Serveur d'exploration sur l'oranger

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Mutation in the xpsD gene of Xanthomonas axonopodis pv. citri affects cellulose degradation and virulence

Identifieur interne : 000D46 ( Ncbi/Merge ); précédent : 000D45; suivant : 000D47

Mutation in the xpsD gene of Xanthomonas axonopodis pv. citri affects cellulose degradation and virulence

Auteurs : Juliana Cristina Baptista ; Marcos Antonio Machado [Brésil] ; Rafael Augusto Homem ; Pablo Sebastián Torres [Argentine] ; Adrian Alberto Vojnov [Argentine] ; Alexandre Morais Do Amaral

Source :

RBID : PMC:3036071

Abstract

The Gram-negative bacterium Xanthomonas axonopodis pv. citri, the causal agent of citrus canker, is a major threat to the citrus industry worldwide. Although this is a leaf spot pathogen, it bears genes highly related to degradation of plant cell walls, which are typically found in plant pathogens that cause symptoms of tissue maceration. Little is known on Xac capacity to cause disease and hydrolyze cellulose. We investigated the contribution of various open reading frames on degradation of a cellulose compound by means of a global mutational assay to selectively screen for a defect in carboxymethyl cellulase (CMCase) secretion in X. axonopodis pv. citri. Screening on CMC agar revealed one mutant clone defective in extracellular glycanase activity, out of nearly 3,000 clones. The insertion was located in the xpsD gene, a component of the type II secretion system (T2SS) showing an influence in the ability of Xac to colonize tissues and hydrolyze cellulose. In summary, these data show for the first time, that X. axonopodis pv. citri is capable of hydrolyzing cellulose in a T2SS-dependent process. Furthermore, it was demonstrated that the ability to degrade cellulose contributes to the infection process as a whole.


Url:
DOI: 10.1590/S1415-47572009005000110
PubMed: 21637619
PubMed Central: 3036071

Links toward previous steps (curation, corpus...)


Links to Exploration step

PMC:3036071

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Mutation in the
<italic>xpsD</italic>
gene of
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
affects cellulose degradation and virulence</title>
<author>
<name sortKey="Baptista, Juliana Cristina" sort="Baptista, Juliana Cristina" uniqKey="Baptista J" first="Juliana Cristina" last="Baptista">Juliana Cristina Baptista</name>
<affiliation>
<nlm:aff>NONE</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Machado, Marcos Antonio" sort="Machado, Marcos Antonio" uniqKey="Machado M" first="Marcos Antonio" last="Machado">Marcos Antonio Machado</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">
<institution>Centro APTA Citros Sylvio Moreira, Cordeirópolis, SP</institution>
<country>Brazil</country>
</nlm:aff>
<country xml:lang="fr">Brésil</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Homem, Rafael Augusto" sort="Homem, Rafael Augusto" uniqKey="Homem R" first="Rafael Augusto" last="Homem">Rafael Augusto Homem</name>
<affiliation>
<nlm:aff>NONE</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Torres, Pablo Sebastian" sort="Torres, Pablo Sebastian" uniqKey="Torres P" first="Pablo Sebastián" last="Torres">Pablo Sebastián Torres</name>
<affiliation wicri:level="1">
<nlm:aff id="aff3">
<institution>Fundación Pablo Cassará, Instituto de Ciencia y Tecnología Dr. Cesar Milstein, Ciudad de Buenos Aires</institution>
<country>Argentina</country>
</nlm:aff>
<country xml:lang="fr">Argentine</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Vojnov, Adrian Alberto" sort="Vojnov, Adrian Alberto" uniqKey="Vojnov A" first="Adrian Alberto" last="Vojnov">Adrian Alberto Vojnov</name>
<affiliation wicri:level="1">
<nlm:aff id="aff3">
<institution>Fundación Pablo Cassará, Instituto de Ciencia y Tecnología Dr. Cesar Milstein, Ciudad de Buenos Aires</institution>
<country>Argentina</country>
</nlm:aff>
<country xml:lang="fr">Argentine</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Do Amaral, Alexandre Morais" sort="Do Amaral, Alexandre Morais" uniqKey="Do Amaral A" first="Alexandre Morais" last="Do Amaral">Alexandre Morais Do Amaral</name>
<affiliation>
<nlm:aff>NONE</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">21637619</idno>
<idno type="pmc">3036071</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3036071</idno>
<idno type="RBID">PMC:3036071</idno>
<idno type="doi">10.1590/S1415-47572009005000110</idno>
<date when="2010">2010</date>
<idno type="wicri:Area/Pmc/Corpus">000F56</idno>
<idno type="wicri:Area/Pmc/Curation">000F55</idno>
<idno type="wicri:Area/Pmc/Checkpoint">000F33</idno>
<idno type="wicri:Area/Ncbi/Merge">000D46</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Mutation in the
<italic>xpsD</italic>
gene of
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
affects cellulose degradation and virulence</title>
<author>
<name sortKey="Baptista, Juliana Cristina" sort="Baptista, Juliana Cristina" uniqKey="Baptista J" first="Juliana Cristina" last="Baptista">Juliana Cristina Baptista</name>
<affiliation>
<nlm:aff>NONE</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Machado, Marcos Antonio" sort="Machado, Marcos Antonio" uniqKey="Machado M" first="Marcos Antonio" last="Machado">Marcos Antonio Machado</name>
<affiliation wicri:level="1">
<nlm:aff id="aff1">
<institution>Centro APTA Citros Sylvio Moreira, Cordeirópolis, SP</institution>
<country>Brazil</country>
</nlm:aff>
<country xml:lang="fr">Brésil</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Homem, Rafael Augusto" sort="Homem, Rafael Augusto" uniqKey="Homem R" first="Rafael Augusto" last="Homem">Rafael Augusto Homem</name>
<affiliation>
<nlm:aff>NONE</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Torres, Pablo Sebastian" sort="Torres, Pablo Sebastian" uniqKey="Torres P" first="Pablo Sebastián" last="Torres">Pablo Sebastián Torres</name>
<affiliation wicri:level="1">
<nlm:aff id="aff3">
<institution>Fundación Pablo Cassará, Instituto de Ciencia y Tecnología Dr. Cesar Milstein, Ciudad de Buenos Aires</institution>
<country>Argentina</country>
</nlm:aff>
<country xml:lang="fr">Argentine</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Vojnov, Adrian Alberto" sort="Vojnov, Adrian Alberto" uniqKey="Vojnov A" first="Adrian Alberto" last="Vojnov">Adrian Alberto Vojnov</name>
<affiliation wicri:level="1">
<nlm:aff id="aff3">
<institution>Fundación Pablo Cassará, Instituto de Ciencia y Tecnología Dr. Cesar Milstein, Ciudad de Buenos Aires</institution>
<country>Argentina</country>
</nlm:aff>
<country xml:lang="fr">Argentine</country>
<wicri:regionArea># see nlm:aff country strict</wicri:regionArea>
</affiliation>
</author>
<author>
<name sortKey="Do Amaral, Alexandre Morais" sort="Do Amaral, Alexandre Morais" uniqKey="Do Amaral A" first="Alexandre Morais" last="Do Amaral">Alexandre Morais Do Amaral</name>
<affiliation>
<nlm:aff>NONE</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Genetics and Molecular Biology</title>
<idno type="ISSN">1415-4757</idno>
<idno type="eISSN">1678-4685</idno>
<imprint>
<date when="2010">2010</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<p>The Gram-negative bacterium
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
, the causal agent of citrus canker, is a major threat to the citrus industry worldwide. Although this is a leaf spot pathogen, it bears genes highly related to degradation of plant cell walls, which are typically found in plant pathogens that cause symptoms of tissue maceration. Little is known on
<italic>Xac</italic>
capacity to cause disease and hydrolyze cellulose. We investigated the contribution of various open reading frames on degradation of a cellulose compound by means of a global mutational assay to selectively screen for a defect in carboxymethyl cellulase (CMCase) secretion in
<italic>X. axonopodis</italic>
pv.
<italic>citri</italic>
. Screening on CMC agar revealed one mutant clone defective in extracellular glycanase activity, out of nearly 3,000 clones. The insertion was located in the
<italic>xpsD</italic>
gene, a component of the type II secretion system (T2SS) showing an influence in the ability of
<italic>Xac</italic>
to colonize tissues and hydrolyze cellulose. In summary, these data show for the first time, that
<italic>X. axonopodis</italic>
pv.
<italic>citri</italic>
is capable of hydrolyzing cellulose in a T2SS-dependent process. Furthermore, it was demonstrated that the ability to degrade cellulose contributes to the infection process as a whole.</p>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Amaral Am Do Toledo, C P" uniqKey="Amaral Am Do Toledo C">C.P. Amaral AM do Toledo</name>
</author>
<author>
<name sortKey="Baptista, J C" uniqKey="Baptista J">J.C. Baptista</name>
</author>
<author>
<name sortKey="Machado, M A" uniqKey="Machado M">M.A. Machado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Astua Monge, G" uniqKey="Astua Monge G">G. Astua-Monge</name>
</author>
<author>
<name sortKey="Freitas Astua, J" uniqKey="Freitas Astua J">J. Freitas-Astua</name>
</author>
<author>
<name sortKey="Bacocina, G" uniqKey="Bacocina G">G. Bacocina</name>
</author>
<author>
<name sortKey="Roncoletta, J" uniqKey="Roncoletta J">J. Roncoletta</name>
</author>
<author>
<name sortKey="Carvalho, A S" uniqKey="Carvalho A">A.S. Carvalho</name>
</author>
<author>
<name sortKey="Machado, M A" uniqKey="Machado M">M.A. Machado</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ausubel, F M" uniqKey="Ausubel F">F.M. Ausubel</name>
</author>
<author>
<name sortKey="Brent, R" uniqKey="Brent R">R. Brent</name>
</author>
<author>
<name sortKey="Kingston, R E" uniqKey="Kingston R">R.E. Kingston</name>
</author>
<author>
<name sortKey="Moore, D D" uniqKey="Moore D">D.D. Moore</name>
</author>
<author>
<name sortKey="Seidman, J G" uniqKey="Seidman J">J.G. Seidman</name>
</author>
<author>
<name sortKey="Smith, J A" uniqKey="Smith J">J.A. Smith</name>
</author>
<author>
<name sortKey="Struhl, K" uniqKey="Struhl K">K. Struhl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bradley, D J" uniqKey="Bradley D">D.J. Bradley</name>
</author>
<author>
<name sortKey="Wood, E A" uniqKey="Wood E">E.A. Wood</name>
</author>
<author>
<name sortKey="Larkins, A P" uniqKey="Larkins A">A.P. Larkins</name>
</author>
<author>
<name sortKey="Galfre, G" uniqKey="Galfre G">G. Galfrè</name>
</author>
<author>
<name sortKey="Butcher, G W" uniqKey="Butcher G">G.W. Butcher</name>
</author>
<author>
<name sortKey="Brewin, N J" uniqKey="Brewin N">N.J. Brewin</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chang, J H" uniqKey="Chang J">J.H. Chang</name>
</author>
<author>
<name sortKey="Urbach, J M" uniqKey="Urbach J">J.M. Urbach</name>
</author>
<author>
<name sortKey="Law, T F" uniqKey="Law T">T.F. Law</name>
</author>
<author>
<name sortKey="Arnold, L W" uniqKey="Arnold L">L.W. Arnold</name>
</author>
<author>
<name sortKey="Hu, A" uniqKey="Hu A">A. Hu</name>
</author>
<author>
<name sortKey="Gombar, S" uniqKey="Gombar S">S. Gombar</name>
</author>
<author>
<name sortKey="Grant, S R" uniqKey="Grant S">S.R. Grant</name>
</author>
<author>
<name sortKey="Ausubel, F M" uniqKey="Ausubel F">F.M. Ausubel</name>
</author>
<author>
<name sortKey="Dangl, J L" uniqKey="Dangl J">J.L. Dangl</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chen, Y" uniqKey="Chen Y">Y. Chen</name>
</author>
<author>
<name sortKey="Shiue, S J" uniqKey="Shiue S">S.-.J. Shiue</name>
</author>
<author>
<name sortKey="Huang, C W" uniqKey="Huang C">C.-.W. Huang</name>
</author>
<author>
<name sortKey="Chang, J L" uniqKey="Chang J">J.-.L. Chang</name>
</author>
<author>
<name sortKey="Chien, Y L" uniqKey="Chien Y">Y.-.L. Chien</name>
</author>
<author>
<name sortKey="Hu, N T" uniqKey="Hu N">N.-.T. Hu</name>
</author>
<author>
<name sortKey="Chan, N L" uniqKey="Chan N">N.-.L. Chan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Collmer, A" uniqKey="Collmer A">A. Collmer</name>
</author>
<author>
<name sortKey="Lindeberg, M" uniqKey="Lindeberg M">M. Lindeberg</name>
</author>
<author>
<name sortKey="Petnicki Ocwieja, T" uniqKey="Petnicki Ocwieja T">T. Petnicki-Ocwieja</name>
</author>
<author>
<name sortKey="Schnieder, D J" uniqKey="Schnieder D">D.J. Schnieder</name>
</author>
<author>
<name sortKey="Alfano, J R" uniqKey="Alfano J">J.R. Alfano</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Corbett, M" uniqKey="Corbett M">M. Corbett</name>
</author>
<author>
<name sortKey="Virtue, S" uniqKey="Virtue S">S. Virtue</name>
</author>
<author>
<name sortKey="Bell, K" uniqKey="Bell K">K. Bell</name>
</author>
<author>
<name sortKey="Birch, P" uniqKey="Birch P">P. Birch</name>
</author>
<author>
<name sortKey="Burr, T" uniqKey="Burr T">T. Burr</name>
</author>
<author>
<name sortKey="Hyman, L" uniqKey="Hyman L">L. Hyman</name>
</author>
<author>
<name sortKey="Lilley, K" uniqKey="Lilley K">K. Lilley</name>
</author>
<author>
<name sortKey="Poock, S" uniqKey="Poock S">S. Poock</name>
</author>
<author>
<name sortKey="Toth, I" uniqKey="Toth I">I. Toth</name>
</author>
<author>
<name sortKey="Salmond, G" uniqKey="Salmond G">G. Salmond</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Da Silva, A C" uniqKey="Da Silva A">A.C. da Silva</name>
</author>
<author>
<name sortKey="Ferro, J A" uniqKey="Ferro J">J.A. Ferro</name>
</author>
<author>
<name sortKey="Reinach, F C" uniqKey="Reinach F">F.C. Reinach</name>
</author>
<author>
<name sortKey="Farah, C S" uniqKey="Farah C">C.S. Farah</name>
</author>
<author>
<name sortKey="Furlan, L R" uniqKey="Furlan L">L.R. Furlan</name>
</author>
<author>
<name sortKey="Quaggio, R B" uniqKey="Quaggio R">R.B. Quaggio</name>
</author>
<author>
<name sortKey="Monteiro Vitorello, C B" uniqKey="Monteiro Vitorello C">C.B. Monteiro-Vitorello</name>
</author>
<author>
<name sortKey="Van Sluys, M A" uniqKey="Van Sluys M">M.A. Van Sluys</name>
</author>
<author>
<name sortKey="Almeida, N F" uniqKey="Almeida N">N.F. Almeida</name>
</author>
<author>
<name sortKey="Alves, L M C" uniqKey="Alves L">L.M.C. Alves</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Economou, A" uniqKey="Economou A">A. Economou</name>
</author>
<author>
<name sortKey="Hamilton, W D O" uniqKey="Hamilton W">W.D.O. Hamilton</name>
</author>
<author>
<name sortKey="Johnston, A W B" uniqKey="Johnston A">A.W.B. Johnston</name>
</author>
<author>
<name sortKey="Downie, J A" uniqKey="Downie J">J.A. Downie</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Graham, J H" uniqKey="Graham J">J.H. Graham</name>
</author>
<author>
<name sortKey="Gottwald, T R" uniqKey="Gottwald T">T.R. Gottwald</name>
</author>
<author>
<name sortKey="Riley, T D" uniqKey="Riley T">T.D. Riley</name>
</author>
<author>
<name sortKey="Achor, D" uniqKey="Achor D">D. Achor</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Graham, J H" uniqKey="Graham J">J.H. Graham</name>
</author>
<author>
<name sortKey="Gottwald, T R" uniqKey="Gottwald T">T.R. Gottwald</name>
</author>
<author>
<name sortKey="Cubero, J" uniqKey="Cubero J">J. Cubero</name>
</author>
<author>
<name sortKey="Achor, D S" uniqKey="Achor D">D.S. Achor</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Guttman, D S" uniqKey="Guttman D">D.S. Guttman</name>
</author>
<author>
<name sortKey="Vinatzer, B A" uniqKey="Vinatzer B">B.A. Vinatzer</name>
</author>
<author>
<name sortKey="Sarkar, S F" uniqKey="Sarkar S">S.F. Sarkar</name>
</author>
<author>
<name sortKey="Ranall, M V" uniqKey="Ranall M">M.V. Ranall</name>
</author>
<author>
<name sortKey="Kettler, G" uniqKey="Kettler G">G. Kettler</name>
</author>
<author>
<name sortKey="Greenberg, J T" uniqKey="Greenberg J">J.T. Greenberg</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hu, N T" uniqKey="Hu N">N.T. Hu</name>
</author>
<author>
<name sortKey="Hung, M N" uniqKey="Hung M">M.N. Hung</name>
</author>
<author>
<name sortKey="Chiou, S J" uniqKey="Chiou S">S.J. Chiou</name>
</author>
<author>
<name sortKey="Tang, F" uniqKey="Tang F">F. Tang</name>
</author>
<author>
<name sortKey="Chiang, D C" uniqKey="Chiang D">D.C. Chiang</name>
</author>
<author>
<name sortKey="Huang, H Y" uniqKey="Huang H">H.Y. Huang</name>
</author>
<author>
<name sortKey="Wu, C Y" uniqKey="Wu C">C.Y. Wu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jha, G" uniqKey="Jha G">G. Jha</name>
</author>
<author>
<name sortKey="Rajeshwari, R" uniqKey="Rajeshwari R">R. Rajeshwari</name>
</author>
<author>
<name sortKey="Sonti, R V" uniqKey="Sonti R">R.V. Sonti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jha, G" uniqKey="Jha G">G. Jha</name>
</author>
<author>
<name sortKey="Rajeshwari, R" uniqKey="Rajeshwari R">R. Rajeshwari</name>
</author>
<author>
<name sortKey="Sonti, R V" uniqKey="Sonti R">R.V. Sonti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kim, Y S" uniqKey="Kim Y">Y.-.S. Kim</name>
</author>
<author>
<name sortKey="Jung, H C" uniqKey="Jung H">H.-.C. Jung</name>
</author>
<author>
<name sortKey="Pan, J G" uniqKey="Pan J">J.-.G. Pan</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Lee, M S" uniqKey="Lee M">M.-.S. Lee</name>
</author>
<author>
<name sortKey="Chen, L Y" uniqKey="Chen L">L.-.Y. Chen</name>
</author>
<author>
<name sortKey="Leu, W M" uniqKey="Leu W">W.-.M. Leu</name>
</author>
<author>
<name sortKey="Shiau, R J" uniqKey="Shiau R">R.-.J. Shiau</name>
</author>
<author>
<name sortKey="Hu, N T" uniqKey="Hu N">N.-.T. Hu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Liu, Y G" uniqKey="Liu Y">Y.G. Liu</name>
</author>
<author>
<name sortKey="Whittier, R F" uniqKey="Whittier R">R.F. Whittier</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Matsumoto, H" uniqKey="Matsumoto H">H. Matsumoto</name>
</author>
<author>
<name sortKey="Jitareerat, P" uniqKey="Jitareerat P">P. Jitareerat</name>
</author>
<author>
<name sortKey="Baba, Y" uniqKey="Baba Y">Y. Baba</name>
</author>
<author>
<name sortKey="Tsuyumu, S" uniqKey="Tsuyumu S">S. Tsuyumu</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nomura, K" uniqKey="Nomura K">K. Nomura</name>
</author>
<author>
<name sortKey="He, S Y" uniqKey="He S">S.Y. He</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Ray, S K" uniqKey="Ray S">S.K. Ray</name>
</author>
<author>
<name sortKey="Rajeshwari, R" uniqKey="Rajeshwari R">R. Rajeshwari</name>
</author>
<author>
<name sortKey="Sonti, R V" uniqKey="Sonti R">R.V. Sonti</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Roden, J A" uniqKey="Roden J">J.A. Roden</name>
</author>
<author>
<name sortKey="Belt, B" uniqKey="Belt B">B. Belt</name>
</author>
<author>
<name sortKey="Ross, J B" uniqKey="Ross J">J.B. Ross</name>
</author>
<author>
<name sortKey="Tachibana, T" uniqKey="Tachibana T">T. Tachibana</name>
</author>
<author>
<name sortKey="Vargas, J" uniqKey="Vargas J">J. Vargas</name>
</author>
<author>
<name sortKey="Mudgett, M B" uniqKey="Mudgett M">M.B. Mudgett</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sambrook, J E" uniqKey="Sambrook J">J.E. Sambrook</name>
</author>
<author>
<name sortKey="Fritsch, E F" uniqKey="Fritsch E">E.F. Fritsch</name>
</author>
<author>
<name sortKey="Maniatis, T A" uniqKey="Maniatis T">T.A. Maniatis</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Schulte, R" uniqKey="Schulte R">R. Schulte</name>
</author>
<author>
<name sortKey="Bonas, U" uniqKey="Bonas U">U. Bonas</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Vincent Sealy, L V" uniqKey="Vincent Sealy L">L.V. Vincent-Sealy</name>
</author>
<author>
<name sortKey="Thomas, J D" uniqKey="Thomas J">J.D. Thomas</name>
</author>
<author>
<name sortKey="Commander, P" uniqKey="Commander P">P. Commander</name>
</author>
<author>
<name sortKey="Salmond, G P C" uniqKey="Salmond G">G.P.C. Salmond</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Walker, D S" uniqKey="Walker D">D.S. Walker</name>
</author>
<author>
<name sortKey="Reeves, P J" uniqKey="Reeves P">P.J. Reeves</name>
</author>
<author>
<name sortKey="Salmond, G P C" uniqKey="Salmond G">G.P.C. Salmond</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zhou, S" uniqKey="Zhou S">S. Zhou</name>
</author>
<author>
<name sortKey="Ingram, L O" uniqKey="Ingram L">L.O. Ingram</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Zorreguieta, A" uniqKey="Zorreguieta A">A. Zorreguieta</name>
</author>
<author>
<name sortKey="Finnie, C" uniqKey="Finnie C">C. Finnie</name>
</author>
<author>
<name sortKey="Downie, J A" uniqKey="Downie J">J.A. Downie</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Genet Mol Biol</journal-id>
<journal-id journal-id-type="publisher-id">GMB</journal-id>
<journal-title-group>
<journal-title>Genetics and Molecular Biology</journal-title>
</journal-title-group>
<issn pub-type="ppub">1415-4757</issn>
<issn pub-type="epub">1678-4685</issn>
<publisher>
<publisher-name>Sociedade Brasileira de Genética</publisher-name>
<publisher-loc>Ribeirão Preto, SP, Brazil</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">21637619</article-id>
<article-id pub-id-type="pmc">3036071</article-id>
<article-id pub-id-type="doi">10.1590/S1415-47572009005000110</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Genetics of Microorganisms</subject>
<subj-group>
<subject>Research Article</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Mutation in the
<italic>xpsD</italic>
gene of
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
affects cellulose degradation and virulence</article-title>
<alt-title alt-title-type="running-head">Gene mutation in Xanthomonas axonopodis pv. citri</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="no">
<name>
<surname>Baptista</surname>
<given-names>Juliana Cristina</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1,2</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="no">
<name>
<surname>Machado</surname>
<given-names>Marcos Antonio</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="no">
<name>
<surname>Homem</surname>
<given-names>Rafael Augusto</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1,2</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="no">
<name>
<surname>Torres</surname>
<given-names>Pablo Sebastián</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="no">
<name>
<surname>Vojnov</surname>
<given-names>Adrian Alberto</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>do Amaral</surname>
<given-names>Alexandre Morais</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1,4</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<institution>Centro APTA Citros Sylvio Moreira, Cordeirópolis, SP</institution>
<country>Brazil</country>
</aff>
<aff id="aff2">
<label>2</label>
<institution>Universidade Estadual de Campinas, Campinas, SP</institution>
<country>Brazil</country>
</aff>
<aff id="aff3">
<label>3</label>
<institution>Fundación Pablo Cassará, Instituto de Ciencia y Tecnología Dr. Cesar Milstein, Ciudad de Buenos Aires</institution>
<country>Argentina</country>
</aff>
<aff id="aff4">
<label>4</label>
<institution>EMBRAPA Recursos Genéticos e Biotecnologia, Brasília, DF</institution>
<country>Brazil</country>
</aff>
<author-notes>
<corresp id="FN990">Send correspondence to Alexandre Morais do Amaral. EMBRAPA Recursos Genéticos e Biotecnologia, Caixa Postal 02372, 70770-917 Brasília, DF, Brazil. E-mail:
<email>aamaral@cenargen.embrapa.br</email>
.</corresp>
</author-notes>
<pub-date pub-type="ppub">
<season>Jan-Mar</season>
<year>2010</year>
</pub-date>
<pub-date pub-type="epub">
<day>1</day>
<month>3</month>
<year>2010</year>
</pub-date>
<volume>33</volume>
<issue>1</issue>
<fpage>146</fpage>
<lpage>153</lpage>
<history>
<date date-type="received">
<day>24</day>
<month>11</month>
<year>2008</year>
</date>
<date date-type="accepted">
<day>6</day>
<month>7</month>
<year>2009</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright © 2010, Sociedade Brasileira de Genética.</copyright-statement>
<copyright-year>2010</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/2.0/">
<license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
</license>
</permissions>
<abstract>
<p>The Gram-negative bacterium
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
, the causal agent of citrus canker, is a major threat to the citrus industry worldwide. Although this is a leaf spot pathogen, it bears genes highly related to degradation of plant cell walls, which are typically found in plant pathogens that cause symptoms of tissue maceration. Little is known on
<italic>Xac</italic>
capacity to cause disease and hydrolyze cellulose. We investigated the contribution of various open reading frames on degradation of a cellulose compound by means of a global mutational assay to selectively screen for a defect in carboxymethyl cellulase (CMCase) secretion in
<italic>X. axonopodis</italic>
pv.
<italic>citri</italic>
. Screening on CMC agar revealed one mutant clone defective in extracellular glycanase activity, out of nearly 3,000 clones. The insertion was located in the
<italic>xpsD</italic>
gene, a component of the type II secretion system (T2SS) showing an influence in the ability of
<italic>Xac</italic>
to colonize tissues and hydrolyze cellulose. In summary, these data show for the first time, that
<italic>X. axonopodis</italic>
pv.
<italic>citri</italic>
is capable of hydrolyzing cellulose in a T2SS-dependent process. Furthermore, it was demonstrated that the ability to degrade cellulose contributes to the infection process as a whole.</p>
</abstract>
<kwd-group>
<kwd>citrus canker</kwd>
<kwd>transposome</kwd>
<kwd>type II secretion system</kwd>
</kwd-group>
</article-meta>
</front>
<floats-group>
<table-wrap id="t1" position="float">
<label>Table 1</label>
<caption>
<p> Bacterial strains and plasmids.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" rowspan="1" colspan="1">Strain or plasmid</td>
<td valign="top" rowspan="1" colspan="1">Characteristics</td>
<td valign="top" rowspan="1" colspan="1">Source or reference</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="1" colspan="1">
<italic>Escherichia coli</italic>
</td>
<td valign="top" rowspan="1" colspan="1"></td>
<td valign="top" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">DH5α</td>
<td valign="top" rowspan="1" colspan="1">F
<sup>-</sup>
φ80d
<italic>lacZ</italic>
ΔM15 Δ (
<italic>lacZYA-argF</italic>
)
<italic>U169 endA1 deoR recA1 hsdR17</italic>
(r
<sub>K</sub>
<sup>-</sup>
m
<sub>K</sub>
<sup>+</sup>
)
<italic>phoA supE44</italic>
λ
<sup>-</sup>
<italic>thi-1 gyrA96 relA1</italic>
</td>
<td valign="top" rowspan="1" colspan="1">Gibco</td>
</tr>
<tr>
<td colspan="1" rowspan="1">
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" colspan="3" rowspan="1">
<italic>Xanthomonas axonopodis</italic>
pv.
<italic>citri</italic>
</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">306</td>
<td valign="top" rowspan="1" colspan="1">Wild type, Ap
<sup>r</sup>
</td>
<td valign="top" rowspan="1" colspan="1">R.P. Leite</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">30E9</td>
<td valign="top" rowspan="1" colspan="1">Kan
<sup>r</sup>
, XpsD-</td>
<td valign="top" rowspan="1" colspan="1">This study</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">Δ
<italic>xpsD</italic>
</td>
<td valign="top" rowspan="1" colspan="1">Kan
<sup>r</sup>
, site-directed XpsD-</td>
<td valign="top" rowspan="1" colspan="1">This study</td>
</tr>
<tr>
<td colspan="3" rowspan="1">
<hr></hr>
</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1"> Plasmid</td>
<td valign="top" rowspan="1" colspan="1"></td>
<td valign="top" rowspan="1" colspan="1"></td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">pCR2.1-TOPO</td>
<td valign="top" rowspan="1" colspan="1">vector pUC18 derivative, kanr,
<italic>bla</italic>
(Apr),
<italic>lac</italic>
Z</td>
<td valign="top" rowspan="1" colspan="1">Invitrogen</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">TOPO-
<italic>xpsD</italic>
</td>
<td valign="top" rowspan="1" colspan="1">PCR-amplified
<italic>xpsD</italic>
(725-1307) in pCR2.1-TOPO; Kan
<sup>r</sup>
</td>
<td valign="top" rowspan="1" colspan="1">This study</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="t2" position="float">
<label>Table 2</label>
<caption>
<p> Oligonucleotides used.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" rowspan="1" colspan="1">Primer</td>
<td valign="top" rowspan="1" colspan="1">Nucleotide sequence (5' → 3')
<sup>a</sup>
</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="1" colspan="1"> KAN RP-1</td>
<td valign="top" rowspan="1" colspan="1">GCAATGTAACATCAGAGATTTTGAG</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">KAN2 FP-1</td>
<td valign="top" rowspan="1" colspan="1">ACCTACAACAAAGCTCTCATCAACC</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">KanA</td>
<td valign="top" rowspan="1" colspan="1">CATGCAAGCTTCAGGGTTGA</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">AD1</td>
<td valign="top" rowspan="1" colspan="1">NTCGA(G/C)T(A/T)T(G/C)G(A/T)GTT</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">AD2</td>
<td valign="top" rowspan="1" colspan="1">NGTCGA(G/C)(A/T)GANA(A/T)GAA</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">AD3</td>
<td valign="top" rowspan="1" colspan="1">(A/T)GTGNAG(A/T)ANCANAGA</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">AD4</td>
<td valign="top" rowspan="1" colspan="1">AG(A/T)GNAG(A/T)ANCA(A/T)AGG</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">XpsD_EcoRI_F</td>
<td valign="top" rowspan="1" colspan="1">
<underline>GAATTC</underline>
CAAGGCCGAAAAAGTCTCTG</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">XpsD_EcoRI_R</td>
<td valign="top" rowspan="1" colspan="1">
<underline>GAATTC</underline>
CACCAGCAGGGTATTGGTCT</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Restriction sites incorporated into primers are underlined.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="t3" position="float">
<label>Table 3</label>
<caption>
<p> Hydrolysis of CMC by wild-type and mutant strains.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" rowspan="1" colspan="1">
<italic>X. axonopodis</italic>
pv.
<italic>citri</italic>
strain</td>
<td valign="top" rowspan="1" colspan="1">CMCase activity index
<sup>*, #</sup>
</td>
<td valign="top" rowspan="1" colspan="1">Standard deviation</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="1" colspan="1"> Wild type</td>
<td valign="top" rowspan="1" colspan="1">5.07a
<sup>&</sup>
± 0.1487</td>
<td valign="top" rowspan="1" colspan="1">0.7285</td>
</tr>
<tr>
<td valign="top" rowspan="1" colspan="1">XpsD-defective mutant (30E9)</td>
<td valign="top" rowspan="1" colspan="1">0.86b ± 0.0804</td>
<td valign="top" rowspan="1" colspan="1">0.3941</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<sup>*</sup>
(H
<sup>2</sup>
- C
<sup>2</sup>
)/ C
<sup>2</sup>
(H - diameter of the halo, C - diameter of the colony).</p>
<p>
<sup>#</sup>
Average ± standard error of the means (n = 24).</p>
<p>
<sup>&</sup>
Statistically significant differences (p < 0.001), as determined by the Student
<italic>t</italic>
test, are indicated by letters “a” and “b” for comparison to the strains.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</floats-group>
</pmc>
<affiliations>
<list>
<country>
<li>Argentine</li>
<li>Brésil</li>
</country>
</list>
<tree>
<noCountry>
<name sortKey="Baptista, Juliana Cristina" sort="Baptista, Juliana Cristina" uniqKey="Baptista J" first="Juliana Cristina" last="Baptista">Juliana Cristina Baptista</name>
<name sortKey="Do Amaral, Alexandre Morais" sort="Do Amaral, Alexandre Morais" uniqKey="Do Amaral A" first="Alexandre Morais" last="Do Amaral">Alexandre Morais Do Amaral</name>
<name sortKey="Homem, Rafael Augusto" sort="Homem, Rafael Augusto" uniqKey="Homem R" first="Rafael Augusto" last="Homem">Rafael Augusto Homem</name>
</noCountry>
<country name="Brésil">
<noRegion>
<name sortKey="Machado, Marcos Antonio" sort="Machado, Marcos Antonio" uniqKey="Machado M" first="Marcos Antonio" last="Machado">Marcos Antonio Machado</name>
</noRegion>
</country>
<country name="Argentine">
<noRegion>
<name sortKey="Torres, Pablo Sebastian" sort="Torres, Pablo Sebastian" uniqKey="Torres P" first="Pablo Sebastián" last="Torres">Pablo Sebastián Torres</name>
</noRegion>
<name sortKey="Vojnov, Adrian Alberto" sort="Vojnov, Adrian Alberto" uniqKey="Vojnov A" first="Adrian Alberto" last="Vojnov">Adrian Alberto Vojnov</name>
</country>
</tree>
</affiliations>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/OrangerV1/Data/Ncbi/Merge
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000D46 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd -nk 000D46 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    OrangerV1
   |flux=    Ncbi
   |étape=   Merge
   |type=    RBID
   |clé=     PMC:3036071
   |texte=   Mutation in the xpsD gene of Xanthomonas axonopodis pv. citri affects cellulose degradation and virulence
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Ncbi/Merge/RBID.i   -Sk "pubmed:21637619" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Ncbi/Merge/biblio.hfd   \
       | NlmPubMed2Wicri -a OrangerV1 

Wicri

This area was generated with Dilib version V0.6.25.
Data generation: Sat Dec 3 17:11:04 2016. Site generation: Wed Mar 6 18:18:32 2024