref>
]. This group was called CRD, abbreviation used to refer to the Cordeirópolis city in the São Paulo State, Brazil, place of collection of the isolate BR_SP_CRD_01 [
<xref rid="B32-viruses-08-00153" ref-type="bibr">32</xref>
]. This abbreviation will be used to specify this viral lineage from now on. The smaller branch of each tree grouped isolates collected in São José do Rio Preto (SJP), Cosmorama (CSM), and Sud Mennucci (SDM), three localities situated
<italic>ca.</italic>
100–300 km distant from each other in the central–Northern part of São Paulo State. This new clade was named SJP denoting the homonymous city, place of the collection of four of the included isolates.</p>
<p>In the
<italic>MP</italic>
gene-based tree most of the Brazilian isolates and those from Mexico (MX_01), Colombia (CO_01), Panama (PA_01), Paraguay (PY_01) and Argentina (AR_01 and AR_02) were grouped in the same branch. The two isolates from tropical spiderwort plants, identified as BR_SP_BRM_01 and BR_SP_SJP_04, were separately distributed in the two predefined branches (
<xref ref-type="fig" rid="viruses-08-00153-f002">Figure 2</xref>
b).</p>
</sec>
<sec id="sec3dot3-viruses-08-00153">
<title>3.3. p15 and IR-Based Trees Suggest Recombination</title>
<p>Topologies of the generated trees using
<italic>p15</italic>
and IR genomic regions were different from those observed using
<italic>p29</italic>
and
<italic>MP</italic>
.
<italic>p15</italic>
tree failed to separate the isolates in the two previously detected branches, probably indicating the low diversity of this gene (
<xref ref-type="fig" rid="viruses-08-00153-f002">Figure 2</xref>
c). Some members of the formerly defined clades were clustered together (
<italic>i.e.</italic>
, isolate BR_SP_SJP_03 of the clade SJP with the isolate BR_SP_CLN_01 of clade CRD, respectively), although in a relatively low bootstrap supported branch (64% of trees). In the IR tree, predefined clades were also not completely separated, although those sequences belonging to isolates of the clade SJP were sub-clustered inside the single branch of the tree (
<xref ref-type="fig" rid="viruses-08-00153-f002">Figure 2</xref>
d).</p>
<p>To obtain a broader perspective of phylogenetic relationship of the 5′ proximal region of the RNA2,
<italic>p15</italic>
, IR and the partial
<italic>MP</italic>
sequences were evaluated in a concatenated analysis. The generated tree showed a topology resembling that obtained using the IR (
<xref ref-type="fig" rid="viruses-08-00153-f002">Figure 2</xref>
e). Since
<italic>p15</italic>
, IR and
<italic>MP</italic>
occur on the same genomic component, the contrasted phylogenetic association between the mentioned isolates indicated recombination events along this RNA2 region.</p>
</sec>
<sec id="sec3dot4-viruses-08-00153">
<title>3.4. Genetic Data Support the Occurrence of Two CiLV-C Clades</title>
<p>Genetic distances within and between the clades defined in the
<italic>p29</italic>
and
<italic>MP</italic>
trees were calculated using MEGA 6 [
<xref rid="B54-viruses-08-00153" ref-type="bibr">54</xref>
]. Based on
<italic>p29</italic>
sequences, the genetic distance within isolates of the clade CRD (0.009 ± 0.006) and SJP (0.007 ± 0.004) were significantly lower than the values obtained comparing sequences from the two clades (0.184 ± 0.007) (
<italic>p</italic>
< 0.01). Similar trend was observed in the calculations using the
<italic>MP</italic>
gene
<italic>i.e.</italic>
, within the clade CRD (0.007 ± 0.006), within the clade SJP (0.004 ± 0.003) and between the clades (0.187 ± 0.006) (
<italic>p</italic>
< 0.01). Genetic distances based on the
<italic>p15</italic>
showed no significant differences whereas those from the IR sequences were not analyzed because of the high coefficient of variations observed in these data, particularly within members of the clade CRD.</p>
<p>Molecular variability of the studied CiLV-C population was also estimated calculating several population genetic parameters such as the nucleotide diversity (π) and the haplotype diversity (Hd) using DnaSP 5 [
<xref rid="B56-viruses-08-00153" ref-type="bibr">56</xref>
]. Only sequences recovered from citrus hosts were considered in these assessments. Nucleotide diversity values ranged from 0.010 to 0.057, the higher values being those corresponding to
<italic>MP</italic>
(0.056 ± 0.009) and
<italic>p29</italic>
(0.053 ± 0.009), which were different (
<italic>p</italic>
< 0.05 and
<italic>p</italic>
< 0.1, respectively) to that showed by
<italic>p15</italic>
(0.010 ± 0.001) (
<xref ref-type="table" rid="viruses-08-00153-t002">Table 2</xref>
). When the analysis was conducted using only the isolates clustered in the clade CRD, the π values associated to
<italic>MP</italic>
(0.007 ± 0.001) and
<italic>p29</italic>
(0.009 ± 0.001) were lower (
<italic>p</italic>
< 0.05 and
<italic>p</italic>
< 0.1, respectively) than those obtained including the whole population. In contrast, in the same analysis the values for
<italic>p15</italic>
(0.010 ± 0.001) and IR (0.016 ± 0.003) were kept invariable (
<italic>p</italic>
< 0.05). The haplotype diversity value for the IR reached maximum Hd = 1, indicating high variability of this region.</p>
</sec>
<sec id="sec3dot5-viruses-08-00153">
<title>3.5. 5′-Proximal Region of CiLV-C RNA2 Harbors Recombination Signatures</title>
<p>To detect possible recombination events amongst the CiLV-C isolates,
<italic>p29</italic>
,
<italic>p15</italic>
, IR and
<italic>MP</italic>
sequences were analyzed using RDP4 v4.66 [
<xref rid="B60-viruses-08-00153" ref-type="bibr">60</xref>
]. Sequences corresponding to the RNA2 (
<italic>i.e.</italic>
,
<italic>p15</italic>
-IR-
<italic>MP</italic>
) were concatenated before the analysis. Only those events consistently detected by four or more methods implemented in RDP4 and
<italic>p</italic>
-values < 0.05 were considered reliable results. Additionally, coding sequences (
<italic>p29</italic>
,
<italic>p15</italic>
and
<italic>MP</italic>
) were tested using GARD, implemented in the HyPhy package.</p>
<p>No evidence of recombination was detected in
<italic>p29</italic>
and
<italic>MP</italic>
using both GARD and RDP4. However, in the analysis involving the RNA2 concatenated sequences, RDP4 revealed that the isolate BR_PR_LDB_01 (clade CRD) bears a putative recombination event supported by seven methods: RDP (
<italic>p</italic>
= 2.29 × 10
<sup>−4</sup>
), GENECONV (
<italic>p</italic>
= 1.29 × 10
<sup>−3</sup>
), BootScan (
<italic>p</italic>
= 3.75 × 10
<sup>−4</sup>
), MaxChi (
<italic>p</italic>
= 6.67 × 10
<sup>−7</sup>
), Chimaera (
<italic>p</italic>
= 4.19 × 10
<sup>−7</sup>
), SiScan (
<italic>p</italic>
= 1.55 × 10
<sup>−6</sup>
), and PhylPro (
<italic>p</italic>
= 2.1 × 10
<sup>−6</sup>
) (
<xref ref-type="fig" rid="viruses-08-00153-f003">Figure 3</xref>
). Recombinant sequence spanned from
<italic>p15</italic>
to almost the end of the IR and the isolates BR_SP_SJP_01 (clade SJP) and AR_2 (clade CRD) were indicated as probable minor and major parents, respectively. The ending breakpoint was identified in position 1180 in the concatenated sequence
<italic>p15</italic>
-IR-
<italic>MP,</italic>
which approximately corresponds to the position 1436 in the CiLV-C RNA2 complete sequence. The beginning breakpoint was not precisely determined by the software. Interestingly, evidence of the same recombinant events was detected in other 26 isolates of clade CRD indicating that all of them might be descendants from a common recombinant ancestor. It was noteworthy that the failure to determine the beginning breakpoints was constant in all detected recombinant events suggesting that identified parental isolates may be actually recombinants as well. Recombination between isolates of CiLV-C and CiLV-C2 was not detected.</p>
</sec>
<sec id="sec3dot6-viruses-08-00153">
<title>3.6. Purifying Selection Is Acting on CiLV-C</title>
<p>The ratio between the non-synonymous and synonymous substitution frequencies (ω = dN/dS) in codons of the analyzed CiLV-C genes was estimated (
<xref ref-type="table" rid="viruses-08-00153-t002">Table 2</xref>
). dN and dS were calculated using MEGA 6. In general, the ω values were lower than 1, indicating a negative or purifying selection, although a different level of pressure over each gene was observed. According to the results,
<italic>p29</italic>
(ω = 0.07) and
<italic>MP</italic>
(ω = 0.10) were exposed to stronger selection strengths than
<italic>p15</italic>
(ω = 0.50). Moreover, in the analysis when only the isolates of the clade CRD were included, ω value for
<italic>p15</italic>
kept almost invariable (ω = 0.57) whereas they were slightly augmented for
<italic>p29</italic>
(ω = 0.18) and
<italic>MP</italic>
(ω = 0.26).</p>
<p>Selection constraints operating on specific sites of the analyzed CiLV-C ORFs were estimated using SLAC (
<italic>p</italic>
< 0.1), FEL (
<italic>p</italic>
< 0.1) and REL (Bayes factor = 50) methods [
<xref rid="B59-viruses-08-00153" ref-type="bibr">59</xref>
] implemented in HyPhy. Nucleotide substitution models TrN93 (Tamura-Nei) [
<xref rid="B68-viruses-08-00153" ref-type="bibr">68</xref>
] was selected for the analyses of
<italic>p29</italic>
, HKY85 (Hasegawa, Kishino and Yano, 1985) [
<xref rid="B69-viruses-08-00153" ref-type="bibr">69</xref>
] for
<italic>p15</italic>
and GTR (generalized time-reversible) for
<italic>MP</italic>
. General results reflected the ω values previously shown. In the sequence corresponding to the analyzed fragment of
<italic>MP</italic>
, 22 codons under purification strengths were identified using FEL and REL (
<xref ref-type="table" rid="viruses-08-00153-t003">Table 3</xref>
), and the number of positions was reduced to three (codons 71, 112 and 148) when the SLAC result was integrated to the analysis. SLAC method tends to be more conservative among the three tools used, reducing the possibilities of identification of neutral sites as under selection [
<xref rid="B70-viruses-08-00153" ref-type="bibr">70</xref>
]. In
<italic>p29</italic>
, ten codons were identified under negative selection by the three methods, and other 34 codons were also recognized as under purification using FEL and REL (
<xref ref-type="table" rid="viruses-08-00153-t003">Table 3</xref>
). In
<italic>p15</italic>
, none of the positions was identified under negative selection, and only the codon at position 91 was indicated under positive selection using FEL and REL (
<xref ref-type="table" rid="viruses-08-00153-t003">Table 3</xref>
).</p>
</sec>
<sec id="sec3dot7-viruses-08-00153">
<title>3.7. Clade-Specific CiLV-C Isolates Can Be Differentially Detected by RT-PCR</title>
<p>The viral isolates included in the present study were analyzed by RT-PCR using two primer pairs based on the
<italic>p29</italic>
gene. The test was designed to distinguish genotypes of the predefined clades CRD or SJP. As expected, amplicons of approx. 330 and 456 bp were observed from isolates previously identified as members of the clades CRD and SJP, respectively (
<xref ref-type="fig" rid="viruses-08-00153-f004">Figure 4</xref>
). Only one band per lane was observed indicating the absence of mixed infections. None of the primer pairs was able to detect CiLV-C2 from the positive control, which was amplified only with the specific primers previously reported [
<xref rid="B14-viruses-08-00153" ref-type="bibr">14</xref>
] (
<xref ref-type="app" rid="app1-viruses-08-00153">Figure S1</xref>
).</p>
</sec>
<sec id="sec3dot8-viruses-08-00153">
<title>3.8. Genomic Characterization of CiLV-C Isolate BR_SP_SJP_01</title>
<p>To better understand the genetic characteristic of the viral haplotypes clustered in the clade SJP, the complete genome of one isolate representative of this clade was sequenced. RNA extracts were obtained from a sweet orange tree, the primary source of the isolate BR_SP_SJP_01, and from one Arabidopsis plant infected after the transmission experiments described below. Therefore, two sources of viral small RNAs were independently processed. The complete genome sequence of the isolate BR_SP_SJP_01 (GenBank database with accession numbers KP336746 and KP336747) was 13,757 nt in length, distributed in 8753 nt in RNA1 and 5004 nt in RNA2. The similarity profile generated from the RNA sequence alignments of CiLV-C and isolate BR_SP_SJP_01 revealed the presence of two peaks of maximum similarities in positions 500 and 1250 of the RNA1, approximately (
<xref ref-type="fig" rid="viruses-08-00153-f005">Figure 5</xref>
), which corresponded to the methyltransferase motif coding sequences conserved in a wide range of ssRNA viruses [
<xref rid="B71-viruses-08-00153" ref-type="bibr">71</xref>
]. The profile of RNA2 showed a highly similar sequence spanning the first
<italic>ca.</italic>
1400 nt of their 5′-proximal regions (
<xref ref-type="fig" rid="viruses-08-00153-f005">Figure 5</xref>
). In contrast, this region of BR_SP_SJP_01 showed the lowest identity (≈45%) with the tentative members of the genus
<italic>Cilevirus i.e.</italic>
, CiLV-C2 Co and CiLV-C2 Hw (
<xref ref-type="fig" rid="viruses-08-00153-f005">Figure 5</xref>
).</p>
<p>Globally, BR_SP_SJP_01 RNA1 and RNA2 showed 85.6% and 88.4% identity, respectively, with cognate molecules of CiLV-C (
<xref ref-type="table" rid="viruses-08-00153-t004">Table 4</xref>
). Further comparisons revealed 85.4% nucleotide identity with the
<italic>RNA-dependent RNA polymerase</italic>
(
<italic>RdRp)</italic>
ORF and 85.0% with the
<italic>p29</italic>
ORF of this virus. A six nucleotide insertion was detected in the
<italic>p29</italic>
gene of the BR_SP_SJP_01 isolate, between positions 247–252 downstream of the translation start site. Nucleotide comparisons of the RNA2-encoded
<italic>p15</italic>
,
<italic>p61</italic>
,
<italic>MP</italic>
and
<italic>p24</italic>
ORFs showed 99.5%, 81.8%, 86.8% and 87.4% identity, respectively; whereas the IR had 96.7% identity with the equivalent sequences of CiLV-C. Although high values of nucleotide identity (>98%) were observed along the
<italic>p15</italic>
and IR regions, excluding these parts, the rest of the molecules showed 84.2% identity. In general, values of nucleotide identity between BR_SP_SJP_01 and those from CiLV-C2 were lower (44.7%–63.9%) than those observed in the comparison with CiLV-C (81.8%–99.5%) (
<xref ref-type="table" rid="viruses-08-00153-t004">Table 4</xref>
).</p>
<p>The deduced amino acid sequence of RdRp from isolate BR_SP_SJP_01 had 93.1% identity with its equivalent from CiLV-C, whereas the predicted proteins from the ORFs
<italic>p24</italic>
and
<italic>MP</italic>
showed 93.9% and 91.9% identity, respectively. Proteins encoded by ORFs
<italic>p15</italic>
and
<italic>p61</italic>
showed the highest (100%) and the lowest (84.0%) values of identity, respectively. The putative coat protein P29 of the isolate BR_SP_SJP_01 (265 aa) was two amino acids longer than cognate protein encoded by CiLV-C (263 aa) and they shared 90.5% identity.</p>
<p>To gain further understanding about the P29 protein of CiLV-C, deduced amino acids belonging to several isolates belonging to clades SJP and CRD were analyzed using the PROMALS algorithm, which generates sequence alignments using information from secondary structure prediction databases [
<xref rid="B61-viruses-08-00153" ref-type="bibr">61</xref>
]. Similarly, available deduced amino acids sequences of the putative coat protein P29 from CiLV-C2 were analyzed using PROMALS. In an attempt to identify putatively conserved structural elements through the P29 proteins of tentative and definitive cileviruses, the results were compared to those obtained for CiLV-C. With the exception of a stretch between amino acids 50 to 120, predictions indicated a predominant array in alpha-helix connected by putative smaller beta stranded or non-ordinary secondary structure regions (
<xref ref-type="fig" rid="viruses-08-00153-f006">Figure 6</xref>
a). Pro83 and Gln84, introduced as consequence of six nucleotide insertion in
<italic>p29</italic>
genes of the clade SJP isolates were identified in the border of the putative alpha helix 5.</p>
</sec>
<sec id="sec3dot9-viruses-08-00153">
<title>3.9. Mite-Mediated Transmission of the Isolate BR_SP_SJP_01</title>
<p>To verify the mite-mediated transmission of the isolate BR_SP_SJP_01, the assays were performed using as viral source the symptomatic sweet orange fruits from the tree where this isolate was originally obtained. After three days of acquisition, viruliferous mites were transferred to healthy Arabidopsis and sweet orange plants. Three independent experiments were conducted. Leprosis disease symptoms appeared 8–10 and 15–20 days after the inoculation in leaves of Arabidopsis and sweet orange plants, respectively. Transmission of CiLV-C isolate BR_SP_SJP_01 was confirmed in more than 90% of Arabidopsis and 93% of inoculated sweet oranges plants (
<xref ref-type="app" rid="app1-viruses-08-00153">Table S3</xref>
).</p>
</sec>
</sec>
<sec id="sec4-viruses-08-00153">
<title>4. Discussion</title>
<p>Citrus leprosis is considered a re-emergent disease in the Americas [
<xref rid="B1-viruses-08-00153" ref-type="bibr">1</xref>
] and the most important among those with viral etiology affecting citrus orchards in Brazil. Since new viruses associated with the disease have recently been reported in Mexico and Colombia [
<xref rid="B12-viruses-08-00153" ref-type="bibr">12</xref>
,
<xref rid="B13-viruses-08-00153" ref-type="bibr">13</xref>
,
<xref rid="B14-viruses-08-00153" ref-type="bibr">14</xref>
], the first objective of this work was to ascertain whether they occur in citrus trees showing typical leprosis symptoms in Brazil. Analysis of a discrete sample of symptomatic tissues collected from distant and diverse regions of the country during the period 2012–2015 indicated the absence of CiLV-C2 and CiLV-N. However, CiLV-C was detected in all of the evaluated samples confirming that this virus is the major causal agent for citrus leprosis in Brazil, as previously indicated [
<xref rid="B7-viruses-08-00153" ref-type="bibr">7</xref>
,
<xref rid="B22-viruses-08-00153" ref-type="bibr">22</xref>
].</p>
<p>We further studied the phylogeny and molecular diversity of CiLV-C as a way to assess the variability of the viral population and to elucidate putative forces driving its evolution. The sequences of four genomic regions (completed
<italic>p29</italic>
and
<italic>p15</italic>
genes, partial
<italic>MP</italic>
gene and the IR of the RNA2) of recently collected isolates were obtained and analyzed together with all of the CiLV-C sequences available in the GenBank database.</p>
<p>Phylogenetic analyses showed that based on
<italic>p29</italic>
and
<italic>MP</italic>
genes the CiLV-C population is consistently subdivided in two clades, where most of the Brazilian isolates are clustered along with the genotype of the type member virus of the genus
<italic>Cilevirus</italic>
[
<xref rid="B29-viruses-08-00153" ref-type="bibr">29</xref>
], defining a group we called clade CRD. The other clade, called SJP, groups a few isolates identified in a small area of the central-northern part of the São Paulo State around the municipality of São José do Rio Preto.</p>
<p>The complete sequence of the isolate BR_SP_SJP_01, clade SJP, was obtained by next generation sequencing and its genomic organization is similar to that described for CiLV-C [
<xref rid="B32-viruses-08-00153" ref-type="bibr">32</xref>
]. Overall, RNA1 of the isolate BR_SP_SJP_01 and CiLV-C shares 85.6% identity, while the value for the RNA2 segment is 88.4%. Higher identity value between the RNA2 of both isolates is due to the existence of a region of approx. 1400 nt in the 5′-termini of the molecules which show more than 98% nucleotide identity. Conversely, comparisons between isolate BR_SP_SJP_01 and the tentative member of the genus
<italic>Cilevirus i.e.</italic>
, CiLV-C2 isolates Co and Hw showed drastically reduced values of nucleotide identity. Differences were even greater in the 5′ proximal region of the RNA2 (ORF
<italic>p15</italic>
and IR), with values as low as 44.7%.</p>
<p>Recombination is considered one of the main sources for molecular variability in plant viruses [
<xref rid="B41-viruses-08-00153" ref-type="bibr">41</xref>
,
<xref rid="B45-viruses-08-00153" ref-type="bibr">45</xref>
]. Having acknowledged the widening disparities in the nucleotide identity along the RNA2 molecules of the isolate BR_SP_SJP_01 and the cilevirus type member, we used concatenated sequences derived from the RNA2 as a way to assess the putative RNA-RNA crossover among these isolates. Recombination was identified in the isolate BR_PR_LDB_01, and similar signatures were identified in other 26 isolates belonging to the clade CRD. Altogether, our findings suggest the
<italic>p15</italic>
-IR region as a crossover hotspot, indicating that recombination is an important source of genetic variability in natural populations of CiLV-C; and likewise, they raise a coherent framework to understand the observed phylogenetic relationship between the two clades in which the CiLV-C population is subdivided. It should be noticed, however, that existence of recombination in other regions of viral genome should not be excluded.</p>
<p>Recombination in RNA viruses seems to be promoted by transcriptional activity [
<xref rid="B72-viruses-08-00153" ref-type="bibr">72</xref>
,
<xref rid="B73-viruses-08-00153" ref-type="bibr">73</xref>
]. In
<italic>Brome mosaic virus</italic>
(BMV) an efficient recombination hotspot was mapped within the intercistronic region of RNA3, which drives the transcription of the sgRNA4 [
<xref rid="B72-viruses-08-00153" ref-type="bibr">72</xref>
]. Similarly, the IR of cileviruses, which is upstream of ORF
<italic>p61</italic>
, could also harbor the promoter elements required to drive the expression of the
<italic>p61</italic>
subgenomic RNA transcribed during CiLV-C and CiLV-C2 replication [
<xref rid="B14-viruses-08-00153" ref-type="bibr">14</xref>
,
<xref rid="B34-viruses-08-00153" ref-type="bibr">34</xref>
].</p>
<p>High variation within the cilevirus RNA2 IR has been previously highlighted [
<xref rid="B14-viruses-08-00153" ref-type="bibr">14</xref>
,
<xref rid="B21-viruses-08-00153" ref-type="bibr">21</xref>
]. Overall, the region shows the lowest nucleotide sequence identity in pairwise comparisons. Moreover, the region harbors a putative ORF encoding a 7 kDa protein (P7) which is found 32, 160 and 515 nt downstream of
<italic>p15</italic>
gene in CiLV-C, CiLV-C2 Co and CiLV-C2 Hw, respectively; while it is partially duplicated in CiLV-C2 Hw [
<xref rid="B21-viruses-08-00153" ref-type="bibr">21</xref>
]. In CiLV-C2, P7 shows a trans-membrane domain not observed in the protein encoded by CiLV-C. Although more evidences are required to understand the cileviruses evolution, it is possible to hypothesize that contrasting structural array among the IR of related viruses is a consequence of continuous illegitimate (non-homologous) recombination processes inter or intra species of cileviruses.</p>
<p>Nucleotide diversity of CiLV-C estimated from
<italic>p29</italic>
and
<italic>MP</italic>
<italic>
<sub>p</sub>
</italic>
<sub>29</sub>
= 0.053 and π
<italic>
<sub>MP</sub>
</italic>
= 0.056) oscillated within the range observed for other citrus-infecting virus populations
<italic>i.e.</italic>
,
<italic>Citrus psorosis virus</italic>
(π = 0.083) [
<xref rid="B74-viruses-08-00153" ref-type="bibr">74</xref>
],
<italic>Citrus tristeza virus</italic>
(π = 0.038) [
<xref rid="B75-viruses-08-00153" ref-type="bibr">75</xref>
] and
<italic>Citrus leaf blotch virus</italic>
(π = 0.021) [
<xref rid="B76-viruses-08-00153" ref-type="bibr">76</xref>
]. Nevertheless, molecular variability of CiLV-C population is mostly determined by the existence of isolates of the clade SJP. When sequences from these isolates were overlooked, π
<italic>
<sub>p</sub>
</italic>
<sub>29</sub>
and π
<italic>
<sub>MP</sub>
</italic>
values were reduced almost six-fold. Low variability seems to be constant along the CiLV-C genome, as also evidenced with the analyses of
<italic>p15</italic>
, and although to a lesser extent, with the IR sequences. Nucleotide diversities associated to
<italic>p15</italic>
and IR were similar when calculated for the whole population and for isolates of the clade CRD, a point likely reflecting the putative acquisition of this genomic region in an ancestral of these isolates from a member of the clade SJP by recombination. On the other hand, our results reveal that the subpopulation grouped in clade CRD, the prevalent through the extensive geographic area where CiLV-C occurs, is characterized by a low molecular variability. These results are reinforced by the fact that the study involved citrus-infecting isolates collected in remote areas of Brazil, and in the case of the analysis of the
<italic>MP</italic>
, also incorporated isolates from Mexico to Argentina. Consistently with this, the analysis of the recently obtained sequence of a CiLV-C isolate originally collected in Argentina in 1967 [
<xref rid="B77-viruses-08-00153" ref-type="bibr">77</xref>
] also supports our findings. This isolate was recovered from the peel of orange fruits showing leprosis-like symptoms that were conserved in the herbarium of the United States Department of Agriculture (USDA) inspection stations [
<xref rid="B77-viruses-08-00153" ref-type="bibr">77</xref>
]. Remarkably, after recovering 87.0% and 98.0% of the RNA1 and RNA2 viral genomic molecules, respectively, the sequences of the CiLV-C isolate Argentina 1967 showed more than 99% nucleotide identity with their cognates from the type member of the genus
<italic>Cilevirus</italic>
[
<xref rid="B77-viruses-08-00153" ref-type="bibr">77</xref>
]. This suggests not only low spatial, but also low temporal variability within CiLV-C isolates.</p>
<p>Low genetic variability seems to be common in natural plant virus populations, which is probably associated with continuous genetic bottlenecks
<italic>i.e.</italic>
, infection of a new cell or vector transmission [
<xref rid="B39-viruses-08-00153" ref-type="bibr">39</xref>
,
<xref rid="B45-viruses-08-00153" ref-type="bibr">45</xref>
,
<xref rid="B46-viruses-08-00153" ref-type="bibr">46</xref>
]. In this regard, it seems plausible that some traits of the CiLV-C biology contribute to low genetic variability and potentiate the impact of bottlenecks on the viral population diversity. Even though plant species belonging to 28 families can be experimentally infected by CiLV-C, the known natural host range of the virus is limited to a few species (tropical spiderwort, citrus and
<italic>Swinglea glutinosa</italic>
) and in both natural and experimental hosts, the virus does not spread systemically [
<xref rid="B17-viruses-08-00153" ref-type="bibr">17</xref>
,
<xref rid="B26-viruses-08-00153" ref-type="bibr">26</xref>
,
<xref rid="B27-viruses-08-00153" ref-type="bibr">27</xref>
,
<xref rid="B78-viruses-08-00153" ref-type="bibr">78</xref>
,
<xref rid="B79-viruses-08-00153" ref-type="bibr">79</xref>
]. Consequently, after multiplication in a relatively low number of epidermal and parenchymal cells around the mite feeding sites [
<xref rid="B8-viruses-08-00153" ref-type="bibr">8</xref>
,
<xref rid="B26-viruses-08-00153" ref-type="bibr">26</xref>
,
<xref rid="B27-viruses-08-00153" ref-type="bibr">27</xref>
,
<xref rid="B80-viruses-08-00153" ref-type="bibr">80</xref>
], CiLV-C colonization to distal parts of the infected plant is exclusively mediated by viruliferous mites. Recently, new evidence indicating multiplication of cileviruses in mites have been suggested [
<xref rid="B1-viruses-08-00153" ref-type="bibr">1</xref>
]. In that context, alternate replication in plant and mite cells might further constrain virus variability as previously observed in the arthropod-borne viruses
<italic>Rice dwarf virus</italic>
(RDV) [
<xref rid="B81-viruses-08-00153" ref-type="bibr">81</xref>
] and
<italic>Tomato spotted wilt virus</italic>
(TSWV) [
<xref rid="B82-viruses-08-00153" ref-type="bibr">82</xref>
].</p>
<p>Low diversity of natural host range of CiLV-C, noticeably homogenous in the context of large-scale sweet orange cultivation, and mite-mediated transmission may also account for the negative or purifying selection mechanism operating upon the evolution of CiLV-C. dN/dS values calculated for p29, MP and p15 were lower than 1, but lower values corresponding to p29 and MP suggested the proteins encoded by these two genes are less flexible to putative amino acids changes than the protein P15 (
<xref ref-type="table" rid="viruses-08-00153-t002">Table 2</xref>
). Purifying selection is the main evolutionary force acting on numerous plant viruses as result of structural constraints and preservation of specific molecular interactions [
<xref rid="B45-viruses-08-00153" ref-type="bibr">45</xref>
]. Particularly, P29 and MP of CiLV-C seem to follow the rule since they may at least be involved in virus particle formation, virus-vector interaction and cell-to-cell movement. Role of P15 in the viral multiplication cycle remains unknown, therefore we lack information to discuss the selection data obtained. However, it is worth noting that several Cys residues are highly conserved among P15 from CiLV-C and CiLV-C2 and they might be involved in a putative Zn-finger motif (
<xref ref-type="fig" rid="viruses-08-00153-f006">Figure 6</xref>
b). Remarkably, the site encoding the Asp91 in p15 gene from CiLV-C and identified under selection (
<xref ref-type="table" rid="viruses-08-00153-t003">Table 3</xref>
) is placed inside the loop of the predicted Zn-finger motif where it aligns with a similar negatively charged amino acid (Glu) in CiLV-C2.</p>
<p>In accordance with dN/dS values for
<italic>p29</italic>
and
<italic>MP</italic>
genes, several negatively selected sites were identified in these regions (
<xref ref-type="table" rid="viruses-08-00153-t003">Table 3</xref>
). In
<italic>MP</italic>
, a total of 22 sites were detected as negatively selected and several of them are involved in conserved sequences and structural motifs of plant virus movement proteins of the 30K superfamily according to a recent study [
<xref rid="B83-viruses-08-00153" ref-type="bibr">83</xref>
] (e.g., Ile84 and Ser85 in the beta strand 2; Val92, Pro93, Pro98 and Ala99 in the loop 2; Ser102 and Lue103 in the beta strand 3; Leu112 in the loop 3; and Val115 and Gln121 in the strand 4). In
<italic>p29</italic>
, many negatively selected sites were revealed to be conserved through the homologous proteins from CiLV-C and CiLV-C2. Analysis revealed that seven out of the ten positions recognized under negative selection by using SLAC, REL and FEL methods are distributed in the C-terminal half of the proteins and five of them encode charged amino acids (Asp156, 207, 211, 259 and Arg173). Four out of the ten amino acids are part of predicted alpha-helix structures throughout the four homologous proteins (
<xref ref-type="fig" rid="viruses-08-00153-f006">Figure 6</xref>
a). Coat proteins from plus strand RNA viruses are involved in several functions during replication, vector interaction and symptom development, determining the viral pathogenicity and epidemiology [
<xref rid="B84-viruses-08-00153" ref-type="bibr">84</xref>
]. In this regard, our studies suggest that amino acids encoded by selected codons may play important functional or structural roles and delimit the sites that can be potentially mutated to assay the properties of proteins and the course of virus infection. Further analyses with mutant infectious clone of CiLV-C will allow final determination of the significance of amino acids under selection pressure.</p>
<p>CiLV-C isolate BR_SP_SJP_01 was transmitted from symptomatic sweet orange fruits to sweet orange seedlings and Arabidopsis plants by viruliferous
<italic>B. yothersi</italic>
mites. The high number of symptomatic plants observed and the confirmation of viral presence at molecular level indicated that mite mediated transmission process of this isolate is at least as efficient as previously described for isolates of the CiLV-C type member [
<xref rid="B85-viruses-08-00153" ref-type="bibr">85</xref>
]. Analyses of symptoms, vector transmission and plant host range did not reveal contrasting biological characteristics between the isolate BR_SP_SJP_01 and the CiLV-C type member. Currently, nucleotide identity-based threshold for species demarcation in the genus
<italic>Cilevirus</italic>
has not been implemented and biological criteria for distinguishing among these viruses have not been recognized. However, based on genome identity data shown elsewhere [
<xref rid="B14-viruses-08-00153" ref-type="bibr">14</xref>
], it seems to be obvious that at least two different viral species exist associated with citrus leprosis within the genus
<italic>Cilevirus i.e.</italic>
, CiLV-C and CiLV-C2 (55% nucleotide identity between their genomes). By analysing this in greater depth, CiLV-C2 isolate Colombia shows about 85% nucleotide identity with CiLV-C2 isolate Hawaii, and they may represent two clades of the same species separately evolving in distant geographic regions and, at least to date, in different hosts (isolate Colombia in sweet orange and isolate Hawaii in hibiscus). CiLV-C isolate BR_SP_SJP_01 (clade SJP) and CiLV-C type member, epitomized by the isolate BR_SP_CRD_01 (clade CRD), also show 85% to 88% nucleotide identity among their genomes, but differently from that observed in the case of CiLV-C2, the two isolates of CiLV-C coexist in the same geographic area and share the same natural hosts. Probably, forces beyond genetic drift, such as those intrinsic to the vector transmitting the virus, might account for the origin of these two divergent genotypes within the CiLV-C population. Interestingly, recent studies showed that several mite morphotypes previously identified as members of the
<italic>B. phoenicis</italic>
species complex are indeed new species [
<xref rid="B25-viruses-08-00153" ref-type="bibr">25</xref>
] and, on top of that, a new report disclosed the existence of diverse
<italic>Brevipalpus</italic>
populations in Brazil [
<xref rid="B86-viruses-08-00153" ref-type="bibr">86</xref>
].</p>
<p>Finally, the low molecular variability observed within the
<italic>MP</italic>
gene in this study warrants the use of the traditional detection test of CiLV-C based on its partial amplification [
<xref rid="B51-viruses-08-00153" ref-type="bibr">51</xref>
]. In addition, we described two primer pairs based on the
<italic>p29</italic>
gene sequence which differentially detect the presence of CiLV-C isolates belonging to the two phylogenetic clades identified in this work. Information and tools generated in this work in combination with those arising from
<italic>Brevipalpus</italic>
population studies will probably lead to improving the strategies used for the control of the citrus leprosis disease, while residues putatively relevant for the biological function of viral proteins were also revealed.</p>
</sec>
<sec id="sec5-viruses-08-00153">
<title>5. Conclusions</title>
<p>This study describes the
<italic>Citrus leprosis virus C</italic>
population as having overall low genetic variability although divided in two clades named CRD and SJP. The complete nucleotide sequence of a new isolate from the clade SJP, which naturally infects not only citrus but also the common weed
<italic>Commelina benghalensis,</italic>
was obtained. This isolate is efficiently transmitted by
<italic>Brevipalpus yothersi</italic>
Baker (synonym
<italic>B. phoenicis</italic>
Geijskes citrus type). At the protein level, several amino acids putatively relevant for cileviruses life cycle were found to be affected by negative selection.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>The authors thank the technical assistance of Leticia Rocha and Jeniffer Silva, undergraduate students of Herminio Ometto University Center, Araras, São Paulo State, Brazil. The authors also appreciate Gabriel Otero-Colina, Colegio de Postgraduados, Texcoco, Mexico, and Walther Turizo-Álvarez, Universidad Nacional de Colombia, Bogotá, Colombia, for providing the CiLV-N and CiLV-C2 cDNA samples, respectively. This work was financially supported by Conselho Nacional de Desenvolvimento Científico e Tecnológico (Proc. 375843/2012-4, 481771/2013-1 and 401564/2012-6) and Fundação de Apoio à Pesquisa no Estado de São Paulo (Proc. 2012/18771-0, 2012/20667-7 and 2014/08458-9).</p>
</ack>
<app-group>
<app id="app1-viruses-08-00153">
<title>Supplementary Materials</title>
<p>The following are available online at
<uri xlink:type="simple" xlink:href="www.mdpi.com/1999-4915/8/6/153/s1">www.mdpi.com/1999-4915/8/6/153/s1</uri>
, Figure S1: 1% agarose gel electrophoresis of RT-PCR products for detection of leprosis associated viruses; Table S1: Library composition and viral genome coverage of the isolate BR_SP_SJP_01 obtained by next generation sequencing of the small RNA fractions derived from infected sweet orange and Arabidopsis plants; Table S2: List of primers used to amplify the BR_SP_SJP_01 complete genome; Table S3: Transmission efficiency of CiLV-C isolate BR_SP_SJP_01 by
<italic>Brevipalpus yothersi</italic>
mites.</p>
<supplementary-material content-type="local-data" id="viruses-08-00153-s001">
<media xlink:href="viruses-08-00153-s001.pdf">
<caption>
<p>Click here for additional data file.</p>
</caption>
</media>
</supplementary-material>
</app>
</app-group>
<notes>
<title>Author Contributions</title>
<p>Pedro Luis Ramos-González and Juliana Freitas-Astúa conceived and designed the experiments; Pedro Luis Ramos-González, Camila Chabi-Jesus, Gabiella Dias Arena and Maria Andreia Nunes performed the experiments; Pedro Luis Ramos-González, Orlene Guerra-Peraza, Michèle Claire Breton and Juliana Freitas-Astúa analyzed the data; Elliot Watanabe Kitajima, Marcos Antonio Machado, Orlene Guerra-Peraza and Juliana Freitas-Astúa contributed with reagents/materials/analysis tools; Pedro Luis Ramos-González, Orlene Guerra-Peraza and Juliana Freitas-Astúa wrote the paper.</p>
</notes>
<notes>
<title>Conflicts of Interest</title>
<p>The authors declare no conflicts of interest.</p>
</notes>
<ref-list>
<title>References</title>
<ref id="B1-viruses-08-00153">
<label>1.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roy</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Hartung</surname>
<given-names>J.S.</given-names>
</name>
<name>
<surname>Schneider</surname>
<given-names>W.L.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Leon</surname>
<given-names>M.G.</given-names>
</name>
<name>
<surname>Melzer</surname>
<given-names>M.J.</given-names>
</name>
<name>
<surname>Beard</surname>
<given-names>J.J.</given-names>
</name>
<name>
<surname>Otero-Colina</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Bauchan</surname>
<given-names>G.R.</given-names>
</name>
<name>
<surname>Ochoa</surname>
<given-names>R.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Role bending: Complex relationships between viruses, hosts, and vectors related to citrus leprosis, an emerging disease</article-title>
<source>Phytopathology</source>
<year>2015</year>
<volume>105</volume>
<fpage>872</fpage>
<lpage>884</lpage>
<pub-id pub-id-type="doi">10.1094/PHYTO-12-14-0375-FI</pub-id>
<pub-id pub-id-type="pmid">26120730</pub-id>
</element-citation>
</ref>
<ref id="B2-viruses-08-00153">
<label>2.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitancourt</surname>
<given-names>A.</given-names>
</name>
</person-group>
<article-title>Estudos sobre a leprose dos citros</article-title>
<source>Arq. Inst. Biológico</source>
<year>1955</year>
<volume>22</volume>
<fpage>161</fpage>
<lpage>231</lpage>
</element-citation>
</ref>
<ref id="B3-viruses-08-00153">
<label>3.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitancourt</surname>
<given-names>A.</given-names>
</name>
</person-group>
<article-title>Relação das doenças e fungos parasitas observados na secção de fitopatologia durante os anos de 1931 e 1932</article-title>
<source>Arq. do Inst. Biológico</source>
<year>1934</year>
<volume>5</volume>
<fpage>185</fpage>
<lpage>196</lpage>
</element-citation>
</ref>
<ref id="B4-viruses-08-00153">
<label>4.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Fawcett</surname>
<given-names>H.S.</given-names>
</name>
</person-group>
<article-title>Scarly bark of citrus</article-title>
<source>Florida Agricultural Experimental Station Annual Report</source>
<person-group person-group-type="editor">
<name>
<surname>Rolfs</surname>
<given-names>P.H.</given-names>
</name>
</person-group>
<publisher-name>Pepper Pub and Ptg. Co.</publisher-name>
<publisher-loc>Gainesville Fla</publisher-loc>
<year>1909</year>
<fpage>75</fpage>
<lpage>80</lpage>
</element-citation>
</ref>
<ref id="B5-viruses-08-00153">
<label>5.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Spegazzini</surname>
<given-names>C.</given-names>
</name>
</person-group>
<article-title>Sobre algunas enfermedades y hongos que afectan las plantas de agrios en el Paraguay</article-title>
<source>An. Soc. Científica Argentina</source>
<year>1920</year>
<volume>90</volume>
<fpage>155</fpage>
<lpage>188</lpage>
</element-citation>
</ref>
<ref id="B6-viruses-08-00153">
<label>6.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Childers</surname>
<given-names>C.C.</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>J.C.</given-names>
</name>
<name>
<surname>Derrick</surname>
<given-names>K.S.</given-names>
</name>
<name>
<surname>Achor</surname>
<given-names>D.S.</given-names>
</name>
<name>
<surname>French</surname>
<given-names>J.V.</given-names>
</name>
<name>
<surname>Welbourn</surname>
<given-names>W.C.</given-names>
</name>
<name>
<surname>Ochoa</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
</person-group>
<article-title>Citrus leprosis and its status in Florida and Texas: past and present</article-title>
<source>Exp. Appl. Acarol.</source>
<year>2003</year>
<volume>30</volume>
<fpage>181</fpage>
<lpage>202</lpage>
<pub-id pub-id-type="doi">10.1023/B:APPA.0000006548.01625.72</pub-id>
<pub-id pub-id-type="pmid">14756416</pub-id>
</element-citation>
</ref>
<ref id="B7-viruses-08-00153">
<label>7.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bastianel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>M.A.</given-names>
</name>
</person-group>
<article-title>The citrus leprosis pathosystem</article-title>
<source>Summa Phytopathol.</source>
<year>2006</year>
<volume>32</volume>
<fpage>211</fpage>
<lpage>220</lpage>
<pub-id pub-id-type="doi">10.1590/S0100-54052006000300001</pub-id>
</element-citation>
</ref>
<ref id="B8-viruses-08-00153">
<label>8.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cáceres</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Aguirre</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Costa</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>de Coll</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Gonzáles Segnana</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Fariña</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Tassi</surname>
<given-names>A.D.</given-names>
</name>
<name>
<surname>Calegario</surname>
<given-names>R.F.</given-names>
</name>
<name>
<surname>Moraes</surname>
<given-names>G.J.de</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Present status of citrus leprosis in Argentina and Paraguay</article-title>
<source>Trop. Plant Pathol.</source>
<year>2013</year>
<volume>38</volume>
<fpage>282</fpage>
<lpage>294</lpage>
<pub-id pub-id-type="doi">10.1590/S1982-56762013005000015</pub-id>
</element-citation>
</ref>
<ref id="B9-viruses-08-00153">
<label>9.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Castillo</surname>
<given-names>I.I.</given-names>
</name>
<name>
<surname>Diaz</surname>
<given-names>L.F.</given-names>
</name>
<name>
<surname>Mendez</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Otero-Colina</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Locali-Fabris</surname>
<given-names>E.C.</given-names>
</name>
<name>
<surname>Moraes</surname>
<given-names>G.J.</given-names>
</name>
<name>
<surname>Calegario</surname>
<given-names>R.F.</given-names>
</name>
<name>
<surname>Tassi</surname>
<given-names>A.D.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
</person-group>
<article-title>Confirmation of the presence of the citrus leprosis virus C (CiLV-C) in Southern Mexico</article-title>
<source>Trop. Plant Pathol.</source>
<year>2011</year>
<volume>36</volume>
<fpage>400</fpage>
<lpage>403</lpage>
</element-citation>
</ref>
<ref id="B10-viruses-08-00153">
<label>10.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leon</surname>
<given-names>G.A.</given-names>
</name>
<name>
<surname>Realpe</surname>
<given-names>C.E.</given-names>
</name>
<name>
<surname>Garzon</surname>
<given-names>P.A.</given-names>
</name>
<name>
<surname>Rodriguez</surname>
<given-names>J.A.</given-names>
</name>
<name>
<surname>Moreno</surname>
<given-names>M.G.</given-names>
</name>
<name>
<surname>Childers</surname>
<given-names>C.C.</given-names>
</name>
<name>
<surname>Achor</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Antonioli-Luizon</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Salaroli</surname>
<given-names>R.B.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Occurrence of citrus leprosis virus in Llanos Orientales, Colombia</article-title>
<source>Plant Dis.</source>
<year>2006</year>
<volume>90</volume>
<fpage>682</fpage>
<pub-id pub-id-type="doi">10.1094/PD-90-0682C</pub-id>
</element-citation>
</ref>
<ref id="B11-viruses-08-00153">
<label>11.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dominguez</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Bernal</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Childers</surname>
<given-names>C.C.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>de Dominguez</surname>
<given-names>F.S.</given-names>
</name>
<name>
<surname>Bernal</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Childers</surname>
<given-names>C.C.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
</person-group>
<article-title>First report of citrus leprosis virus in Panama</article-title>
<source>Plant Dis.</source>
<year>2001</year>
<volume>85</volume>
<fpage>228</fpage>
<pub-id pub-id-type="doi">10.1094/PDIS.2001.85.2.228A</pub-id>
</element-citation>
</ref>
<ref id="B12-viruses-08-00153">
<label>12.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cruz-Jaramillo</surname>
<given-names>J.L.</given-names>
</name>
<name>
<surname>Ruiz-Medrano</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Rojas-Morales</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>López-Buenfil</surname>
<given-names>J.A.</given-names>
</name>
<name>
<surname>Morales-Galván</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Chavarín-Palacio</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Ramírez-Pool</surname>
<given-names>J.A.</given-names>
</name>
<name>
<surname>Xoconostle-Cázares</surname>
<given-names>B.</given-names>
</name>
</person-group>
<article-title>Characterization of a proposed dichorhavirus associated with the citrus leprosis disease and analysis of the host response</article-title>
<source>Viruses</source>
<year>2014</year>
<volume>6</volume>
<fpage>2602</fpage>
<lpage>2622</lpage>
<pub-id pub-id-type="doi">10.3390/v6072602</pub-id>
<pub-id pub-id-type="pmid">25004279</pub-id>
</element-citation>
</ref>
<ref id="B13-viruses-08-00153">
<label>13.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roy</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Stone</surname>
<given-names>A.L.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Otero-Colina</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Choudhary</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Achor</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Levy</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Nakhla</surname>
<given-names>M.K.</given-names>
</name>
<name>
<surname>Hartung</surname>
<given-names>J.S.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Identification and molecular characterization of nuclear citrus leprosis virus, a member of the proposed
<italic>Dichorhavirus</italic>
genus infecting multiple citrus species in Mexico</article-title>
<source>Phytopathology</source>
<year>2015</year>
<volume>105</volume>
<fpage>564</fpage>
<lpage>575</lpage>
<pub-id pub-id-type="doi">10.1094/PHYTO-09-14-0245-R</pub-id>
<pub-id pub-id-type="pmid">25423071</pub-id>
</element-citation>
</ref>
<ref id="B14-viruses-08-00153">
<label>14.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roy</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Choudhary</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Guillermo</surname>
<given-names>L.M.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Govindarajulu</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Achor</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Picton</surname>
<given-names>D.D.</given-names>
</name>
<name>
<surname>Levy</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Nakhla</surname>
<given-names>M.K.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>A novel virus of the genus
<italic>Cilevirus</italic>
causing symptoms similar to citrus leprosis</article-title>
<source>Phytopathology</source>
<year>2013</year>
<volume>103</volume>
<fpage>488</fpage>
<lpage>500</lpage>
<pub-id pub-id-type="doi">10.1094/PHYTO-07-12-0177-R</pub-id>
<pub-id pub-id-type="pmid">23268581</pub-id>
</element-citation>
</ref>
<ref id="B15-viruses-08-00153">
<label>15.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rodrigues</surname>
<given-names>J.C.V.</given-names>
</name>
<name>
<surname>Zuniga Reyes</surname>
<given-names>J.A.</given-names>
</name>
<name>
<surname>Achor</surname>
<given-names>D.S.</given-names>
</name>
<name>
<surname>Childers</surname>
<given-names>C.C.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
</person-group>
<article-title>Occurrence and distribution of citrus leprosis virus in Honduras</article-title>
<source>Plant Pathol.</source>
<year>2007</year>
<volume>56</volume>
<fpage>344</fpage>
<pub-id pub-id-type="doi">10.1111/j.1365-3059.2007.01520.x</pub-id>
</element-citation>
</ref>
<ref id="B16-viruses-08-00153">
<label>16.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gómez</surname>
<given-names>E.C.</given-names>
</name>
<name>
<surname>Vargas</surname>
<given-names>M.R.</given-names>
</name>
<name>
<surname>Rivadameira</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Locali</surname>
<given-names>E.C.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Astúa-Monge</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>J.C.V.</given-names>
</name>
<name>
<surname>Mesa Cobo</surname>
<given-names>N.C.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
</person-group>
<article-title>First report of citrus leprosis virus on citrus in Santa Cruz, Bolivia</article-title>
<source>Plant Dis.</source>
<year>2005</year>
<volume>89</volume>
<fpage>686</fpage>
<pub-id pub-id-type="doi">10.1094/PD-89-0686A</pub-id>
</element-citation>
</ref>
<ref id="B17-viruses-08-00153">
<label>17.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>León</surname>
<given-names>M.G.</given-names>
</name>
<name>
<surname>Becerra</surname>
<given-names>C.H.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Salaroli</surname>
<given-names>R.B.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
</person-group>
<article-title>Natural infection of
<italic>Swinglea glutinosa</italic>
by the citrus leprosis virus cytoplasmic type (CiLV-C) in Colombia</article-title>
<source>Plant Dis.</source>
<year>2008</year>
<volume>92</volume>
<fpage>1364</fpage>
<pub-id pub-id-type="doi">10.1094/PDIS-92-9-1364C</pub-id>
</element-citation>
</ref>
<ref id="B18-viruses-08-00153">
<label>18.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Araya-Gonzáles</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>Leprosis de los cítricos</article-title>
<source>Actual. Fitosanit.</source>
<year>2001</year>
<volume>1</volume>
<fpage>4</fpage>
</element-citation>
</ref>
<ref id="B19-viruses-08-00153">
<label>19.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mejia</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Paniagua</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Cruz</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Porras</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Palmieri</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>Citrus leprosis, disease that endangers plantations in Guatemala</article-title>
<source>Proc. Annu. Meet. Am. Phytopathol. Soc. Caribb. Div.</source>
<year>2002</year>
<volume>42</volume>
<fpage>17</fpage>
<lpage>19</lpage>
</element-citation>
</ref>
<ref id="B20-viruses-08-00153">
<label>20.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Melzer</surname>
<given-names>M.J.</given-names>
</name>
<name>
<surname>Sether</surname>
<given-names>D.M.</given-names>
</name>
<name>
<surname>Borth</surname>
<given-names>W.B.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>J.S.</given-names>
</name>
</person-group>
<article-title>Characterization of a virus infecting
<italic>Citrus volkameriana</italic>
with citrus leprosis-like symptoms</article-title>
<source>Phytopathology</source>
<year>2013</year>
<volume>102</volume>
<fpage>122</fpage>
<lpage>127</lpage>
<pub-id pub-id-type="doi">10.1094/PHYTO-01-11-0013</pub-id>
<pub-id pub-id-type="pmid">21916557</pub-id>
</element-citation>
</ref>
<ref id="B21-viruses-08-00153">
<label>21.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Melzer</surname>
<given-names>M.J.</given-names>
</name>
<name>
<surname>Simbajon</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Carillo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Borth</surname>
<given-names>W.B.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Neupane</surname>
<given-names>K.R.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>J.S.</given-names>
</name>
</person-group>
<article-title>A cilevirus infects ornamental hibiscus in Hawaii</article-title>
<source>Arch. Virol.</source>
<year>2013</year>
<volume>158</volume>
<fpage>2421</fpage>
<lpage>2424</lpage>
<pub-id pub-id-type="doi">10.1007/s00705-013-1745-0</pub-id>
<pub-id pub-id-type="pmid">23732930</pub-id>
</element-citation>
</ref>
<ref id="B22-viruses-08-00153">
<label>22.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bastianel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Novelli</surname>
<given-names>V.M.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Kubo</surname>
<given-names>K.S.</given-names>
</name>
<name>
<surname>Bassanezi</surname>
<given-names>R.B.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>M.A.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>Citrus Leprosis: Centennial of an unusual mite–virus pathosystem</article-title>
<source>Plant Dis.</source>
<year>2010</year>
<volume>94</volume>
<fpage>284</fpage>
<lpage>292</lpage>
<pub-id pub-id-type="doi">10.1094/PDIS-94-3-0284</pub-id>
</element-citation>
</ref>
<ref id="B23-viruses-08-00153">
<label>23.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rodrigues</surname>
<given-names>J.C.V.</given-names>
</name>
<name>
<surname>Childers</surname>
<given-names>C.C.</given-names>
</name>
</person-group>
<article-title>Brevipalpus mites (Acari: Tenuipalpidae): Vectors of invasive, non-systemic cytoplasmic and nuclear viruses in plants</article-title>
<source>Exp. Appl. Acarol.</source>
<year>2013</year>
<volume>59</volume>
<fpage>165</fpage>
<lpage>175</lpage>
<pub-id pub-id-type="doi">10.1007/s10493-012-9632-z</pub-id>
<pub-id pub-id-type="pmid">23203501</pub-id>
</element-citation>
</ref>
<ref id="B24-viruses-08-00153">
<label>24.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Chagas</surname>
<given-names>C.M.</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>J.C.</given-names>
</name>
</person-group>
<article-title>Brevipalpus-transmitted plant virus and virus-like diseases: Cytopathology and some recent cases</article-title>
<source>Exp. Appl. Acarol.</source>
<year>2003</year>
<volume>30</volume>
<fpage>135</fpage>
<lpage>160</lpage>
<pub-id pub-id-type="doi">10.1023/B:APPA.0000006546.55305.e3</pub-id>
<pub-id pub-id-type="pmid">14756414</pub-id>
</element-citation>
</ref>
<ref id="B25-viruses-08-00153">
<label>25.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Beard</surname>
<given-names>J.J.</given-names>
</name>
<name>
<surname>Ochoa</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Braswell</surname>
<given-names>W.E.</given-names>
</name>
<name>
<surname>Bauchan</surname>
<given-names>G.R.</given-names>
</name>
</person-group>
<article-title>
<italic>Brevipalpus phoenicis</italic>
(Geijskes) species complex (Acari:
<italic>Tenuipalpidae</italic>
)-a closer look</article-title>
<source>Zootaxa</source>
<year>2015</year>
<volume>3944</volume>
<fpage>1</fpage>
<lpage>67</lpage>
<pub-id pub-id-type="doi">10.11646/zootaxa.3944.1.1</pub-id>
<pub-id pub-id-type="pmid">25947538</pub-id>
</element-citation>
</ref>
<ref id="B26-viruses-08-00153">
<label>26.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garita</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Tassi</surname>
<given-names>A.D.</given-names>
</name>
<name>
<surname>Calegario</surname>
<given-names>R.F.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Carbonell</surname>
<given-names>S.A.M.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>Common bean (
<italic>Phaseolus vulgaris</italic>
L.): Experimental local lesion host for citrus leprosis virus C (CiLV-C) and some other cytoplasmic-type
<italic>Brevipalpus</italic>
-transmitted viruses</article-title>
<source>Plant Dis.</source>
<year>2013</year>
<volume>97</volume>
<fpage>1346</fpage>
<lpage>1351</lpage>
<pub-id pub-id-type="doi">10.1094/PDIS-12-12-1143-RE</pub-id>
</element-citation>
</ref>
<ref id="B27-viruses-08-00153">
<label>27.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garita</surname>
<given-names>L.C.</given-names>
</name>
<name>
<surname>Tassi</surname>
<given-names>A.D.</given-names>
</name>
<name>
<surname>Calegario</surname>
<given-names>R.F.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Salaroli</surname>
<given-names>R.B.</given-names>
</name>
<name>
<surname>Romão</surname>
<given-names>G.O.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
</person-group>
<article-title>Experimental host range of citrus leprosis virus C (CiLV-C)</article-title>
<source>Trop. Plant Pathol.</source>
<year>2014</year>
<volume>39</volume>
<fpage>43</fpage>
<lpage>55</lpage>
<pub-id pub-id-type="doi">10.1590/S1982-56762014005000004</pub-id>
</element-citation>
</ref>
<ref id="B28-viruses-08-00153">
<label>28.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Afonso</surname>
<given-names>C.L.</given-names>
</name>
<name>
<surname>Amarasinghe</surname>
<given-names>G.K.</given-names>
</name>
<name>
<surname>Bányai</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Bào</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Basler</surname>
<given-names>C.F.</given-names>
</name>
<name>
<surname>Bavari</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Bejerman</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Blasdell</surname>
<given-names>K.R.</given-names>
</name>
<name>
<surname>Briand</surname>
<given-names>F.-X.</given-names>
</name>
<name>
<surname>Briese</surname>
<given-names>T.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Taxonomy of the order
<italic>Mononegavirales</italic>
: Update 2016</article-title>
<source>Arch. Virol.</source>
<year>2016</year>
<comment>(in press)</comment>
<pub-id pub-id-type="doi">10.1007/s00705-016-2880-1</pub-id>
<pub-id pub-id-type="pmid">27216929</pub-id>
</element-citation>
</ref>
<ref id="B29-viruses-08-00153">
<label>29.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Locali-Fabris</surname>
<given-names>E.C.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>M.A.</given-names>
</name>
</person-group>
<article-title>Genus
<italic>Cilevirus</italic>
</article-title>
<source>Virus Taxonomy - Ninth Report of the International Committee on Taxonomy of Viruses</source>
<person-group person-group-type="editor">
<name>
<surname>King</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Adams</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Carstens</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Lefkowitz</surname>
<given-names>E.</given-names>
</name>
</person-group>
<publisher-name>Elsevier/Avademic Press</publisher-name>
<publisher-loc>London, United Kingdom</publisher-loc>
<year>2011</year>
<fpage>1139</fpage>
<lpage>1142</lpage>
</element-citation>
</ref>
<ref id="B30-viruses-08-00153">
<label>30.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dietzgen</surname>
<given-names>R.G.</given-names>
</name>
<name>
<surname>Kuhn</surname>
<given-names>J.H.</given-names>
</name>
<name>
<surname>Clawson</surname>
<given-names>A.N.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Goodin</surname>
<given-names>M.M.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Kondo</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wetzel</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Whitfield</surname>
<given-names>A.E.</given-names>
</name>
</person-group>
<article-title>
<italic>Dichorhavirus</italic>
: A proposed new genus for
<italic>Brevipalpus</italic>
mite-transmitted, nuclear, bacilliform, bipartite, negative-strand RNA plant viruses</article-title>
<source>Arch. Virol.</source>
<year>2014</year>
<volume>159</volume>
<fpage>607</fpage>
<lpage>619</lpage>
<pub-id pub-id-type="doi">10.1007/s00705-013-1834-0</pub-id>
<pub-id pub-id-type="pmid">24081823</pub-id>
</element-citation>
</ref>
<ref id="B31-viruses-08-00153">
<label>31.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roy</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Leon</surname>
<given-names>M.G.</given-names>
</name>
<name>
<surname>Stone</surname>
<given-names>A.L.</given-names>
</name>
<name>
<surname>Schneider</surname>
<given-names>W.L.</given-names>
</name>
<name>
<surname>Hartung</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Brlansky</surname>
<given-names>R.H.</given-names>
</name>
</person-group>
<article-title>First report of citrus leprosis virus nuclear type in sweet orange in Colombia</article-title>
<source>Plant Dis.</source>
<year>2014</year>
<volume>98</volume>
<fpage>1162</fpage>
<pub-id pub-id-type="doi">10.1094/PDIS-02-14-0117-PDN</pub-id>
</element-citation>
</ref>
<ref id="B32-viruses-08-00153">
<label>32.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Locali-Fabris</surname>
<given-names>E.C.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Souza</surname>
<given-names>A.A.</given-names>
</name>
<name>
<surname>Takita</surname>
<given-names>M.A.</given-names>
</name>
<name>
<surname>Astúa-Monge</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Antonioli-Luizon</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Targon</surname>
<given-names>M.L.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>M.A.</given-names>
</name>
</person-group>
<article-title>Complete nucleotide sequence, genomic organization and phylogenetic analysis of citrus leprosis virus cytoplasmic type</article-title>
<source>J. Gen. Virol.</source>
<year>2006</year>
<volume>87</volume>
<fpage>2721</fpage>
<lpage>2729</lpage>
<pub-id pub-id-type="doi">10.1099/vir.0.82038-0</pub-id>
<pub-id pub-id-type="pmid">16894213</pub-id>
</element-citation>
</ref>
<ref id="B33-viruses-08-00153">
<label>33.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kuchibhatla</surname>
<given-names>D.B.</given-names>
</name>
<name>
<surname>Sherman</surname>
<given-names>W.A.</given-names>
</name>
<name>
<surname>Chung</surname>
<given-names>B.Y.W.</given-names>
</name>
<name>
<surname>Cook</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Schneider</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Eisenhaber</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Karlin</surname>
<given-names>D.G.</given-names>
</name>
</person-group>
<article-title>Powerful sequence similarity search methods and in-depth manual analyses can identify remote homologs in many apparently “orphan” viral proteins</article-title>
<source>J. Virol.</source>
<year>2014</year>
<volume>88</volume>
<fpage>10</fpage>
<lpage>20</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.02595-13</pub-id>
<pub-id pub-id-type="pmid">24155369</pub-id>
</element-citation>
</ref>
<ref id="B34-viruses-08-00153">
<label>34.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pascon</surname>
<given-names>R.C.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>J.P.</given-names>
</name>
<name>
<surname>Breton</surname>
<given-names>M.C.</given-names>
</name>
<name>
<surname>Assumpção</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Greggio</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Zanca</surname>
<given-names>A.S.</given-names>
</name>
<name>
<surname>Okura</surname>
<given-names>V.K.</given-names>
</name>
<name>
<surname>Alegria</surname>
<given-names>M.C.</given-names>
</name>
<name>
<surname>Camargo</surname>
<given-names>M.E.</given-names>
</name>
<name>
<surname>Silva</surname>
<given-names>G.G.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>The complete nucleotide sequence and genomic organization of citrus leprosis associated virus, cytoplasmatic type (CiLV-C)</article-title>
<source>Virus Genes</source>
<year>2006</year>
<volume>32</volume>
<fpage>289</fpage>
<lpage>298</lpage>
<pub-id pub-id-type="doi">10.1007/s11262-005-6913-1</pub-id>
<pub-id pub-id-type="pmid">16732481</pub-id>
</element-citation>
</ref>
<ref id="B35-viruses-08-00153">
<label>35.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weeks</surname>
<given-names>A.R.</given-names>
</name>
<name>
<surname>Marec</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Breeuwer</surname>
<given-names>J.A.</given-names>
</name>
</person-group>
<article-title>A mite species that consists entirely of haploid females</article-title>
<source>Science</source>
<year>2001</year>
<volume>292</volume>
<fpage>2479</fpage>
<lpage>2482</lpage>
<pub-id pub-id-type="doi">10.1126/science.1060411</pub-id>
<pub-id pub-id-type="pmid">11431565</pub-id>
</element-citation>
</ref>
<ref id="B36-viruses-08-00153">
<label>36.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Childers</surname>
<given-names>C.C.</given-names>
</name>
<name>
<surname>French</surname>
<given-names>J.V.</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>J.C.</given-names>
</name>
</person-group>
<article-title>
<italic>Brevipalpus californicus, B. obovatus, B. phoenicis</italic>
, and
<italic>B. lewisi</italic>
(Acari:
<italic>Tenuipalpidae</italic>
): A review of their biology, feeding injury and economic importance</article-title>
<source>Exp. Appl. Acarol.</source>
<year>2003</year>
<volume>30</volume>
<fpage>5</fpage>
<lpage>28</lpage>
<pub-id pub-id-type="doi">10.1023/B:APPA.0000006543.34042.b4</pub-id>
<pub-id pub-id-type="pmid">14756411</pub-id>
</element-citation>
</ref>
<ref id="B37-viruses-08-00153">
<label>37.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Alberti</surname>
<given-names>G.</given-names>
</name>
</person-group>
<article-title>Anatomy and fine structure of
<italic>Bevipalpus</italic>
mites (
<italic>Tenuipalpidae</italic>
)—Economically important plant virus vectors. Part 7. Ultrastructural detection of cytoplasmic and nuclear types of
<italic>Brevipalpus</italic>
transmitted viruses</article-title>
<source>Zoologica</source>
<year>2014</year>
<volume>160</volume>
<fpage>174</fpage>
<lpage>192</lpage>
</element-citation>
</ref>
<ref id="B38-viruses-08-00153">
<label>38.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Domingo-Calap</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Sanjuán</surname>
<given-names>R.</given-names>
</name>
</person-group>
<article-title>Experimental evolution of RNA
<italic>versus</italic>
DNA viruses</article-title>
<source>Evolution</source>
<year>2011</year>
<volume>65</volume>
<fpage>2987</fpage>
<lpage>2994</lpage>
<pub-id pub-id-type="doi">10.1111/j.1558-5646.2011.01339.x</pub-id>
<pub-id pub-id-type="pmid">21967437</pub-id>
</element-citation>
</ref>
<ref id="B39-viruses-08-00153">
<label>39.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Gibbs</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Calisher</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>García-Arenal</surname>
<given-names>F.</given-names>
</name>
</person-group>
<source>Molecular basis of virus evolution</source>
<edition>1st ed.</edition>
<publisher-name>Cambrige University Press</publisher-name>
<publisher-loc>New York, NY, USA</publisher-loc>
<year>1995</year>
</element-citation>
</ref>
<ref id="B40-viruses-08-00153">
<label>40.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Simon-Loriere</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Holmes</surname>
<given-names>E.C.</given-names>
</name>
</person-group>
<article-title>Why do RNA viruses recombine?</article-title>
<source>Nat. Rev. Microbiol.</source>
<year>2011</year>
<volume>9</volume>
<fpage>617</fpage>
<lpage>626</lpage>
<pub-id pub-id-type="doi">10.1038/nrmicro2614</pub-id>
<pub-id pub-id-type="pmid">21725337</pub-id>
</element-citation>
</ref>
<ref id="B41-viruses-08-00153">
<label>41.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bujarski</surname>
<given-names>J.J.</given-names>
</name>
</person-group>
<article-title>Genetic recombination in plant-infecting messenger-sense RNA viruses: Overview and research perspectives</article-title>
<source>Front. Plant Sci.</source>
<year>2013</year>
<volume>4</volume>
<fpage>68</fpage>
<pub-id pub-id-type="doi">10.3389/fpls.2013.00068</pub-id>
<pub-id pub-id-type="pmid">23533000</pub-id>
</element-citation>
</ref>
<ref id="B42-viruses-08-00153">
<label>42.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roossinck</surname>
<given-names>M.J.</given-names>
</name>
</person-group>
<article-title>Mechanisms of plant virus evolution</article-title>
<source>Annu. Rev. Phytopathol.</source>
<year>1997</year>
<volume>35</volume>
<fpage>191</fpage>
<lpage>209</lpage>
<pub-id pub-id-type="doi">10.1146/annurev.phyto.35.1.191</pub-id>
<pub-id pub-id-type="pmid">15012521</pub-id>
</element-citation>
</ref>
<ref id="B43-viruses-08-00153">
<label>43.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sztuba-Solińska</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Urbanowicz</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Figlerowicz</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Bujarski</surname>
<given-names>J.J.</given-names>
</name>
</person-group>
<article-title>RNA-RNA recombination in plant virus replication and evolution</article-title>
<source>Annu. Rev. Phytopathol.</source>
<year>2011</year>
<volume>49</volume>
<fpage>415</fpage>
<lpage>443</lpage>
<pub-id pub-id-type="doi">10.1146/annurev-phyto-072910-095351</pub-id>
<pub-id pub-id-type="pmid">21529157</pub-id>
</element-citation>
</ref>
<ref id="B44-viruses-08-00153">
<label>44.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Greenbaum</surname>
<given-names>B.D.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>O.T.</given-names>
</name>
<name>
<surname>Poon</surname>
<given-names>L.L.</given-names>
</name>
<name>
<surname>Levine</surname>
<given-names>A.J.</given-names>
</name>
<name>
<surname>Rabadan</surname>
<given-names>R.</given-names>
</name>
</person-group>
<article-title>Viral reassortment as an information exchange between viral segments</article-title>
<source>Proc. Natl. Acad. Sci. USA</source>
<year>2012</year>
<volume>109</volume>
<fpage>3341</fpage>
<lpage>3346</lpage>
<pub-id pub-id-type="doi">10.1073/pnas.1113300109</pub-id>
<pub-id pub-id-type="pmid">22331898</pub-id>
</element-citation>
</ref>
<ref id="B45-viruses-08-00153">
<label>45.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>García-Arenal</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Fraile</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Malpica</surname>
<given-names>J.M.</given-names>
</name>
</person-group>
<article-title>Variability and genetic structure of plant virus populations</article-title>
<source>Annu. Rev. Phytopathol.</source>
<year>2001</year>
<volume>39</volume>
<fpage>157</fpage>
<lpage>186</lpage>
<pub-id pub-id-type="doi">10.1146/annurev.phyto.39.1.157</pub-id>
<pub-id pub-id-type="pmid">11701863</pub-id>
</element-citation>
</ref>
<ref id="B46-viruses-08-00153">
<label>46.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gutiérrez</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Michalakis</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Blanc</surname>
<given-names>S.</given-names>
</name>
</person-group>
<article-title>Virus population bottlenecks during within-host progression and host-to-host transmission</article-title>
<source>Curr. Opin. Virol.</source>
<year>2012</year>
<volume>2</volume>
<fpage>546</fpage>
<lpage>555</lpage>
<pub-id pub-id-type="doi">10.1016/j.coviro.2012.08.001</pub-id>
<pub-id pub-id-type="pmid">22921636</pub-id>
</element-citation>
</ref>
<ref id="B47-viruses-08-00153">
<label>47.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Acosta-Leal</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Duffy</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Hammond</surname>
<given-names>R.W.</given-names>
</name>
<name>
<surname>Elena</surname>
<given-names>S.F.</given-names>
</name>
</person-group>
<article-title>Advances in plant virus evolution: translating evolutionary insights into better disease management</article-title>
<source>Phytopathology</source>
<year>2011</year>
<volume>101</volume>
<fpage>1136</fpage>
<lpage>1148</lpage>
<pub-id pub-id-type="doi">10.1094/PHYTO-01-11-0017</pub-id>
<pub-id pub-id-type="pmid">21554186</pub-id>
</element-citation>
</ref>
<ref id="B48-viruses-08-00153">
<label>48.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Neves</surname>
<given-names>M.F.</given-names>
</name>
<name>
<surname>Trombin</surname>
<given-names>V.G.</given-names>
</name>
<name>
<surname>Lopes</surname>
<given-names>F.F.</given-names>
</name>
<name>
<surname>Kalaki</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Milan</surname>
<given-names>P.</given-names>
</name>
</person-group>
<source>The Orange Juice Business: A Brazilian Perspective</source>
<publisher-name>Wageningen Academic Publishers</publisher-name>
<publisher-loc>Wageningen, The Netherlands</publisher-loc>
<year>2011</year>
</element-citation>
</ref>
<ref id="B49-viruses-08-00153">
<label>49.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nunes</surname>
<given-names>M.A.</given-names>
</name>
<name>
<surname>Bergamini</surname>
<given-names>M.P.</given-names>
</name>
<name>
<surname>Coerini</surname>
<given-names>L.F.</given-names>
</name>
<name>
<surname>Bastianel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Novelli</surname>
<given-names>V.M.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>
<italic>Citrus leprosis virus C</italic>
naturally infecting
<italic>Commelina benghalensis</italic>
, a prevalent monocot weed of citrus orchards in Brazil</article-title>
<source>Plant Dis.</source>
<year>2012</year>
<volume>96</volume>
<fpage>770</fpage>
<pub-id pub-id-type="doi">10.1094/PDIS-11-11-0925-PDN</pub-id>
</element-citation>
</ref>
<ref id="B50-viruses-08-00153">
<label>50.</label>
<element-citation publication-type="other">
<person-group person-group-type="author">
<name>
<surname>Guerra</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Manjunath</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Rangel</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Brlansky</surname>
<given-names>R.H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>R.F.</given-names>
</name>
</person-group>
<article-title>Citrus leprosis symptoms can be associated with the presence of two different viruses, cytoplasmic and nuclear, the former having a multipartite RNA genome</article-title>
<comment>(unpublished)</comment>
</element-citation>
</ref>
<ref id="B51-viruses-08-00153">
<label>51.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Locali</surname>
<given-names>E.C.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>de Souza</surname>
<given-names>A.A.</given-names>
</name>
<name>
<surname>Takita</surname>
<given-names>M.A.</given-names>
</name>
<name>
<surname>Astúa-Monge</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Antonioli</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>M.A.</given-names>
</name>
</person-group>
<article-title>Development of a molecular tool for the diagnosis of leprosis, a major threat to citrus production in the Americas</article-title>
<source>Plant Dis.</source>
<year>2003</year>
<volume>87</volume>
<fpage>1317</fpage>
<lpage>1321</lpage>
<pub-id pub-id-type="doi">10.1094/PDIS.2003.87.11.1317</pub-id>
</element-citation>
</ref>
<ref id="B52-viruses-08-00153">
<label>52.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Untergasser</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Cutcutache</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Koressaar</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Ye</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Faircloth</surname>
<given-names>B.C.</given-names>
</name>
<name>
<surname>Remm</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rozen</surname>
<given-names>S.G.</given-names>
</name>
</person-group>
<article-title>Primer3–new capabilities and interfaces</article-title>
<source>Nucleic Acids Res.</source>
<year>2012</year>
<volume>40</volume>
<fpage>e115</fpage>
<pub-id pub-id-type="doi">10.1093/nar/gks596</pub-id>
<pub-id pub-id-type="pmid">22730293</pub-id>
</element-citation>
</ref>
<ref id="B53-viruses-08-00153">
<label>53.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Edgar</surname>
<given-names>R.C.</given-names>
</name>
</person-group>
<article-title>MUSCLE: Multiple sequence alignment with high accuracy and high throughput</article-title>
<source>Nucleic Acids Res.</source>
<year>2004</year>
<volume>32</volume>
<fpage>1792</fpage>
<lpage>1797</lpage>
<pub-id pub-id-type="doi">10.1093/nar/gkh340</pub-id>
<pub-id pub-id-type="pmid">15034147</pub-id>
</element-citation>
</ref>
<ref id="B54-viruses-08-00153">
<label>54.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tamura</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Stecher</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Peterson</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Filipski</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kumar</surname>
<given-names>S.</given-names>
</name>
</person-group>
<article-title>MEGA6: Molecular Evolutionary Genetics Analysis version 6.0</article-title>
<source>Mol. Biol. Evol.</source>
<year>2013</year>
<volume>30</volume>
<fpage>2725</fpage>
<lpage>2729</lpage>
<pub-id pub-id-type="doi">10.1093/molbev/mst197</pub-id>
<pub-id pub-id-type="pmid">24132122</pub-id>
</element-citation>
</ref>
<ref id="B55-viruses-08-00153">
<label>55.</label>
<element-citation publication-type="webpage">
<article-title>FigTree</article-title>
<comment>Available online:
<ext-link ext-link-type="uri" xlink:href="http://tree.bio.ed.ac.uk/software/figtree/">http://tree.bio.ed.ac.uk/software/figtree/</ext-link>
</comment>
<date-in-citation>(accessed on 25 October 2015)</date-in-citation>
</element-citation>
</ref>
<ref id="B56-viruses-08-00153">
<label>56.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Librado</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Rozas</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>DnaSP v5: A software for comprehensive analysis of DNA polymorphism data</article-title>
<source>Bioinformatics</source>
<year>2009</year>
<volume>25</volume>
<fpage>1451</fpage>
<lpage>1452</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btp187</pub-id>
<pub-id pub-id-type="pmid">19346325</pub-id>
</element-citation>
</ref>
<ref id="B57-viruses-08-00153">
<label>57.</label>
<element-citation publication-type="webpage">
<article-title>Datamonkey: Rapid Detection of Positive Selection</article-title>
<comment>Available online:
<ext-link ext-link-type="uri" xlink:href="http://www.datamonkey.org/dataupload.php">http://www.datamonkey.org/dataupload.php</ext-link>
</comment>
<date-in-citation>(accessed on 4 June 2015)</date-in-citation>
</element-citation>
</ref>
<ref id="B58-viruses-08-00153">
<label>58.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Delport</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Poon</surname>
<given-names>A.F.</given-names>
</name>
<name>
<surname>Frost</surname>
<given-names>S.D.</given-names>
</name>
<name>
<surname>Kosakovsky Pond</surname>
<given-names>S.L.</given-names>
</name>
</person-group>
<article-title>Datamonkey 2010: A suite of phylogenetic analysis tools for evolutionary biology</article-title>
<source>Bioinformatics</source>
<year>2010</year>
<volume>26</volume>
<fpage>2455</fpage>
<lpage>2457</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btq429</pub-id>
<pub-id pub-id-type="pmid">20671151</pub-id>
</element-citation>
</ref>
<ref id="B59-viruses-08-00153">
<label>59.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kosakovsky Pond</surname>
<given-names>S.L.</given-names>
</name>
<name>
<surname>Posada</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Gravenor</surname>
<given-names>M.B.</given-names>
</name>
<name>
<surname>Woelk</surname>
<given-names>C.H.</given-names>
</name>
<name>
<surname>Frost</surname>
<given-names>S.D.W.</given-names>
</name>
</person-group>
<article-title>GARD: A genetic algorithm for recombination detection</article-title>
<source>Bioinformatics</source>
<year>2006</year>
<volume>22</volume>
<fpage>3096</fpage>
<lpage>3098</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btl474</pub-id>
<pub-id pub-id-type="pmid">17110367</pub-id>
</element-citation>
</ref>
<ref id="B60-viruses-08-00153">
<label>60.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martin</surname>
<given-names>D.P.</given-names>
</name>
<name>
<surname>Murrell</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Golden</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Khoosal</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Muhire</surname>
<given-names>B.</given-names>
</name>
</person-group>
<article-title>RDP4: Detection and analysis of recombination patterns in virus genomes</article-title>
<source>Virus Evol.</source>
<year>2015</year>
<volume>1</volume>
<fpage>vev003</fpage>
<pub-id pub-id-type="doi">10.1093/ve/vev003</pub-id>
</element-citation>
</ref>
<ref id="B61-viruses-08-00153">
<label>61.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pei</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Grishin</surname>
<given-names>N.V.</given-names>
</name>
</person-group>
<article-title>PROMALS: Towards accurate multiple sequence alignments of distantly related proteins</article-title>
<source>Bioinformatics</source>
<year>2007</year>
<volume>23</volume>
<fpage>802</fpage>
<lpage>808</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/btm017</pub-id>
<pub-id pub-id-type="pmid">17267437</pub-id>
</element-citation>
</ref>
<ref id="B62-viruses-08-00153">
<label>62.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Notredame</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Higgins</surname>
<given-names>D.G.</given-names>
</name>
<name>
<surname>Heringa</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>T-Coffee: A novel method for fast and accurate multiple sequence alignment</article-title>
<source>J. Mol. Biol.</source>
<year>2000</year>
<volume>302</volume>
<fpage>205</fpage>
<lpage>217</lpage>
<pub-id pub-id-type="doi">10.1006/jmbi.2000.4042</pub-id>
<pub-id pub-id-type="pmid">10964570</pub-id>
</element-citation>
</ref>
<ref id="B63-viruses-08-00153">
<label>63.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Robert</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Gouet</surname>
<given-names>P.</given-names>
</name>
</person-group>
<article-title>Deciphering key features in protein structures with the new ENDscript server</article-title>
<source>Nucleic Acids Res.</source>
<year>2014</year>
<volume>42</volume>
<fpage>W320</fpage>
<lpage>W324</lpage>
<pub-id pub-id-type="doi">10.1093/nar/gku316</pub-id>
<pub-id pub-id-type="pmid">24753421</pub-id>
</element-citation>
</ref>
<ref id="B64-viruses-08-00153">
<label>64.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zerbino</surname>
<given-names>D.R.</given-names>
</name>
<name>
<surname>Birney</surname>
<given-names>E.</given-names>
</name>
</person-group>
<article-title>Velvet: Algorithms for
<italic>de novo</italic>
short read assembly using de Bruijn graphs</article-title>
<source>Genome Res.</source>
<year>2008</year>
<volume>18</volume>
<fpage>821</fpage>
<lpage>829</lpage>
<pub-id pub-id-type="doi">10.1101/gr.074492.107</pub-id>
<pub-id pub-id-type="pmid">18349386</pub-id>
</element-citation>
</ref>
<ref id="B65-viruses-08-00153">
<label>65.</label>
<element-citation publication-type="webpage">
<person-group person-group-type="author">
<collab>PlantGDB</collab>
</person-group>
<article-title>
<italic>Arabidopsis thaliana</italic>
Genome</article-title>
<comment>Available online:
<ext-link ext-link-type="uri" xlink:href="http://www.plantgdb.org/AtGDB/">http://www.plantgdb.org/AtGDB/</ext-link>
</comment>
<date-in-citation>(accessed on 4 June 2015)</date-in-citation>
</element-citation>
</ref>
<ref id="B66-viruses-08-00153">
<label>66.</label>
<element-citation publication-type="webpage">
<article-title>Citrus Genome Database</article-title>
<comment>Available online:
<ext-link ext-link-type="uri" xlink:href="https://www.citrusgenomedb.org/">https://www.citrusgenomedb.org/</ext-link>
</comment>
<date-in-citation>(accessed on 4 June 2015)</date-in-citation>
</element-citation>
</ref>
<ref id="B67-viruses-08-00153">
<label>67.</label>
<element-citation publication-type="webpage">
<person-group person-group-type="author">
<name>
<surname>Knudsen</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Knudsen</surname>
<given-names>B.</given-names>
</name>
</person-group>
<article-title>CLC genomics benchwork 6</article-title>
<comment>Available online:
<ext-link ext-link-type="uri" xlink:href="http://www.clcbio.com">http://www.clcbio.com</ext-link>
</comment>
<date-in-citation>(accessed on 25 October 2015)</date-in-citation>
</element-citation>
</ref>
<ref id="B68-viruses-08-00153">
<label>68.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tamura</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Nei</surname>
<given-names>M.</given-names>
</name>
</person-group>
<article-title>Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees</article-title>
<source>Mol. Biol. Evol.</source>
<year>1993</year>
<volume>10</volume>
<fpage>512</fpage>
<lpage>526</lpage>
<pub-id pub-id-type="pmid">8336541</pub-id>
</element-citation>
</ref>
<ref id="B69-viruses-08-00153">
<label>69.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hasegawa</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kishino</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yano</surname>
<given-names>T.</given-names>
</name>
</person-group>
<article-title>Dating of the human-ape splitting by a molecular clock of mitochondrial DNA</article-title>
<source>J. Mol. Evol.</source>
<year>1985</year>
<volume>22</volume>
<fpage>160</fpage>
<lpage>174</lpage>
<pub-id pub-id-type="doi">10.1007/BF02101694</pub-id>
<pub-id pub-id-type="pmid">3934395</pub-id>
</element-citation>
</ref>
<ref id="B70-viruses-08-00153">
<label>70.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pond</surname>
<given-names>S.L.</given-names>
</name>
<name>
<surname>Frost</surname>
<given-names>S.D.</given-names>
</name>
<name>
<surname>Muse</surname>
<given-names>S.V.</given-names>
</name>
</person-group>
<article-title>HyPhy: Hypothesis testing using phylogenies</article-title>
<source>Bioinformatics</source>
<year>2005</year>
<volume>21</volume>
<fpage>676</fpage>
<lpage>679</lpage>
<pub-id pub-id-type="doi">10.1093/bioinformatics/bti079</pub-id>
<pub-id pub-id-type="pmid">15509596</pub-id>
</element-citation>
</ref>
<ref id="B71-viruses-08-00153">
<label>71.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rozanov</surname>
<given-names>M.N.</given-names>
</name>
<name>
<surname>Koonin</surname>
<given-names>E.V.</given-names>
</name>
<name>
<surname>Gorbalenya</surname>
<given-names>A.E.</given-names>
</name>
</person-group>
<article-title>Conservation of the putative methyltransferase domain: A hallmark of the “Sindbis-like” supergroup of positive-strand RNA viruses</article-title>
<source>J. Gen. Virol.</source>
<year>1992</year>
<volume>73</volume>
<fpage>2129</fpage>
<lpage>2134</lpage>
<pub-id pub-id-type="doi">10.1099/0022-1317-73-8-2129</pub-id>
<pub-id pub-id-type="pmid">1645151</pub-id>
</element-citation>
</ref>
<ref id="B72-viruses-08-00153">
<label>72.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wierzchoslawski</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Dzianott</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Bujarski</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>Dissecting the requirement for subgenomic promoter sequences by RNA recombination of brome mosaic virus
<italic>in vivo</italic>
: Evidence for functional separation of transcription and recombination</article-title>
<source>J. Virol.</source>
<year>2004</year>
<volume>78</volume>
<fpage>8552</fpage>
<lpage>8564</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.78.16.8552-8564.2004</pub-id>
<pub-id pub-id-type="pmid">15280464</pub-id>
</element-citation>
</ref>
<ref id="B73-viruses-08-00153">
<label>73.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wierzchoslawski</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Dzianott</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kunimalayan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Bujarski</surname>
<given-names>J.J.</given-names>
</name>
</person-group>
<article-title>A transcriptionally active subgenomic promoter supports homologous crossovers in a plus-strand RNA virus</article-title>
<source>J. Virol.</source>
<year>2003</year>
<volume>77</volume>
<fpage>6769</fpage>
<lpage>6776</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.77.12.6769-6776.2003</pub-id>
<pub-id pub-id-type="pmid">12767997</pub-id>
</element-citation>
</ref>
<ref id="B74-viruses-08-00153">
<label>74.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Martin</surname>
<given-names>S.</given-names>
</name>
</person-group>
<article-title>Genetic variation of populations of
<italic>Citrus psorosis virus</italic>
</article-title>
<source>J. Gen. Virol.</source>
<year>2006</year>
<volume>87</volume>
<fpage>3097</fpage>
<lpage>3102</lpage>
<pub-id pub-id-type="doi">10.1099/vir.0.81742-0</pub-id>
<pub-id pub-id-type="pmid">16963769</pub-id>
</element-citation>
</ref>
<ref id="B75-viruses-08-00153">
<label>75.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rubio</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Ayllón</surname>
<given-names>M.A.</given-names>
</name>
<name>
<surname>Kong</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Fernández</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Polek</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Guerri</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Moreno</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Falk</surname>
<given-names>B.W.</given-names>
</name>
</person-group>
<article-title>Genetic variation of
<italic>Citrus tristeza virus</italic>
isolates from California and Spain: Evidence for mixed infections and recombination</article-title>
<source>J. Virol.</source>
<year>2001</year>
<volume>75</volume>
<fpage>8054</fpage>
<lpage>8062</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.75.17.8054-8062.2001</pub-id>
<pub-id pub-id-type="pmid">11483750</pub-id>
</element-citation>
</ref>
<ref id="B76-viruses-08-00153">
<label>76.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vives</surname>
<given-names>M.C.</given-names>
</name>
<name>
<surname>Rubio</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Galipienso</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Navarro</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Moreno</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Guerri</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>Low genetic variation between isolates of
<italic>Citrus leaf blotch virus</italic>
from different host species and of different geographical origins</article-title>
<source>J. Gen. Virol.</source>
<year>2002</year>
<volume>83</volume>
<fpage>2587</fpage>
<lpage>2591</lpage>
<pub-id pub-id-type="doi">10.1099/0022-1317-83-10-2587</pub-id>
<pub-id pub-id-type="pmid">12237442</pub-id>
</element-citation>
</ref>
<ref id="B77-viruses-08-00153">
<label>77.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hartung</surname>
<given-names>J.S.</given-names>
</name>
<name>
<surname>Roy</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Schneider</surname>
<given-names>W.L.</given-names>
</name>
<name>
<surname>Brlansky</surname>
<given-names>R.H.</given-names>
</name>
</person-group>
<article-title>History and diversity of citrus leprosis virus recorded in herbarium specimens</article-title>
<source>Phytopathology</source>
<year>2015</year>
<volume>105</volume>
<fpage>1277</fpage>
<lpage>1284</lpage>
<pub-id pub-id-type="doi">10.1094/PHYTO-03-15-0064-R</pub-id>
<pub-id pub-id-type="pmid">25961338</pub-id>
</element-citation>
</ref>
<ref id="B78-viruses-08-00153">
<label>78.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bastianel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Nicolini</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Segatti</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Novelli</surname>
<given-names>V.M.</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Medina</surname>
<given-names>C.L.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>M.A.</given-names>
</name>
</person-group>
<article-title>Response of mandarin cultivars and hybrids to citrus leprosis virus</article-title>
<source>J. Plant Pathol.</source>
<year>2008</year>
<volume>90</volume>
<fpage>305</fpage>
<lpage>301</lpage>
</element-citation>
</ref>
<ref id="B79-viruses-08-00153">
<label>79.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arena</surname>
<given-names>G.D.</given-names>
</name>
<name>
<surname>Bergamini</surname>
<given-names>M.P.</given-names>
</name>
<name>
<surname>Tassi</surname>
<given-names>A.D.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Kubo</surname>
<given-names>K.S.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>
<italic>Citrus leprosis virus C</italic>
infects
<italic>Arabidopsis thaliana</italic>
, the model for plant-pathogen interactions</article-title>
<source>J. Plant Pathol.</source>
<year>2013</year>
<volume>95</volume>
<fpage>448</fpage>
</element-citation>
</ref>
<ref id="B80-viruses-08-00153">
<label>80.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nunes</surname>
<given-names>M.A.</given-names>
</name>
<name>
<surname>Lameiro</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Calegario</surname>
<given-names>R.F.</given-names>
</name>
<name>
<surname>Bergamini</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Fender</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Bastianel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Novelli</surname>
<given-names>V.M.</given-names>
</name>
<name>
<surname>Freita-Astua</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>Tropical spiderwort (
<italic>Commelina benghalensis</italic>
L.) as source of inoculum for citrus leprosis virus C</article-title>
<source>Citrus Res. Technol.</source>
<year>2012</year>
<volume>33</volume>
<fpage>1</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="doi">10.5935/2236-3122.20120001</pub-id>
</element-citation>
</ref>
<ref id="B81-viruses-08-00153">
<label>81.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Kikuchi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Moriyasu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Tomaru</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Suga</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Hagiwara</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Akita</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Shimizu</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Netsu</surname>
<given-names>O.</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Rice dwarf viruses with dysfunctional genomes generated in plants are filtered out in vector insects: Implications for the origin of the virus</article-title>
<source>J. Virol.</source>
<year>2011</year>
<volume>85</volume>
<fpage>2975</fpage>
<lpage>2979</lpage>
<pub-id pub-id-type="doi">10.1128/JVI.02147-10</pub-id>
<pub-id pub-id-type="pmid">21191024</pub-id>
</element-citation>
</ref>
<ref id="B82-viruses-08-00153">
<label>82.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sin</surname>
<given-names>S.-H.</given-names>
</name>
<name>
<surname>McNulty</surname>
<given-names>B.C.</given-names>
</name>
<name>
<surname>Kennedy</surname>
<given-names>G.G.</given-names>
</name>
<name>
<surname>Moyer</surname>
<given-names>J.W.</given-names>
</name>
</person-group>
<article-title>Viral genetic determinants for thrips transmission of
<italic>Tomato spotted wilt virus</italic>
</article-title>
<source>Proc. Natl. Acad. Sci. USA</source>
<year>2005</year>
<volume>102</volume>
<fpage>5168</fpage>
<lpage>5173</lpage>
<pub-id pub-id-type="doi">10.1073/pnas.0407354102</pub-id>
<pub-id pub-id-type="pmid">15753307</pub-id>
</element-citation>
</ref>
<ref id="B83-viruses-08-00153">
<label>83.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mushegian</surname>
<given-names>A.R.</given-names>
</name>
<name>
<surname>Elena</surname>
<given-names>S.F.</given-names>
</name>
</person-group>
<article-title>Evolution of plant virus movement proteins from the 30K superfamily and of their homologs integrated in plant genomes</article-title>
<source>Virology</source>
<year>2015</year>
<volume>476C</volume>
<fpage>304</fpage>
<lpage>315</lpage>
<pub-id pub-id-type="doi">10.1016/j.virol.2014.12.012</pub-id>
<pub-id pub-id-type="pmid">25576984</pub-id>
</element-citation>
</ref>
<ref id="B84-viruses-08-00153">
<label>84.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weber</surname>
<given-names>P.H.</given-names>
</name>
<name>
<surname>Bujarski</surname>
<given-names>J.J.</given-names>
</name>
</person-group>
<article-title>Multiple functions of capsid proteins in (+) stranded RNA viruses during plant-virus interactions</article-title>
<source>Virus Res.</source>
<year>2015</year>
<volume>196C</volume>
<fpage>140</fpage>
<lpage>149</lpage>
<pub-id pub-id-type="doi">10.1016/j.virusres.2014.11.014</pub-id>
<pub-id pub-id-type="pmid">25445337</pub-id>
</element-citation>
</ref>
<ref id="B85-viruses-08-00153">
<label>85.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arrivabem</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Rodrigues</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Bastianel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Locali-Fabris</surname>
<given-names>E.C.</given-names>
</name>
<name>
<surname>Antonioli-Luizon</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Novelli</surname>
<given-names>V.M.</given-names>
</name>
<name>
<surname>Kitajima</surname>
<given-names>E.W.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>M.A.</given-names>
</name>
</person-group>
<article-title>Transmissão diferencial do vírus da leprose dos citros por populações de
<italic>Brevipalpus phoenicis</italic>
</article-title>
<source>Summa Phytopathol.</source>
<year>2005</year>
<volume>31</volume>
<fpage>80</fpage>
</element-citation>
</ref>
<ref id="B86-viruses-08-00153">
<label>86.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sánchez-Velázquez</surname>
<given-names>E.J.</given-names>
</name>
<name>
<surname>Santillán-Galicia</surname>
<given-names>M.T.</given-names>
</name>
<name>
<surname>Novelli</surname>
<given-names>V.M.</given-names>
</name>
<name>
<surname>Nunes</surname>
<given-names>M.A.</given-names>
</name>
<name>
<surname>Mora-Aguilera</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Valdez-Carrasco</surname>
<given-names>J.M.</given-names>
</name>
<name>
<surname>Otero-Colina</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Freitas-Astúa</surname>
<given-names>J.</given-names>
</name>
</person-group>
<article-title>Diversity and genetic variation among
<italic>Brevipalpus</italic>
populations from Brazil and Mexico</article-title>
<source>PLoS ONE</source>
<year>2015</year>
<volume>10</volume>
<elocation-id>153</elocation-id>
</element-citation>
</ref>
</ref-list>
</back>
<floats-group>
<fig id="viruses-08-00153-f001" position="float">
<label>Figure 1</label>
<caption>
<p>(
<bold>a</bold>
) Citrus leprosis symptoms in sweet orange (
<italic>Citrus sinensis</italic>
) fruits, twig and leaves. (
<bold>b</bold>
) Genomic organization of
<italic>Citrus leprosis virus C</italic>
(CiLV-C). Blue solid bars indicate regions used in the variability study.
<italic>RdRp</italic>
: RNA-dependent RNA polymerase;
<italic>p29</italic>
: putative coat protein;
<italic>MP</italic>
: putative 30K superfamily movement protein;
<italic>p15</italic>
,
<italic>p61</italic>
and
<italic>p24</italic>
: proteins with unknown functions. IR: intergenic region. A
<sub>n</sub>
: poly(A) tail.</p>
</caption>
<graphic xlink:href="viruses-08-00153-g001"></graphic>
</fig>
<fig id="viruses-08-00153-f002" position="float">
<label>Figure 2</label>
<caption>
<p>Midpoint-rooted neighbor joining phylogenetic trees of CiLV-C isolates based on four genomic regions. Isolates of the clade CRD and SJP were highlighted in blue and red, respectively. (
<bold>a</bold>
)
<italic>p29</italic>
complete sequence (792 nt); (
<bold>b</bold>
)
<italic>MP</italic>
partial sequence (300 nt); (
<bold>c</bold>
)
<italic>p15</italic>
complete sequence (393 nt); (
<bold>d</bold>
) IR (940 nt); (
<bold>e</bold>
) Fragment encompassing concatenated sequences of the RNA2 (
<italic>p15</italic>
+ IR +
<italic>MP</italic>
, 1633 nt). Sequences from CiLV-C2 isolate Colombia (CiLV-C2_Co, GenBank accessions JX000024 and JX000025) and CiLV-C2 isolate Hawaii (CiLV-C2_Hw, GenBank accessions KC626783 and KC626784) were incorporated as outgroup. Bootstrap support values (1000 iterations) of main branches are indicated. Branches with less than 50% bootstrap support were condensed.</p>
</caption>
<graphic xlink:href="viruses-08-00153-g002a"></graphic>
<graphic xlink:href="viruses-08-00153-g002b"></graphic>
</fig>
<fig id="viruses-08-00153-f003" position="float">
<label>Figure 3</label>
<caption>
<p>Evidence of recombination in RNA2 of the isolate BR_PR_LDB_01. Similarity plots of the recombinant with the minor (isolate BR_SP_SJR_01) and major (isolate AR_02) parents are shown as obtained from the analysis of concatenated sequences of the RNA2 (
<italic>p15</italic>
+ IR +
<italic>MP</italic>
) using the RDP software.</p>
</caption>
<graphic xlink:href="viruses-08-00153-g003"></graphic>
</fig>
<fig id="viruses-08-00153-f004" position="float">
<label>Figure 4</label>
<caption>
<p>Differential detection of CiLV-C isolates belonging to clades CRD or SJP. 1% agarose gel electrophoresis of RT-PCR products obtained from nine CiLV-C isolates.
<italic>p29</italic>
CiLV-C CRD and
<italic>p29</italic>
CiLV-C SJP indicate reactions carried out using specific primers designed to detect isolates of the clade CRD and SJP, respectively. Lane 1: molecular weight marker, 1 Kbp Plus DNA Ladder (Invitrogen, Carlsbad, CA, USA); lanes 2 & 13: healthy citrus plant; lanes 3 & 14: citrus tree infected with CiLV-C2 isolate Colombia; lanes 4 & 15: Arabidopsis plant infected with CiLV-C isolate BR_SP_SJP_01; lanes 5 & 16: citrus plant from Cordeirópolis, SP (positive control sample for the clade CRD); lanes 6 & 17: citrus plant, São José do Rio Preto, SP (source of the isolate BR_SP_SJP_01—positive sample for the clade SJP); lanes 7 & 18: tropical spiderwort plant, São José do Rio Preto, SP (isolate BR_SP_SJP_04); lanes 8 & 19: citrus plant, Argentina (isolate AR_02); lanes 9 & 20: citrus plant, Londrina, PR (isolate BR_PR_LDB_01); lanes 10 & 21: citrus plant, Brasília, DF (isolate BR_DF_BSB_01); lanes 11 & 22: citrus plant, Maringá, PR (isolate BR_PR_MGF_01); lanes 12 & 23: citrus plant, Itu, SP (isolate BR_SP_ITU_01).</p>
</caption>
<graphic xlink:href="viruses-08-00153-g004"></graphic>
</fig>
<fig id="viruses-08-00153-f005" position="float">
<label>Figure 5</label>
<caption>
<p>Nucleotide identity plot among BR_SP_SJP_01 full-length genome and those from CiLV-C, CiLV-C2 Colombia and CiLV-C2 Hawaii. Plots were generated with a sliding window size of 300 nt and a shift of one nucleotide at a time from aligned sequences. Nucleotide position is indicated at the beginning of each ORF according to the BR_SP_SJP_01 sequence.</p>
</caption>
<graphic xlink:href="viruses-08-00153-g005"></graphic>
</fig>
<fig id="viruses-08-00153-f006" position="float">
<label>Figure 6</label>
<caption>
<p>Deduced amino acid sequence alignments of P29 (
<bold>a</bold>
) and P15 (
<bold>b</bold>
) proteins from CiLV-C and CiLV-C2. Blue letters indicate positions under selection in CiLV-C as shown by a combination of SLAC, FEL and REL methods. (
<bold>a</bold>
) Consensus predicted secondary structures of P29 proteins from CiLV-C and CilV-C2 are on the top and bottom of each block, respectively. α, alpha-helix; β, beta strand; (
<bold>b</bold>
) Conserved Cys residues involved in a putative Zn-finger motif are highlighted with green stars.</p>
</caption>
<graphic xlink:href="viruses-08-00153-g006"></graphic>
</fig>
<table-wrap id="viruses-08-00153-t001" position="float">
<object-id pub-id-type="pii">viruses-08-00153-t001_Table 1</object-id>
<label>Table 1</label>
<caption>
<p>Complete list of CiLV-C sequences used in this work. Accession numbers in the GenBank database for genomic region, host and year of collection of each viral isolates are indicated.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Isolate Identification
<sup>1</sup>
and Host
<sup>2</sup>
of Collection</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Collection Year</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Viral Genomic Region</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">GenBank Accession No.</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Reference</th>
</tr>
</thead>
<tbody>
<tr>
<td colspan="5" align="center" valign="middle" style="border-bottom:solid thin" rowspan="1">Brazilian isolates</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">BR_MG_AFE_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093040</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">This work</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_AMP_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093041</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093078</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093139</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093106</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SE_AJU_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093042</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093079</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093140</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093107</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_ARA_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2014</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093043</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093080</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093141</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093108</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_PA_BEL_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093045</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR136415</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093143</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093110</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">BR_SP_BRM_01 (
<italic>Commelina benghalensis</italic>
)</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">JQ944802</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">[
<xref rid="B49-viruses-08-00153" ref-type="bibr">49</xref>
]</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_BRM_02</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093046</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093084</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093144</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093112</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_DF_BSB_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093047</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093085</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093145</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093113</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">BR_SP_CMP_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093049</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">This work</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_CSB_01</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093050</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093086</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_CLN_01</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093051</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093082</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_MG_CGZ_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093048</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093087</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093146</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093114</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_CCH_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093052</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093088</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093147</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093115</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_CRD_01</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2006</td>
<td align="center" valign="middle" rowspan="1" colspan="1">RNA1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">DQ352194</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">[
<xref rid="B32-viruses-08-00153" ref-type="bibr">32</xref>
]</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">RNA2</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">DQ352195</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_CRD_02</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093053</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093089</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093148</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093116</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">BR_SP_CRD_03</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093117</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">This work</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_CSM_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093054</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093083</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093149</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093111</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_GO_GYN_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093055</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093090</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093150</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093118</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">BR_MG_LAV_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093120</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">This work</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SC_LSP_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093056</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093091</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093151</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093119</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_PR_LDB_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093057</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093092</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093152</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093121</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_AM_MAO_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093058</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093093</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093153</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093122</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_PR_MGF_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093059</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093094</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093154</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093123</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_MRN_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093060</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR136416</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093155</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093124</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">BR_SC_NCH_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093061</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">BR_SC_NTB_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093062</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">This work</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_TO_PMW_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093063</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093105</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093166</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093134</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_PRB_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2014</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093064</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093095</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093156</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093125</td>
</tr>
<tr>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_GO_PNT_01</td>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093065</td>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093096</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093126</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_PRT_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093066</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093097</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093157</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093127</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">BR_AC_RBR_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093067</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">This work</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_ITU_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093070</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093099</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093159</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093129</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">BR_MG_STC_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093069</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">This work</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SAP_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093068</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093098</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093158</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093128</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_JBT_01</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2006</td>
<td align="center" valign="middle" rowspan="1" colspan="1">RNA1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">DQ157466</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">[
<xref rid="B34-viruses-08-00153" ref-type="bibr">34</xref>
]</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">RNA2</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">DQ157465</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SNG_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093071</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093100</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093160</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093130</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SJP_01</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">RNA1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KP336746</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">RNA2</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KP336747</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SJP_02</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093072</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093101</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093161</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093135</td>
</tr>
<tr>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SJP_03</td>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093167</td>
<td rowspan="3" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093162</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093136</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SJP_04 (
<italic>Commelina benghalensis</italic>
)</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2013</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093077</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093137</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SDM_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2015</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253463</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253469</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253475</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KT253481</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SDM_02</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2015</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253464</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253470</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253476</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KT253482</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SDM_03</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2015</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253465</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253471</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253477</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KT253483</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SDM_04</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2015</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253466</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253472</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253478</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KT253484</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SDM_05</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2015</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253467</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253473</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253479</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KT253485</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_SDM_06</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2015</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253468</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253474</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KT253480</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KT253486</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_RJ_TNG_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093073</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093102</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093163</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093131</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_SP_TTI_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093074</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093103</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093164</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093132</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">BR_MT_TRN_01</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093075</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093104</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093165</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093133</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" colspan="1">BR_MG_UBA_01</td>
<td rowspan="2" align="center" valign="middle" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093076</td>
<td rowspan="2" align="center" valign="middle" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093138</td>
</tr>
<tr>
<td colspan="5" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1">Isolates from other countries</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">AR_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">JX163907</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">[
<xref rid="B8-viruses-08-00153" ref-type="bibr">8</xref>
]</td>
</tr>
<tr>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">AR_02</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2012</td>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093044</td>
<td rowspan="4" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">This work</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093081</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" rowspan="1" colspan="1">KR093142</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">KR093109</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CO_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2005</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">DQ272491</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">[
<xref rid="B10-viruses-08-00153" ref-type="bibr">10</xref>
]</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">MX_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2010</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">HQ292778</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">[
<xref rid="B9-viruses-08-00153" ref-type="bibr">9</xref>
]</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">PA_01</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">2006</td>
<td align="center" valign="middle" rowspan="1" colspan="1">RNA1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">DQ388512</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">[
<xref rid="B50-viruses-08-00153" ref-type="bibr">50</xref>
]</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">RNA2</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">DQ388513</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">PY_01</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2012</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">
<italic>MP</italic>
</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">JX163908</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">[
<xref rid="B8-viruses-08-00153" ref-type="bibr">8</xref>
]</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<sup>1</sup>
Unless otherwise indicated, the collection hosts for isolates described in this work were sweet orange (
<italic>Citrus sinensis</italic>
L. Osb.) trees;
<sup>2</sup>
Isolates were designated including several entries separated by underscores. First two letters identify the country (AR: Argentina; BR: Brazil; CO: Colombia; MX: Mexico; PA: Panama and PY: Paraguay), followed by the Brazilian state (AC: Acre; AM: Amazonas; DF: Distrito Federal; GO: Goiás; MG: Minas Gerais; MS: Mato Grosso do Sul; PA: Pará; PR: Paraná; RJ: Rio de Janeiro; SC: Santa Catarina; SE: Sergipe; SP: São Paulo and TO: Tocantins), the city of collection (AFE: Alfenas; AJU: Aracaju; AMP: Amparo; ARA: Araras; BEL: Belém; BRM: Borborema; BSB: Brasília; CCH: Conchal; CRD: Cordeirópolis; CGZ: Comendador Gomes; CLN: Colina; CMP: Campinas; CSB: Casa Branca; CSM: Cosmorama; GYN: Goiânia; ITU: Itu; JBT: Jaboticabal; LAV: Lavras; LDB: Londrina; LSP: Linha Espuma; MAO: Manaus; MGF: Maringá; MRN: Mirandópolis; NCH: Nova Erechim; NTB: Nova Itaberaba; PMW: Palmas; PNT: Planaltina; PRB: Piracicaba; PRT: Pratânia; SAP: Santo Antônio de Posse; SDM: Sud Mennucci; SJP: São José do Rio Preto; SNG: Serra Negra; STC: Santa Conceição; TNG: Tanguá; TRN: Terenos; TTI: Tatuí; UBA: Uberaba; UBT: Ubatuba), and the sample number.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="viruses-08-00153-t002" position="float">
<object-id pub-id-type="pii">viruses-08-00153-t002_Table 2</object-id>
<label>Table 2</label>
<caption>
<p>Population genetic parameters and selection pressure estimates for four CiLV-C genomic regions. Independent analyses were carried out including all isolates and only those grouped within the clade CRD according to the phylogenetic study.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Genomic Region</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Region Length (nt)</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Dataset
<sup>1</sup>
/# of Isolates</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">π</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">h</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Hd</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">dS</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">dN</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">ω (dN/dS)</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<bold>
<italic>p29</italic>
</bold>
</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">792</td>
<td align="center" valign="middle" rowspan="1" colspan="1">All/47</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.053 ± 0.009</td>
<td align="center" valign="middle" rowspan="1" colspan="1">40</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.990</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.252 ± 0.037
<sup>2</sup>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.018 ± 0.003
<sup>2</sup>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.07</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CRD/38</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.009 ± 0.001</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">32</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.986</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.022 ± 0.004</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.004 ± 0.001</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.18</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<bold>
<italic>p15</italic>
</bold>
</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">393</td>
<td align="center" valign="middle" rowspan="1" colspan="1">All/41</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.010 ± 0.001</td>
<td align="center" valign="middle" rowspan="1" colspan="1">30</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.961</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.014 ± 0.004</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.007 ± 0.002</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.50</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CRD/31</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.010 ± 0.001</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">24</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.953</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.014 ± 0.004</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.008 ± 0.002</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.57</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<bold>
<italic>MP</italic>
</bold>
</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">300</td>
<td align="center" valign="middle" rowspan="1" colspan="1">All/46</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.056 ± 0.009</td>
<td align="center" valign="middle" rowspan="1" colspan="1">22</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.854</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.202 ± 0.043</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.021 ± 0.007</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.10</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CRD/36</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.007 ± 0.001</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">17</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.778</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.019 ± 0.006</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.005 ± 0.002</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.26</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<bold>IR</bold>
</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">940</td>
<td align="center" valign="middle" rowspan="1" colspan="1">All/38</td>
<td align="center" valign="middle" rowspan="1" colspan="1">0.021 ± 0.003</td>
<td align="center" valign="middle" rowspan="1" colspan="1">38</td>
<td align="center" valign="middle" rowspan="1" colspan="1">1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">CRD/28</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">0.016 ± 0.003</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">28</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">1</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">-</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<sup>1</sup>
Only citrus isolates were considered.
<sup>2</sup>
Standard error of means was calculated by using the bootstrap method implemented in the MEGA6 program. All: Total population; CRD: Only members of the clade CRD; π: Nucleotide diversity; h: Number of haplotypes; Hd: haplotype (gene) diversity; dS: frequency of synonymous substitution per site; dN: frequency of non-synonymous substitution per site.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="viruses-08-00153-t003" position="float">
<object-id pub-id-type="pii">viruses-08-00153-t003_Table 3</object-id>
<label>Table 3</label>
<caption>
<p>Amino acids likely to be under selection in CiLV-C.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">ORF</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Nucleotide Substitution Model</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Methods</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Selection Pressure</th>
<th align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1" colspan="1">Amino Acid Position in the Sequence of Isolate BR_SP_SJP_01</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<bold>
<italic>p29</italic>
</bold>
</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">TrN</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">SLAC-FEL-REL</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">purification</td>
<td align="left" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">27, 39, 113, 156, 157, 173, 207, 211, 227, 259</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">FEL-REL</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">purification</td>
<td align="left" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">2, 7, 23, 30, 47, 49, 57, 58, 76, 87, 99, 100, 104, 116, 118, 133, 137, 140, 151, 154, 165, 171, 172, 180, 181, 190, 196, 202, 213, 214, 217, 219, 245, 254</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<bold>
<italic>p15</italic>
</bold>
</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">HKY85</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">SLAC-FEL-REL</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">-</td>
<td align="left" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">-</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">FEL-REL</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">positive</td>
<td align="left" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">91</td>
</tr>
<tr>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">
<bold>
<italic>MP</italic>
<sup>1</sup>
</bold>
</td>
<td rowspan="2" align="center" valign="middle" style="border-bottom:solid thin" colspan="1">GTR</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">SLAC-FEL-REL</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">purification</td>
<td align="left" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">71, 112, 148</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">FEL-REL</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">purification</td>
<td align="left" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">59, 74, 80, 84, 85, 92, 93, 96, 97, 98, 99, 102, 103, 111, 115, 118, 121, 136, 146</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<sup>1</sup>
Fragment of the gene corresponding to amino acid stretch between the positions 55 and 150.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="viruses-08-00153-t004" position="float">
<object-id pub-id-type="pii">viruses-08-00153-t004_Table 4</object-id>
<label>Table 4</label>
<caption>
<p>Nucleotide and deduced amino acids identities between the isolate BR_SP_SJP_01 and definitive and tentative cileviruses.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th rowspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" colspan="1">BR_SP_SJP_01</th>
<th colspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1">CiLV-C</th>
<th colspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1">CiLV-C2 Isolate Colombia</th>
<th colspan="2" align="center" valign="middle" style="border-top:solid thin;border-bottom:solid thin" rowspan="1">CiLV-C2 Isolate Hawaii</th>
</tr>
<tr>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">nt</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">aa</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">nt</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">aa</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">nt</th>
<th align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">aa</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<bold>RNA1</bold>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">85.6</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" rowspan="1" colspan="1">60.1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" rowspan="1" colspan="1">60.1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">ORF
<italic>RdRp</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">85.4</td>
<td align="center" valign="middle" rowspan="1" colspan="1">93.1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">61.4</td>
<td align="center" valign="middle" rowspan="1" colspan="1">59.3</td>
<td align="center" valign="middle" rowspan="1" colspan="1">61.4</td>
<td align="center" valign="middle" rowspan="1" colspan="1">59.1</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">ORF
<italic>p29</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">85.0</td>
<td align="center" valign="middle" rowspan="1" colspan="1">90.5</td>
<td align="center" valign="middle" rowspan="1" colspan="1">49.2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">36.0</td>
<td align="center" valign="middle" rowspan="1" colspan="1">49.0</td>
<td align="center" valign="middle" rowspan="1" colspan="1">35.0</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">
<bold>RNA2</bold>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">88.4</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" rowspan="1" colspan="1">52.6</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" rowspan="1" colspan="1">52.0</td>
<td align="center" valign="middle" rowspan="1" colspan="1">-</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">ORF
<italic>p15</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">99.5</td>
<td align="center" valign="middle" rowspan="1" colspan="1">100.0</td>
<td align="center" valign="middle" rowspan="1" colspan="1">44.7</td>
<td align="center" valign="middle" rowspan="1" colspan="1">20.8</td>
<td align="center" valign="middle" rowspan="1" colspan="1">45.2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">24.6</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">ORF
<italic>p61</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">81.8</td>
<td align="center" valign="middle" rowspan="1" colspan="1">84.0</td>
<td align="center" valign="middle" rowspan="1" colspan="1">52.0</td>
<td align="center" valign="middle" rowspan="1" colspan="1">32.0</td>
<td align="center" valign="middle" rowspan="1" colspan="1">51.2</td>
<td align="center" valign="middle" rowspan="1" colspan="1">33.1</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">ORF
<italic>MP</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">86.8</td>
<td align="center" valign="middle" rowspan="1" colspan="1">91.9</td>
<td align="center" valign="middle" rowspan="1" colspan="1">56.6</td>
<td align="center" valign="middle" rowspan="1" colspan="1">51.7</td>
<td align="center" valign="middle" rowspan="1" colspan="1">54.9</td>
<td align="center" valign="middle" rowspan="1" colspan="1">51.4</td>
</tr>
<tr>
<td align="center" valign="middle" rowspan="1" colspan="1">ORF
<italic>p24</italic>
</td>
<td align="center" valign="middle" rowspan="1" colspan="1">87.4</td>
<td align="center" valign="middle" rowspan="1" colspan="1">93.9</td>
<td align="center" valign="middle" rowspan="1" colspan="1">63.9</td>
<td align="center" valign="middle" rowspan="1" colspan="1">63.1</td>
<td align="center" valign="middle" rowspan="1" colspan="1">62.0</td>
<td align="center" valign="middle" rowspan="1" colspan="1">61.6</td>
</tr>
<tr>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">IR</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">96.7</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">46.0</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">-</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">46.0</td>
<td align="center" valign="middle" style="border-bottom:solid thin" rowspan="1" colspan="1">-</td>
</tr>
</tbody>
</table>
</table-wrap>
</floats-group>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000406  | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000406  | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     
   |texte=   
}}

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024