Serveur d'exploration sur le chêne en Belgique

Attention, ce site est en cours de développement !
Attention, site généré par des moyens informatiques à partir de corpus bruts.
Les informations ne sont donc pas validées.

Detection of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria

Identifieur interne : 000077 ( Pmc/Corpus ); précédent : 000076; suivant : 000078

Detection of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria

Auteurs : Hamza Leulmi ; Atef Aouadi ; Idir Bitam ; Amina Bessas ; Ahmed Benakhla ; Didier Raoult ; Philippe Parola

Source :

RBID : PMC:4721140

Abstract

Background

In recent years, the scope and importance of emergent vector-borne diseases has increased dramatically. In Algeria, only limited information is currently available concerning the presence and prevalence of these zoonotic diseases. For this reason, we conducted a survey of hematophagous ectoparasites of domestic mammals and/or spleens of wild animals in El Tarf and Souk Ahras, Algeria.

Methods

Using real-time PCR, standard PCR and sequencing, the presence of Bartonella spp., Rickettsia spp., Borrelia spp. and Coxiella burnetii was evaluated in 268/1626 ticks, 136 fleas, 11 Nycteribiidae flies and 16 spleens of domestic and/or wild animals from the El Tarf and Souk Ahras areas.

Results

For the first time in Algeria, Bartonella tamiae was detected in 12/19 (63.2 %) Ixodes vespertilionis ticks, 8/11 (72.7 %) Nycteribiidae spp. flies and in 6/10 (60 %) bat spleens (Chiroptera spp.). DNA from Coxiella burnetii, the agent of Q fever, was also identified in 3/19 (15.8 %) I. vespertilionis from bats. Rickettsia slovaca, the agent of tick-borne lymphadenopathy, was detected in 1/1 (100 %) Haemaphysalis punctata and 2/3 (66.7 %) Dermacentor marginatus ticks collected from two boars (Sus scrofa algira) respectively. Ri. massiliae, an agent of spotted fever, was detected in 38/94 (40.4 %) Rhipicephalus sanguineus sensu lato collected from cattle, sheep, dogs, boars and jackals. DNA of Ri. aeschlimannii was detected in 6/20 (30 %) Hyalomma anatolicum excavatum and 6/20 (30 %) Hy. scupense from cattle. Finally, Ri. felis, an emerging rickettsial pathogen, was detected in 80/110 (72.7 %) Archaeopsylla erinacei and 2/2 (100 %) Ctenocephalides felis of hedgehogs (Atelerix algirus).

Conclusion

In this study, we expanded knowledge about the repertoire of ticks and flea-borne bacteria present in ectoparasites and/or tissues of domestic and wild animals in Algeria.


Url:
DOI: 10.1186/s13071-016-1316-9
PubMed: 26791781
PubMed Central: 4721140

Links to Exploration step

PMC:4721140

Le document en format XML

<record>
<TEI>
<teiHeader>
<fileDesc>
<titleStmt>
<title xml:lang="en">Detection of
<italic>Bartonella tamiae, Coxiella burnetii</italic>
and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria</title>
<author>
<name sortKey="Leulmi, Hamza" sort="Leulmi, Hamza" uniqKey="Leulmi H" first="Hamza" last="Leulmi">Hamza Leulmi</name>
<affiliation>
<nlm:aff id="Aff1">Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille, Cedex 5 France</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Ecole Nationale Supérieure Vétérinaire d’Alger. El Aliya Alger, Algiers, 16000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Aouadi, Atef" sort="Aouadi, Atef" uniqKey="Aouadi A" first="Atef" last="Aouadi">Atef Aouadi</name>
<affiliation>
<nlm:aff id="Aff3">Département des Sciences Vétérinaires, Université Cherif Messaadia, Souk Ahras, 41000 Algeria</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff4">Département des Sciences Vétérinaires, Université Chadli Bendjdid, El Tarf, 36000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bitam, Idir" sort="Bitam, Idir" uniqKey="Bitam I" first="Idir" last="Bitam">Idir Bitam</name>
<affiliation>
<nlm:aff id="Aff1">Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille, Cedex 5 France</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Ecole Nationale Supérieure Vétérinaire d’Alger. El Aliya Alger, Algiers, 16000 Algeria</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff5">Laboratoire d’Ecologie et Environnement: Interaction, Génome, Université de Bab Ezzouar, Bab Ezzouar, 16000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bessas, Amina" sort="Bessas, Amina" uniqKey="Bessas A" first="Amina" last="Bessas">Amina Bessas</name>
<affiliation>
<nlm:aff id="Aff2">Ecole Nationale Supérieure Vétérinaire d’Alger. El Aliya Alger, Algiers, 16000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Benakhla, Ahmed" sort="Benakhla, Ahmed" uniqKey="Benakhla A" first="Ahmed" last="Benakhla">Ahmed Benakhla</name>
<affiliation>
<nlm:aff id="Aff3">Département des Sciences Vétérinaires, Université Cherif Messaadia, Souk Ahras, 41000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Raoult, Didier" sort="Raoult, Didier" uniqKey="Raoult D" first="Didier" last="Raoult">Didier Raoult</name>
<affiliation>
<nlm:aff id="Aff1">Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille, Cedex 5 France</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Parola, Philippe" sort="Parola, Philippe" uniqKey="Parola P" first="Philippe" last="Parola">Philippe Parola</name>
<affiliation>
<nlm:aff id="Aff1">Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille, Cedex 5 France</nlm:aff>
</affiliation>
</author>
</titleStmt>
<publicationStmt>
<idno type="wicri:source">PMC</idno>
<idno type="pmid">26791781</idno>
<idno type="pmc">4721140</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4721140</idno>
<idno type="RBID">PMC:4721140</idno>
<idno type="doi">10.1186/s13071-016-1316-9</idno>
<date when="2016">2016</date>
<idno type="wicri:Area/Pmc/Corpus">000077</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">000077</idno>
</publicationStmt>
<sourceDesc>
<biblStruct>
<analytic>
<title xml:lang="en" level="a" type="main">Detection of
<italic>Bartonella tamiae, Coxiella burnetii</italic>
and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria</title>
<author>
<name sortKey="Leulmi, Hamza" sort="Leulmi, Hamza" uniqKey="Leulmi H" first="Hamza" last="Leulmi">Hamza Leulmi</name>
<affiliation>
<nlm:aff id="Aff1">Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille, Cedex 5 France</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Ecole Nationale Supérieure Vétérinaire d’Alger. El Aliya Alger, Algiers, 16000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Aouadi, Atef" sort="Aouadi, Atef" uniqKey="Aouadi A" first="Atef" last="Aouadi">Atef Aouadi</name>
<affiliation>
<nlm:aff id="Aff3">Département des Sciences Vétérinaires, Université Cherif Messaadia, Souk Ahras, 41000 Algeria</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff4">Département des Sciences Vétérinaires, Université Chadli Bendjdid, El Tarf, 36000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bitam, Idir" sort="Bitam, Idir" uniqKey="Bitam I" first="Idir" last="Bitam">Idir Bitam</name>
<affiliation>
<nlm:aff id="Aff1">Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille, Cedex 5 France</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff2">Ecole Nationale Supérieure Vétérinaire d’Alger. El Aliya Alger, Algiers, 16000 Algeria</nlm:aff>
</affiliation>
<affiliation>
<nlm:aff id="Aff5">Laboratoire d’Ecologie et Environnement: Interaction, Génome, Université de Bab Ezzouar, Bab Ezzouar, 16000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Bessas, Amina" sort="Bessas, Amina" uniqKey="Bessas A" first="Amina" last="Bessas">Amina Bessas</name>
<affiliation>
<nlm:aff id="Aff2">Ecole Nationale Supérieure Vétérinaire d’Alger. El Aliya Alger, Algiers, 16000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Benakhla, Ahmed" sort="Benakhla, Ahmed" uniqKey="Benakhla A" first="Ahmed" last="Benakhla">Ahmed Benakhla</name>
<affiliation>
<nlm:aff id="Aff3">Département des Sciences Vétérinaires, Université Cherif Messaadia, Souk Ahras, 41000 Algeria</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Raoult, Didier" sort="Raoult, Didier" uniqKey="Raoult D" first="Didier" last="Raoult">Didier Raoult</name>
<affiliation>
<nlm:aff id="Aff1">Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille, Cedex 5 France</nlm:aff>
</affiliation>
</author>
<author>
<name sortKey="Parola, Philippe" sort="Parola, Philippe" uniqKey="Parola P" first="Philippe" last="Parola">Philippe Parola</name>
<affiliation>
<nlm:aff id="Aff1">Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille, Cedex 5 France</nlm:aff>
</affiliation>
</author>
</analytic>
<series>
<title level="j">Parasites & Vectors</title>
<idno type="eISSN">1756-3305</idno>
<imprint>
<date when="2016">2016</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc>
<textClass></textClass>
</profileDesc>
</teiHeader>
<front>
<div type="abstract" xml:lang="en">
<sec>
<title>Background</title>
<p>In recent years, the scope and importance of emergent vector-borne diseases has increased dramatically. In Algeria, only limited information is currently available concerning the presence and prevalence of these zoonotic diseases. For this reason, we conducted a survey of hematophagous ectoparasites of domestic mammals and/or spleens of wild animals in El Tarf and Souk Ahras, Algeria.</p>
</sec>
<sec>
<title>Methods</title>
<p>Using real-time PCR, standard PCR and sequencing, the presence of
<italic>Bartonella</italic>
spp.,
<italic>Rickettsia</italic>
spp.,
<italic>Borrelia</italic>
spp. and
<italic>Coxiella burnetii</italic>
was evaluated in 268/1626 ticks, 136 fleas, 11
<italic>Nycteribiidae</italic>
flies and 16 spleens of domestic and/or wild animals from the El Tarf and Souk Ahras areas.</p>
</sec>
<sec>
<title>Results</title>
<p>For the first time in Algeria,
<italic>Bartonella tamiae</italic>
was detected in 12/19 (63.2 %)
<italic>Ixodes vespertilionis</italic>
ticks, 8/11 (72.7 %)
<italic>Nycteribiidae</italic>
spp. flies and in 6/10 (60 %) bat spleens (
<italic>Chiroptera</italic>
spp.). DNA from
<italic>Coxiella burnetii</italic>
, the agent of Q fever, was also identified in 3/19 (15.8 %)
<italic>I. vespertilionis</italic>
from bats.
<italic>Rickettsia slovaca</italic>
, the agent of tick-borne lymphadenopathy, was detected in 1/1 (100 %)
<italic>Haemaphysalis punctata</italic>
and 2/3 (66.7 %)
<italic>Dermacentor marginatus</italic>
ticks collected from two boars (
<italic>Sus scrofa algira</italic>
) respectively.
<italic>Ri. massiliae</italic>
, an agent of spotted fever, was detected in 38/94 (40.4 %)
<italic>Rhipicephalus sanguineus</italic>
sensu lato collected from cattle, sheep, dogs, boars and jackals. DNA of
<italic>Ri. aeschlimannii</italic>
was detected in 6/20 (30 %)
<italic>Hyalomma anatolicum excavatum</italic>
and 6/20 (30 %)
<italic>Hy. scupense</italic>
from cattle. Finally,
<italic>Ri. felis</italic>
, an emerging rickettsial pathogen, was detected in 80/110 (72.7 %)
<italic>Archaeopsylla erinacei</italic>
and 2/2 (100 %)
<italic>Ctenocephalides felis</italic>
of hedgehogs (
<italic>Atelerix algirus</italic>
).</p>
</sec>
<sec>
<title>Conclusion</title>
<p>In this study, we expanded knowledge about the repertoire of ticks and flea-borne bacteria present in ectoparasites and/or tissues of domestic and wild animals in Algeria.</p>
</sec>
</div>
</front>
<back>
<div1 type="bibliography">
<listBibl>
<biblStruct>
<analytic>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Paddock, Cd" uniqKey="Paddock C">CD Paddock</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mediannikov, O" uniqKey="Mediannikov O">O Mediannikov</name>
</author>
<author>
<name sortKey="Fenollar, F" uniqKey="Fenollar F">F Fenollar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Baneth, G" uniqKey="Baneth G">G Baneth</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
<author>
<name sortKey="Dittmar, K" uniqKey="Dittmar K">K Dittmar</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Whiting, Mf" uniqKey="Whiting M">MF Whiting</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Davoust, B" uniqKey="Davoust B">B Davoust</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Eisen, Rj" uniqKey="Eisen R">RJ Eisen</name>
</author>
<author>
<name sortKey="Gage, Kl" uniqKey="Gage K">KL Gage</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Knobel, Dl" uniqKey="Knobel D">DL Knobel</name>
</author>
<author>
<name sortKey="Maina, An" uniqKey="Maina A">AN Maina</name>
</author>
<author>
<name sortKey="Cutler, Sj" uniqKey="Cutler S">SJ Cutler</name>
</author>
<author>
<name sortKey="Ogola, E" uniqKey="Ogola E">E Ogola</name>
</author>
<author>
<name sortKey="Feikin, Dr" uniqKey="Feikin D">DR Feikin</name>
</author>
<author>
<name sortKey="Junghae, M" uniqKey="Junghae M">M Junghae</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Gil, H" uniqKey="Gil H">H Gil</name>
</author>
<author>
<name sortKey="Escudero, R" uniqKey="Escudero R">R Escudero</name>
</author>
<author>
<name sortKey="Pons, I" uniqKey="Pons I">I Pons</name>
</author>
<author>
<name sortKey="Rodriguez Vargas, M" uniqKey="Rodriguez Vargas M">M Rodriguez-Vargas</name>
</author>
<author>
<name sortKey="Garcia Esteban, C" uniqKey="Garcia Esteban C">C Garcia-Esteban</name>
</author>
<author>
<name sortKey="Rodriguez Moreno, I" uniqKey="Rodriguez Moreno I">I Rodriguez-Moreno</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Znazen, A" uniqKey="Znazen A">A Znazen</name>
</author>
<author>
<name sortKey="Khrouf, F" uniqKey="Khrouf F">F Khrouf</name>
</author>
<author>
<name sortKey="Elleuch, N" uniqKey="Elleuch N">N Elleuch</name>
</author>
<author>
<name sortKey="Lahiani, D" uniqKey="Lahiani D">D Lahiani</name>
</author>
<author>
<name sortKey="Marrekchi, C" uniqKey="Marrekchi C">C Marrekchi</name>
</author>
<author>
<name sortKey="M Ghirbi, Y" uniqKey="M Ghirbi Y">Y M'Ghirbi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Merhej, V" uniqKey="Merhej V">V Merhej</name>
</author>
<author>
<name sortKey="El, Kk" uniqKey="El K">KK El</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Nogueras, Mm" uniqKey="Nogueras M">MM Nogueras</name>
</author>
<author>
<name sortKey="Pons, I" uniqKey="Pons I">I Pons</name>
</author>
<author>
<name sortKey="Ortuno, A" uniqKey="Ortuno A">A Ortuno</name>
</author>
<author>
<name sortKey="Miret, J" uniqKey="Miret J">J Miret</name>
</author>
<author>
<name sortKey="Pla, J" uniqKey="Pla J">J Pla</name>
</author>
<author>
<name sortKey="Castella, J" uniqKey="Castella J">J Castella</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mouffok, N" uniqKey="Mouffok N">N Mouffok</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Lepidi, H" uniqKey="Lepidi H">H Lepidi</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Abdel Shafy, S" uniqKey="Abdel Shafy S">S Abdel-Shafy</name>
</author>
<author>
<name sortKey="Allam, Na" uniqKey="Allam N">NA Allam</name>
</author>
<author>
<name sortKey="Mediannikov, O" uniqKey="Mediannikov O">O Mediannikov</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kernif, T" uniqKey="Kernif T">T Kernif</name>
</author>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chomel, Bb" uniqKey="Chomel B">BB Chomel</name>
</author>
<author>
<name sortKey="Boulouis, Hj" uniqKey="Boulouis H">HJ Boulouis</name>
</author>
<author>
<name sortKey="Breitschwerdt, Eb" uniqKey="Breitschwerdt E">EB Breitschwerdt</name>
</author>
<author>
<name sortKey="Kasten, Rw" uniqKey="Kasten R">RW Kasten</name>
</author>
<author>
<name sortKey="Vayssier Taussat, M" uniqKey="Vayssier Taussat M">M Vayssier-Taussat</name>
</author>
<author>
<name sortKey="Birtles, Rj" uniqKey="Birtles R">RJ Birtles</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mogollon Pasapera, E" uniqKey="Mogollon Pasapera E">E Mogollon-Pasapera</name>
</author>
<author>
<name sortKey="Otvos, L" uniqKey="Otvos L">L Otvos</name>
</author>
<author>
<name sortKey="Giordano, A" uniqKey="Giordano A">A Giordano</name>
</author>
<author>
<name sortKey="Cassone, M" uniqKey="Cassone M">M Cassone</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Chomel, Bb" uniqKey="Chomel B">BB Chomel</name>
</author>
<author>
<name sortKey="Kasten, Rw" uniqKey="Kasten R">RW Kasten</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Harms, A" uniqKey="Harms A">A Harms</name>
</author>
<author>
<name sortKey="Dehio, C" uniqKey="Dehio C">C Dehio</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Azzag, N" uniqKey="Azzag N">N Azzag</name>
</author>
<author>
<name sortKey="Petit, E" uniqKey="Petit E">E Petit</name>
</author>
<author>
<name sortKey="Gandoin, C" uniqKey="Gandoin C">C Gandoin</name>
</author>
<author>
<name sortKey="Bouillin, C" uniqKey="Bouillin C">C Bouillin</name>
</author>
<author>
<name sortKey="Ghalmi, F" uniqKey="Ghalmi F">F Ghalmi</name>
</author>
<author>
<name sortKey="Haddad, N" uniqKey="Haddad N">N Haddad</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kernif, T" uniqKey="Kernif T">T Kernif</name>
</author>
<author>
<name sortKey="Aissi, M" uniqKey="Aissi M">M Aissi</name>
</author>
<author>
<name sortKey="Doumandji, Se" uniqKey="Doumandji S">SE Doumandji</name>
</author>
<author>
<name sortKey="Chomel, Bb" uniqKey="Chomel B">BB Chomel</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
<author>
<name sortKey="Rolain, Jm" uniqKey="Rolain J">JM Rolain</name>
</author>
<author>
<name sortKey="Nicolas, V" uniqKey="Nicolas V">V Nicolas</name>
</author>
<author>
<name sortKey="Tsai, Yl" uniqKey="Tsai Y">YL Tsai</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Gundi, Va" uniqKey="Gundi V">VA Gundi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Azzag, N" uniqKey="Azzag N">N Azzag</name>
</author>
<author>
<name sortKey="Haddad, N" uniqKey="Haddad N">N Haddad</name>
</author>
<author>
<name sortKey="Durand, B" uniqKey="Durand B">B Durand</name>
</author>
<author>
<name sortKey="Petit, E" uniqKey="Petit E">E Petit</name>
</author>
<author>
<name sortKey="Ammouche, A" uniqKey="Ammouche A">A Ammouche</name>
</author>
<author>
<name sortKey="Chomel, B" uniqKey="Chomel B">B Chomel</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Maurin, M" uniqKey="Maurin M">M Maurin</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Angelakis, E" uniqKey="Angelakis E">E Angelakis</name>
</author>
<author>
<name sortKey="Mediannikov, O" uniqKey="Mediannikov O">O Mediannikov</name>
</author>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Mouffok, N" uniqKey="Mouffok N">N Mouffok</name>
</author>
<author>
<name sortKey="Bassene, H" uniqKey="Bassene H">H Bassene</name>
</author>
<author>
<name sortKey="Tall, A" uniqKey="Tall A">A Tall</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Sobhi, Z" uniqKey="Sobhi Z">Z Sobhi</name>
</author>
<author>
<name sortKey="Allal Benfekih, L" uniqKey="Allal Benfekih L">L Allal-Benfekih</name>
</author>
<author>
<name sortKey="Petit, D" uniqKey="Petit D">D Petit</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bouattour, A" uniqKey="Bouattour A">A Bouattour</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Beaucournu, J C" uniqKey="Beaucournu J">J-C Beaucournu</name>
</author>
<author>
<name sortKey="Launay, H" uniqKey="Launay H">H Launay</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Pages, F" uniqKey="Pages F">F Pages</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Varagnol, M" uniqKey="Varagnol M">M Varagnol</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Jouan, R" uniqKey="Jouan R">R Jouan</name>
</author>
<author>
<name sortKey="Beaucournu, Jc" uniqKey="Beaucournu J">JC Beaucournu</name>
</author>
<author>
<name sortKey="Rolain, Jm" uniqKey="Rolain J">JM Rolain</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kosoy, M" uniqKey="Kosoy M">M Kosoy</name>
</author>
<author>
<name sortKey="Morway, C" uniqKey="Morway C">C Morway</name>
</author>
<author>
<name sortKey="Sheff, Kw" uniqKey="Sheff K">KW Sheff</name>
</author>
<author>
<name sortKey="Bai, Y" uniqKey="Bai Y">Y Bai</name>
</author>
<author>
<name sortKey="Colborn, J" uniqKey="Colborn J">J Colborn</name>
</author>
<author>
<name sortKey="Chalcraft, L" uniqKey="Chalcraft L">L Chalcraft</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Kernif, T" uniqKey="Kernif T">T Kernif</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Leulmi, H" uniqKey="Leulmi H">H Leulmi</name>
</author>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Laudisoit, A" uniqKey="Laudisoit A">A Laudisoit</name>
</author>
<author>
<name sortKey="Houemenou, G" uniqKey="Houemenou G">G Houemenou</name>
</author>
<author>
<name sortKey="Davoust, B" uniqKey="Davoust B">B Davoust</name>
</author>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mediannikov, O" uniqKey="Mediannikov O">O Mediannikov</name>
</author>
<author>
<name sortKey="Fenollar, F" uniqKey="Fenollar F">F Fenollar</name>
</author>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Diatta, G" uniqKey="Diatta G">G Diatta</name>
</author>
<author>
<name sortKey="Bassene, H" uniqKey="Bassene H">H Bassene</name>
</author>
<author>
<name sortKey="Molez, Jf" uniqKey="Molez J">JF Molez</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Jacomo, V" uniqKey="Jacomo V">V Jacomo</name>
</author>
<author>
<name sortKey="Kelly, Pj" uniqKey="Kelly P">PJ Kelly</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Colton, L" uniqKey="Colton L">L Colton</name>
</author>
<author>
<name sortKey="Zeidner, N" uniqKey="Zeidner N">N Zeidner</name>
</author>
<author>
<name sortKey="Lynch, T" uniqKey="Lynch T">T Lynch</name>
</author>
<author>
<name sortKey="Kosoy, My" uniqKey="Kosoy M">MY Kosoy</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kabeya, H" uniqKey="Kabeya H">H Kabeya</name>
</author>
<author>
<name sortKey="Colborn, Jm" uniqKey="Colborn J">JM Colborn</name>
</author>
<author>
<name sortKey="Bai, Y" uniqKey="Bai Y">Y Bai</name>
</author>
<author>
<name sortKey="Lerdthusnee, K" uniqKey="Lerdthusnee K">K Lerdthusnee</name>
</author>
<author>
<name sortKey="Richardson, Jh" uniqKey="Richardson J">JH Richardson</name>
</author>
<author>
<name sortKey="Maruyama, S" uniqKey="Maruyama S">S Maruyama</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Concannon, R" uniqKey="Concannon R">R Concannon</name>
</author>
<author>
<name sortKey="Wynn Owen, K" uniqKey="Wynn Owen K">K Wynn-Owen</name>
</author>
<author>
<name sortKey="Simpson, Vr" uniqKey="Simpson V">VR Simpson</name>
</author>
<author>
<name sortKey="Birtles, Rj" uniqKey="Birtles R">RJ Birtles</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kosoy, M" uniqKey="Kosoy M">M Kosoy</name>
</author>
<author>
<name sortKey="Bai, Y" uniqKey="Bai Y">Y Bai</name>
</author>
<author>
<name sortKey="Lynch, T" uniqKey="Lynch T">T Lynch</name>
</author>
<author>
<name sortKey="Kuzmin, Iv" uniqKey="Kuzmin I">IV Kuzmin</name>
</author>
<author>
<name sortKey="Niezgoda, M" uniqKey="Niezgoda M">M Niezgoda</name>
</author>
<author>
<name sortKey="Franka, R" uniqKey="Franka R">R Franka</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bai, Y" uniqKey="Bai Y">Y Bai</name>
</author>
<author>
<name sortKey="Kosoy, M" uniqKey="Kosoy M">M Kosoy</name>
</author>
<author>
<name sortKey="Recuenco, S" uniqKey="Recuenco S">S Recuenco</name>
</author>
<author>
<name sortKey="Alvarez, D" uniqKey="Alvarez D">D Alvarez</name>
</author>
<author>
<name sortKey="Moran, D" uniqKey="Moran D">D Moran</name>
</author>
<author>
<name sortKey="Turmelle, A" uniqKey="Turmelle A">A Turmelle</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kazar, J" uniqKey="Kazar J">J Kazar</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Angelakis, E" uniqKey="Angelakis E">E Angelakis</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Benslimani, A" uniqKey="Benslimani A">A Benslimani</name>
</author>
<author>
<name sortKey="Fenollar, F" uniqKey="Fenollar F">F Fenollar</name>
</author>
<author>
<name sortKey="Lepidi, H" uniqKey="Lepidi H">H Lepidi</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Arthur, Dr" uniqKey="Arthur D">DR Arthur</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Hornok, S" uniqKey="Hornok S">S Hornok</name>
</author>
<author>
<name sortKey="Estrada Pena, A" uniqKey="Estrada Pena A">A Estrada-Pena</name>
</author>
<author>
<name sortKey="Kontschan, J" uniqKey="Kontschan J">J Kontschan</name>
</author>
<author>
<name sortKey="Plantard, O" uniqKey="Plantard O">O Plantard</name>
</author>
<author>
<name sortKey="Kunz, B" uniqKey="Kunz B">B Kunz</name>
</author>
<author>
<name sortKey="Mihalca, Ad" uniqKey="Mihalca A">AD Mihalca</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Piksa, K" uniqKey="Piksa K">K Piksa</name>
</author>
<author>
<name sortKey="Gorz, A" uniqKey="Gorz A">A Gorz</name>
</author>
<author>
<name sortKey="Nowak Chmura, M" uniqKey="Nowak Chmura M">M Nowak-Chmura</name>
</author>
<author>
<name sortKey="Siuda, K" uniqKey="Siuda K">K Siuda</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Obsomer, V" uniqKey="Obsomer V">V Obsomer</name>
</author>
<author>
<name sortKey="Wirtgen, M" uniqKey="Wirtgen M">M Wirtgen</name>
</author>
<author>
<name sortKey="Linden, A" uniqKey="Linden A">A Linden</name>
</author>
<author>
<name sortKey="Claerebout, E" uniqKey="Claerebout E">E Claerebout</name>
</author>
<author>
<name sortKey="Heyman, P" uniqKey="Heyman P">P Heyman</name>
</author>
<author>
<name sortKey="Heylen, D" uniqKey="Heylen D">D Heylen</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Cornet, Jp" uniqKey="Cornet J">JP Cornet</name>
</author>
<author>
<name sortKey="Sanogo, Yo" uniqKey="Sanogo Y">YO Sanogo</name>
</author>
<author>
<name sortKey="Miller, Rs" uniqKey="Miller R">RS Miller</name>
</author>
<author>
<name sortKey="Thien, Hv" uniqKey="Thien H">HV Thien</name>
</author>
<author>
<name sortKey="Gonzalez, Jp" uniqKey="Gonzalez J">JP Gonzalez</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Paddock, Cd" uniqKey="Paddock C">CD Paddock</name>
</author>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Labruna, Mb" uniqKey="Labruna M">MB Labruna</name>
</author>
<author>
<name sortKey="Mediannikov, O" uniqKey="Mediannikov O">O Mediannikov</name>
</author>
<author>
<name sortKey="Kernif, T" uniqKey="Kernif T">T Kernif</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Kernif, T" uniqKey="Kernif T">T Kernif</name>
</author>
<author>
<name sortKey="Messaoudene, D" uniqKey="Messaoudene D">D Messaoudene</name>
</author>
<author>
<name sortKey="Ouahioune, S" uniqKey="Ouahioune S">S Ouahioune</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Matsumoto, K" uniqKey="Matsumoto K">K Matsumoto</name>
</author>
<author>
<name sortKey="Rolain, Jm" uniqKey="Rolain J">JM Rolain</name>
</author>
<author>
<name sortKey="Baziz, B" uniqKey="Baziz B">B Baziz</name>
</author>
<author>
<name sortKey="Boubidi, Sc" uniqKey="Boubidi S">SC Boubidi</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Djerbouh, A" uniqKey="Djerbouh A">A Djerbouh</name>
</author>
<author>
<name sortKey="Kernif, T" uniqKey="Kernif T">T Kernif</name>
</author>
<author>
<name sortKey="Beneldjouzi, A" uniqKey="Beneldjouzi A">A Beneldjouzi</name>
</author>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Kechemir, N" uniqKey="Kechemir N">N Kechemir</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
<author>
<name sortKey="Kernif, T" uniqKey="Kernif T">T Kernif</name>
</author>
<author>
<name sortKey="Harrat, Z" uniqKey="Harrat Z">Z Harrat</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="La, Sb" uniqKey="La S">SB La</name>
</author>
<author>
<name sortKey="Meconi, S" uniqKey="Meconi S">S Meconi</name>
</author>
<author>
<name sortKey="Fenollar, F" uniqKey="Fenollar F">F Fenollar</name>
</author>
<author>
<name sortKey="Rolain, Jm" uniqKey="Rolain J">JM Rolain</name>
</author>
<author>
<name sortKey="Roux, V" uniqKey="Roux V">V Roux</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Keita, Ak" uniqKey="Keita A">AK Keita</name>
</author>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Ahuka Mundeke, S" uniqKey="Ahuka Mundeke S">S Ahuka-Mundeke</name>
</author>
<author>
<name sortKey="Ratmanov, P" uniqKey="Ratmanov P">P Ratmanov</name>
</author>
<author>
<name sortKey="Butel, C" uniqKey="Butel C">C Butel</name>
</author>
<author>
<name sortKey="Ayouba, A" uniqKey="Ayouba A">A Ayouba</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Mediannikov, O" uniqKey="Mediannikov O">O Mediannikov</name>
</author>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Edouard, S" uniqKey="Edouard S">S Edouard</name>
</author>
<author>
<name sortKey="Fenollar, F" uniqKey="Fenollar F">F Fenollar</name>
</author>
<author>
<name sortKey="Mouffok, N" uniqKey="Mouffok N">N Mouffok</name>
</author>
<author>
<name sortKey="Bassene, H" uniqKey="Bassene H">H Bassene</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
<author>
<name sortKey="Baziz, B" uniqKey="Baziz B">B Baziz</name>
</author>
<author>
<name sortKey="Kernif, T" uniqKey="Kernif T">T Kernif</name>
</author>
<author>
<name sortKey="Harrat, Z" uniqKey="Harrat Z">Z Harrat</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="Raoult, D" uniqKey="Raoult D">D Raoult</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Bitam, I" uniqKey="Bitam I">I Bitam</name>
</author>
<author>
<name sortKey="Parola, P" uniqKey="Parola P">P Parola</name>
</author>
<author>
<name sortKey="De La Cruz, Kd" uniqKey="De La Cruz K">KD De La Cruz</name>
</author>
<author>
<name sortKey="Matsumoto, K" uniqKey="Matsumoto K">K Matsumoto</name>
</author>
<author>
<name sortKey="Baziz, B" uniqKey="Baziz B">B Baziz</name>
</author>
<author>
<name sortKey="Rolain, Jm" uniqKey="Rolain J">JM Rolain</name>
</author>
</analytic>
</biblStruct>
<biblStruct>
<analytic>
<author>
<name sortKey="Khaldi, M" uniqKey="Khaldi M">M Khaldi</name>
</author>
<author>
<name sortKey="Socolovschi, C" uniqKey="Socolovschi C">C Socolovschi</name>
</author>
<author>
<name sortKey="Benyettou, M" uniqKey="Benyettou M">M Benyettou</name>
</author>
<author>
<name sortKey="Barech, G" uniqKey="Barech G">G Barech</name>
</author>
<author>
<name sortKey="Biche, M" uniqKey="Biche M">M Biche</name>
</author>
<author>
<name sortKey="Kernif, T" uniqKey="Kernif T">T Kernif</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article">
<pmc-dir>properties open_access</pmc-dir>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Parasit Vectors</journal-id>
<journal-id journal-id-type="iso-abbrev">Parasit Vectors</journal-id>
<journal-title-group>
<journal-title>Parasites & Vectors</journal-title>
</journal-title-group>
<issn pub-type="epub">1756-3305</issn>
<publisher>
<publisher-name>BioMed Central</publisher-name>
<publisher-loc>London</publisher-loc>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="pmid">26791781</article-id>
<article-id pub-id-type="pmc">4721140</article-id>
<article-id pub-id-type="publisher-id">1316</article-id>
<article-id pub-id-type="doi">10.1186/s13071-016-1316-9</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Detection of
<italic>Bartonella tamiae, Coxiella burnetii</italic>
and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Leulmi</surname>
<given-names>Hamza</given-names>
</name>
<address>
<email>drleulmihamza@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Aouadi</surname>
<given-names>Atef</given-names>
</name>
<address>
<email>draouadiatef@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff3"></xref>
<xref ref-type="aff" rid="Aff4"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bitam</surname>
<given-names>Idir</given-names>
</name>
<address>
<email>idirbitam@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
<xref ref-type="aff" rid="Aff2"></xref>
<xref ref-type="aff" rid="Aff5"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bessas</surname>
<given-names>Amina</given-names>
</name>
<address>
<email>bsamina@outlook.com</email>
</address>
<xref ref-type="aff" rid="Aff2"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Benakhla</surname>
<given-names>Ahmed</given-names>
</name>
<address>
<email>benakhlaahmed@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff3"></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Raoult</surname>
<given-names>Didier</given-names>
</name>
<address>
<email>didier.raoult@gmail.com</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Parola</surname>
<given-names>Philippe</given-names>
</name>
<address>
<phone>33(0)491324375</phone>
<phone>33(0)491324375</phone>
<email>philippe.parola@univ-amu.fr</email>
</address>
<xref ref-type="aff" rid="Aff1"></xref>
</contrib>
<aff id="Aff1">
<label></label>
Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille, Cedex 5 France</aff>
<aff id="Aff2">
<label></label>
Ecole Nationale Supérieure Vétérinaire d’Alger. El Aliya Alger, Algiers, 16000 Algeria</aff>
<aff id="Aff3">
<label></label>
Département des Sciences Vétérinaires, Université Cherif Messaadia, Souk Ahras, 41000 Algeria</aff>
<aff id="Aff4">
<label></label>
Département des Sciences Vétérinaires, Université Chadli Bendjdid, El Tarf, 36000 Algeria</aff>
<aff id="Aff5">
<label></label>
Laboratoire d’Ecologie et Environnement: Interaction, Génome, Université de Bab Ezzouar, Bab Ezzouar, 16000 Algeria</aff>
</contrib-group>
<pub-date pub-type="epub">
<day>20</day>
<month>1</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="pmc-release">
<day>20</day>
<month>1</month>
<year>2016</year>
</pub-date>
<pub-date pub-type="collection">
<year>2016</year>
</pub-date>
<volume>9</volume>
<elocation-id>27</elocation-id>
<history>
<date date-type="received">
<day>25</day>
<month>6</month>
<year>2015</year>
</date>
<date date-type="accepted">
<day>15</day>
<month>1</month>
<year>2016</year>
</date>
</history>
<permissions>
<copyright-statement>© Leulmi et al. 2016</copyright-statement>
<license license-type="OpenAccess">
<license-p>
<bold>Open Access</bold>
This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">http://creativecommons.org/licenses/by/4.0/</ext-link>
), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">http://creativecommons.org/publicdomain/zero/1.0/</ext-link>
) applies to the data made available in this article, unless otherwise stated.</license-p>
</license>
</permissions>
<abstract id="Abs1">
<sec>
<title>Background</title>
<p>In recent years, the scope and importance of emergent vector-borne diseases has increased dramatically. In Algeria, only limited information is currently available concerning the presence and prevalence of these zoonotic diseases. For this reason, we conducted a survey of hematophagous ectoparasites of domestic mammals and/or spleens of wild animals in El Tarf and Souk Ahras, Algeria.</p>
</sec>
<sec>
<title>Methods</title>
<p>Using real-time PCR, standard PCR and sequencing, the presence of
<italic>Bartonella</italic>
spp.,
<italic>Rickettsia</italic>
spp.,
<italic>Borrelia</italic>
spp. and
<italic>Coxiella burnetii</italic>
was evaluated in 268/1626 ticks, 136 fleas, 11
<italic>Nycteribiidae</italic>
flies and 16 spleens of domestic and/or wild animals from the El Tarf and Souk Ahras areas.</p>
</sec>
<sec>
<title>Results</title>
<p>For the first time in Algeria,
<italic>Bartonella tamiae</italic>
was detected in 12/19 (63.2 %)
<italic>Ixodes vespertilionis</italic>
ticks, 8/11 (72.7 %)
<italic>Nycteribiidae</italic>
spp. flies and in 6/10 (60 %) bat spleens (
<italic>Chiroptera</italic>
spp.). DNA from
<italic>Coxiella burnetii</italic>
, the agent of Q fever, was also identified in 3/19 (15.8 %)
<italic>I. vespertilionis</italic>
from bats.
<italic>Rickettsia slovaca</italic>
, the agent of tick-borne lymphadenopathy, was detected in 1/1 (100 %)
<italic>Haemaphysalis punctata</italic>
and 2/3 (66.7 %)
<italic>Dermacentor marginatus</italic>
ticks collected from two boars (
<italic>Sus scrofa algira</italic>
) respectively.
<italic>Ri. massiliae</italic>
, an agent of spotted fever, was detected in 38/94 (40.4 %)
<italic>Rhipicephalus sanguineus</italic>
sensu lato collected from cattle, sheep, dogs, boars and jackals. DNA of
<italic>Ri. aeschlimannii</italic>
was detected in 6/20 (30 %)
<italic>Hyalomma anatolicum excavatum</italic>
and 6/20 (30 %)
<italic>Hy. scupense</italic>
from cattle. Finally,
<italic>Ri. felis</italic>
, an emerging rickettsial pathogen, was detected in 80/110 (72.7 %)
<italic>Archaeopsylla erinacei</italic>
and 2/2 (100 %)
<italic>Ctenocephalides felis</italic>
of hedgehogs (
<italic>Atelerix algirus</italic>
).</p>
</sec>
<sec>
<title>Conclusion</title>
<p>In this study, we expanded knowledge about the repertoire of ticks and flea-borne bacteria present in ectoparasites and/or tissues of domestic and wild animals in Algeria.</p>
</sec>
</abstract>
<kwd-group xml:lang="en">
<title>Keywords</title>
<kwd>
<italic>Bartonella tamiae</italic>
</kwd>
<kwd>
<italic>Rickettsia</italic>
</kwd>
<kwd>
<italic>Coxiella burnetii</italic>
</kwd>
<kwd>Ticks</kwd>
<kwd>Fleas</kwd>
<kwd>Algeria</kwd>
</kwd-group>
<funding-group>
<award-group>
<funding-source>
<institution>A*MIDEX</institution>
</funding-source>
<award-id>project (n° ANR-11-IDEX-0001-02) funded by the French Government’s “Investissements d’Avenir” program, managed by the French National Research Agency (ANR).</award-id>
<principal-award-recipient>
<name>
<surname>Parola</surname>
<given-names>Philippe</given-names>
</name>
</principal-award-recipient>
</award-group>
</funding-group>
<custom-meta-group>
<custom-meta>
<meta-name>issue-copyright-statement</meta-name>
<meta-value>© The Author(s) 2016</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="Sec1" sec-type="introduction">
<title>Background</title>
<p>Since the beginning of the 20th century, ticks (Acarina), fleas (Siphonaptera) and other hematophagous arthropods have been implicated as vectors, reservoirs, and/or amplifiers of agents of human zoonoses [
<xref ref-type="bibr" rid="CR1">1</xref>
]. Ticks are hematophagous arthropods that are considered second vectors (after mosquitoes) of human disease and the most significant vectors of disease-causing pathogens in animals [
<xref ref-type="bibr" rid="CR2">2</xref>
,
<xref ref-type="bibr" rid="CR3">3</xref>
]. Ticks can transmit a broad range of pathogens, including viruses, protozoa and bacteria [
<xref ref-type="bibr" rid="CR4">4</xref>
]. Likewise, fleas are also able to transmit several agents of infectious diseases [
<xref ref-type="bibr" rid="CR5">5</xref>
]. The transmission of these zoonotic agents to humans occurs mainly through their bites or inoculation of their infected feces into pruritic bite lesions [
<xref ref-type="bibr" rid="CR6">6</xref>
<xref ref-type="bibr" rid="CR9">9</xref>
]. Rickettsioses, bartonelloses and Q fever are vector-borne diseases that may be severe and that have a widespread geographical distribution.</p>
<p>
<italic>Rickettsia</italic>
spp., the etiological agent of rickettsioses, are intracellular Gram-negative bacteria that represent an emergent global threat [
<xref ref-type="bibr" rid="CR10">10</xref>
].
<italic>Ri. felis,</italic>
an emerging pathogen, and
<italic>Ri. typhi,</italic>
the agent of murine typhus (MT), are the main rickettsial pathogens associated with fleas [
<xref ref-type="bibr" rid="CR11">11</xref>
], belonging to the spotted fever group (SFG) [
<xref ref-type="bibr" rid="CR12">12</xref>
] and typhus group of rickettsiae, respectively [
<xref ref-type="bibr" rid="CR13">13</xref>
]. Most of the SFG are transmitted by ticks [
<xref ref-type="bibr" rid="CR14">14</xref>
] that are widely distributed in northern Africa [
<xref ref-type="bibr" rid="CR15">15</xref>
,
<xref ref-type="bibr" rid="CR16">16</xref>
]. In Algeria, 11 rickettsial pathogens have been detected in ticks, fleas, lice and humans, including
<italic>Ri. conorii</italic>
subspecies
<italic>conorii</italic>
,
<italic>Ri. aeschlimannii</italic>
,
<italic>Ri. sibirica mongolitimonae</italic>
,
<italic>Ri. massiliae</italic>
,
<italic>Ri. slovaca</italic>
,
<italic>Ri. helvetica</italic>
,
<italic>Ri. africae, Ri. monacensis, Ri. felis, Ri. typhi</italic>
and
<italic>Ri. prowazekii</italic>
[
<xref ref-type="bibr" rid="CR17">17</xref>
].</p>
<p>Likewise, bartonelloses are diseases caused by fastidious, hemotropic bacteria from the genus
<italic>Bartonella</italic>
[
<xref ref-type="bibr" rid="CR18">18</xref>
] which parasitize erythrocytes or epithelial cells across a range of mammalian hosts, including humans, rodents and chiroptera [
<xref ref-type="bibr" rid="CR19">19</xref>
<xref ref-type="bibr" rid="CR21">21</xref>
]. In Algeria, few investigations into the diversity of
<italic>Bartonella</italic>
spp
<italic>.</italic>
from animals and vectors have been conducted. Namely,
<italic>B. vinsonii</italic>
subsp.
<italic>berkhoffii</italic>
,
<italic>B. clarridgeiae</italic>
, and
<italic>B. elizabethae</italic>
were detected infecting domestic dogs [
<xref ref-type="bibr" rid="CR22">22</xref>
,
<xref ref-type="bibr" rid="CR23">23</xref>
] and fleas collected from hedgehogs [
<xref ref-type="bibr" rid="CR24">24</xref>
],
<italic>B. henselae</italic>
was isolated from stray cats [
<xref ref-type="bibr" rid="CR25">25</xref>
] and
<italic>B. rochalimae</italic>
was detected in fleas collected from brown rats (
<italic>Rattus norvegicus</italic>
) [
<xref ref-type="bibr" rid="CR24">24</xref>
].</p>
<p>In addition,
<italic>Coxiella burnetii</italic>
, the causative agent of Q fever, is a highly infectious zoonotic intracellular bacterium which can affect different species of wild and domestic mammals; it can also infect arthropods and birds [
<xref ref-type="bibr" rid="CR26">26</xref>
]. In Algeria few human cases of Q fever have been documented, with only two human cases reported in Oran [
<xref ref-type="bibr" rid="CR27">27</xref>
].</p>
<p>The goal of this investigation was to assess the presence of emerging zoonotic bacteria in ectoparasites and tissues sampled from wild and domestic animals present in northeastern Algeria.</p>
</sec>
<sec id="Sec2" sec-type="materials|methods">
<title>Methods</title>
<sec id="Sec3">
<title>Study areas</title>
<p>The first part of the study was conducted in May 2012 in El Ghorra (Bougous, El Tarf) (36° 39′ 34″ N 8° 22′ 10″ E) in the far northeast of Algeria. El Ghorra is a humid bioclimatic zone. It was the highest site in the study area, where the maximum altitude is 1202 m (Jebel El Ghorra). The relief of El Ghorra is characterized by a set of wooded mountains forming the “forest of El Ghorra”. Its coverage includes 96 % vegetation and 2 % herbaceous layer, of which 500 ha are occupied by cork oak (
<italic>Quercus suber</italic>
) and 600 ha by canary oak, locally known as zeen oak (
<italic>Quercus canariensis</italic>
) [
<xref ref-type="bibr" rid="CR28">28</xref>
].</p>
<p>The second part of this work was performed in July 2013, in Cheabat El Balout (Ouled Driss, Souk Ahras) in northeastern Algeria near El Tarf, (36° 22′ 01.30″ N 08° 07′ 27.48″ E). This study area is mountainous and is located at 1000 m above sea level, representing an extension of the Telli Atlas. It has a semi-humid climate characterized by hot summers and cold, wet winters with a rainfall averaging 800 mm per year.</p>
</sec>
<sec id="Sec4">
<title>Ectoparasite collection and tissue sampling</title>
<p>The investigation in El Ghorra (Bougous, El Tarf) was conducted on domestic animals (cattle, sheep, goats and dogs). Ectoparasites were collected with the permission of the animals’ owners. All arthropods were collected using blunted watchmakers forceps and immediately placed in tubes of 70 % ethanol labeled with the identification number and the date of collection. A portion of the collected ectoparasites was used for the present study.</p>
<p>The field sampling in Cheabat El Balout (Ouled Driss, Souk Ahras) was conducted on wild mammals [two boars (
<italic>Sus scrofa algira</italic>
), two jackals (
<italic>Canis aureus</italic>
) one mongoose (
<italic>Echinomon herpestis</italic>
), ten bats (
<italic>Chiroptera</italic>
spp.), one porcupine (
<italic>Hystrix cristata</italic>
) and four hedgehogs (
<italic>Atelerix algirus</italic>
)]. Ectoparasites and tissues (spleens) were sampled. Hedgehogs were captured with the aid of flashlights during nightly walks through parts of the study regions near a poultry slaughterhouse. Hedgehogs were anesthetized using ketamine and released into their natural habitat after full recovery of ectoparasites.</p>
<p>Two boars, two jackals, one mongoose and one porcupine were found recently dead following road accidents and were also inspected for ectoparasites, and their spleens were sampled using adapted scalpels and stored in tubes containing 70 % ethanol. Finally, we caught ten bats using hunting nets. The nets, identical to those used by ornithologists to capture and band birds, are very fine, and similar to a mesh-like fishing net. They are stretched between two poles, and placed at the entrance of the bat cave. Once detached from the nets, we searched for ectoparasites and took spleen samples.</p>
<p>All biological materials were forwarded thereafter to Marseille, France for morphological identification of ectoparasites at the species level using morphological criteria within standard taxonomic keys [
<xref ref-type="bibr" rid="CR29">29</xref>
,
<xref ref-type="bibr" rid="CR30">30</xref>
]. Molecular analyses of ectoparasites and tissue samples were performed to detect
<italic>Rickettsia</italic>
spp.,
<italic>Bartonella</italic>
spp.
<italic>, Coxiella burnetii</italic>
and
<italic>Borrelia</italic>
spp.</p>
</sec>
<sec id="Sec5">
<title>Ethical approval</title>
<p>The study on hedgehogs was authorized by the local ethics committee and by national legislation (le journal officiel n° 47 du 19 juillet 2006,
<ext-link ext-link-type="uri" xlink:href="http://www.iucnredlist.org/apps/redlist/details/27926/0">http://www.iucnredlist.org/apps/redlist/details/27926/0</ext-link>
). Oral permission to place nets to trap bats in the study area was granted by the landowner, who placed his pets inside the cave in the rainy days. At the beginning of the study, the work on bats was programmed only on bats ectoparasites and when bats were recovered the next day, they were dead, that because we proceeded bats spleen also. In addition Algeria does not have ethical committee of bats. All experiments were done under the supervision of the Ministry of Health of Algeria.</p>
</sec>
<sec id="Sec6">
<title>DNA extraction</title>
<p>Prior to DNA extraction, a convenient sample was selected according to a good representation of species and hosts in El Ghorra (samples < 20 were all processed while for samples > 20 only 20 samples were processed). All collected ectoparasites and biological materials from Cheabat El Balout were used to extract their DNA.</p>
<p>Arthropods and spleens were rinsed twice in distilled water for 10 min and dried on sterile filter paper; handling was performed in a laminar flow biosafety cabinet. Ectoparasites and a portion of the spleen samples were individually crushed in sterile Eppendorf tubes. Total DNA was extracted in a final volume of 200 μl from one half of each ectoparasite and a portion of the spleen using the QIAamp Tissue Kit (Qiagen, Hilden, Germany) by Qiagen-BioRobot EZ1, according to the manufacturer’s instructions. Genomic DNA was stored at −22 °C under sterile conditions.</p>
</sec>
<sec id="Sec7">
<title>Detection of bacteria</title>
<p>Once DNA had been extracted, it was used in qPCR template assays to detect
<italic>Bartonella</italic>
spp.,
<italic>Rickettsia</italic>
spp.,
<italic>Coxiella burnetii</italic>
and
<italic>Borrelia</italic>
spp. The final qPCR reaction mixture consisted of 5 μl of DNA and 15 μl of mix from the Takyon PCR Kit (Qiagen, Hilden, Germany) as described [
<xref ref-type="bibr" rid="CR31">31</xref>
]. Negative controls were used in each qPCR and consisted of DNA extracted from uninfected ticks from our laboratory colony. Positive controls included DNA extracted from a dilution of cultured strains of
<italic>B. elizabethae</italic>
(detection of
<italic>Bartonella</italic>
spp.),
<italic>Ri. montanensis</italic>
(for the detection of
<italic>Rickettsia</italic>
spp.),
<italic>Coxiella burnetii</italic>
(for the detection of
<italic>Coxiella burnetii</italic>
) and
<italic>Borrelia crocidurae</italic>
(for the detection of
<italic>Borrelia</italic>
spp.). Results were deemed positive if the Cycle threshold (Ct) value obtained by CFX96 was lower than 36. All positive results were confirmed with a second qPCR system and/or sequence reaction.</p>
</sec>
<sec id="Sec8">
<title>Detection of
<italic>Bartonella</italic>
spp.</title>
<p>DNA samples were screened by qPCR targeting the ITS for the detection of
<italic>Bartonella</italic>
spp. [
<xref ref-type="bibr" rid="CR32">32</xref>
]. The positive samples with ITS primers were then confirmed by standard PCR performed with
<italic>Bartonella-</italic>
specific primers of the intergenic spacer region between the 16S and 23S rRNA genes [
<xref ref-type="bibr" rid="CR33">33</xref>
]. PCR amplification success was verified by migration in 2 % Agarose gel, followed by purification using the NucleoFast 96 PCR plate (Machery-Nagel EURL, France), as recommended by the manufacturer. The purified PCR products were sequenced using Urb1 and Urb2 primers and using BigDye version 1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems, Foster City, CA). Data were collected with an ABI Prism 3130xl Genetic Analyzer capillary sequencer (ABI PRISM, PE Applied Biosystems, USA). Sequences were edited and assembled using Chromas Pro 1.34 (Technelysium Pty. Ltd., Tewantin, Australia). BLAST searches were performed to identify the obtained sequences.</p>
</sec>
<sec id="Sec9">
<title>Detection of
<italic>Rickettsia</italic>
spp.</title>
<p>Rickettsial DNA was detected using a Rickettsia genus-specific qPCR with a 25-bp probe targeting the partial sequence of the citrate synthase gene (
<italic>gltA</italic>
) [
<xref ref-type="bibr" rid="CR34">34</xref>
]. All tick samples identified as positive by qPCR were confirmed by a different standard PCR and sequencing for the fragments of
<italic>OmpA</italic>
gene [
<xref ref-type="bibr" rid="CR34">34</xref>
]. DNA sequencing reactions were performed on highly positive samples (Ct <28). Tick samples with Ct > 28 were screened by qPCR specific to the species according to the sequencing result using
<italic>Ri. slovaca</italic>
,
<italic>Ri. massiliae</italic>
or
<italic>Ri. aeschlimannii</italic>
qPCRs systems (Table 
<xref rid="Tab1" ref-type="table">1</xref>
), while flea samples testing positive with the RKND03 qPCR were directly tested with two qPCRs systems targeting the biotin synthase (
<italic>bioB</italic>
) and membrane phosphatase genes of
<italic>Ri. felis</italic>
[
<xref ref-type="bibr" rid="CR35">35</xref>
]. Table 
<xref rid="Tab1" ref-type="table">1</xref>
summarizes the probes and primers used to confirm and identify rickettsiae in samples.
<table-wrap id="Tab1">
<label>Table 1</label>
<caption>
<p>Target sequences, primers and probes used to confirm the detection of rickettsiae by qPCR</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Quantitative real-time PCR designation and specificity</th>
<th>qPCR Sytem used</th>
<th>Forward primer</th>
<th>Reverse primer</th>
<th>Probe</th>
</tr>
</thead>
<tbody>
<tr>
<td>
<italic>Rickettsia felis</italic>
</td>
<td>Biotin synthase</td>
<td>ATG-TTC-GGG-CTTCCG-GTA-TG</td>
<td>CCG-ATT-CAG-CAGGTT-CTT-CAA</td>
<td>6-FAM- GCT-GCG-GCGGTA-TTT-TAG-GAA -TGGG-TAMRA</td>
</tr>
<tr>
<td>
<italic>Rickettsia aeschlimannii</italic>
</td>
<td>Scal</td>
<td>AAGCGGCACTTTAGGTAAAGAAA</td>
<td>CATGCTCTGCAAATGAACCA</td>
<td>6FAM-TGGGGAAATATGCCGTATACGCAAGC -TAMRA</td>
</tr>
<tr>
<td>
<italic>Rickettsia massiliae</italic>
</td>
<td>R.mass_9666</td>
<td>CCAACCTTTTGTTGTTGCAC</td>
<td>TTGGATCAGTGTGACGGACT</td>
<td>6FAM-CACGTGCTGCTTATACCAGCAAACA -TAMRA</td>
</tr>
<tr>
<td>
<italic>Rickettsia slovaca</italic>
</td>
<td>R.slov</td>
<td>GCAACGGTTTTTGGTATCGT</td>
<td>AATCGAATGCACCACCACTT</td>
<td>6FAM- TCCCGTCCCAGCCATTCGTC -TAMRA</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
</sec>
<sec id="Sec10">
<title>Detection of
<italic>Borrelia</italic>
spp.</title>
<p>qPCR targeting the 16S rRNA gene was used, as described elsewhere [
<xref ref-type="bibr" rid="CR34">34</xref>
], to screen DNA samples for all
<italic>Borrelia</italic>
spp.</p>
</sec>
<sec id="Sec11">
<title>Detection of
<italic>Coxiella burnetii</italic>
</title>
<p>
<italic>Coxiella burnetii</italic>
bacterial DNA was initially detected by qPCR with
<italic>C. burnetii</italic>
–specific primers and a probe designed to amplify the IS1111 gene [
<xref ref-type="bibr" rid="CR36">36</xref>
]. qPCR with primers and a probe designed for the amplification of IS30a spacers were used to confirm
<italic>C. burnetii</italic>
–positive results [
<xref ref-type="bibr" rid="CR27">27</xref>
].</p>
</sec>
</sec>
<sec id="Sec12" sec-type="results">
<title>Results</title>
<sec id="Sec13">
<title>Sample collection and ectoparasites identification</title>
<p>In El Ghorra, a total of 1549 ticks (Table 
<xref rid="Tab2" ref-type="table">2</xref>
) were collected, including eight species; 565 ticks were sampled from 123 cattle, 529 ticks from 250 sheep, 130 ticks were collected from 125 goats and 325 ticks were sampled from 50 dogs.
<table-wrap id="Tab2">
<label>Table 2</label>
<caption>
<p>Detection of Rickettsiae,
<italic>Bartonella</italic>
spp., and
<italic>Coxiella burnetii</italic>
in arthropods</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th>Ectoparasite species</th>
<th>Localization</th>
<th>Animal (N)</th>
<th>No. of ectoparasites collected (m = male, f = female)</th>
<th>No. of ectoparasites tested by qPCR (m = male, f = female)</th>
<th>
<italic>Rickettsia spp</italic>
</th>
<th>
<italic>Bartonella spp</italic>
</th>
<th>
<italic>Coxiella burnetii</italic>
</th>
</tr>
</thead>
<tbody>
<tr>
<td rowspan="8">
<italic>Rhipicephalus sanguineus</italic>
</td>
<td rowspan="4">El Ghorra, El Tarf.</td>
<td>Cattle (123)</td>
<td>316 (104 m, 212f)</td>
<td>20 (10 m, 10f)</td>
<td>3/20 (1 m, 2f)
<italic>Ri. massiliae</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Sheep (250)</td>
<td>454 (217 m, 237f)</td>
<td>20 (10 m, 10f)</td>
<td>11/20 (9 m, 2f)
<italic>Ri. massiliae</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Goats (128)</td>
<td>104 (55 m, 49f)</td>
<td>20 (10 m, 10f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Dogs (50)</td>
<td>323 (222 m, 101f)</td>
<td>20 (10 m, 10f)</td>
<td>1/20 (1 m)
<italic>Ri. massiliae</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td rowspan="4">Cheabat El Balout, Souk Ahras</td>
<td>Boars (2)</td>
<td>9 (5 m, 4f)</td>
<td>9 (5 m, 4f)</td>
<td>8/9 (5 m, 3f)
<italic>Ri. massiliae</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Mangoose (1)</td>
<td>2 (1 m, 1f)</td>
<td>2 (1 m, 1f)</td>
<td>2/2 (1 m, 1f)
<italic>Ri. massiliae</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Jackals (2)</td>
<td>23 (15 m, 8f)</td>
<td>23(15 m, 8f)</td>
<td>13/23(8 m, 5f)
<italic>Ri. massiliae</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Hedgehogs (4)</td>
<td>10 (2 m, 8f)</td>
<td>10(2 m, 8f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td rowspan="3">
<italic>Rhipicephalus bursa</italic>
</td>
<td rowspan="3">El Ghorra, El Tarf.</td>
<td>Cattle (123)</td>
<td>50 (39 m, 11f)</td>
<td>20 (10 m, 10f)</td>
<td>2/20 (2f)
<italic>Ri. massiliae</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Sheep (250)</td>
<td>72 (37 m, 35f)</td>
<td>20 (10 m, 10f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Goats (128)</td>
<td>19 (19 m)</td>
<td>19 (19 m)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td rowspan="2">
<italic>Hyalomma lusitanicum</italic>
</td>
<td rowspan="2">El Ghorra, El Tarf.</td>
<td>Sheep (250)</td>
<td>1 (1 m)</td>
<td>1 (1 m)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Goats (128)</td>
<td>3 (2 m, 1f)</td>
<td>3 (2 m, 1f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td rowspan="2">
<italic>Hyalomma scupense</italic>
</td>
<td rowspan="2">El Ghorra, El Tarf.</td>
<td>Cattle (123)</td>
<td>94 (41 m, 53f)</td>
<td>20 (10 m, 10f)</td>
<td>6/20 (2 m, 4f)
<italic>Ri. aeschlimannii</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Sheep (250)</td>
<td>1 (1f)</td>
<td>1 (1f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>
<italic>Hyalomma anatolicum excavatum</italic>
</td>
<td>El Ghorra, El Tarf.</td>
<td>Cattle (123)</td>
<td>105 (54 m, 51f)</td>
<td>20 (10 m, 10f)</td>
<td>6/20 (4 m, 2f)
<italic>Ri. aeschlimannii</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>
<italic>Hyalomma marginatum</italic>
</td>
<td>El Ghorra, El Tarf.</td>
<td>Goats (128)</td>
<td>4 (4f)</td>
<td>4 (4f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td rowspan="2">
<italic>Ixodes ricinus</italic>
</td>
<td>El Ghorra, El Tarf.</td>
<td>Sheep (250)</td>
<td>1 (1 m)</td>
<td>1 (1 m)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Mongoose (1)</td>
<td>1 (1 m)</td>
<td>1 (1 m)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td rowspan="2">
<italic>Ixodes hexagonus</italic>
</td>
<td>El Ghorra, El Tarf.</td>
<td>Dogs (50)</td>
<td>2 (2f)</td>
<td>2 (2f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Hedgehogs (4)</td>
<td>9 (1 m, 8f)</td>
<td>9 (1 m, 8f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>
<italic>Dermacentor marginatus</italic>
</td>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Boars (2)</td>
<td>3 (3f)</td>
<td>3 (3f)</td>
<td>2/3 (2f)
<italic>Ri. slovaca</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>
<italic>Haemaphysalis punctata</italic>
</td>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Boars (2)</td>
<td>1 (1f)</td>
<td>1 (1f)</td>
<td>1/1 (1f)
<italic>Ri. slovaca</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>
<italic>Ixodes vespertilionis</italic>
</td>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Bats (10)</td>
<td>19 (2f, 17 nymphs)</td>
<td>19 (2f, 17 nymphs)</td>
<td>-</td>
<td>12/19 (1f, 11 nymphs)
<italic>B. tamiae</italic>
</td>
<td>3/19 (2f, 1 nymph)</td>
</tr>
<tr>
<td>
<italic>Ischnopsyllus intermedius</italic>
</td>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Bats (10)</td>
<td>3 (3f)</td>
<td>3 (3f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>
<italic>Ctencephalides felis</italic>
</td>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Hedgehogs (4)</td>
<td>2 (2f)</td>
<td>2 (2f)</td>
<td>2/2 (2f)
<italic>Ri. felis</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>
<italic>Pariodontis riggenbachi</italic>
</td>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Porcupine (1)</td>
<td>21 (3 m, 18f)</td>
<td>21 (3 m, 18f)</td>
<td>-</td>
<td>-</td>
<td>-</td>
</tr>
<tr>
<td>
<italic>Nycteribiidae</italic>
</td>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Bats (10)</td>
<td>11(5 m, 6f)</td>
<td>11(5 m, 6f)</td>
<td>-</td>
<td>8/11
<italic>B. tamiae</italic>
</td>
<td>-</td>
</tr>
<tr>
<td>
<italic>Archaeopsylla erinacei</italic>
</td>
<td>Cheabat El Balout, Souk Ahras</td>
<td>Hedgehogs (4)</td>
<td>110 (39 m, 71f)</td>
<td>110 (39 m, 71f)</td>
<td>80/110 (19 m, 61f)
<italic>Ri. felis</italic>
</td>
<td>-</td>
<td>-</td>
</tr>
</tbody>
</table>
</table-wrap>
</p>
<p>For the investigation on wild animals and their ectoparasites in Cheabat El Balout, 77 ticks, 136 fleas, 11
<italic>Nycteribiidae</italic>
(Table 
<xref rid="Tab2" ref-type="table">2</xref>
) and 16 spleens were sampled (two spleens from boars, one from a mongoose, two from jackals, one from a porcupine and 10 from bats).</p>
</sec>
<sec id="Sec14">
<title>Detection of
<italic>Bartonella</italic>
spp.</title>
<p>All the selected 191 ticks of El Ghorra (Table 
<xref rid="Tab2" ref-type="table">2</xref>
) tested negative for
<italic>Bartonella</italic>
spp. However, out of all ticks, fleas,
<italic>Nycteribiidae</italic>
and spleen portions, 26 samples collected from bats were positive, including 12/19 (63.2 %) of
<italic>I. vespertilionis</italic>
ticks, 8/11 (72.7 %)
<italic>Nycteribiidae</italic>
flies and 6/10 (60 %) spleens. The results showed that all sequences of
<italic>Bartonella</italic>
spp. detected in ectoparasites and bat spleens were similar to the sequence of
<italic>B. tamiae</italic>
(100 % similarity with the
<italic>Bartonella tamiae</italic>
strain Th339 16S-23S ribosomal RNA intergenic spacer, partial sequence, GenBank no EF605284.1, 451/451 bp).</p>
</sec>
<sec id="Sec15">
<title>Detection of
<italic>Rickettsia</italic>
spp.</title>
<p>In El Ghorra, 29/191 (15.2 %) of ticks tested positive for
<italic>Rickettsia</italic>
spp. by qPCR. These included 15/29 (51.7 %)
<italic>R. sanguineus</italic>
sensu lato, 2/29 (6.9 %)
<italic>R. bursa,</italic>
6/29 (20.7 %)
<italic>Hy. scupense</italic>
and 6/29 (20.7 %)
<italic>Hy. a. excavatum</italic>
. Concerning the 15
<italic>R. sanguineus</italic>
sensu lato that were
<italic>Rickettsia</italic>
spp.-positive, 3 were collected from cattle, 11 from sheep and 1 from dogs. The two
<italic>R. bursa</italic>
were sampled from cattleas well as all six
<italic>Hy. scupense</italic>
. Finally, the 6
<italic>Hy. a. excavatum</italic>
were sampled from goats. DNA sequence analyses of the PCR products targeting
<italic>OmpA</italic>
on the
<italic>R. sanguineus</italic>
sensu lato and
<italic>R. bursa</italic>
ticks showed 100 % similarity with
<italic>Rickettsia massiliae</italic>
(GenBank accession no. U43793.1), regardless of the host’s tick type. In addition, the sequencing of the
<italic>OmpA</italic>
gene fragment from the positive
<italic>Hy. scupense</italic>
and
<italic>Hy. a. excavatum</italic>
showed 100 % similarity with
<italic>Rickettsia aeschlimannii</italic>
strain EgyRickHimp-El-Arish-17 outer membrane protein A (
<italic>OmpA</italic>
) gene, partial cds (GenBank accession no. HQ335158.1, 633/633 bp).</p>
<p>In Cheabat el Balout, the RKND03 qPCR system was used to test the 77 ticks, 136 fleas, 11
<italic>Nycteribiidae</italic>
flies and 16 spleens sampled from wild animals. Overall, we detected DNA from
<italic>Rickettsia</italic>
spp. in three ticks from boars (two
<italic>D. marginatus</italic>
and one
<italic>Hae. punctata</italic>
), in 80
<italic>A. erinacei</italic>
and two
<italic>C. felis</italic>
fleas from hedgehogs. The DNA sequence of the two rickettsia-positive
<italic>D. marginatus</italic>
and
<italic>Hae. punctata</italic>
showed 100 % similarity with
<italic>Rickettsia slovaca</italic>
strain WB2/Dm Pavullo outer membrane protein A (
<italic>OmpA</italic>
) gene, partial cds GenBank accession no. HM161787.1, 633/633 bp). Concerning the 80
<italic>A. erinacei</italic>
and 2
<italic>C. felis</italic>
of hedgehogs positive for
<italic>Rickettsia</italic>
spp, all 82 fleas were positive for
<italic>Ri. felis</italic>
(Table 
<xref rid="Tab2" ref-type="table">2</xref>
).</p>
</sec>
<sec id="Sec16">
<title>Detection of
<italic>Coxiella burnetii</italic>
</title>
<p>In El Ghorra, all the 191 screened ticks were negative, however in Cheabat el Balout, we detected DNA from
<italic>C. burnetii</italic>
in three
<italic>I. vespertilionis</italic>
of bats. We confirmed the result using the second qPCR system (Table 
<xref rid="Tab2" ref-type="table">2</xref>
).</p>
</sec>
<sec id="Sec17">
<title>Detection of
<italic>Borrelia</italic>
spp.</title>
<p>All tested samples were negative for
<italic>Borrelia</italic>
spp. using the 16S qPCR system from the
<italic>Borrelia</italic>
genus.</p>
</sec>
</sec>
<sec id="Sec18" sec-type="discussion">
<title>Discussion</title>
<p>This investigation reports the first direct evidence of DNA from
<italic>B. tamiae</italic>
in
<italic>I. vespertilionis</italic>
,
<italic>Nycteribiidae</italic>
and bat spleens in Algeria. The association between the DNA from
<italic>Ri. slovaca</italic>
and
<italic>Hae. punctata</italic>
from boars and also between
<italic>Ri. massiliae</italic>
and
<italic>R. bursa</italic>
from cattle are reported for the first time in Algeria. Other rickettsiae were detected in this field as previously detected in Algeria, namely
<italic>Ri. massiliae</italic>
in
<italic>R. sanguineus</italic>
sensu lato,
<italic>Ri. aeschlimannii</italic>
in
<italic>Hyalomma</italic>
spp. ticks and
<italic>Ri. felis</italic>
in
<italic>A. erinacei</italic>
and in
<italic>C. felis</italic>
fleas. Using molecular tools
<italic>C. burnetii</italic>
, the agent of Q fever, was also detected in
<italic>I. vespertilionis</italic>
ticks of bat. Since ticks were removed from animals that in some cases could have been bacteremic, the ticks can be vectors for some pathogens but also only carriers in other cases. As a consequence, we cannot consider the presence of bacteria in the ectoparasite as proof of vector competence.</p>
<p>Bartonella-associated illnesses occur worldwide, and they encompass a broad clinical spectrum, including fever, skin lesions, endocarditis, lymphadenopathy, and abnormalities of the central nervous system, eye, liver and bone tissues [
<xref ref-type="bibr" rid="CR37">37</xref>
].
<italic>Bartonella tamiae</italic>
is a newly described bacterial species, initially isolated from the blood of three hospitalized patients in Thailand [
<xref ref-type="bibr" rid="CR33">33</xref>
]. These patients presented with headache, myalgia, anemia, and mild liver function abnormalities [
<xref ref-type="bibr" rid="CR38">38</xref>
]. This novel
<italic>Bartonella</italic>
species has been newly recognized as a pathogen [
<xref ref-type="bibr" rid="CR33">33</xref>
,
<xref ref-type="bibr" rid="CR39">39</xref>
]. Throughout our investigation,
<italic>B. tamiae</italic>
was detected for the first time in Algeria, and in ticks,
<italic>Nycteribiidae</italic>
and bat spleens. Bats are the second species group of mammals after rodents confirmed to carry
<italic>Bartonella</italic>
spp. [
<xref ref-type="bibr" rid="CR40">40</xref>
]. Renewed interest in
<italic>Bartonella</italic>
research in mammals has confirmed the presence of
<italic>Bartonella</italic>
spp. in bats in Guatemala, Kenya [
<xref ref-type="bibr" rid="CR41">41</xref>
] and the United Kingdom [
<xref ref-type="bibr" rid="CR42">42</xref>
].</p>
<p>
<italic>C. burnetii</italic>
was also detected in this study; this pathogenic agent of Q fever is associated with many manifestations [
<xref ref-type="bibr" rid="CR26">26</xref>
,
<xref ref-type="bibr" rid="CR43">43</xref>
]. Q fever is typically an acute febrile illness with nonspecific clinical signs in humans, but isolated fever, hepatitis and/or atypical pneumonia are the most commonly described manifestations. A small proportion of infected people develop life-threatening valvular endocarditis [
<xref ref-type="bibr" rid="CR26">26</xref>
,
<xref ref-type="bibr" rid="CR43">43</xref>
]. Q fever has been described worldwide in outbreaks involving sheep, goats, cats, dogs and wild animals, while reservoirs are extensive but only partially known and include mammals, birds, and arthropods, mainly ticks [
<xref ref-type="bibr" rid="CR44">44</xref>
]. In Algeria, few human cases have been reported, including one in 2005, where two patients were found to be seropositive for
<italic>C. burnetii</italic>
(one was confirmed positive by nested PCR) [
<xref ref-type="bibr" rid="CR45">45</xref>
]. In 2012, through 268 qPCR-tested samples from Oran, Western Algeria, only one patient was positive for
<italic>C. burnetii</italic>
[
<xref ref-type="bibr" rid="CR27">27</xref>
].</p>
<p>
<italic>B. tamiae</italic>
and
<italic>C. burnetii</italic>
were detected in
<italic>I. vespertilionis</italic>
. This tick species parasitizes bats specifically [
<xref ref-type="bibr" rid="CR46">46</xref>
,
<xref ref-type="bibr" rid="CR47">47</xref>
]. Humans can also act as accidental hosts [
<xref ref-type="bibr" rid="CR48">48</xref>
].
<italic>I. vespertilionis</italic>
represents little interest for human health because it is restricted to the darkest part of bat caves [
<xref ref-type="bibr" rid="CR49">49</xref>
]. In literature, no evidence was found to prove that this species can transmit pathogens to humans or other animals [
<xref ref-type="bibr" rid="CR49">49</xref>
]. We detected
<italic>Ri. slovaca</italic>
in ticks from boars, namely in
<italic>Hae. punctata</italic>
and
<italic>D. marginatus</italic>
. Our detection of
<italic>Ri. slovaca</italic>
in
<italic>Hae. punctata</italic>
ticks may be due to co-feeding with infected
<italic>D. marginatus</italic>
, which is a recognized vector and reservoir of the bacteria. Literature reported also the possibility of transmission to other tick species by feeding on bacteremic animals, as is the case of
<italic>Ri. slovaca</italic>
[
<xref ref-type="bibr" rid="CR50">50</xref>
].
<italic>Ri. slovaca</italic>
is associated with a syndrome characterized by scalp eschar and neck lymphadenopathy following tick bites [
<xref ref-type="bibr" rid="CR51">51</xref>
]. In Algeria,
<italic>Ri. slovaca</italic>
was previously detected in
<italic>D. marginatus</italic>
ticks collected from vegetation in the Blida region, in 2012 [
<xref ref-type="bibr" rid="CR52">52</xref>
].</p>
<p>In Algeria,
<italic>Ri. massiliae</italic>
was detected in
<italic>R. turanicus,</italic>
in 2006 [
<xref ref-type="bibr" rid="CR53">53</xref>
]. Our results confirm the presence of
<italic>Ri. massiliae</italic>
in Algerian ticks, where we detected it in
<italic>R. sanguineus</italic>
sensu lato from cattle, sheep, dogs and boars. Using qPCR, it was also detected in
<italic>R. bursa</italic>
from cattle. These SFG rickettsiae were described in 1992, and then subsequently detected in other
<italic>Rhipicephalus</italic>
spp., including
<italic>R. bursa</italic>
in European countries [
<xref ref-type="bibr" rid="CR51">51</xref>
].</p>
<p>Our results indicate the presence of
<italic>Ri. aeschlimannii</italic>
in
<italic>Hy. a. excavatum</italic>
and
<italic>Hy. scupense</italic>
ticks from cattle in the far northeast of Algeria.
<italic>Ri. aeschlimannii</italic>
is an emerging pathogen that causes symptoms similar to those of Mediterranean spotted fever [
<xref ref-type="bibr" rid="CR51">51</xref>
]. It has been associated with ticks, particularly with
<italic>Hy. marginatum</italic>
and
<italic>Hy. rufipes</italic>
ticks, in southern Europe and Africa [
<xref ref-type="bibr" rid="CR51">51</xref>
].</p>
<p>In Algeria,
<italic>Ri. aeschlimannii</italic>
was previously detected in
<italic>Hy. dromedarii</italic>
and
<italic>Hy. rufipes</italic>
from camels from southern Algeria [
<xref ref-type="bibr" rid="CR54">54</xref>
] and
<italic>Hy. aegyptium</italic>
ticks from tortoises trapped near Algiers [
<xref ref-type="bibr" rid="CR55">55</xref>
]. Our results confirm the presence of
<italic>Ri. aeschlimannii</italic>
in Algeria but also complete the geographical distribution of this pathogen from the south and center to the far northeast.</p>
<p>Finally, we detected DNA from
<italic>Ri. felis</italic>
in hedgehog fleas (
<italic>Ct. felis and A. erinacei</italic>
).
<italic>Ri. felis</italic>
is an emergent agent of infectious diseases in humans, and this SFG agent is known to be maintained in cat fleas (
<italic>Ct. felis</italic>
) [
<xref ref-type="bibr" rid="CR56">56</xref>
,
<xref ref-type="bibr" rid="CR57">57</xref>
]. To date, 12 flea species, eight tick species and three mite species have been found to be infected with
<italic>Ri. felis</italic>
[
<xref ref-type="bibr" rid="CR57">57</xref>
]. These rickettsiae have also recently been detected in several mosquito species in sub-Saharan Africa [
<xref ref-type="bibr" rid="CR31">31</xref>
,
<xref ref-type="bibr" rid="CR58">58</xref>
,
<xref ref-type="bibr" rid="CR59">59</xref>
]. Clinical features may include fever, fatigue, headache, generalized maculopapular rash and inoculation eschar(s) [
<xref ref-type="bibr" rid="CR57">57</xref>
]. It is known to be a frequent agent of fever of unknown origin [
<xref ref-type="bibr" rid="CR60">60</xref>
]. In Algeria
<italic>Ri. felis</italic>
was previously detected in
<italic>A. erinacei</italic>
fleas of hedgehogs of M’sila and Bordj-Bou-Arreridj, Algeria [
<xref ref-type="bibr" rid="CR61">61</xref>
,
<xref ref-type="bibr" rid="CR62">62</xref>
]. It was also detected in
<italic>Ct. canis</italic>
[
<xref ref-type="bibr" rid="CR60">60</xref>
]. Here, we report for the first time the presence of
<italic>Ri. felis</italic>
in
<italic>Ct. felis</italic>
fleas from Algeria.</p>
</sec>
<sec id="Sec19" sec-type="conclusion">
<title>Conclusion</title>
<p>For the first time in Algeria, we detected
<italic>B. tamiae</italic>
,
<italic>Coxiella burnetii</italic>
and rickettsiae (
<italic>Ri. slovaca, Ri. massiliae, Ri. aeschlimannii</italic>
and
<italic>Ri. felis</italic>
) in two regions of the far northeast of Algeria. We expanded knowledge of the repertoire of ticks and flea-borne bacteria present in ectoparasites and/or tissues of domestic and wild animals in Algeria. Our findings will help human and veterinary clinicians to enlarge the spectrum of pathogens to consider in differential diagnosis. Future studies on rickettsioses, bartonelloses and other vector-borne diseases should be performed to assess their epidemiological and clinical relevance in Algeria, to estimate the actual prevalence and to allow the establishment of anti-vector control plans.</p>
</sec>
</body>
<back>
<fn-group>
<fn>
<p>
<bold>Competing interests</bold>
</p>
<p>The authors declare that they have no competing interests.</p>
</fn>
<fn>
<p>
<bold>Authors’ contributions</bold>
</p>
<p>HL contributed to arthropod collections (first part), performed DNA extractions, qPCRs, sequencing and created the first draft of the paper. AA contributed to arthropod collections (second part) and preparation of the manuscript. IB analyzed the data, coordinated the study and identified the arthropods. ABES contributed to the preparation of the manuscript. ABEN contributed to creating, designing and coordinating the study. DR contributed reagents/materials/analysis tools and analyzed the data. PP created, designed and coordinated the experiment. All authors read and approved the final manuscript.</p>
</fn>
</fn-group>
<ack>
<title>Acknowledgements</title>
<p>This work was carried out thanks to the support of the A*MIDEX project (n° ANR-11-IDEX-0001-02) funded by the French Government’s “Investissements d’Avenir” program, managed by the French National Research Agency (ANR).</p>
</ack>
<ref-list id="Bib1">
<title>References</title>
<ref id="CR1">
<label>1.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Paddock</surname>
<given-names>CD</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Tick-borne rickettsioses around the world: emerging diseases challenging old concepts</article-title>
<source>Clin Microbiol Rev</source>
<year>2005</year>
<volume>18</volume>
<fpage>719</fpage>
<lpage>56</lpage>
<pub-id pub-id-type="doi">10.1128/CMR.18.4.719-756.2005</pub-id>
<pub-id pub-id-type="pmid">16223955</pub-id>
</element-citation>
</ref>
<ref id="CR2">
<label>2.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Ticks and tickborne bacterial diseases in humans: an emerging infectious threat</article-title>
<source>Clin Infect Dis</source>
<year>2001</year>
<volume>32</volume>
<fpage>897</fpage>
<lpage>928</lpage>
<pub-id pub-id-type="doi">10.1086/319347</pub-id>
<pub-id pub-id-type="pmid">11247714</pub-id>
</element-citation>
</ref>
<ref id="CR3">
<label>3.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mediannikov</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Fenollar</surname>
<given-names>F</given-names>
</name>
</person-group>
<article-title>Looking in ticks for human bacterial pathogens</article-title>
<source>Microb Pathog</source>
<year>2014</year>
<volume>77</volume>
<fpage>142</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="doi">10.1016/j.micpath.2014.09.008</pub-id>
<pub-id pub-id-type="pmid">25229617</pub-id>
</element-citation>
</ref>
<ref id="CR4">
<label>4.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baneth</surname>
<given-names>G</given-names>
</name>
</person-group>
<article-title>Tick-borne infections of animals and humans: a common ground</article-title>
<source>Int J Parasitol</source>
<year>2014</year>
<volume>44</volume>
<fpage>591</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="doi">10.1016/j.ijpara.2014.03.011</pub-id>
<pub-id pub-id-type="pmid">24846527</pub-id>
</element-citation>
</ref>
<ref id="CR5">
<label>5.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Dittmar</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Whiting</surname>
<given-names>MF</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Fleas and flea-borne diseases</article-title>
<source>Int J Infect Dis</source>
<year>2010</year>
<volume>14</volume>
<fpage>e667</fpage>
<lpage>76</lpage>
<pub-id pub-id-type="doi">10.1016/j.ijid.2009.11.011</pub-id>
<pub-id pub-id-type="pmid">20189862</pub-id>
</element-citation>
</ref>
<ref id="CR6">
<label>6.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Davoust</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Tick- and flea-borne rickettsial emerging zoonoses</article-title>
<source>Vet Res</source>
<year>2005</year>
<volume>36</volume>
<fpage>469</fpage>
<lpage>92</lpage>
<pub-id pub-id-type="doi">10.1051/vetres:2005004</pub-id>
<pub-id pub-id-type="pmid">15845235</pub-id>
</element-citation>
</ref>
<ref id="CR7">
<label>7.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eisen</surname>
<given-names>RJ</given-names>
</name>
<name>
<surname>Gage</surname>
<given-names>KL</given-names>
</name>
</person-group>
<article-title>Transmission of flea-borne zoonotic agents</article-title>
<source>Annu Rev Entomol</source>
<year>2012</year>
<volume>57</volume>
<fpage>61</fpage>
<lpage>82</lpage>
<pub-id pub-id-type="doi">10.1146/annurev-ento-120710-100717</pub-id>
<pub-id pub-id-type="pmid">21888520</pub-id>
</element-citation>
</ref>
<ref id="CR8">
<label>8.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Knobel</surname>
<given-names>DL</given-names>
</name>
<name>
<surname>Maina</surname>
<given-names>AN</given-names>
</name>
<name>
<surname>Cutler</surname>
<given-names>SJ</given-names>
</name>
<name>
<surname>Ogola</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Feikin</surname>
<given-names>DR</given-names>
</name>
<name>
<surname>Junghae</surname>
<given-names>M</given-names>
</name>
<etal></etal>
</person-group>
<article-title>
<italic>Coxiella burnetii</italic>
in humans, domestic ruminants, and ticks in rural western Kenya</article-title>
<source>Am J Trop Med Hyg</source>
<year>2013</year>
<volume>88</volume>
<fpage>513</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="doi">10.4269/ajtmh.12-0169</pub-id>
<pub-id pub-id-type="pmid">23382156</pub-id>
</element-citation>
</ref>
<ref id="CR9">
<label>9.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gil</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Escudero</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Pons</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Rodriguez-Vargas</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Garcia-Esteban</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Rodriguez-Moreno</surname>
<given-names>I</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Distribution of
<italic>Bartonella henselae</italic>
variants in patients, reservoir hosts and vectors in Spain</article-title>
<source>PLoS One</source>
<year>2013</year>
<volume>8</volume>
<fpage>e68248</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0068248</pub-id>
<pub-id pub-id-type="pmid">23874563</pub-id>
</element-citation>
</ref>
<ref id="CR10">
<label>10.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Tropical rickettsioses</article-title>
<source>Clin Dermatol</source>
<year>2006</year>
<volume>24</volume>
<fpage>191</fpage>
<lpage>200</lpage>
<pub-id pub-id-type="doi">10.1016/j.clindermatol.2005.11.007</pub-id>
<pub-id pub-id-type="pmid">16714200</pub-id>
</element-citation>
</ref>
<ref id="CR11">
<label>11.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Znazen</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Khrouf</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Elleuch</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Lahiani</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Marrekchi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>M'Ghirbi</surname>
<given-names>Y</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Multispacer typing of Rickettsia isolates from humans and ticks in Tunisia revealing new genotypes</article-title>
<source>Parasit Vectors.</source>
<year>2013</year>
<volume>6</volume>
<fpage>367</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-6-367</pub-id>
<pub-id pub-id-type="pmid">24380581</pub-id>
</element-citation>
</ref>
<ref id="CR12">
<label>12.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Merhej</surname>
<given-names>V</given-names>
</name>
<name>
<surname>El</surname>
<given-names>KK</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Whole genome-based phylogenetic analysis of Rickettsiae</article-title>
<source>Clin Microbiol Infect</source>
<year>2009</year>
<volume>15</volume>
<issue>Suppl 2</issue>
<fpage>336</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="doi">10.1111/j.1469-0691.2008.02265.x</pub-id>
<pub-id pub-id-type="pmid">19456801</pub-id>
</element-citation>
</ref>
<ref id="CR13">
<label>13.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nogueras</surname>
<given-names>MM</given-names>
</name>
<name>
<surname>Pons</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Ortuno</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Miret</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Pla</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Castella</surname>
<given-names>J</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Molecular detection of
<italic>Rickettsia typhi</italic>
in cats and fleas</article-title>
<source>PLoS One</source>
<year>2013</year>
<volume>8</volume>
<fpage>e71386</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0071386</pub-id>
<pub-id pub-id-type="pmid">23940746</pub-id>
</element-citation>
</ref>
<ref id="CR14">
<label>14.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Vectors of rickettsiae in Africa</article-title>
<source>Ticks Tick Borne Dis</source>
<year>2012</year>
<volume>3</volume>
<fpage>382</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="doi">10.1016/j.ttbdis.2012.10.011</pub-id>
<pub-id pub-id-type="pmid">23168053</pub-id>
</element-citation>
</ref>
<ref id="CR15">
<label>15.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mouffok</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Lepidi</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Mediterranean spotted fever in Algeria--new trends</article-title>
<source>Int J Infect Dis</source>
<year>2009</year>
<volume>13</volume>
<fpage>227</fpage>
<lpage>35</lpage>
<pub-id pub-id-type="doi">10.1016/j.ijid.2008.06.035</pub-id>
<pub-id pub-id-type="pmid">18930677</pub-id>
</element-citation>
</ref>
<ref id="CR16">
<label>16.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abdel-Shafy</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Allam</surname>
<given-names>NA</given-names>
</name>
<name>
<surname>Mediannikov</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Molecular detection of spotted fever group rickettsiae associated with ixodid ticks in Egypt</article-title>
<source>Vector Borne Zoonotic Dis.</source>
<year>2012</year>
<volume>12</volume>
<fpage>346</fpage>
<lpage>59</lpage>
<pub-id pub-id-type="doi">10.1089/vbz.2010.0241</pub-id>
<pub-id pub-id-type="pmid">22217182</pub-id>
</element-citation>
</ref>
<ref id="CR17">
<label>17.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kernif</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Vector-borne rickettsioses in North Africa</article-title>
<source>Infect Dis Clin North Am</source>
<year>2012</year>
<volume>26</volume>
<fpage>455</fpage>
<lpage>78</lpage>
<pub-id pub-id-type="doi">10.1016/j.idc.2012.03.007</pub-id>
<pub-id pub-id-type="pmid">22632649</pub-id>
</element-citation>
</ref>
<ref id="CR18">
<label>18.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chomel</surname>
<given-names>BB</given-names>
</name>
<name>
<surname>Boulouis</surname>
<given-names>HJ</given-names>
</name>
<name>
<surname>Breitschwerdt</surname>
<given-names>EB</given-names>
</name>
<name>
<surname>Kasten</surname>
<given-names>RW</given-names>
</name>
<name>
<surname>Vayssier-Taussat</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Birtles</surname>
<given-names>RJ</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Ecological fitness and strategies of adaptation of Bartonella species to their hosts and vectors</article-title>
<source>Vet Res</source>
<year>2009</year>
<volume>40</volume>
<fpage>29</fpage>
<pub-id pub-id-type="doi">10.1051/vetres/2009011</pub-id>
<pub-id pub-id-type="pmid">19284965</pub-id>
</element-citation>
</ref>
<ref id="CR19">
<label>19.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mogollon-Pasapera</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Otvos</surname>
<given-names>L</given-names>
<suffix>Jr</suffix>
</name>
<name>
<surname>Giordano</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Cassone</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Bartonella: emerging pathogen or emerging awareness?</article-title>
<source>Int J Infect Dis</source>
<year>2009</year>
<volume>13</volume>
<fpage>3</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="doi">10.1016/j.ijid.2008.04.002</pub-id>
<pub-id pub-id-type="pmid">18621561</pub-id>
</element-citation>
</ref>
<ref id="CR20">
<label>20.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chomel</surname>
<given-names>BB</given-names>
</name>
<name>
<surname>Kasten</surname>
<given-names>RW</given-names>
</name>
</person-group>
<article-title>Bartonellosis, an increasingly recognized zoonosis</article-title>
<source>J Appl Microbiol</source>
<year>2010</year>
<volume>109</volume>
<fpage>743</fpage>
<lpage>50</lpage>
<pub-id pub-id-type="doi">10.1111/j.1365-2672.2010.04679.x</pub-id>
<pub-id pub-id-type="pmid">20148999</pub-id>
</element-citation>
</ref>
<ref id="CR21">
<label>21.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harms</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Dehio</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Intruders below the radar: molecular pathogenesis of
<italic>Bartonella</italic>
spp</article-title>
<source>Clin Microbiol Rev</source>
<year>2012</year>
<volume>25</volume>
<fpage>42</fpage>
<lpage>78</lpage>
<pub-id pub-id-type="doi">10.1128/CMR.05009-11</pub-id>
<pub-id pub-id-type="pmid">22232371</pub-id>
</element-citation>
</ref>
<ref id="CR22">
<label>22.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Azzag</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Petit</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Gandoin</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Bouillin</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ghalmi</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Haddad</surname>
<given-names>N</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Prevalence of select vector-borne pathogens in stray and client-owned dogs from Algiers</article-title>
<source>Comp Immunol Microbiol Infect Dis</source>
<year>2015</year>
<volume>38</volume>
<fpage>1</fpage>
<lpage>7</lpage>
<pub-id pub-id-type="doi">10.1016/j.cimid.2015.01.001</pub-id>
<pub-id pub-id-type="pmid">25638478</pub-id>
</element-citation>
</ref>
<ref id="CR23">
<label>23.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kernif</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Aissi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Doumandji</surname>
<given-names>SE</given-names>
</name>
<name>
<surname>Chomel</surname>
<given-names>BB</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Molecular evidence of Bartonella infection in domestic dogs from Algeria, North Africa, by polymerase chain reaction (PCR)</article-title>
<source>Am J Trop Med Hyg</source>
<year>2010</year>
<volume>83</volume>
<fpage>298</fpage>
<lpage>300</lpage>
<pub-id pub-id-type="doi">10.4269/ajtmh.2010.09-0052</pub-id>
<pub-id pub-id-type="pmid">20682871</pub-id>
</element-citation>
</ref>
<ref id="CR24">
<label>24.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Rolain</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Nicolas</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Tsai</surname>
<given-names>YL</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Gundi</surname>
<given-names>VA</given-names>
</name>
<etal></etal>
</person-group>
<article-title>A multi-gene analysis of diversity of Bartonella detected in fleas from Algeria</article-title>
<source>Comp Immunol Microbiol Infect Dis</source>
<year>2012</year>
<volume>35</volume>
<fpage>71</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="doi">10.1016/j.cimid.2011.11.002</pub-id>
<pub-id pub-id-type="pmid">22153359</pub-id>
</element-citation>
</ref>
<ref id="CR25">
<label>25.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Azzag</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Haddad</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Durand</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Petit</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Ammouche</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Chomel</surname>
<given-names>B</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Population structure of
<italic>Bartonella henselae</italic>
in Algerian urban stray cats</article-title>
<source>PLoS One</source>
<year>2012</year>
<volume>7</volume>
<fpage>e43621</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0043621</pub-id>
<pub-id pub-id-type="pmid">22956995</pub-id>
</element-citation>
</ref>
<ref id="CR26">
<label>26.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maurin</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Q fever</article-title>
<source>Clin Microbiol Rev</source>
<year>1999</year>
<volume>12</volume>
<fpage>518</fpage>
<lpage>53</lpage>
<pub-id pub-id-type="pmid">10515901</pub-id>
</element-citation>
</ref>
<ref id="CR27">
<label>27.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Angelakis</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Mediannikov</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Mouffok</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Bassene</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Tall</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<article-title>
<italic>Coxiella burnetii</italic>
-positive PCR in febrile patients in rural and urban Africa</article-title>
<source>Int J Infect Dis</source>
<year>2014</year>
<volume>28</volume>
<fpage>107</fpage>
<lpage>10</lpage>
<pub-id pub-id-type="doi">10.1016/j.ijid.2014.05.029</pub-id>
<pub-id pub-id-type="pmid">25245003</pub-id>
</element-citation>
</ref>
<ref id="CR28">
<label>28.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sobhi</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Allal-Benfekih</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Petit</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Biodiversité acaridienne des zonnes humides et des écosystemes forestiers (de Quercus suber et de Q. canariensis): effets du climat et de la végétation</article-title>
<source>Bull Soc Zool Fr</source>
<year>2013</year>
<volume>138</volume>
<fpage>229</fpage>
<lpage>50</lpage>
</element-citation>
</ref>
<ref id="CR29">
<label>29.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bouattour</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Dichotomous identification keys of ticks (Acari: Ixodidae), livestock parasites in North Africa</article-title>
<source>Arch Inst Pasteur Tunis</source>
<year>2002</year>
<volume>79</volume>
<fpage>43</fpage>
<lpage>50</lpage>
<pub-id pub-id-type="pmid">15072244</pub-id>
</element-citation>
</ref>
<ref id="CR30">
<label>30.</label>
<element-citation publication-type="book">
<person-group person-group-type="author">
<name>
<surname>Beaucournu</surname>
<given-names>J-C</given-names>
</name>
<name>
<surname>Launay</surname>
<given-names>H</given-names>
</name>
</person-group>
<source>Les puces (Siphonaptera) de France et du Bassin méditerranéen occidental</source>
<year>1990</year>
</element-citation>
</ref>
<ref id="CR31">
<label>31.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Pages</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>
<italic>Rickettsia felis</italic>
in
<italic>Aedes albopictus</italic>
mosquitoes, Libreville, Gabon</article-title>
<source>Emerg Infect Dis</source>
<year>2012</year>
<volume>18</volume>
<fpage>1687</fpage>
<lpage>9</lpage>
<pub-id pub-id-type="doi">10.3201/eid1810.120178</pub-id>
<pub-id pub-id-type="pmid">23017437</pub-id>
</element-citation>
</ref>
<ref id="CR32">
<label>32.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Varagnol</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Jouan</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Beaucournu</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Rolain</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>First detection of
<italic>Rickettsia felis</italic>
and
<italic>Bartonella clarridgeiae</italic>
in fleas from Laos</article-title>
<source>Clin Microbiol Infect</source>
<year>2009</year>
<volume>15</volume>
<issue>Suppl 2</issue>
<fpage>334</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="doi">10.1111/j.1469-0691.2008.02272.x</pub-id>
<pub-id pub-id-type="pmid">19438611</pub-id>
</element-citation>
</ref>
<ref id="CR33">
<label>33.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kosoy</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Morway</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Sheff</surname>
<given-names>KW</given-names>
</name>
<name>
<surname>Bai</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Colborn</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Chalcraft</surname>
<given-names>L</given-names>
</name>
<etal></etal>
</person-group>
<article-title>
<italic>Bartonella tamiae</italic>
sp. nov., a newly recognized pathogen isolated from three human patients from Thailand</article-title>
<source>J Clin Microbiol</source>
<year>2008</year>
<volume>46</volume>
<fpage>772</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="doi">10.1128/JCM.02120-07</pub-id>
<pub-id pub-id-type="pmid">18077632</pub-id>
</element-citation>
</ref>
<ref id="CR34">
<label>34.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Kernif</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>Borrelia, Rickettsia, and Ehrlichia species in bat ticks, France, 2010</article-title>
<source>Emerg Infect Dis</source>
<year>2012</year>
<volume>18</volume>
<fpage>1966</fpage>
<lpage>75</lpage>
<pub-id pub-id-type="doi">10.3201/eid1812.111237</pub-id>
<pub-id pub-id-type="pmid">23171714</pub-id>
</element-citation>
</ref>
<ref id="CR35">
<label>35.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leulmi</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Laudisoit</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Houemenou</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Davoust</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Detection of
<italic>Rickettsia felis</italic>
,
<italic>Rickettsia typhi</italic>
, Bartonella Species and
<italic>Yersinia pestis</italic>
in Fleas (Siphonaptera) from Africa</article-title>
<source>PLoS Negl Trop Dis</source>
<year>2014</year>
<volume>8</volume>
<fpage>e3152</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pntd.0003152</pub-id>
<pub-id pub-id-type="pmid">25299702</pub-id>
</element-citation>
</ref>
<ref id="CR36">
<label>36.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mediannikov</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Fenollar</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Diatta</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Bassene</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Molez</surname>
<given-names>JF</given-names>
</name>
<etal></etal>
</person-group>
<article-title>
<italic>Coxiella burnetii</italic>
in humans and ticks in rural Senegal</article-title>
<source>PLoS Negl Trop Dis</source>
<year>2010</year>
<volume>4</volume>
<fpage>e654</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pntd.0000654</pub-id>
<pub-id pub-id-type="pmid">20386603</pub-id>
</element-citation>
</ref>
<ref id="CR37">
<label>37.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jacomo</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Kelly</surname>
<given-names>PJ</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Natural history of Bartonella infections (an exception to Koch’s postulate)</article-title>
<source>Clin Diagn Lab Immunol</source>
<year>2002</year>
<volume>9</volume>
<fpage>8</fpage>
<lpage>18</lpage>
<pub-id pub-id-type="pmid">11777823</pub-id>
</element-citation>
</ref>
<ref id="CR38">
<label>38.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Colton</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Zeidner</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Lynch</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Kosoy</surname>
<given-names>MY</given-names>
</name>
</person-group>
<article-title>Human isolates of
<italic>Bartonella tamiae</italic>
induce pathology in experimentally inoculated immunocompetent mice</article-title>
<source>BMC Infect Dis</source>
<year>2010</year>
<volume>10</volume>
<fpage>229</fpage>
<pub-id pub-id-type="doi">10.1186/1471-2334-10-229</pub-id>
<pub-id pub-id-type="pmid">20673363</pub-id>
</element-citation>
</ref>
<ref id="CR39">
<label>39.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kabeya</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Colborn</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Bai</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Lerdthusnee</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Richardson</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Maruyama</surname>
<given-names>S</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Detection of
<italic>Bartonella tamiae</italic>
DNA in ectoparasites from rodents in Thailand and their sequence similarity with bacterial cultures from Thai patients</article-title>
<source>Vector Borne Zoonotic Dis</source>
<year>2010</year>
<volume>10</volume>
<fpage>429</fpage>
<lpage>34</lpage>
<pub-id pub-id-type="doi">10.1089/vbz.2009.0124</pub-id>
<pub-id pub-id-type="pmid">20017718</pub-id>
</element-citation>
</ref>
<ref id="CR40">
<label>40.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Concannon</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Wynn-Owen</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Simpson</surname>
<given-names>VR</given-names>
</name>
<name>
<surname>Birtles</surname>
<given-names>RJ</given-names>
</name>
</person-group>
<article-title>Molecular characterization of haemoparasites infecting bats (Microchiroptera) in Cornwall, UK</article-title>
<source>Parasitology</source>
<year>2005</year>
<volume>131</volume>
<fpage>489</fpage>
<lpage>96</lpage>
<pub-id pub-id-type="doi">10.1017/S0031182005008097</pub-id>
<pub-id pub-id-type="pmid">16174413</pub-id>
</element-citation>
</ref>
<ref id="CR41">
<label>41.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kosoy</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Bai</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Lynch</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Kuzmin</surname>
<given-names>IV</given-names>
</name>
<name>
<surname>Niezgoda</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Franka</surname>
<given-names>R</given-names>
</name>
<etal></etal>
</person-group>
<article-title>
<italic>Bartonella</italic>
spp. in bats, Kenya</article-title>
<source>Emerg Infect Dis</source>
<year>2010</year>
<volume>16</volume>
<fpage>1875</fpage>
<lpage>81</lpage>
<pub-id pub-id-type="doi">10.3201/eid1612.100601</pub-id>
<pub-id pub-id-type="pmid">21122216</pub-id>
</element-citation>
</ref>
<ref id="CR42">
<label>42.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bai</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Kosoy</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Recuenco</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Alvarez</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Moran</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Turmelle</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<article-title>
<italic>Bartonella</italic>
spp. in Bats, Guatemala</article-title>
<source>Emerg Infect Dis</source>
<year>2011</year>
<volume>17</volume>
<fpage>1269</fpage>
<lpage>72</lpage>
<pub-id pub-id-type="doi">10.3201/eid1707.101867</pub-id>
<pub-id pub-id-type="pmid">21762584</pub-id>
</element-citation>
</ref>
<ref id="CR43">
<label>43.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kazar</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>
<italic>Coxiella burnetii</italic>
infection</article-title>
<source>Ann N Y Acad Sci</source>
<year>2005</year>
<volume>1063</volume>
<fpage>105</fpage>
<lpage>14</lpage>
<pub-id pub-id-type="doi">10.1196/annals.1355.018</pub-id>
<pub-id pub-id-type="pmid">16481501</pub-id>
</element-citation>
</ref>
<ref id="CR44">
<label>44.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Angelakis</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Q Fever</article-title>
<source>Vet Microbiol</source>
<year>2010</year>
<volume>140</volume>
<fpage>297</fpage>
<lpage>309</lpage>
<pub-id pub-id-type="doi">10.1016/j.vetmic.2009.07.016</pub-id>
<pub-id pub-id-type="pmid">19875249</pub-id>
</element-citation>
</ref>
<ref id="CR45">
<label>45.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Benslimani</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Fenollar</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Lepidi</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Bacterial zoonoses and infective endocarditis, Algeria</article-title>
<source>Emerg Infect Dis</source>
<year>2005</year>
<volume>11</volume>
<fpage>216</fpage>
<lpage>24</lpage>
<pub-id pub-id-type="doi">10.3201/eid1102.040668</pub-id>
<pub-id pub-id-type="pmid">15752438</pub-id>
</element-citation>
</ref>
<ref id="CR46">
<label>46.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arthur</surname>
<given-names>DR</given-names>
</name>
</person-group>
<article-title>The Ixodes ticks of Chiroptera (Ixodoidea, Ixodidae)</article-title>
<source>J Parasitol</source>
<year>1956</year>
<volume>42</volume>
<fpage>180</fpage>
<lpage>96</lpage>
<pub-id pub-id-type="doi">10.2307/3274734</pub-id>
<pub-id pub-id-type="pmid">13320260</pub-id>
</element-citation>
</ref>
<ref id="CR47">
<label>47.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hornok</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Estrada-Pena</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Kontschan</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Plantard</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Kunz</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Mihalca</surname>
<given-names>AD</given-names>
</name>
<etal></etal>
</person-group>
<article-title>High degree of mitochondrial gene heterogeneity in the bat tick species
<italic>Ixodes vespertilionis</italic>
,
<italic>I. ariadnae</italic>
and
<italic>I. simplex</italic>
from Eurasia</article-title>
<source>Parasit Vectors</source>
<year>2015</year>
<volume>8</volume>
<fpage>457</fpage>
<pub-id pub-id-type="doi">10.1186/s13071-015-1056-2</pub-id>
<pub-id pub-id-type="pmid">26382218</pub-id>
</element-citation>
</ref>
<ref id="CR48">
<label>48.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Piksa</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Gorz</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Nowak-Chmura</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Siuda</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>The patterns of seasonal activity of
<italic>Ixodes vespertilionis</italic>
(Acari: Ixodidae) on
<italic>Rhinolophus hipposideros</italic>
in nursery colonies</article-title>
<source>Ticks Tick Borne Dis</source>
<year>2014</year>
<volume>5</volume>
<fpage>69</fpage>
<lpage>74</lpage>
<pub-id pub-id-type="doi">10.1016/j.ttbdis.2013.08.006</pub-id>
<pub-id pub-id-type="pmid">24252260</pub-id>
</element-citation>
</ref>
<ref id="CR49">
<label>49.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Obsomer</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Wirtgen</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Linden</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Claerebout</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Heyman</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Heylen</surname>
<given-names>D</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Spatial disaggregation of tick occurrence and ecology at a local scale as a preliminary step for spatial surveillance of tick-borne diseases: general framework and health implications in Belgium</article-title>
<source>Parasit Vectors</source>
<year>2013</year>
<volume>6</volume>
<fpage>190</fpage>
<pub-id pub-id-type="doi">10.1186/1756-3305-6-190</pub-id>
<pub-id pub-id-type="pmid">23800283</pub-id>
</element-citation>
</ref>
<ref id="CR50">
<label>50.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Cornet</surname>
<given-names>JP</given-names>
</name>
<name>
<surname>Sanogo</surname>
<given-names>YO</given-names>
</name>
<name>
<surname>Miller</surname>
<given-names>RS</given-names>
</name>
<name>
<surname>Thien</surname>
<given-names>HV</given-names>
</name>
<name>
<surname>Gonzalez</surname>
<given-names>JP</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Detection of
<italic>Ehrlichia</italic>
spp.,
<italic>Anaplasma</italic>
spp.,
<italic>Rickettsia</italic>
spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam</article-title>
<source>J Clin Microbiol</source>
<year>2003</year>
<volume>41</volume>
<fpage>1600</fpage>
<lpage>8</lpage>
<pub-id pub-id-type="doi">10.1128/JCM.41.4.1600-1608.2003</pub-id>
<pub-id pub-id-type="pmid">12682151</pub-id>
</element-citation>
</ref>
<ref id="CR51">
<label>51.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Paddock</surname>
<given-names>CD</given-names>
</name>
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Labruna</surname>
<given-names>MB</given-names>
</name>
<name>
<surname>Mediannikov</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Kernif</surname>
<given-names>T</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Update on tick-borne rickettsioses around the world: a geographic approach</article-title>
<source>Clin Microbiol Rev</source>
<year>2013</year>
<volume>26</volume>
<fpage>657</fpage>
<lpage>702</lpage>
<pub-id pub-id-type="doi">10.1128/CMR.00032-13</pub-id>
<pub-id pub-id-type="pmid">24092850</pub-id>
</element-citation>
</ref>
<ref id="CR52">
<label>52.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kernif</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Messaoudene</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Ouahioune</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
</person-group>
<article-title>Spotted fever group rickettsiae identified in
<italic>Dermacentor marginatus</italic>
and
<italic>Ixodes ricinus</italic>
ticks in Algeria</article-title>
<source>Ticks Tick Borne Dis</source>
<year>2012</year>
<volume>3</volume>
<fpage>380</fpage>
<lpage>1</lpage>
<pub-id pub-id-type="doi">10.1016/j.ttbdis.2012.10.012</pub-id>
<pub-id pub-id-type="pmid">23168054</pub-id>
</element-citation>
</ref>
<ref id="CR53">
<label>53.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Matsumoto</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Rolain</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Baziz</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Boubidi</surname>
<given-names>SC</given-names>
</name>
<etal></etal>
</person-group>
<article-title>First molecular detection of
<italic>R. conorii</italic>
,
<italic>R. aeschlimannii</italic>
, and
<italic>R. massiliae</italic>
in ticks from Algeria</article-title>
<source>Ann N Y Acad Sci</source>
<year>2006</year>
<volume>1078</volume>
<fpage>368</fpage>
<lpage>72</lpage>
<pub-id pub-id-type="doi">10.1196/annals.1374.073</pub-id>
<pub-id pub-id-type="pmid">17114743</pub-id>
</element-citation>
</ref>
<ref id="CR54">
<label>54.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Djerbouh</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Kernif</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Beneldjouzi</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Kechemir</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<etal></etal>
</person-group>
<article-title>The first molecular detection of
<italic>Rickettsia aeschlimannii</italic>
in the ticks of camels from southern Algeria</article-title>
<source>Ticks Tick Borne Dis</source>
<year>2012</year>
<volume>3</volume>
<fpage>374</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="doi">10.1016/j.ttbdis.2012.10.014</pub-id>
<pub-id pub-id-type="pmid">23168055</pub-id>
</element-citation>
</ref>
<ref id="CR55">
<label>55.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Kernif</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Harrat</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>First detection of
<italic>Rickettsia aeschlimannii</italic>
in
<italic>Hyalomma aegyptium</italic>
from Algeria</article-title>
<source>Clin Microbiol Infect</source>
<year>2009</year>
<volume>15</volume>
<issue>Suppl 2</issue>
<fpage>253</fpage>
<lpage>4</lpage>
<pub-id pub-id-type="doi">10.1111/j.1469-0691.2008.02274.x</pub-id>
<pub-id pub-id-type="pmid">19548989</pub-id>
</element-citation>
</ref>
<ref id="CR56">
<label>56.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>La</surname>
<given-names>SB</given-names>
</name>
<name>
<surname>Meconi</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Fenollar</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Rolain</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Roux</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Emended description of
<italic>Rickettsia felis</italic>
(Bouyer et al. 2001), a temperature-dependent cultured bacterium</article-title>
<source>Int J Syst Evol Microbiol</source>
<year>2001</year>
<volume>2002</volume>
<issue>52</issue>
<fpage>2035</fpage>
<lpage>41</lpage>
</element-citation>
</ref>
<ref id="CR57">
<label>57.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>
<italic>Rickettsia felis</italic>
: from a rare disease in the USA to a common cause of fever in sub-Saharan Africa</article-title>
<source>Clin Microbiol Infect</source>
<year>2011</year>
<volume>17</volume>
<fpage>996</fpage>
<lpage>1000</lpage>
<pub-id pub-id-type="doi">10.1111/j.1469-0691.2011.03516.x</pub-id>
<pub-id pub-id-type="pmid">21722253</pub-id>
</element-citation>
</ref>
<ref id="CR58">
<label>58.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Keita</surname>
<given-names>AK</given-names>
</name>
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ahuka-Mundeke</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Ratmanov</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Butel</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Ayouba</surname>
<given-names>A</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Molecular evidence for the presence of
<italic>Rickettsia felis</italic>
in the feces of wild-living African apes</article-title>
<source>PLoS One</source>
<year>2013</year>
<volume>8</volume>
<fpage>e54679</fpage>
<pub-id pub-id-type="doi">10.1371/journal.pone.0054679</pub-id>
<pub-id pub-id-type="pmid">23405087</pub-id>
</element-citation>
</ref>
<ref id="CR59">
<label>59.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mediannikov</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Edouard</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Fenollar</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Mouffok</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Bassene</surname>
<given-names>H</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Common epidemiology of
<italic>Rickettsia felis</italic>
infection and malaria, Africa</article-title>
<source>Emerg Infect Dis</source>
<year>2013</year>
<volume>19</volume>
<fpage>1775</fpage>
<lpage>83</lpage>
<pub-id pub-id-type="doi">10.3201/eid1911.130361</pub-id>
<pub-id pub-id-type="pmid">24188709</pub-id>
</element-citation>
</ref>
<ref id="CR60">
<label>60.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Baziz</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Kernif</surname>
<given-names>T</given-names>
</name>
<name>
<surname>Harrat</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Raoult</surname>
<given-names>D</given-names>
</name>
</person-group>
<article-title>Molecular detection of
<italic>Rickettsia typhi</italic>
and
<italic>Rickettsia felis</italic>
in fleas from Algeria</article-title>
<source>Clin Microbiol Infect</source>
<year>2009</year>
<volume>15</volume>
<issue>Suppl 2</issue>
<fpage>255</fpage>
<lpage>6</lpage>
<pub-id pub-id-type="doi">10.1111/j.1469-0691.2008.02275.x</pub-id>
<pub-id pub-id-type="pmid">19548988</pub-id>
</element-citation>
</ref>
<ref id="CR61">
<label>61.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitam</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Parola</surname>
<given-names>P</given-names>
</name>
<name>
<surname>De La Cruz</surname>
<given-names>KD</given-names>
</name>
<name>
<surname>Matsumoto</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Baziz</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Rolain</surname>
<given-names>JM</given-names>
</name>
<etal></etal>
</person-group>
<article-title>First molecular detection of
<italic>Rickettsia felis</italic>
in fleas from Algeria</article-title>
<source>Am J Trop Med Hyg</source>
<year>2006</year>
<volume>74</volume>
<fpage>532</fpage>
<lpage>5</lpage>
<pub-id pub-id-type="pmid">16606979</pub-id>
</element-citation>
</ref>
<ref id="CR62">
<label>62.</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khaldi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Socolovschi</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Benyettou</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Barech</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Biche</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Kernif</surname>
<given-names>T</given-names>
</name>
<etal></etal>
</person-group>
<article-title>Rickettsiae in arthropods collected from the North African Hedgehog (
<italic>Atelerix algirus</italic>
) and the desert hedgehog (
<italic>Paraechinus aethiopicus</italic>
) in Algeria</article-title>
<source>Comp Immunol Microbiol Infect Dis</source>
<year>2012</year>
<volume>35</volume>
<fpage>117</fpage>
<lpage>22</lpage>
<pub-id pub-id-type="doi">10.1016/j.cimid.2011.11.007</pub-id>
<pub-id pub-id-type="pmid">22222114</pub-id>
</element-citation>
</ref>
</ref-list>
</back>
</pmc>
</record>

Pour manipuler ce document sous Unix (Dilib)

EXPLOR_STEP=$WICRI_ROOT/Wicri/Bois/explor/CheneBelgiqueV2/Data/Pmc/Corpus
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 000077 | SxmlIndent | more

Ou

HfdSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd -nk 000077 | SxmlIndent | more

Pour mettre un lien sur cette page dans le réseau Wicri

{{Explor lien
   |wiki=    Wicri/Bois
   |area=    CheneBelgiqueV2
   |flux=    Pmc
   |étape=   Corpus
   |type=    RBID
   |clé=     PMC:4721140
   |texte=   Detection of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria
}}

Pour générer des pages wiki

HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Corpus/RBID.i   -Sk "pubmed:26791781" \
       | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Corpus/biblio.hfd   \
       | NlmPubMed2Wicri -a CheneBelgiqueV2 

Wicri

This area was generated with Dilib version V0.6.27.
Data generation: Wed Mar 22 20:06:11 2017. Site generation: Wed Mar 6 16:09:04 2024