Plasmodium Merozoite TRAP Family Protein Is Essential for Vacuole Membrane Disruption and Gamete Egress from Erythrocytes
Identifieur interne : 002220 ( Pmc/Curation ); précédent : 002219; suivant : 002221Plasmodium Merozoite TRAP Family Protein Is Essential for Vacuole Membrane Disruption and Gamete Egress from Erythrocytes
Auteurs : Daniel Y. Bargieri [France, Brésil] ; Sabine Thiberge [France] ; Chwen L. Tay [Royaume-Uni] ; Alison F. Carey [France, États-Unis] ; Alice Rantz [France] ; Florian Hischen [Allemagne] ; Audrey Lorthiois [France] ; Ursula Straschil [Royaume-Uni] ; Pallavi Singh [France] ; Shailja Singh [France] ; Tony Triglia [Australie] ; Takafumi Tsuboi [Japon] ; Alan Cowman [Australie] ; Chetan Chitnis [France] ; Pietro Alano [Italie] ; Jake Baum [Royaume-Uni] ; Gabriele Pradel [Allemagne] ; Catherine Lavazec [France] ; Robert Ménard [France]Source :
- Cell Host & Microbe [ 1931-3128 ] ; 2016.
Abstract
Surface-associated TRAP (thrombospondin-related anonymous protein) family proteins are conserved across the phylum of apicomplexan parasites. TRAP proteins are thought to play an integral role in parasite motility and cell invasion by linking the extracellular environment with the parasite submembrane actomyosin motor. Blood stage forms of the malaria parasite
Url:
DOI: 10.1016/j.chom.2016.10.015
PubMed: 27832590
PubMed Central: 5104695
Links toward previous steps (curation, corpus...)
- to stream Pmc, to step Corpus: Pour aller vers cette notice dans l'étape Curation :002370
Links to Exploration step
PMC:5104695Le document en format XML
<record><TEI><teiHeader><fileDesc><titleStmt><title xml:lang="en"><italic>Plasmodium</italic>
Merozoite TRAP Family Protein Is Essential for Vacuole Membrane Disruption and Gamete Egress from Erythrocytes</title>
<author><name sortKey="Bargieri, Daniel Y" sort="Bargieri, Daniel Y" uniqKey="Bargieri D" first="Daniel Y." last="Bargieri">Daniel Y. Bargieri</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="aff2">Department of Parasitology, University of São Paulo-USP, São Paulo 05508-000, SP, Brazil</nlm:aff>
<country xml:lang="fr">Brésil</country>
<wicri:regionArea>Department of Parasitology, University of São Paulo-USP, São Paulo 05508-000, SP</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Thiberge, Sabine" sort="Thiberge, Sabine" uniqKey="Thiberge S" first="Sabine" last="Thiberge">Sabine Thiberge</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Tay, Chwen L" sort="Tay, Chwen L" uniqKey="Tay C" first="Chwen L." last="Tay">Chwen L. Tay</name>
<affiliation wicri:level="1"><nlm:aff id="aff3">Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ, UK</nlm:aff>
<country xml:lang="fr">Royaume-Uni</country>
<wicri:regionArea>Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Carey, Alison F" sort="Carey, Alison F" uniqKey="Carey A" first="Alison F." last="Carey">Alison F. Carey</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="aff4">Department of Pathology, Massachusetts General Hospital, Boston, MA 02114, USA</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea>Department of Pathology, Massachusetts General Hospital, Boston, MA 02114</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Rantz, Alice" sort="Rantz, Alice" uniqKey="Rantz A" first="Alice" last="Rantz">Alice Rantz</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Hischen, Florian" sort="Hischen, Florian" uniqKey="Hischen F" first="Florian" last="Hischen">Florian Hischen</name>
<affiliation wicri:level="1"><nlm:aff id="aff5">Division of Cellular and Applied Infection Biology, Institute of Zoology, RWTH Aachen University, Aachen 52074, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Cellular and Applied Infection Biology, Institute of Zoology, RWTH Aachen University, Aachen 52074</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Lorthiois, Audrey" sort="Lorthiois, Audrey" uniqKey="Lorthiois A" first="Audrey" last="Lorthiois">Audrey Lorthiois</name>
<affiliation wicri:level="1"><nlm:aff id="aff6">Inserm U1016, CNRS UMR 8104, Université Paris Descartes, Institut Cochin, Paris 75014, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Inserm U1016, CNRS UMR 8104, Université Paris Descartes, Institut Cochin, Paris 75014</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Straschil, Ursula" sort="Straschil, Ursula" uniqKey="Straschil U" first="Ursula" last="Straschil">Ursula Straschil</name>
<affiliation wicri:level="1"><nlm:aff id="aff3">Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ, UK</nlm:aff>
<country xml:lang="fr">Royaume-Uni</country>
<wicri:regionArea>Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Singh, Pallavi" sort="Singh, Pallavi" uniqKey="Singh P" first="Pallavi" last="Singh">Pallavi Singh</name>
<affiliation wicri:level="1"><nlm:aff id="aff7">Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Singh, Shailja" sort="Singh, Shailja" uniqKey="Singh S" first="Shailja" last="Singh">Shailja Singh</name>
<affiliation wicri:level="1"><nlm:aff id="aff7">Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Triglia, Tony" sort="Triglia, Tony" uniqKey="Triglia T" first="Tony" last="Triglia">Tony Triglia</name>
<affiliation wicri:level="1"><nlm:aff id="aff8">The Walter and Eliza Hall Institute of Medical Research, Parkville 3052, VIC, Australia</nlm:aff>
<country xml:lang="fr">Australie</country>
<wicri:regionArea>The Walter and Eliza Hall Institute of Medical Research, Parkville 3052, VIC</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Tsuboi, Takafumi" sort="Tsuboi, Takafumi" uniqKey="Tsuboi T" first="Takafumi" last="Tsuboi">Takafumi Tsuboi</name>
<affiliation wicri:level="1"><nlm:aff id="aff10">Division of Malaria Research, Proteo-Science Center, Ehime University, Matsuyama, Ehime 790-8577, Japan</nlm:aff>
<country xml:lang="fr">Japon</country>
<wicri:regionArea>Division of Malaria Research, Proteo-Science Center, Ehime University, Matsuyama, Ehime 790-8577</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Cowman, Alan" sort="Cowman, Alan" uniqKey="Cowman A" first="Alan" last="Cowman">Alan Cowman</name>
<affiliation wicri:level="1"><nlm:aff id="aff8">The Walter and Eliza Hall Institute of Medical Research, Parkville 3052, VIC, Australia</nlm:aff>
<country xml:lang="fr">Australie</country>
<wicri:regionArea>The Walter and Eliza Hall Institute of Medical Research, Parkville 3052, VIC</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="aff9">Department of Medical Biology, University of Melbourne, Parkville 3052, VIC, Australia</nlm:aff>
<country xml:lang="fr">Australie</country>
<wicri:regionArea>Department of Medical Biology, University of Melbourne, Parkville 3052, VIC</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Chitnis, Chetan" sort="Chitnis, Chetan" uniqKey="Chitnis C" first="Chetan" last="Chitnis">Chetan Chitnis</name>
<affiliation wicri:level="1"><nlm:aff id="aff7">Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Alano, Pietro" sort="Alano, Pietro" uniqKey="Alano P" first="Pietro" last="Alano">Pietro Alano</name>
<affiliation wicri:level="1"><nlm:aff id="aff11">Dipartimento di Malattie Infettive, Parassitarie ed Immunomediate, Istituto Superiore di Sanità, Rome 00161, Italy</nlm:aff>
<country xml:lang="fr">Italie</country>
<wicri:regionArea>Dipartimento di Malattie Infettive, Parassitarie ed Immunomediate, Istituto Superiore di Sanità, Rome 00161</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Baum, Jake" sort="Baum, Jake" uniqKey="Baum J" first="Jake" last="Baum">Jake Baum</name>
<affiliation wicri:level="1"><nlm:aff id="aff3">Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ, UK</nlm:aff>
<country xml:lang="fr">Royaume-Uni</country>
<wicri:regionArea>Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Pradel, Gabriele" sort="Pradel, Gabriele" uniqKey="Pradel G" first="Gabriele" last="Pradel">Gabriele Pradel</name>
<affiliation wicri:level="1"><nlm:aff id="aff5">Division of Cellular and Applied Infection Biology, Institute of Zoology, RWTH Aachen University, Aachen 52074, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Cellular and Applied Infection Biology, Institute of Zoology, RWTH Aachen University, Aachen 52074</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Lavazec, Catherine" sort="Lavazec, Catherine" uniqKey="Lavazec C" first="Catherine" last="Lavazec">Catherine Lavazec</name>
<affiliation wicri:level="1"><nlm:aff id="aff6">Inserm U1016, CNRS UMR 8104, Université Paris Descartes, Institut Cochin, Paris 75014, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Inserm U1016, CNRS UMR 8104, Université Paris Descartes, Institut Cochin, Paris 75014</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Menard, Robert" sort="Menard, Robert" uniqKey="Menard R" first="Robert" last="Ménard">Robert Ménard</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
</titleStmt>
<publicationStmt><idno type="wicri:source">PMC</idno>
<idno type="pmid">27832590</idno>
<idno type="pmc">5104695</idno>
<idno type="url">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5104695</idno>
<idno type="RBID">PMC:5104695</idno>
<idno type="doi">10.1016/j.chom.2016.10.015</idno>
<date when="2016">2016</date>
<idno type="wicri:Area/Pmc/Corpus">002370</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Corpus" wicri:corpus="PMC">002370</idno>
<idno type="wicri:Area/Pmc/Curation">002220</idno>
<idno type="wicri:explorRef" wicri:stream="Pmc" wicri:step="Curation">002220</idno>
</publicationStmt>
<sourceDesc><biblStruct><analytic><title xml:lang="en" level="a" type="main"><italic>Plasmodium</italic>
Merozoite TRAP Family Protein Is Essential for Vacuole Membrane Disruption and Gamete Egress from Erythrocytes</title>
<author><name sortKey="Bargieri, Daniel Y" sort="Bargieri, Daniel Y" uniqKey="Bargieri D" first="Daniel Y." last="Bargieri">Daniel Y. Bargieri</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="aff2">Department of Parasitology, University of São Paulo-USP, São Paulo 05508-000, SP, Brazil</nlm:aff>
<country xml:lang="fr">Brésil</country>
<wicri:regionArea>Department of Parasitology, University of São Paulo-USP, São Paulo 05508-000, SP</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Thiberge, Sabine" sort="Thiberge, Sabine" uniqKey="Thiberge S" first="Sabine" last="Thiberge">Sabine Thiberge</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Tay, Chwen L" sort="Tay, Chwen L" uniqKey="Tay C" first="Chwen L." last="Tay">Chwen L. Tay</name>
<affiliation wicri:level="1"><nlm:aff id="aff3">Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ, UK</nlm:aff>
<country xml:lang="fr">Royaume-Uni</country>
<wicri:regionArea>Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Carey, Alison F" sort="Carey, Alison F" uniqKey="Carey A" first="Alison F." last="Carey">Alison F. Carey</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="aff4">Department of Pathology, Massachusetts General Hospital, Boston, MA 02114, USA</nlm:aff>
<country xml:lang="fr">États-Unis</country>
<wicri:regionArea>Department of Pathology, Massachusetts General Hospital, Boston, MA 02114</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Rantz, Alice" sort="Rantz, Alice" uniqKey="Rantz A" first="Alice" last="Rantz">Alice Rantz</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Hischen, Florian" sort="Hischen, Florian" uniqKey="Hischen F" first="Florian" last="Hischen">Florian Hischen</name>
<affiliation wicri:level="1"><nlm:aff id="aff5">Division of Cellular and Applied Infection Biology, Institute of Zoology, RWTH Aachen University, Aachen 52074, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Cellular and Applied Infection Biology, Institute of Zoology, RWTH Aachen University, Aachen 52074</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Lorthiois, Audrey" sort="Lorthiois, Audrey" uniqKey="Lorthiois A" first="Audrey" last="Lorthiois">Audrey Lorthiois</name>
<affiliation wicri:level="1"><nlm:aff id="aff6">Inserm U1016, CNRS UMR 8104, Université Paris Descartes, Institut Cochin, Paris 75014, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Inserm U1016, CNRS UMR 8104, Université Paris Descartes, Institut Cochin, Paris 75014</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Straschil, Ursula" sort="Straschil, Ursula" uniqKey="Straschil U" first="Ursula" last="Straschil">Ursula Straschil</name>
<affiliation wicri:level="1"><nlm:aff id="aff3">Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ, UK</nlm:aff>
<country xml:lang="fr">Royaume-Uni</country>
<wicri:regionArea>Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Singh, Pallavi" sort="Singh, Pallavi" uniqKey="Singh P" first="Pallavi" last="Singh">Pallavi Singh</name>
<affiliation wicri:level="1"><nlm:aff id="aff7">Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Singh, Shailja" sort="Singh, Shailja" uniqKey="Singh S" first="Shailja" last="Singh">Shailja Singh</name>
<affiliation wicri:level="1"><nlm:aff id="aff7">Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Triglia, Tony" sort="Triglia, Tony" uniqKey="Triglia T" first="Tony" last="Triglia">Tony Triglia</name>
<affiliation wicri:level="1"><nlm:aff id="aff8">The Walter and Eliza Hall Institute of Medical Research, Parkville 3052, VIC, Australia</nlm:aff>
<country xml:lang="fr">Australie</country>
<wicri:regionArea>The Walter and Eliza Hall Institute of Medical Research, Parkville 3052, VIC</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Tsuboi, Takafumi" sort="Tsuboi, Takafumi" uniqKey="Tsuboi T" first="Takafumi" last="Tsuboi">Takafumi Tsuboi</name>
<affiliation wicri:level="1"><nlm:aff id="aff10">Division of Malaria Research, Proteo-Science Center, Ehime University, Matsuyama, Ehime 790-8577, Japan</nlm:aff>
<country xml:lang="fr">Japon</country>
<wicri:regionArea>Division of Malaria Research, Proteo-Science Center, Ehime University, Matsuyama, Ehime 790-8577</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Cowman, Alan" sort="Cowman, Alan" uniqKey="Cowman A" first="Alan" last="Cowman">Alan Cowman</name>
<affiliation wicri:level="1"><nlm:aff id="aff8">The Walter and Eliza Hall Institute of Medical Research, Parkville 3052, VIC, Australia</nlm:aff>
<country xml:lang="fr">Australie</country>
<wicri:regionArea>The Walter and Eliza Hall Institute of Medical Research, Parkville 3052, VIC</wicri:regionArea>
</affiliation>
<affiliation wicri:level="1"><nlm:aff id="aff9">Department of Medical Biology, University of Melbourne, Parkville 3052, VIC, Australia</nlm:aff>
<country xml:lang="fr">Australie</country>
<wicri:regionArea>Department of Medical Biology, University of Melbourne, Parkville 3052, VIC</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Chitnis, Chetan" sort="Chitnis, Chetan" uniqKey="Chitnis C" first="Chetan" last="Chitnis">Chetan Chitnis</name>
<affiliation wicri:level="1"><nlm:aff id="aff7">Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Alano, Pietro" sort="Alano, Pietro" uniqKey="Alano P" first="Pietro" last="Alano">Pietro Alano</name>
<affiliation wicri:level="1"><nlm:aff id="aff11">Dipartimento di Malattie Infettive, Parassitarie ed Immunomediate, Istituto Superiore di Sanità, Rome 00161, Italy</nlm:aff>
<country xml:lang="fr">Italie</country>
<wicri:regionArea>Dipartimento di Malattie Infettive, Parassitarie ed Immunomediate, Istituto Superiore di Sanità, Rome 00161</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Baum, Jake" sort="Baum, Jake" uniqKey="Baum J" first="Jake" last="Baum">Jake Baum</name>
<affiliation wicri:level="1"><nlm:aff id="aff3">Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ, UK</nlm:aff>
<country xml:lang="fr">Royaume-Uni</country>
<wicri:regionArea>Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Pradel, Gabriele" sort="Pradel, Gabriele" uniqKey="Pradel G" first="Gabriele" last="Pradel">Gabriele Pradel</name>
<affiliation wicri:level="1"><nlm:aff id="aff5">Division of Cellular and Applied Infection Biology, Institute of Zoology, RWTH Aachen University, Aachen 52074, Germany</nlm:aff>
<country xml:lang="fr">Allemagne</country>
<wicri:regionArea>Division of Cellular and Applied Infection Biology, Institute of Zoology, RWTH Aachen University, Aachen 52074</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Lavazec, Catherine" sort="Lavazec, Catherine" uniqKey="Lavazec C" first="Catherine" last="Lavazec">Catherine Lavazec</name>
<affiliation wicri:level="1"><nlm:aff id="aff6">Inserm U1016, CNRS UMR 8104, Université Paris Descartes, Institut Cochin, Paris 75014, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Inserm U1016, CNRS UMR 8104, Université Paris Descartes, Institut Cochin, Paris 75014</wicri:regionArea>
</affiliation>
</author>
<author><name sortKey="Menard, Robert" sort="Menard, Robert" uniqKey="Menard R" first="Robert" last="Ménard">Robert Ménard</name>
<affiliation wicri:level="1"><nlm:aff id="aff1">Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</nlm:aff>
<country xml:lang="fr">France</country>
<wicri:regionArea>Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015</wicri:regionArea>
</affiliation>
</author>
</analytic>
<series><title level="j">Cell Host & Microbe</title>
<idno type="ISSN">1931-3128</idno>
<idno type="eISSN">1934-6069</idno>
<imprint><date when="2016">2016</date>
</imprint>
</series>
</biblStruct>
</sourceDesc>
</fileDesc>
<profileDesc><textClass></textClass>
</profileDesc>
</teiHeader>
<front><div type="abstract" xml:lang="en"><title>Summary</title>
<p>Surface-associated TRAP (thrombospondin-related anonymous protein) family proteins are conserved across the phylum of apicomplexan parasites. TRAP proteins are thought to play an integral role in parasite motility and cell invasion by linking the extracellular environment with the parasite submembrane actomyosin motor. Blood stage forms of the malaria parasite <italic>Plasmodium</italic>
express a TRAP family protein called merozoite-TRAP (MTRAP) that has been implicated in erythrocyte invasion. Using MTRAP-deficient mutants of the rodent-infecting <italic>P. berghei</italic>
and human-infecting <italic>P. falciparum</italic>
parasites, we show that MTRAP is dispensable for erythrocyte invasion. Instead, MTRAP is essential for gamete egress from erythrocytes, where it is necessary for the disruption of the gamete-containing parasitophorous vacuole membrane, and thus for parasite transmission to mosquitoes. This indicates that motor-binding TRAP family members function not just in parasite motility and cell invasion but also in membrane disruption and cell egress.</p>
</div>
</front>
<back><div1 type="bibliography"><listBibl><biblStruct><analytic><author><name sortKey="Aikawa, M" uniqKey="Aikawa M">M. Aikawa</name>
</author>
<author><name sortKey="Miller, L H" uniqKey="Miller L">L.H. Miller</name>
</author>
<author><name sortKey="Johnson, J" uniqKey="Johnson J">J. Johnson</name>
</author>
<author><name sortKey="Rabbege, J" uniqKey="Rabbege J">J. Rabbege</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Amino, R" uniqKey="Amino R">R. Amino</name>
</author>
<author><name sortKey="Thiberge, S" uniqKey="Thiberge S">S. Thiberge</name>
</author>
<author><name sortKey="Martin, B" uniqKey="Martin B">B. Martin</name>
</author>
<author><name sortKey="Celli, S" uniqKey="Celli S">S. Celli</name>
</author>
<author><name sortKey="Shorte, S" uniqKey="Shorte S">S. Shorte</name>
</author>
<author><name sortKey="Frischknecht, F" uniqKey="Frischknecht F">F. Frischknecht</name>
</author>
<author><name sortKey="Menard, R" uniqKey="Menard R">R. Ménard</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Angrisano, F" uniqKey="Angrisano F">F. Angrisano</name>
</author>
<author><name sortKey="Riglar, D T" uniqKey="Riglar D">D.T. Riglar</name>
</author>
<author><name sortKey="Sturm, A" uniqKey="Sturm A">A. Sturm</name>
</author>
<author><name sortKey="Volz, J C" uniqKey="Volz J">J.C. Volz</name>
</author>
<author><name sortKey="Delves, M J" uniqKey="Delves M">M.J. Delves</name>
</author>
<author><name sortKey="Zuccala, E S" uniqKey="Zuccala E">E.S. Zuccala</name>
</author>
<author><name sortKey="Turnbull, L" uniqKey="Turnbull L">L. Turnbull</name>
</author>
<author><name sortKey="Dekiwadia, C" uniqKey="Dekiwadia C">C. Dekiwadia</name>
</author>
<author><name sortKey="Olshina, M A" uniqKey="Olshina M">M.A. Olshina</name>
</author>
<author><name sortKey="Marapana, D S" uniqKey="Marapana D">D.S. Marapana</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bargieri, D" uniqKey="Bargieri D">D. Bargieri</name>
</author>
<author><name sortKey="Lagal, V" uniqKey="Lagal V">V. Lagal</name>
</author>
<author><name sortKey="Andenmatten, N" uniqKey="Andenmatten N">N. Andenmatten</name>
</author>
<author><name sortKey="Tardieux, I" uniqKey="Tardieux I">I. Tardieux</name>
</author>
<author><name sortKey="Meissner, M" uniqKey="Meissner M">M. Meissner</name>
</author>
<author><name sortKey="Menard, R" uniqKey="Menard R">R. Ménard</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Bartholdson, S J" uniqKey="Bartholdson S">S.J. Bartholdson</name>
</author>
<author><name sortKey="Bustamante, L Y" uniqKey="Bustamante L">L.Y. Bustamante</name>
</author>
<author><name sortKey="Crosnier, C" uniqKey="Crosnier C">C. Crosnier</name>
</author>
<author><name sortKey="Johnson, S" uniqKey="Johnson S">S. Johnson</name>
</author>
<author><name sortKey="Lea, S" uniqKey="Lea S">S. Lea</name>
</author>
<author><name sortKey="Rayner, J C" uniqKey="Rayner J">J.C. Rayner</name>
</author>
<author><name sortKey="Wright, G J" uniqKey="Wright G">G.J. Wright</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Baum, J" uniqKey="Baum J">J. Baum</name>
</author>
<author><name sortKey="Richard, D" uniqKey="Richard D">D. Richard</name>
</author>
<author><name sortKey="Healer, J" uniqKey="Healer J">J. Healer</name>
</author>
<author><name sortKey="Rug, M" uniqKey="Rug M">M. Rug</name>
</author>
<author><name sortKey="Krnajski, Z" uniqKey="Krnajski Z">Z. Krnajski</name>
</author>
<author><name sortKey="Gilberger, T W" uniqKey="Gilberger T">T.W. Gilberger</name>
</author>
<author><name sortKey="Green, J L" uniqKey="Green J">J.L. Green</name>
</author>
<author><name sortKey="Holder, A A" uniqKey="Holder A">A.A. Holder</name>
</author>
<author><name sortKey="Cowman, A F" uniqKey="Cowman A">A.F. Cowman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Billker, O" uniqKey="Billker O">O. Billker</name>
</author>
<author><name sortKey="Dechamps, S" uniqKey="Dechamps S">S. Dechamps</name>
</author>
<author><name sortKey="Tewari, R" uniqKey="Tewari R">R. Tewari</name>
</author>
<author><name sortKey="Wenig, G" uniqKey="Wenig G">G. Wenig</name>
</author>
<author><name sortKey="Franke Fayard, B" uniqKey="Franke Fayard B">B. Franke-Fayard</name>
</author>
<author><name sortKey="Brinkmann, V" uniqKey="Brinkmann V">V. Brinkmann</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Boucher, L E" uniqKey="Boucher L">L.E. Boucher</name>
</author>
<author><name sortKey="Bosch, J" uniqKey="Bosch J">J. Bosch</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Combe, A" uniqKey="Combe A">A. Combe</name>
</author>
<author><name sortKey="Moreira, C" uniqKey="Moreira C">C. Moreira</name>
</author>
<author><name sortKey="Ackerman, S" uniqKey="Ackerman S">S. Ackerman</name>
</author>
<author><name sortKey="Thiberge, S" uniqKey="Thiberge S">S. Thiberge</name>
</author>
<author><name sortKey="Templeton, T J" uniqKey="Templeton T">T.J. Templeton</name>
</author>
<author><name sortKey="Menard, R" uniqKey="Menard R">R. Ménard</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="De Koning Ward, T F" uniqKey="De Koning Ward T">T.F. de Koning-Ward</name>
</author>
<author><name sortKey="Olivieri, A" uniqKey="Olivieri A">A. Olivieri</name>
</author>
<author><name sortKey="Bertuccini, L" uniqKey="Bertuccini L">L. Bertuccini</name>
</author>
<author><name sortKey="Hood, A" uniqKey="Hood A">A. Hood</name>
</author>
<author><name sortKey="Silvestrini, F" uniqKey="Silvestrini F">F. Silvestrini</name>
</author>
<author><name sortKey="Charvalias, K" uniqKey="Charvalias K">K. Charvalias</name>
</author>
<author><name sortKey="Berzosa Diaz, P" uniqKey="Berzosa Diaz P">P. Berzosa Díaz</name>
</author>
<author><name sortKey="Camarda, G" uniqKey="Camarda G">G. Camarda</name>
</author>
<author><name sortKey="Mcelwain, T F" uniqKey="Mcelwain T">T.F. McElwain</name>
</author>
<author><name sortKey="Papenfuss, T" uniqKey="Papenfuss T">T. Papenfuss</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Dearnley, M K" uniqKey="Dearnley M">M.K. Dearnley</name>
</author>
<author><name sortKey="Yeoman, J A" uniqKey="Yeoman J">J.A. Yeoman</name>
</author>
<author><name sortKey="Hanssen, E" uniqKey="Hanssen E">E. Hanssen</name>
</author>
<author><name sortKey="Kenny, S" uniqKey="Kenny S">S. Kenny</name>
</author>
<author><name sortKey="Turnbull, L" uniqKey="Turnbull L">L. Turnbull</name>
</author>
<author><name sortKey="Whitchurch, C B" uniqKey="Whitchurch C">C.B. Whitchurch</name>
</author>
<author><name sortKey="Tilley, L" uniqKey="Tilley L">L. Tilley</name>
</author>
<author><name sortKey="Dixon, M W" uniqKey="Dixon M">M.W. Dixon</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Deligianni, E" uniqKey="Deligianni E">E. Deligianni</name>
</author>
<author><name sortKey="Morgan, R N" uniqKey="Morgan R">R.N. Morgan</name>
</author>
<author><name sortKey="Bertuccini, L" uniqKey="Bertuccini L">L. Bertuccini</name>
</author>
<author><name sortKey="Kooij, T W" uniqKey="Kooij T">T.W. Kooij</name>
</author>
<author><name sortKey="Laforge, A" uniqKey="Laforge A">A. Laforge</name>
</author>
<author><name sortKey="Nahar, C" uniqKey="Nahar C">C. Nahar</name>
</author>
<author><name sortKey="Poulakakis, N" uniqKey="Poulakakis N">N. Poulakakis</name>
</author>
<author><name sortKey="Schuler, H" uniqKey="Schuler H">H. Schüler</name>
</author>
<author><name sortKey="Louis, C" uniqKey="Louis C">C. Louis</name>
</author>
<author><name sortKey="Matuschewski, K" uniqKey="Matuschewski K">K. Matuschewski</name>
</author>
<author><name sortKey="Siden Kiamos, I" uniqKey="Siden Kiamos I">I. Siden-Kiamos</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Deligianni, E" uniqKey="Deligianni E">E. Deligianni</name>
</author>
<author><name sortKey="Morgan, R N" uniqKey="Morgan R">R.N. Morgan</name>
</author>
<author><name sortKey="Bertuccini, L" uniqKey="Bertuccini L">L. Bertuccini</name>
</author>
<author><name sortKey="Wirth, C C" uniqKey="Wirth C">C.C. Wirth</name>
</author>
<author><name sortKey="Silmon De Monerri, N C" uniqKey="Silmon De Monerri N">N.C. Silmon de Monerri</name>
</author>
<author><name sortKey="Spanos, L" uniqKey="Spanos L">L. Spanos</name>
</author>
<author><name sortKey="Blackman, M J" uniqKey="Blackman M">M.J. Blackman</name>
</author>
<author><name sortKey="Louis, C" uniqKey="Louis C">C. Louis</name>
</author>
<author><name sortKey="Pradel, G" uniqKey="Pradel G">G. Pradel</name>
</author>
<author><name sortKey="Siden Kiamos, I" uniqKey="Siden Kiamos I">I. Siden-Kiamos</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Dessens, J T" uniqKey="Dessens J">J.T. Dessens</name>
</author>
<author><name sortKey="Beetsma, A L" uniqKey="Beetsma A">A.L. Beetsma</name>
</author>
<author><name sortKey="Dimopoulos, G" uniqKey="Dimopoulos G">G. Dimopoulos</name>
</author>
<author><name sortKey="Wengelnik, K" uniqKey="Wengelnik K">K. Wengelnik</name>
</author>
<author><name sortKey="Crisanti, A" uniqKey="Crisanti A">A. Crisanti</name>
</author>
<author><name sortKey="Kafatos, F C" uniqKey="Kafatos F">F.C. Kafatos</name>
</author>
<author><name sortKey="Sinden, R E" uniqKey="Sinden R">R.E. Sinden</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Diaz, S A" uniqKey="Diaz S">S.A. Diaz</name>
</author>
<author><name sortKey="Martin, S R" uniqKey="Martin S">S.R. Martin</name>
</author>
<author><name sortKey="Grainger, M" uniqKey="Grainger M">M. Grainger</name>
</author>
<author><name sortKey="Howell, S A" uniqKey="Howell S">S.A. Howell</name>
</author>
<author><name sortKey="Green, J L" uniqKey="Green J">J.L. Green</name>
</author>
<author><name sortKey="Holder, A A" uniqKey="Holder A">A.A. Holder</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Dixon, M W" uniqKey="Dixon M">M.W. Dixon</name>
</author>
<author><name sortKey="Dearnley, M K" uniqKey="Dearnley M">M.K. Dearnley</name>
</author>
<author><name sortKey="Hanssen, E" uniqKey="Hanssen E">E. Hanssen</name>
</author>
<author><name sortKey="Gilberger, T" uniqKey="Gilberger T">T. Gilberger</name>
</author>
<author><name sortKey="Tilley, L" uniqKey="Tilley L">L. Tilley</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fidock, D A" uniqKey="Fidock D">D.A. Fidock</name>
</author>
<author><name sortKey="Wellems, T E" uniqKey="Wellems T">T.E. Wellems</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Fivelman, Q L" uniqKey="Fivelman Q">Q.L. Fivelman</name>
</author>
<author><name sortKey="Mcrobert, L" uniqKey="Mcrobert L">L. McRobert</name>
</author>
<author><name sortKey="Sharp, S" uniqKey="Sharp S">S. Sharp</name>
</author>
<author><name sortKey="Taylor, C J" uniqKey="Taylor C">C.J. Taylor</name>
</author>
<author><name sortKey="Saeed, M" uniqKey="Saeed M">M. Saeed</name>
</author>
<author><name sortKey="Swales, C A" uniqKey="Swales C">C.A. Swales</name>
</author>
<author><name sortKey="Sutherland, C J" uniqKey="Sutherland C">C.J. Sutherland</name>
</author>
<author><name sortKey="Baker, D A" uniqKey="Baker D">D.A. Baker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Frischknecht, F" uniqKey="Frischknecht F">F. Frischknecht</name>
</author>
<author><name sortKey="Baldacci, P" uniqKey="Baldacci P">P. Baldacci</name>
</author>
<author><name sortKey="Martin, B" uniqKey="Martin B">B. Martin</name>
</author>
<author><name sortKey="Zimmer, C" uniqKey="Zimmer C">C. Zimmer</name>
</author>
<author><name sortKey="Thiberge, S" uniqKey="Thiberge S">S. Thiberge</name>
</author>
<author><name sortKey="Olivo Marin, J C" uniqKey="Olivo Marin J">J.C. Olivo-Marin</name>
</author>
<author><name sortKey="Shorte, S L" uniqKey="Shorte S">S.L. Shorte</name>
</author>
<author><name sortKey="Menard, R" uniqKey="Menard R">R. Ménard</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ghorbal, M" uniqKey="Ghorbal M">M. Ghorbal</name>
</author>
<author><name sortKey="Gorman, M" uniqKey="Gorman M">M. Gorman</name>
</author>
<author><name sortKey="Macpherson, C R" uniqKey="Macpherson C">C.R. Macpherson</name>
</author>
<author><name sortKey="Martins, R M" uniqKey="Martins R">R.M. Martins</name>
</author>
<author><name sortKey="Scherf, A" uniqKey="Scherf A">A. Scherf</name>
</author>
<author><name sortKey="Lopez Rubio, J J" uniqKey="Lopez Rubio J">J.J. Lopez-Rubio</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Gould, S B" uniqKey="Gould S">S.B. Gould</name>
</author>
<author><name sortKey="Kraft, L G" uniqKey="Kraft L">L.G. Kraft</name>
</author>
<author><name sortKey="Van Dooren, G G" uniqKey="Van Dooren G">G.G. van Dooren</name>
</author>
<author><name sortKey="Goodman, C D" uniqKey="Goodman C">C.D. Goodman</name>
</author>
<author><name sortKey="Ford, K L" uniqKey="Ford K">K.L. Ford</name>
</author>
<author><name sortKey="Cassin, A M" uniqKey="Cassin A">A.M. Cassin</name>
</author>
<author><name sortKey="Bacic, A" uniqKey="Bacic A">A. Bacic</name>
</author>
<author><name sortKey="Mcfadden, G I" uniqKey="Mcfadden G">G.I. McFadden</name>
</author>
<author><name sortKey="Waller, R F" uniqKey="Waller R">R.F. Waller</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Guttery, D S" uniqKey="Guttery D">D.S. Guttery</name>
</author>
<author><name sortKey="Roques, M" uniqKey="Roques M">M. Roques</name>
</author>
<author><name sortKey="Holder, A A" uniqKey="Holder A">A.A. Holder</name>
</author>
<author><name sortKey="Tewari, R" uniqKey="Tewari R">R. Tewari</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hayton, K" uniqKey="Hayton K">K. Hayton</name>
</author>
<author><name sortKey="Templeton, T J" uniqKey="Templeton T">T.J. Templeton</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Heintzelman, M B" uniqKey="Heintzelman M">M.B. Heintzelman</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Heiss, K" uniqKey="Heiss K">K. Heiss</name>
</author>
<author><name sortKey="Nie, H" uniqKey="Nie H">H. Nie</name>
</author>
<author><name sortKey="Kumar, S" uniqKey="Kumar S">S. Kumar</name>
</author>
<author><name sortKey="Daly, T M" uniqKey="Daly T">T.M. Daly</name>
</author>
<author><name sortKey="Bergman, L W" uniqKey="Bergman L">L.W. Bergman</name>
</author>
<author><name sortKey="Matuschewski, K" uniqKey="Matuschewski K">K. Matuschewski</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Hliscs, M" uniqKey="Hliscs M">M. Hliscs</name>
</author>
<author><name sortKey="Millet, C" uniqKey="Millet C">C. Millet</name>
</author>
<author><name sortKey="Dixon, M W" uniqKey="Dixon M">M.W. Dixon</name>
</author>
<author><name sortKey="Siden Kiamos, I" uniqKey="Siden Kiamos I">I. Siden-Kiamos</name>
</author>
<author><name sortKey="Mcmillan, P" uniqKey="Mcmillan P">P. McMillan</name>
</author>
<author><name sortKey="Tilley, L" uniqKey="Tilley L">L. Tilley</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Iwanaga, S" uniqKey="Iwanaga S">S. Iwanaga</name>
</author>
<author><name sortKey="Khan, S M" uniqKey="Khan S">S.M. Khan</name>
</author>
<author><name sortKey="Kaneko, I" uniqKey="Kaneko I">I. Kaneko</name>
</author>
<author><name sortKey="Christodoulou, Z" uniqKey="Christodoulou Z">Z. Christodoulou</name>
</author>
<author><name sortKey="Newbold, C" uniqKey="Newbold C">C. Newbold</name>
</author>
<author><name sortKey="Yuda, M" uniqKey="Yuda M">M. Yuda</name>
</author>
<author><name sortKey="Janse, C J" uniqKey="Janse C">C.J. Janse</name>
</author>
<author><name sortKey="Waters, A P" uniqKey="Waters A">A.P. Waters</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Janse, C J" uniqKey="Janse C">C.J. Janse</name>
</author>
<author><name sortKey="Waters, A P" uniqKey="Waters A">A.P. Waters</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Jewett, T J" uniqKey="Jewett T">T.J. Jewett</name>
</author>
<author><name sortKey="Sibley, L D" uniqKey="Sibley L">L.D. Sibley</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kappe, S" uniqKey="Kappe S">S. Kappe</name>
</author>
<author><name sortKey="Bruderer, T" uniqKey="Bruderer T">T. Bruderer</name>
</author>
<author><name sortKey="Gantt, S" uniqKey="Gantt S">S. Gantt</name>
</author>
<author><name sortKey="Fujioka, H" uniqKey="Fujioka H">H. Fujioka</name>
</author>
<author><name sortKey="Nussenzweig, V" uniqKey="Nussenzweig V">V. Nussenzweig</name>
</author>
<author><name sortKey="Menard, R" uniqKey="Menard R">R. Ménard</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kehrer, J" uniqKey="Kehrer J">J. Kehrer</name>
</author>
<author><name sortKey="Frischknecht, F" uniqKey="Frischknecht F">F. Frischknecht</name>
</author>
<author><name sortKey="Mair, G R" uniqKey="Mair G">G.R. Mair</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="King, C A" uniqKey="King C">C.A. King</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Kuehn, A" uniqKey="Kuehn A">A. Kuehn</name>
</author>
<author><name sortKey="Pradel, G" uniqKey="Pradel G">G. Pradel</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lacroix, C" uniqKey="Lacroix C">C. Lacroix</name>
</author>
<author><name sortKey="Giovannini, D" uniqKey="Giovannini D">D. Giovannini</name>
</author>
<author><name sortKey="Combe, A" uniqKey="Combe A">A. Combe</name>
</author>
<author><name sortKey="Bargieri, D Y" uniqKey="Bargieri D">D.Y. Bargieri</name>
</author>
<author><name sortKey="Sp Th, S" uniqKey="Sp Th S">S. Späth</name>
</author>
<author><name sortKey="Panchal, D" uniqKey="Panchal D">D. Panchal</name>
</author>
<author><name sortKey="Tawk, L" uniqKey="Tawk L">L. Tawk</name>
</author>
<author><name sortKey="Thiberge, S" uniqKey="Thiberge S">S. Thiberge</name>
</author>
<author><name sortKey="Carvalho, T G" uniqKey="Carvalho T">T.G. Carvalho</name>
</author>
<author><name sortKey="Barale, J C" uniqKey="Barale J">J.C. Barale</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lamour, S D" uniqKey="Lamour S">S.D. Lamour</name>
</author>
<author><name sortKey="Straschil, U" uniqKey="Straschil U">U. Straschil</name>
</author>
<author><name sortKey="Saric, J" uniqKey="Saric J">J. Saric</name>
</author>
<author><name sortKey="Delves, M J" uniqKey="Delves M">M.J. Delves</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Lindner, S E" uniqKey="Lindner S">S.E. Lindner</name>
</author>
<author><name sortKey="Miller, J L" uniqKey="Miller J">J.L. Miller</name>
</author>
<author><name sortKey="Kappe, S H" uniqKey="Kappe S">S.H. Kappe</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Matuschewski, K" uniqKey="Matuschewski K">K. Matuschewski</name>
</author>
<author><name sortKey="Nunes, A C" uniqKey="Nunes A">A.C. Nunes</name>
</author>
<author><name sortKey="Nussenzweig, V" uniqKey="Nussenzweig V">V. Nussenzweig</name>
</author>
<author><name sortKey="Menard, R" uniqKey="Menard R">R. Ménard</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Miller, L H" uniqKey="Miller L">L.H. Miller</name>
</author>
<author><name sortKey="Aikawa, M" uniqKey="Aikawa M">M. Aikawa</name>
</author>
<author><name sortKey="Johnson, J G" uniqKey="Johnson J">J.G. Johnson</name>
</author>
<author><name sortKey="Shiroishi, T" uniqKey="Shiroishi T">T. Shiroishi</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Morahan, B J" uniqKey="Morahan B">B.J. Morahan</name>
</author>
<author><name sortKey="Wang, L" uniqKey="Wang L">L. Wang</name>
</author>
<author><name sortKey="Coppel, R L" uniqKey="Coppel R">R.L. Coppel</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Ponzi, M" uniqKey="Ponzi M">M. Ponzi</name>
</author>
<author><name sortKey="Siden Kiamos, I" uniqKey="Siden Kiamos I">I. Sidén-Kiamos</name>
</author>
<author><name sortKey="Bertuccini, L" uniqKey="Bertuccini L">L. Bertuccini</name>
</author>
<author><name sortKey="Curra, C" uniqKey="Curra C">C. Currà</name>
</author>
<author><name sortKey="Kroeze, H" uniqKey="Kroeze H">H. Kroeze</name>
</author>
<author><name sortKey="Camarda, G" uniqKey="Camarda G">G. Camarda</name>
</author>
<author><name sortKey="Pace, T" uniqKey="Pace T">T. Pace</name>
</author>
<author><name sortKey="Franke Fayard, B" uniqKey="Franke Fayard B">B. Franke-Fayard</name>
</author>
<author><name sortKey="Laurentino, E C" uniqKey="Laurentino E">E.C. Laurentino</name>
</author>
<author><name sortKey="Louis, C" uniqKey="Louis C">C. Louis</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rangarajan, R" uniqKey="Rangarajan R">R. Rangarajan</name>
</author>
<author><name sortKey="Bei, A K" uniqKey="Bei A">A.K. Bei</name>
</author>
<author><name sortKey="Jethwaney, D" uniqKey="Jethwaney D">D. Jethwaney</name>
</author>
<author><name sortKey="Maldonado, P" uniqKey="Maldonado P">P. Maldonado</name>
</author>
<author><name sortKey="Dorin, D" uniqKey="Dorin D">D. Dorin</name>
</author>
<author><name sortKey="Sultan, A A" uniqKey="Sultan A">A.A. Sultan</name>
</author>
<author><name sortKey="Doerig, C" uniqKey="Doerig C">C. Doerig</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Riglar, D T" uniqKey="Riglar D">D.T. Riglar</name>
</author>
<author><name sortKey="Whitehead, L" uniqKey="Whitehead L">L. Whitehead</name>
</author>
<author><name sortKey="Cowman, A F" uniqKey="Cowman A">A.F. Cowman</name>
</author>
<author><name sortKey="Rogers, K L" uniqKey="Rogers K">K.L. Rogers</name>
</author>
<author><name sortKey="Baum, J" uniqKey="Baum J">J. Baum</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Rupp, I" uniqKey="Rupp I">I. Rupp</name>
</author>
<author><name sortKey="Sologub, L" uniqKey="Sologub L">L. Sologub</name>
</author>
<author><name sortKey="Williamson, K C" uniqKey="Williamson K">K.C. Williamson</name>
</author>
<author><name sortKey="Scheuermayer, M" uniqKey="Scheuermayer M">M. Scheuermayer</name>
</author>
<author><name sortKey="Reininger, L" uniqKey="Reininger L">L. Reininger</name>
</author>
<author><name sortKey="Doerig, C" uniqKey="Doerig C">C. Doerig</name>
</author>
<author><name sortKey="Eksi, S" uniqKey="Eksi S">S. Eksi</name>
</author>
<author><name sortKey="Kombila, D U" uniqKey="Kombila D">D.U. Kombila</name>
</author>
<author><name sortKey="Frank, M" uniqKey="Frank M">M. Frank</name>
</author>
<author><name sortKey="Pradel, G" uniqKey="Pradel G">G. Pradel</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Silvestrini, F" uniqKey="Silvestrini F">F. Silvestrini</name>
</author>
<author><name sortKey="Bozdech, Z" uniqKey="Bozdech Z">Z. Bozdech</name>
</author>
<author><name sortKey="Lanfrancotti, A" uniqKey="Lanfrancotti A">A. Lanfrancotti</name>
</author>
<author><name sortKey="Di Giulio, E" uniqKey="Di Giulio E">E. Di Giulio</name>
</author>
<author><name sortKey="Bultrini, E" uniqKey="Bultrini E">E. Bultrini</name>
</author>
<author><name sortKey="Picci, L" uniqKey="Picci L">L. Picci</name>
</author>
<author><name sortKey="Derisi, J L" uniqKey="Derisi J">J.L. Derisi</name>
</author>
<author><name sortKey="Pizzi, E" uniqKey="Pizzi E">E. Pizzi</name>
</author>
<author><name sortKey="Alano, P" uniqKey="Alano P">P. Alano</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sinden, R E" uniqKey="Sinden R">R.E. Sinden</name>
</author>
<author><name sortKey="Canning, E U" uniqKey="Canning E">E.U. Canning</name>
</author>
<author><name sortKey="Bray, R S" uniqKey="Bray R">R.S. Bray</name>
</author>
<author><name sortKey="Smalley, M E" uniqKey="Smalley M">M.E. Smalley</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sologub, L" uniqKey="Sologub L">L. Sologub</name>
</author>
<author><name sortKey="Kuehn, A" uniqKey="Kuehn A">A. Kuehn</name>
</author>
<author><name sortKey="Kern, S" uniqKey="Kern S">S. Kern</name>
</author>
<author><name sortKey="Przyborski, J" uniqKey="Przyborski J">J. Przyborski</name>
</author>
<author><name sortKey="Schillig, R" uniqKey="Schillig R">R. Schillig</name>
</author>
<author><name sortKey="Pradel, G" uniqKey="Pradel G">G. Pradel</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Steinbuechel, M" uniqKey="Steinbuechel M">M. Steinbuechel</name>
</author>
<author><name sortKey="Matuschewski, K" uniqKey="Matuschewski K">K. Matuschewski</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Suarez Cortes, P" uniqKey="Suarez Cortes P">P. Suárez-Cortés</name>
</author>
<author><name sortKey="Sharma, V" uniqKey="Sharma V">V. Sharma</name>
</author>
<author><name sortKey="Bertuccini, L" uniqKey="Bertuccini L">L. Bertuccini</name>
</author>
<author><name sortKey="Costa, G" uniqKey="Costa G">G. Costa</name>
</author>
<author><name sortKey="Bannerman, N L" uniqKey="Bannerman N">N.L. Bannerman</name>
</author>
<author><name sortKey="Rosa Sannella, A" uniqKey="Rosa Sannella A">A. Rosa Sannella</name>
</author>
<author><name sortKey="Williamson, K" uniqKey="Williamson K">K. Williamson</name>
</author>
<author><name sortKey="Klemba, M" uniqKey="Klemba M">M. Klemba</name>
</author>
<author><name sortKey="Levashina, E A" uniqKey="Levashina E">E.A. Levashina</name>
</author>
<author><name sortKey="Lasonder, E" uniqKey="Lasonder E">E. Lasonder</name>
</author>
<author><name sortKey="Alano, P" uniqKey="Alano P">P. Alano</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Sultan, A A" uniqKey="Sultan A">A.A. Sultan</name>
</author>
<author><name sortKey="Thathy, V" uniqKey="Thathy V">V. Thathy</name>
</author>
<author><name sortKey="Frevert, U" uniqKey="Frevert U">U. Frevert</name>
</author>
<author><name sortKey="Robson, K J" uniqKey="Robson K">K.J. Robson</name>
</author>
<author><name sortKey="Crisanti, A" uniqKey="Crisanti A">A. Crisanti</name>
</author>
<author><name sortKey="Nussenzweig, V" uniqKey="Nussenzweig V">V. Nussenzweig</name>
</author>
<author><name sortKey="Nussenzweig, R S" uniqKey="Nussenzweig R">R.S. Nussenzweig</name>
</author>
<author><name sortKey="Menard, R" uniqKey="Menard R">R. Ménard</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Talman, A M" uniqKey="Talman A">A.M. Talman</name>
</author>
<author><name sortKey="Lacroix, C" uniqKey="Lacroix C">C. Lacroix</name>
</author>
<author><name sortKey="Marques, S R" uniqKey="Marques S">S.R. Marques</name>
</author>
<author><name sortKey="Blagborough, A M" uniqKey="Blagborough A">A.M. Blagborough</name>
</author>
<author><name sortKey="Carzaniga, R" uniqKey="Carzaniga R">R. Carzaniga</name>
</author>
<author><name sortKey="Menard, R" uniqKey="Menard R">R. Ménard</name>
</author>
<author><name sortKey="Sinden, R E" uniqKey="Sinden R">R.E. Sinden</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tewari, R" uniqKey="Tewari R">R. Tewari</name>
</author>
<author><name sortKey="Dorin, D" uniqKey="Dorin D">D. Dorin</name>
</author>
<author><name sortKey="Moon, R" uniqKey="Moon R">R. Moon</name>
</author>
<author><name sortKey="Doerig, C" uniqKey="Doerig C">C. Doerig</name>
</author>
<author><name sortKey="Billker, O" uniqKey="Billker O">O. Billker</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tiburcio, M" uniqKey="Tiburcio M">M. Tibúrcio</name>
</author>
<author><name sortKey="Sauerwein, R" uniqKey="Sauerwein R">R. Sauerwein</name>
</author>
<author><name sortKey="Lavazec, C" uniqKey="Lavazec C">C. Lavazec</name>
</author>
<author><name sortKey="Alano, P" uniqKey="Alano P">P. Alano</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tilley, L" uniqKey="Tilley L">L. Tilley</name>
</author>
<author><name sortKey="Dixon, M W" uniqKey="Dixon M">M.W. Dixon</name>
</author>
<author><name sortKey="Kirk, K" uniqKey="Kirk K">K. Kirk</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Trager, W" uniqKey="Trager W">W. Trager</name>
</author>
<author><name sortKey="Jensen, J B" uniqKey="Jensen J">J.B. Jensen</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Tsuboi, T" uniqKey="Tsuboi T">T. Tsuboi</name>
</author>
<author><name sortKey="Takeo, S" uniqKey="Takeo S">S. Takeo</name>
</author>
<author><name sortKey="Iriko, H" uniqKey="Iriko H">H. Iriko</name>
</author>
<author><name sortKey="Jin, L" uniqKey="Jin L">L. Jin</name>
</author>
<author><name sortKey="Tsuchimochi, M" uniqKey="Tsuchimochi M">M. Tsuchimochi</name>
</author>
<author><name sortKey="Matsuda, S" uniqKey="Matsuda S">S. Matsuda</name>
</author>
<author><name sortKey="Han, E T" uniqKey="Han E">E.T. Han</name>
</author>
<author><name sortKey="Otsuki, H" uniqKey="Otsuki H">H. Otsuki</name>
</author>
<author><name sortKey="Kaneko, O" uniqKey="Kaneko O">O. Kaneko</name>
</author>
<author><name sortKey="Sattabongkot, J" uniqKey="Sattabongkot J">J. Sattabongkot</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Uchime, O" uniqKey="Uchime O">O. Uchime</name>
</author>
<author><name sortKey="Herrera, R" uniqKey="Herrera R">R. Herrera</name>
</author>
<author><name sortKey="Reiter, K" uniqKey="Reiter K">K. Reiter</name>
</author>
<author><name sortKey="Kotova, S" uniqKey="Kotova S">S. Kotova</name>
</author>
<author><name sortKey="Shimp, R L" uniqKey="Shimp R">R.L. Shimp</name>
</author>
<author><name sortKey="Miura, K" uniqKey="Miura K">K. Miura</name>
</author>
<author><name sortKey="Jones, D" uniqKey="Jones D">D. Jones</name>
</author>
<author><name sortKey="Lebowitz, J" uniqKey="Lebowitz J">J. Lebowitz</name>
</author>
<author><name sortKey="Ambroggio, X" uniqKey="Ambroggio X">X. Ambroggio</name>
</author>
<author><name sortKey="Hurt, D E" uniqKey="Hurt D">D.E. Hurt</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Vanderberg, J P" uniqKey="Vanderberg J">J.P. Vanderberg</name>
</author>
<author><name sortKey="Frevert, U" uniqKey="Frevert U">U. Frevert</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wesseling, J G" uniqKey="Wesseling J">J.G. Wesseling</name>
</author>
<author><name sortKey="Snijders, P J" uniqKey="Snijders P">P.J. Snijders</name>
</author>
<author><name sortKey="Van Someren, P" uniqKey="Van Someren P">P. van Someren</name>
</author>
<author><name sortKey="Jansen, J" uniqKey="Jansen J">J. Jansen</name>
</author>
<author><name sortKey="Smits, M A" uniqKey="Smits M">M.A. Smits</name>
</author>
<author><name sortKey="Schoenmakers, J G" uniqKey="Schoenmakers J">J.G. Schoenmakers</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wirth, C C" uniqKey="Wirth C">C.C. Wirth</name>
</author>
<author><name sortKey="Pradel, G" uniqKey="Pradel G">G. Pradel</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Wirth, C C" uniqKey="Wirth C">C.C. Wirth</name>
</author>
<author><name sortKey="Glushakova, S" uniqKey="Glushakova S">S. Glushakova</name>
</author>
<author><name sortKey="Scheuermayer, M" uniqKey="Scheuermayer M">M. Scheuermayer</name>
</author>
<author><name sortKey="Repnik, U" uniqKey="Repnik U">U. Repnik</name>
</author>
<author><name sortKey="Garg, S" uniqKey="Garg S">S. Garg</name>
</author>
<author><name sortKey="Schaack, D" uniqKey="Schaack D">D. Schaack</name>
</author>
<author><name sortKey="Kachman, M M" uniqKey="Kachman M">M.M. Kachman</name>
</author>
<author><name sortKey="Wei Bach, T" uniqKey="Wei Bach T">T. Weißbach</name>
</author>
<author><name sortKey="Zimmerberg, J" uniqKey="Zimmerberg J">J. Zimmerberg</name>
</author>
<author><name sortKey="Dandekar, T" uniqKey="Dandekar T">T. Dandekar</name>
</author>
</analytic>
</biblStruct>
<biblStruct><analytic><author><name sortKey="Zieler, H" uniqKey="Zieler H">H. Zieler</name>
</author>
<author><name sortKey="Dvorak, J A" uniqKey="Dvorak J">J.A. Dvorak</name>
</author>
</analytic>
</biblStruct>
</listBibl>
</div1>
</back>
</TEI>
<pmc article-type="research-article"><pmc-dir>properties open_access</pmc-dir>
<front><journal-meta><journal-id journal-id-type="nlm-ta">Cell Host Microbe</journal-id>
<journal-id journal-id-type="iso-abbrev">Cell Host Microbe</journal-id>
<journal-title-group><journal-title>Cell Host & Microbe</journal-title>
</journal-title-group>
<issn pub-type="ppub">1931-3128</issn>
<issn pub-type="epub">1934-6069</issn>
<publisher><publisher-name>Cell Press</publisher-name>
</publisher>
</journal-meta>
<article-meta><article-id pub-id-type="pmid">27832590</article-id>
<article-id pub-id-type="pmc">5104695</article-id>
<article-id pub-id-type="publisher-id">S1931-3128(16)30441-3</article-id>
<article-id pub-id-type="doi">10.1016/j.chom.2016.10.015</article-id>
<article-categories><subj-group subj-group-type="heading"><subject>Article</subject>
</subj-group>
</article-categories>
<title-group><article-title><italic>Plasmodium</italic>
Merozoite TRAP Family Protein Is Essential for Vacuole Membrane Disruption and Gamete Egress from Erythrocytes</article-title>
</title-group>
<contrib-group><contrib contrib-type="author"><name><surname>Bargieri</surname>
<given-names>Daniel Y.</given-names>
</name>
<email>danielbargieri@gmail.com</email>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff2" ref-type="aff">2</xref>
<xref rid="fn1" ref-type="fn">12</xref>
<xref rid="fn2" ref-type="fn">13</xref>
<xref rid="cor1" ref-type="corresp">∗</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Thiberge</surname>
<given-names>Sabine</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="fn2" ref-type="fn">13</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Tay</surname>
<given-names>Chwen L.</given-names>
</name>
<xref rid="aff3" ref-type="aff">3</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Carey</surname>
<given-names>Alison F.</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
<xref rid="aff4" ref-type="aff">4</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Rantz</surname>
<given-names>Alice</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Hischen</surname>
<given-names>Florian</given-names>
</name>
<xref rid="aff5" ref-type="aff">5</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Lorthiois</surname>
<given-names>Audrey</given-names>
</name>
<xref rid="aff6" ref-type="aff">6</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Straschil</surname>
<given-names>Ursula</given-names>
</name>
<xref rid="aff3" ref-type="aff">3</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Singh</surname>
<given-names>Pallavi</given-names>
</name>
<xref rid="aff7" ref-type="aff">7</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Singh</surname>
<given-names>Shailja</given-names>
</name>
<xref rid="aff7" ref-type="aff">7</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Triglia</surname>
<given-names>Tony</given-names>
</name>
<xref rid="aff8" ref-type="aff">8</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Tsuboi</surname>
<given-names>Takafumi</given-names>
</name>
<xref rid="aff10" ref-type="aff">10</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Cowman</surname>
<given-names>Alan</given-names>
</name>
<xref rid="aff8" ref-type="aff">8</xref>
<xref rid="aff9" ref-type="aff">9</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Chitnis</surname>
<given-names>Chetan</given-names>
</name>
<xref rid="aff7" ref-type="aff">7</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Alano</surname>
<given-names>Pietro</given-names>
</name>
<xref rid="aff11" ref-type="aff">11</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Baum</surname>
<given-names>Jake</given-names>
</name>
<xref rid="aff3" ref-type="aff">3</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Pradel</surname>
<given-names>Gabriele</given-names>
</name>
<xref rid="aff5" ref-type="aff">5</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Lavazec</surname>
<given-names>Catherine</given-names>
</name>
<xref rid="aff6" ref-type="aff">6</xref>
</contrib>
<contrib contrib-type="author"><name><surname>Ménard</surname>
<given-names>Robert</given-names>
</name>
<xref rid="aff1" ref-type="aff">1</xref>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label>
Malaria Biology and Genetics Unit, Pasteur Institute, Paris 75015, France</aff>
<aff id="aff2"><label>2</label>
Department of Parasitology, University of São Paulo-USP, São Paulo 05508-000, SP, Brazil</aff>
<aff id="aff3"><label>3</label>
Department of Life Sciences, Imperial College London, South Kensington, London SW7 2AZ, UK</aff>
<aff id="aff4"><label>4</label>
Department of Pathology, Massachusetts General Hospital, Boston, MA 02114, USA</aff>
<aff id="aff5"><label>5</label>
Division of Cellular and Applied Infection Biology, Institute of Zoology, RWTH Aachen University, Aachen 52074, Germany</aff>
<aff id="aff6"><label>6</label>
Inserm U1016, CNRS UMR 8104, Université Paris Descartes, Institut Cochin, Paris 75014, France</aff>
<aff id="aff7"><label>7</label>
Malaria Parasite Biology and Vaccines Unit, Pasteur Institute, Paris 75015, France</aff>
<aff id="aff8"><label>8</label>
The Walter and Eliza Hall Institute of Medical Research, Parkville 3052, VIC, Australia</aff>
<aff id="aff9"><label>9</label>
Department of Medical Biology, University of Melbourne, Parkville 3052, VIC, Australia</aff>
<aff id="aff10"><label>10</label>
Division of Malaria Research, Proteo-Science Center, Ehime University, Matsuyama, Ehime 790-8577, Japan</aff>
<aff id="aff11"><label>11</label>
Dipartimento di Malattie Infettive, Parassitarie ed Immunomediate, Istituto Superiore di Sanità, Rome 00161, Italy</aff>
<author-notes><corresp id="cor1"><label>∗</label>
Corresponding author <email>danielbargieri@gmail.com</email>
</corresp>
<fn id="fn1"><label>12</label>
<p id="ntpara0010">Lead Contact</p>
</fn>
<fn id="fn2"><label>13</label>
<p id="ntpara0015">Co-first author</p>
</fn>
</author-notes>
<pub-date pub-type="pmc-release"><day>09</day>
<month>11</month>
<year>2016</year>
</pub-date>
<pmc-comment> PMC Release delay is 0 months and 0 days and was based on .</pmc-comment>
<pub-date pub-type="ppub"><day>09</day>
<month>11</month>
<year>2016</year>
</pub-date>
<volume>20</volume>
<issue>5</issue>
<fpage>618</fpage>
<lpage>630</lpage>
<history><date date-type="received"><day>22</day>
<month>5</month>
<year>2016</year>
</date>
<date date-type="rev-recd"><day>16</day>
<month>9</month>
<year>2016</year>
</date>
<date date-type="accepted"><day>19</day>
<month>10</month>
<year>2016</year>
</date>
</history>
<permissions><copyright-statement>© 2016 The Authors</copyright-statement>
<copyright-year>2016</copyright-year>
<license license-type="CC BY" xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).</license-p>
</license>
</permissions>
<abstract id="abs0010"><title>Summary</title>
<p>Surface-associated TRAP (thrombospondin-related anonymous protein) family proteins are conserved across the phylum of apicomplexan parasites. TRAP proteins are thought to play an integral role in parasite motility and cell invasion by linking the extracellular environment with the parasite submembrane actomyosin motor. Blood stage forms of the malaria parasite <italic>Plasmodium</italic>
express a TRAP family protein called merozoite-TRAP (MTRAP) that has been implicated in erythrocyte invasion. Using MTRAP-deficient mutants of the rodent-infecting <italic>P. berghei</italic>
and human-infecting <italic>P. falciparum</italic>
parasites, we show that MTRAP is dispensable for erythrocyte invasion. Instead, MTRAP is essential for gamete egress from erythrocytes, where it is necessary for the disruption of the gamete-containing parasitophorous vacuole membrane, and thus for parasite transmission to mosquitoes. This indicates that motor-binding TRAP family members function not just in parasite motility and cell invasion but also in membrane disruption and cell egress.</p>
</abstract>
<abstract abstract-type="graphical" id="abs0015"><title>Graphical Abstract</title>
<fig id="undfig1" position="anchor"><graphic xlink:href="fx1"></graphic>
</fig>
</abstract>
<abstract abstract-type="author-highlights" id="abs0020"><title>Highlights</title>
<p><list list-type="simple"><list-item id="u0010"><label>•</label>
<p>Merozoite TRAP protein, MTRAP, is dispensable for <italic>Plasmodium</italic>
asexual blood stages</p>
</list-item>
<list-item id="u0015"><label>•</label>
<p>MTRAP-deficient parasites are blocked from transmission to mosquitoes</p>
</list-item>
<list-item id="u0020"><label>•</label>
<p>MTRAP is expressed in <italic>Plasmodium</italic>
sexual stages and is essential for gamete egress</p>
</list-item>
<list-item id="u0025"><label>•</label>
<p>MTRAP-deficient gametes fail to lyse the parasitophorous vacuole membrane for egress</p>
</list-item>
</list>
</p>
</abstract>
<abstract abstract-type="teaser" id="abs0025"><p>MTRAP, a protein expressed in <italic>Plasmodium</italic>
blood stages, was thought to function during invasion of erythrocytes by the asexual merozoite stage. Bargieri et al. report that MTRAP is dispensable for merozoite invasion but is essential for egress of the gamete sexual stage from erythrocytes and for parasite transmission to mosquitoes.</p>
</abstract>
</article-meta>
<notes><p id="misc0010">Published: November 9, 2016</p>
</notes>
</front>
<floats-group><fig id="fig1"><label>Figure 1</label>
<caption><p>Generation of <italic>Pb</italic>
MTRAP<sup>KO</sup>
Clones</p>
<p>(A) Illustration of the strategy used for replacing the coding sequence of MTRAP by a cassette for expression of the selection marker human dihydrofolate reductase (hDHFR), that confers resistance to pyrimethamine, and a cassette for expression of mCherry (red fluorescence). The primers (arrowheads) and probes (green bars) used for genotyping are shown. The expected fragment sizes after digestion of the loci with MfeI are also shown.</p>
<p>(B) PCR analysis of the <italic>mtrap</italic>
locus in wild-type (WT) or mutant (B4 and B8) parasites. P1/P2 pair of primers is specific to the WT locus, and P1/P3 pair is specific to integration of the targeting sequence.</p>
<p>(C) Southern blot detecting the <italic>mtrap</italic>
locus in wild-type (WT) or mutant (B4 and B8) parasites after digestion of genomic DNA with MfeI. The probe used is illustrated in (A) (green bars).</p>
<p>(D) Growth curves assessed daily in mouse blood after infection with wild-type (black line) or the two clones of <italic>Pb</italic>
MTRAP<sup>KO</sup>
parasites (blue and red lines). Results are shown as mean ± SD and are representative of three independent experiments. N = 5 for each group.</p>
<p>(E) Fluorescence microscopy with anti-<italic>Pb</italic>
MTRAP (green), anti-AMA1 (red), and DAPI (blue) in wild-type <italic>P. berghei</italic>
merozoites. BF, brightfield. Scale bar, 5 μm.</p>
<p>(F) Fluorescence microscopy with anti-<italic>Pb</italic>
MTRAP (green), anti-MDV-1/PEG3 (red) and DAPI (blue) in a wild-type <italic>P. berghei</italic>
sexual stage isolated from infected mouse blood. BF, brightfield. Scale bar, 5 μm. See also <xref rid="mmc1" ref-type="supplementary-material">Figure S1</xref>
.</p>
<p>(G) Fluorescence microscopy with anti-<italic>Pb</italic>
MTRAP (green), anti-MDV-1/PEG3 (red), and DAPI (blue) in nonactivated or 10 min activated wild-type <italic>P. berghei</italic>
sexual stages isolated from infected mouse blood. BF, brightfield. Scale bar, 5 μm.</p>
<p>(H) Fluorescence microscopy with anti-<italic>Pb</italic>
MTRAP (green) and DAPI (blue) in MTRAP knockout (<italic>Pb</italic>
MTRAP<sup>KO</sup>
) and wild-type parasites. BF, brightfield. Scale bar, 5 μm.</p>
<p>(I) Western blot analysis of the gametocyte extract of <italic>Pb</italic>
MTRAP<sup>KO</sup>
(gKO) with a specific antibody recognizing the MTRAP C-terminal region. Total extract (tWT) or gametocyte extract (gWT) of wild-type <italic>P. berghei</italic>
ANKA strain was used as control. Anti-aldolase (ALD) was used as loading control. The anti-MTRAP recognizes two specific bands in tWT and one specific band in gWT parasites. No bands are recognized in the three gKO extract.</p>
</caption>
<graphic xlink:href="gr1"></graphic>
</fig>
<fig id="fig2"><label>Figure 2</label>
<caption><p><italic>Pb</italic>
MTRAP<sup>KO</sup>
Are Blocked in Mosquito Transmission</p>
<p>(A) <italic>P. berghei</italic>
oocysts in the midgut of mosquitoes fed onto mice infected with wild-type or <italic>Pb</italic>
MTRAP<sup>KO</sup>
. Oocysts are visualized by mercurochrome staining of mosquito midguts 7 days after mosquito feeding. Scale bar, 100 μm. Quantification is shown on the left. N = 100 mosquitoes for each group.</p>
<p>(B) Quantification of <italic>P. berghei</italic>
male gametocytes (MG, blue) and female gametocytes (FG, pink) circulating in mouse blood infected with either wild-type (WT) or <italic>Pb</italic>
MTRAP<sup>KO</sup>
parasites.</p>
<p>(C) Quantification of in vitro ookinete formation from gametocytes circulating in mouse blood infected with either wild-type (WT) or <italic>Pb</italic>
MTRAP<sup>KO</sup>
parasites.</p>
<p>(D) Quantification of green, red, and yellow (green + red) <italic>P. berghei</italic>
oocyst numbers by fluorescence microscopy of mosquito midguts 7 days after mosquito feeding onto mice infected with a control mixture of green and red wild-type parasites (GFP<sup>+</sup>
WT and RFP<sup>+</sup>
WT, respectively), or with a mixture of <italic>Pb</italic>
MTRAP<sup>KO</sup>
(red, mCh<sup>+</sup>
<italic>Pb</italic>
MTRAP<sup>KO</sup>
) and wild-type green (GFP<sup>+</sup>
WT) parasites. N = 100 mosquitoes for each group. The gametocytemia of green and red parasites were comparable in infected mice of the different groups used for mosquito feeding (data not shown).</p>
<p>For all panels, data are shown as mean ± SD and are representative of three independent experiments.</p>
</caption>
<graphic xlink:href="gr2"></graphic>
</fig>
<fig id="fig3"><label>Figure 3</label>
<caption><p><italic>Pb</italic>
MTRAP<sup>KO</sup>
Male Gametocytes Do Not Make Exflagellation Centers but Form Motile Axonemes</p>
<p>(A) Quantification of exflagellation centers per 10× field formed by in vitro-activated wild-type <italic>P. berghei</italic>
(WT), <italic>Pb</italic>
MTRAP<sup>KO</sup>
male gametocytes, or <italic>Pb</italic>
MTRAP<sup>KO</sup>
carrying either a control episome (<italic>cont</italic>
Comp) or an episome with the promoter and coding sequence of <italic>mtrap</italic>
cloned upstream the 3′UTR of <italic>trap</italic>
, a centromeric sequence and a cassette for GFP (green) expression (<italic>mtrap</italic>
Comp). The results are shown as mean ± SD and are representative of four independent experiments.</p>
<p>(B) Time-lapse microscopy of an activated <italic>Pb</italic>
MTRAP<sup>KO</sup>
male gametocyte. The time in seconds is shown in each image. The results are representative of five independent experiments.</p>
<p>(C) Quantification of oocysts per midgut of mosquitoes fed onto mice infected with <italic>Pb</italic>
MTRAP<sup>KO</sup>
carrying either the control episome (<italic>cont</italic>
Comp) or the episome with <italic>mtrap</italic>
(<italic>mtrap</italic>
Comp). The results are shown as mean ± SD and are representative of two independent experiments.</p>
<p>(D) Fluorescence microscopy of mosquito midgut 7 days after mosquito feeding onto mice infected with <italic>Pb</italic>
MTRAP<sup>KO</sup>
(red) electroporated with the <italic>mtrap</italic>
Comp episome. The presence of the episome is depicted by green fluorescence, and parasites are red fluorescent. Single color oocysts were never seen. N = 100 mosquitoes. Scale bar, 100 μm.</p>
</caption>
<graphic xlink:href="gr3"></graphic>
</fig>
<fig id="fig4"><label>Figure 4</label>
<caption><p><italic>Pb</italic>
MTRAP<sup>KO</sup>
Gametes Are Trapped inside the PV Membrane</p>
<p>(A) Micrographs of wild-type <italic>P. berghei</italic>
(WT) or <italic>Pb</italic>
MTRAP<sup>KO</sup>
gametocytes isolated from infected mice blood and immediately fixed (nonactivated) or fixed after activation in vitro for 15 min (15 min p.a.) in ookinete medium. Ultrastructures are indicated with arrows. IMC, inner membrane complex; PPM, parasite plasma membrane; PVM, parasitophorous vacuole membrane; EM, erythrocyte membrane; N, nucleus; G, Golgi complex. Results are representative of three independent experiments. N = 6 for WT and 19 for <italic>Pb</italic>
MTRAP<sup>KO</sup>
. Scale bars, 1 μm.</p>
<p>(B) Micrograph of a male <italic>Pb</italic>
MTRAP<sup>KO</sup>
gametocyte activated in vitro for 15 min in ookinete medium. Ultrastructures are shown as in (A), except for Ax, axonemes. Scale bars, 1 μm.</p>
</caption>
<graphic xlink:href="gr4"></graphic>
</fig>
<fig id="fig5"><label>Figure 5</label>
<caption><p>MTRAP Is Dispensable for <italic>P. falciparum</italic>
Asexual Stages</p>
<p>(A) Illustration of the strategy used to target <italic>P. falciparum mtrap</italic>
for disruption. Two plasmids were transfected in the <italic>P. falciparum</italic>
3D7 strain, one plasmid carrying a guide DNA sequence (GAATGGTCAGAATGTAAAGA) and a hDHFR cassette flanked by two homology regions with the 5′and 3′ sequences of the <italic>mtrap</italic>
coding sequence as indicated in the figure, and the second plasmid bearing a cassette for Cas9 expression. Double homologous recombination replaces 935 base pairs of the <italic>mtrap</italic>
coding sequence by the hDHFR cassette, creating a disrupted locus. Primers used for PCR specific detection of the genomic or the disrupted loci are shown. See also <xref rid="mmc1" ref-type="supplementary-material">Figure S2</xref>
.</p>
<p>(B) Western blot analysis of the <italic>Pf</italic>
MTRAP<sup>KO</sup>
clones C3, C8, and C18 with a specific antibody recognizing the MTRAP C-terminal region (α-MTRAP-Tail). Wild-type <italic>P. falciparum</italic>
3D7 strain (WT) was used as control. The α-MTRAP-Tail recognizes three specific bands in WT parasites, FL as the full-length protein, cleavage as a processed fragment, and Tail as the C-terminal region after processing. No bands are recognized in the three <italic>Pf</italic>
MTRAP<sup>KO</sup>
clones. Actin (α-actin) was used as loading controls.</p>
<p>(C) Growth curves assessed every 48 hr by flow cytometry in blood cultures of <italic>P. falciparum</italic>
wild-type (3D7, black line) or the three <italic>Pf</italic>
MTRAP<sup>KO</sup>
clones (colored lines). The experiment was performed in triplicate and the data are presented as mean ± SD.</p>
</caption>
<graphic xlink:href="gr5"></graphic>
</fig>
<fig id="fig6"><label>Figure 6</label>
<caption><p>MTRAP Is Expressed in Sexual Stages of <italic>P. falciparum</italic>
</p>
<p>(A) Fluorescence microscopy with anti-<italic>Pf</italic>
MTRAP (green), anti-Pfg377 (red), and DAPI (blue) in wild-type <italic>P. falciparum</italic>
sexual stages matured in vitro. Stages III, IV, and V gametocytes are shown. BF, brightfield. Scale bar, 5 μm. See also <xref rid="mmc1" ref-type="supplementary-material">Figure S3</xref>
.</p>
<p>(B) Fluorescence microscopy with anti-<italic>Pf</italic>
MTRAP (green), anti-Band3 (red), and DAPI (blue) in wild-type <italic>P. falciparum</italic>
sexual stages matured in vitro. A gametocyte nonactivated (preactivation), a gametocyte activated for 30 s in vitro, and an egressed gamete after 600 s of activation in vitro are shown. BF, brightfield. Scale bar, 5 μm. See also <xref rid="mmc1" ref-type="supplementary-material">Figure S7</xref>
A.</p>
</caption>
<graphic xlink:href="gr6"></graphic>
</fig>
<fig id="fig7"><label>Figure 7</label>
<caption><p>PPLP2 Secretion in <italic>Pf</italic>
MTRAP<sup>KO</sup>
Gametocytes</p>
<p>(A) Fluorescence microscopy with anti-Band3 (green), anti-PPLP2 (red), and DAPI (blue) in wild-type and MTRAP<sup>KO</sup>
NF54 <italic>P. falciparum</italic>
sexual stages matured in vitro nonactivated or 2.5 hr postactivation. BF, brightfield. Scale bar, 5 μm.</p>
<p>(B) Fluorescence microscopy with anti-tubulin (green), anti-PPLP2 (red), and DAPI (blue) in wild-type and MTRAP<sup>KO</sup>
NF54 <italic>P. falciparum</italic>
sexual stages matured in vitro 25 min postactivation. BF, brightfield. Scale bar, 5 μm.</p>
</caption>
<graphic xlink:href="gr7"></graphic>
</fig>
</floats-group>
</pmc>
</record>
Pour manipuler ce document sous Unix (Dilib)
EXPLOR_STEP=$WICRI_ROOT/Wicri/Asie/explor/AustralieFrV1/Data/Pmc/Curation
HfdSelect -h $EXPLOR_STEP/biblio.hfd -nk 002220 | SxmlIndent | more
Ou
HfdSelect -h $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd -nk 002220 | SxmlIndent | more
Pour mettre un lien sur cette page dans le réseau Wicri
{{Explor lien |wiki= Wicri/Asie |area= AustralieFrV1 |flux= Pmc |étape= Curation |type= RBID |clé= PMC:5104695 |texte= Plasmodium Merozoite TRAP Family Protein Is Essential for Vacuole Membrane Disruption and Gamete Egress from Erythrocytes }}
Pour générer des pages wiki
HfdIndexSelect -h $EXPLOR_AREA/Data/Pmc/Curation/RBID.i -Sk "pubmed:27832590" \ | HfdSelect -Kh $EXPLOR_AREA/Data/Pmc/Curation/biblio.hfd \ | NlmPubMed2Wicri -a AustralieFrV1
![]() | This area was generated with Dilib version V0.6.33. | ![]() |